A high-methanol-tolerant yeast chassis strain, a high-yield 3-hydroxypropionic acid engineering bacterium and application thereof

By modifying the Pichia pastoris strain, the problems of insufficient methanol tolerance and low product yield were solved, and the efficient synthesis of 3-hydroxypropionic acid and long-chain fatty acids was achieved, thereby improving the production capacity of chemicals.

CN122465736APending Publication Date: 2026-07-28DALIAN INSTITUTE OF CHEMICAL PHYSICS CHINESE ACADEMY OF SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610840403.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-11
Publication Date
2026-07-28

AI Technical Summary

Technical Problem

Existing Pichia pastoris cells suffer from problems such as insufficient methanol tolerance, low energy efficiency, low product yield, and methanol cytotoxicity during the synthesis of 3-hydroxypropionic acid from methanol, and there is a lack of effective modification methods and theoretical guidance.

Method used

By modifying Pichia pastoris strains, knocking out the MIOX, DMA2, MET17, BUB2, CLB4, UBP12, and AOX1 genes, introducing a 3-hydroxypropionic acid synthesis module, enhancing the supply of precursor acetyl-CoA and reducing coenzyme NADPH, weakening the methanol dissociation pathway, and overexpressing carboxylic acid transporter proteins, the strains were modified using CRISPR-Cas9 gene editing technology.

Benefits of technology

The strain achieved efficient synthesis of 3-hydroxypropionic acid and long-chain fatty acids. It exhibited tolerance to methanol concentrations of over 50 g/L, improving the yield and efficiency of the chemicals. It is suitable for bio-fermentation using methanol as a carbon source.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application belongs to the field of microbial metabolic engineering and synthetic biology technology application, in particular to a high methanol tolerance yeast chassis strain, a high 3-hydroxypropionic acid yield engineering bacterium and application. The high methanol tolerance yeast chassis strain takes wild type Pichia pastoris or fatty acid producing Pichia pastoris as a starting strain, is modified according to at least one of the following conditions (a)-(h), and a high methanol tolerance strain is obtained, wherein (a) MIOX gene knockout; (b) DMA2 gene knockout; (c) MET17 gene knockout; (d) BUB2 gene knockout; (e) CLB4 gene knockout; (f) UBP12 gene knockout; (g) ZFP gene knockout; (h) AOX1 gene mutation. The high methanol tolerance yeast chassis strain is further modified to obtain a high 3-hydroxypropionic acid yield engineering bacterium. The present application combines rational and non-rational metabolic engineering strategies, realizes efficient biosynthesis of fatty acids and 3-hydroxypropionic acid with methanol as the only carbon source, and lays an important foundation for low-carbon green biological manufacturing of chemicals.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial metabolic engineering and synthetic biology technology application, and specifically relates to a yeast chassis strain with high methanol tolerance and an engineered strain with high 3-hydroxypropionic acid production and its application. Background Technology

[0002] With increasing global concern over climate change, energy security, and environmental pollution, chemical production has gradually shifted from reliance on fossil resources to a sustainable development path. Therefore, developing green, low-carbon biomanufacturing technologies using renewable non-food resources as raw materials has become a strategic high ground in global technological and industrial competition. Against this backdrop, "methanol bioconversion" opens up a highly promising new path for the green synthesis of chemicals. Methanol, as a simple single-carbon compound (C1), is abundant and renewable. It can be synthesized from industrial waste gas (such as CO2), biogas, and biomass gasification with hydrogenation catalytic catalysis, achieving the recycling of carbon resources. As a liquid, methanol has well-developed storage and transportation infrastructure, and its cost is far lower than that of gaseous substrates (such as methane and syngas). Furthermore, it is miscible with water in any proportion, exhibits high liquid-liquid mass transfer efficiency, contains no heteroatoms, produces pure metabolites, and has a higher energy density than sugars, making it an ideal substrate for biofermentation (Zhou et al., Nat. Energy (2018, 3, 925-935). However, the bioconversion of methanol also faces core challenges. The natural utilization efficiency of methanol by microorganisms is low and the pathways are complex. Methanol and its oxidation product formaldehyde have significant biotoxicity, which places extremely high demands on the performance of cell factories.

[0003] Pichia pastoris ( Komagataella phaffii Also known as Pichia pastoris Pichia pastoris is a methyltrophic yeast widely used in the biotechnology field. It possesses a natural methanol metabolism pathway and a strictly methanol-induced expression system, making it a widely used "super factory" for the expression of exogenous recombinant proteins. Pichia pastoris can perform high-density fermentation and has good tolerance to changes in pH, temperature, and osmotic pressure in the fermentation environment, making it very suitable for industrial-scale production (Guo et al., Trends Biotechnol ., 2023, 41(8): 1066-1079.). With the gradual improvement of the Pichia pastoris gene editing platform and the continuous development of various enabling tools (Cai et al., 2023, 41(8): 1066-1079.). Nucleic Acids Res ., 2021,49(13):7791-7805), In recent years, there have been increasing reports of using Pichia pastoris as a chassis for the synthesis of chemicals from methanol, such as fatty acids (Cai et al., 2021,49(13):7791-7805). Proc Natl Acad Sci U S A. , 2022, 119(29):e2201711119), terpenoids (Gao et al.,JACS Au , 2024, 4(7), 2474-2483.), lactic acid (Wuet al., Bioresour. Technol. , 2025, 415, 131730. Yamada et al., World J Microbiol Biotechnol. , 2019 Feb 4;35(2):37.), 3-hydroxypropionic acid (Wu et al., ACS Sustainable Chem. Eng. (Wang et al., 2023, 11, 6445-6453.). Among them, 3-hydroxypropionic acid is a precursor to biodegradable plastics and has been designated as one of the twelve platform compounds by the U.S. Department of Energy, possessing broad application scenarios and high value (Wang et al., 2023, 11, 6445-6453.). Molecules , 2023, 28(4): 1888.). Although Pichia pastoris has achieved a yield of 48 g / L of 3-hydroxypropionic acid from methanol, which is the highest reported level for methanol synthesis chemicals to date, it is still lower than the 100 g / L production level of glycosyl fermentation (Zhao et al., 2023, 28(4): 1888.). Appl. Microbiol. Biotechnol. , 2019, 103, 4017-4031; Kang et al., Bioresour. Technol. There is still a significant gap compared to (2025, 432, 132656). Currently, the main challenges facing Pichia pastoris cell methanol factories include energy efficiency, product yield, pathway optimization, and methanol cytotoxicity. Furthermore, rational modification is gradually reaching a bottleneck, lacking effective modification methods and theoretical guidance. Further in-depth exploration of the methanol metabolism patterns and regulatory mechanisms in Pichia pastoris is urgently needed. Summary of the Invention

[0004] The main objective of this invention is to provide a yeast chassis strain with high methanol tolerance and an engineered strain that produces high levels of 3-hydroxypropionic acid, and its applications.

[0005] The present invention also provides a Pichia pastoris engineered strain that efficiently synthesizes 3-hydroxypropionic acid using methanol from the methanol-tolerant strain.

[0006] Another object of the present invention is to provide a method for constructing the aforementioned engineered strain.

[0007] Another objective of this invention is to provide the application of the described Pichia pastoris engineered strain in the low-carbon, green manufacturing of 3-hydroxypropionic acid.

[0008] A highly methanol-tolerant yeast chassis strain was obtained by using wild-type Pichia pastoris or fatty acid-producing Pichia pastoris as the starting strain and modifying it according to at least one of the conditions described in (a)-(h) below, wherein... (a) MIOX Gene knockout; (b) DMA2 Gene knockout; (c) MET17 Gene knockout; (d) BUB2 Gene knockout; (e) CLB4 Gene knockout; (f) UBP12 Gene knockout; (g) ZFP Gene knockout; (h) AOX1 Gene mutation.

[0009] The conditions for modification AOX1 Gene mutation AOX1 F419L / A207S / G625A .

[0010] The starting strains were wild-type Pichia pastoris GS115 and fatty acid-producing strain PC103. Proc. Natl. Acad. Sci. USA , 2022, 119(29), e2201711119; Authorized Patent: ZL202010516436.1) respectively to replenish auxotrophic genes HIS4 The result.

[0011] A high-3-hydroxypropionic acid-producing engineered bacterium, using a yeast chassis strain with high methanol tolerance as the starting strain, is further modified in at least one of the following ways: (a) Introducing a 3-hydroxypropionic acid synthesis module; (b) Enhance the supply of precursor acetyl-CoA and / or reduced coenzyme NADPH; (c) Weakening the methanol dissociation pathway; (d) Overexpression of carboxylic acid transporter protein.

[0012] The 3-hydroxypropionic acid synthesis module is an overexpression of the malonyl-CoA reductase gene. MCR Among them, the MCR gene originates from *Flexobacter orangeii* (…). Chloroflexus aurantiacus Its nucleotide sequence is shown in SEQ ID NO: 1.

[0013] The MCR The copy number of the gene is 1-3.

[0014] The supply of the enhanced precursor acetyl-CoA and / or reduced coenzyme NADPH includes at least one of the following strategies: (1) Overexpression of endogenous ATP-NADH kinase UTR1 Gene (2) Overexpression of the combination of the gene encoding phosphoketolase and the gene encoding phosphotransacetase; (3) Overexpression of the citrate lyase-encoding gene; (4) Overexpression of dihydroxyacetone phosphate synthase gene DAS2 .

[0015] The phosphatosterolase encoding gene is selected from BbXFPK or LmXFPK The gene encoding the phosphoryltransferase is CkPTA (Overexpressing the phosphatidylcholinesterase encoding gene BbXFPK or LmXFPK, and then combining them with the phosphatidyltransferase encoding gene CkPTA for expression, using P...) HTX1 (promoter-driven expression); where, BbXFPK Derived from Bifidobacterium breve ( Bifidobacterium breve Its nucleotide sequence is shown in SEQ ID NO: 2; LmXFPK Derived from Leuconostoc mesenteroides ( Leuconostoc mesenteroides Its nucleotide sequence is shown in SEQ ID NO: 3; CkPTA Derived from Clostridium kuristegia ( Clostridium kluyveri Its nucleotide sequence is shown in SEQ ID NO:4.

[0016] The citrate lyase encoding gene is: MmACL It comes from house mice ( Mus musculus Its nucleotide sequence is shown in SEQ ID NO: 5.

[0017] The weakened methanol dissociation pathway includes the use of formaldehyde dehydrogenase genes. FLD1 The promoter was replaced with a promoter with weaker expression intensity; the promoter with weaker expression intensity was selected from P TEF1 P PEX5 or P PMP20 At least one of them.

[0018] The carboxylic acid transporter was selected from the endogenous acetic acid transporter of Pichia pastoris. ADY2-1 , ADY2-2 , ADY2-3 , ADY2-4 Monocarboxylic acid transporter JEN1 and from Aspergillus ( Aspergillus pseudoterreus At least one of the monocarboxylic acid transporters Apg2945.

[0019] The nucleotide sequence of Apg2945 is shown in SEQ ID NO: 6.

[0020] The gene manipulation was achieved using CRISPR-Cas9 gene editing technology.

[0021] The application of the aforementioned high-yield 3-hydroxypropionic acid engineered bacteria in the preparation of 3-hydroxypropionic acid or fatty acids.

[0022] The engineered bacteria are used in the fermentation of methanol as the sole carbon source to prepare 3-hydroxypropionic acid or fatty acids.

[0023] A method for preparing 3-hydroxypropionic acid or fatty acids involves fermenting engineered bacteria using methanol as the sole carbon source to prepare 3-hydroxypropionic acid or fatty acids.

[0024] The strain was inoculated into Delft medium containing methanol and fermented at 30°C. The methanol concentration was controlled to be less than 10 g / L in the bioreactor by continuous feeding, which efficiently biosynthesized 3-hydroxypropionic acid or fatty acids.

[0025] The fatty acids are mainly C16 and C18 fatty acids, including at least one of C16:0, C16:1, C18:0, C18:1 and C18:2.

[0026] The beneficial effects that this application can produce include: This invention significantly enhances the methanol tolerance of chassis cells through an irrational adaptive evolutionary strategy. Furthermore, by utilizing multi-omics joint analysis techniques to obtain strains validated through reverse metabolic engineering, key targets for improving cellular methanol tolerance were effectively identified. Through further modification of the methanol oxidation module to precisely regulate methanol metabolic flux, and by combining multiple strategies such as assembling a 3-HP synthesis module and regulating transport proteins, the efficient synthesis of 3-hydroxypropionic acid using methanol as the sole carbon source was successfully achieved. Further: 1. The method for constructing Pichia pastoris chassis cells for synthesizing long-chain fatty acids provided in this application improves methanol tolerance through adaptive evolution, and further analysis reveals key mutation sites, which are then used to modify the starting strain to improve the ability to synthesize long-chain fatty acids. 2. The method for constructing Pichia pastoris chassis cells for synthesizing 3-hydroxypropionic acid provided in this application enhances the ability of Pichia pastoris to synthesize 3-hydroxypropionic acid by optimizing the methanol metabolism module, strengthening the supply of acetyl-CoA and reducing coenzymes, and matching and adapting the transport protein for pumping 3-hydroxypropionic acid out of the cell. The obtained strain has a tolerance to methanol of more than 50 g / L and can be used for bio-fermentation in inorganic salt culture media with methanol as the carbon source, thereby improving the yield and efficiency of the chemical. 3. The method for constructing engineered bacteria capable of efficiently synthesizing long-chain fatty acids and 3-hydroxypropionic acid provided in this application. Attached Figure Description

[0027] Figure 1 shows a schematic diagram of adaptive evolution and the growth of the domesticated strains in methanol culture media of different concentrations; where A is a schematic diagram of adaptive evolution, B is the growth curve of the starting strain and the domesticated strain under different methanol concentration conditions, and C is the formaldehyde accumulation of different strains.

[0028] Figure 2 illustrates the reverse metabolic engineering validation of the mutant targets; where A represents the effect of knocking out different targets in GS115 strain on growth in high-concentration methanol Delft medium, B represents the effect of knocking out different targets in PC103 strain on growth in high-concentration methanol Delft medium, C represents the lag phase and specific growth rate of the strain after target combination knockout, D represents the effect of target combination knockout combined with Aox1 mutant on growth in high-concentration methanol Delft medium in GS115 strain, and E represents the effect of target combination knockout combined with Aox1 mutant on growth in high-concentration methanol Delft medium in PC103 strain.

[0029] Figure 3 shows the production of long-chain fatty acids synthesized by methanol fermentation of the domesticated strain X80; where A represents fatty acid synthesis under different methanol concentrations, B represents fatty acid synthesis by batch-fed fermentation in a bioreactor, C represents solid fatty acid precipitation, and D represents the proportion of fatty acid products synthesized from methanol.

[0030] Figure 4 shows the construction of the 3-HP synthesis module; where A represents the effect of different MCR copy numbers on 3-HP synthesis, and B represents the effect of the third copy of the MCR on 3-HP synthesis.

[0031] Figure 5 illustrates the central metabolic modification that enhances 3-HP synthesis.

[0032] Figure 6 shows the enhancement of 3-HP synthesis by transporter modification; where A is a schematic diagram of transporter modification, B is the effect of different carboxylic acid transporters on 3-HP yield in Delft medium containing 10 g / L methanol, and C is the effect of Apg2945 on 3-HP and cell growth in Delft medium containing 20 g / L methanol.

[0033] Figure 7 The synthesis of 3-HP by feed-in methanol fermentation using recombinant strains is shown. Detailed Implementation

[0034] To make the technical problems solved, the technical solutions, and the beneficial effects of this invention clearer, the invention will be described in detail below. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the materials and reagents used can be purchased commercially.

[0035] The following examples involve Pichia pastoris ( Komagataella phaffiiAll strains were either preserved in our laboratory or obtained through adaptive evolution. All molecular biology procedures used, including gene cloning, plasmid construction, electroporation, and genome integration, followed standard methods in the field. Specific procedures can be performed according to the instructions in *Molecular Cloning: A Laboratory Manual* (4th Edition) or the corresponding kit instructions.

[0036] The strain used in this application is based on the recombinant Pichia pastoris PC103 (genotype) that was previously independently modified in the laboratory. Mut + , his4 - , AOX1, AOX2,HIS4::PGAP-PpRAD52-TAOX1 , PNSI-2::PGAP-hCas9-TDAS, faa1 Δ, faa2Δ ), and with the help of CRISPR-Cas9 technology (the strain construction method follows Cai et al., Nucleic Acids Res (As recorded in 2021;49(13):7791-7805) to carry out genetic modification of engineered strains.

[0037] The culture medium used in this application is Delft-methanol medium (inorganic salt medium), with the following formula (per liter): ammonium sulfate 2.5 g, potassium dihydrogen phosphate 14.4 g, magnesium sulfate heptahydrate 0.5 g, trace element solution 2.0 mL, vitamin solution 1.0 mL (see Table 1 for specific formulas). Methanol is added as needed as the sole carbon source. The formulas for the trace element solution and vitamin solution are based on the Pichia pastoris expression manual. During fermentation, 25% ammonia water or 4M potassium hydroxide is used to adjust the pH.

[0038] Table 1. Trace elements and microbial composition used in this application

[0039] In this invention, the concentration of methanol and the concentration of 3-hydroxypropionic acid (3-HP) were determined by high-performance liquid chromatography (HPLC), and the chromatographic conditions were as follows: Bio-Rad Aminex HPX-87H column (300 × 7.8 mm, 9 μm). The mobile phase is 0.5 mM dilute sulfuric acid. Flow rate 0.5 mL / min, column temperature 50℃, The detector is a differential and ultraviolet coupled detector, with an ultraviolet detection wavelength of 210 nm.

[0040] The concentration of free fatty acids was determined by gas chromatography-mass spectrometry (GC-MS).

[0041] Example 1: Construction of a Pichia pastoris chassis with high methanol tolerance 1.1 Starting strain The wild-type Pichia pastoris strain GS115 (patent number ZL 2024 11775334.6) preserved in the early stage of the experiment and the fatty acid production strain PC103 constructed in our laboratory in the early stage (see details) were selected. Proc. Natl. Acad. Sci. USA , 2022, 119(29), e2201711119, authorized patent number: ZL202010516436.1) as the starting strain for adaptive evolution.

[0042] 1.2 Adaptive Evolution The shake-flask gradient subculturing method was used for acclimatization. The basal medium was Delft-methanol medium with an initial methanol concentration of 10 g / L. Single colonies of strains GS115 and PC103 were picked from YPD plates and inoculated into 3 ml of YPD liquid medium, and cultured overnight. The next day, the cultured strains were inoculated into Delft medium containing 10 g / L methanol and initially cultured at 30°C and 220 rpm until the logarithmic growth phase (OD50). 600 Value approximately 4-5). Then, aspirate the culture medium at the initial inoculum volume OD... 600 Once the value is 0.3, transfer to fresh culture medium to complete one subculture. Wait for the strain to grow faster, setting a target of reaching OD500 within 48 hours. 600 When the methanol concentration reaches approximately 4 or higher, subculture is initiated. During cultivation, the methanol concentration is gradually increased in increments of 10 g / L, with approximately 20 subcultures per concentration gradient. After continuous subculturing and acclimatization, strains capable of stable growth in Delft medium with a methanol concentration of 50 g / L are finally selected. Figure 1 A). At this point, the culture system could be a mixed system (mixed genotypes). Therefore, the cultured strains were streaked on YPD plates, and a certain number of single clones (single genotype) were selected for growth performance verification on Delft medium with methanol as the carbon source. Finally, single clones capable of tolerating 50 g / L methanol were successfully selected. The strain domesticated from the wild-type Pichia pastoris strain GS115 was named E50, and the strain domesticated from the wild-type Pichia pastoris strain GS115 was named X80.

[0043] Different starting strains and different domesticated strains were cultured in Delft medium containing different concentrations of methanol (10-60 g / L). The results showed that the uncultured strains were severely inhibited by methanol, especially the PC103 strain, which could not grow at methanol concentrations greater than 30 g / L. The domesticated strains, however, grew well at methanol concentrations of 10-60 g / L. Although slight inhibition gradually appeared with increasing methanol concentration, the wild-type domesticated strain E50 could even survive in medium containing 60 g / L methanol, with a maximum OD... 600 The value can reach around 12 ( Figure 1 B). On the other hand, the detection results for the toxic intermediate formaldehyde showed that the domesticated strains could significantly reduce intracellular formaldehyde accumulation by optimizing the endogenous metabolic network, thereby restoring the growth viability of the strains in methanol medium. Figure 1 C).

[0044] 1.3 Genome sequencing and key mutation site mining To elucidate the intrinsic molecular mechanisms of methanol metabolism and enhanced tolerance phenotype in domesticated strains, whole-genome resequencing was performed on domesticated strains E50 and X80, with the originating strain GS115 as a control, to screen for mutation sites associated with methanol tolerance. Sequencing results showed that the domesticated strains, compared to the originating strain, possessed eight non-synonymous mutations located in the coding regions, involving functional modules such as transcriptional regulators, ubiquitination regulation, DNA replication, and methanol metabolism. Through functional annotation and metabolic network analysis, mutant genes that may play a key role in methanol tolerance were screened; detailed information is shown in Table 2.

[0045] Table 2 Key mutation sites in domesticated strains

[0046] 1.4 Validation of Reverse Metabolic Engineering Using GS115 and PC103 as starter strains, respectively, we employed a previously constructed high-efficiency CRISPR / Cas9 gene editing system for target knockout modification to verify the role of related gene functions in enhancing methanol tolerance. The specific procedures are as follows: (1) Replenishing auxotrophic genes through homologous recombination HIS4 (The nucleotide sequences are shown in SEQ ID NO: 7), and recombinant strains G4RCH and PC103RCH were obtained; (2) Design gRNAs using CHOPCHOP to knock out the genes in Table 2 individually or in combination. See Table 3 for details of the gRNA sequences (underlined) and primers used for vector construction. Table 3. Primers for gRNA expression vector amplification involved in gene knockout in the examples

[0047] The recombinant strains constructed by knocking out the corresponding genes as described above were cultured in Delft medium containing 50 g / L methanol as the sole carbon source in shake flasks at 30°C and 220 rpm to verify the growth performance and metabolic activity of each recombinant strain under methanol stress. Wild-type strains GS115 and PC103, or adaptively evolved strains E50 and X80, were used as controls.

[0048] The results showed that neither individual gene modification could effectively restore the growth of the original strain in high-concentration methanol medium. Figure 2 (A and B).

[0049] Then, following the method described above, the strain was simultaneously knocked out. UBP12, DMA2 and ZFP, The recombinant strains (A22, D372) were cultured according to the above-mentioned culture method. The growth lag phase of the strains was shortened from 82 hours to 26.8 hours. The PC103 strain, which was originally unable to grow, had its lag phase shortened to 29.4 hours after modification. At the same time, the growth rate of the reverse metabolism modified strains was also slightly improved. Figure 2 C).

[0050] (3) Introduce the Aox1 mutant into the A22 and D372 strains obtained above to construct the Aox1 mutant. Use three pairs of mutation primers to achieve amino acid mutations at F419, A207, and G625A sites in the Aox1 protein sequence. The specific mutation primer sequences are as follows: 207M-F: CTCTGCTCATTCATTTGTCCACTCTAC 207M-R:GTAGAGTGGACAAATGAATGAGCAGAG 419M-F:TATGTTCCACcTCTTGGAATACCCA 419M-R:GGGTATTCCAAGAgGTGGAACATAGT 625M-F: GATCGCTGAAAAGACTGCCAC 625M-R: GCAGTCTTTTCAGCGATCAAAAGAGC Then, the strains (A26 and D372A) obtained by introducing the Aox1 mutant were cultured according to the above culture method to verify the growth performance and metabolic activity of each recombinant strain under methanol stress.

[0051] Further combining Aox1 F419L / A207S / G625AAfter three-site mutation, rationally modified strains A26 (derived from G4RCH) and D372A (derived from PC103RCH) were constructed. The OD of the strains in 50 g / L methanol was... 600 They reached 20.7 respectively. Figure 2 D) and 20.9 ( Figure 2 E), where the growth of strain D372A even surpassed that of the domesticated strain X80, indicating that the mutation site is the key genetic basis for conferring high methanol tolerance to Pichia pastoris.

[0052] Example 2: Verification of the efficient synthesis of fatty acids using reverse metabolism engineered strains 2.1 Detection of D372A strain by shake-flask fermentation The D372A strain was cultured in methanol medium with different concentrations (10-50 g / L). The accumulation of fatty acids at the fermentation endpoint was detected by gas chromatography. The results showed that within the methanol concentration range of 10-40 g / L, fatty acid production gradually increased with increasing methanol concentration, reaching its maximum at 40 g / L methanol medium, at 1.2 g / L. Figure 3 A). However, when the methanol concentration was further increased to 50 g / L, fatty acid synthesis was inhibited, with a yield of only 808 mg / L. This indicates that although the domesticated strain can tolerate higher concentrations of methanol, it is still strongly inhibited by high concentrations, leading to increased methanol metabolism and detoxification stress, resulting in reduced fatty acid production.

[0053] 2.2 Fermented Methanol Fermentation in a Bioreactor The potential for fatty acid production was further validated using a 3 L bioreactor with fed-batch fermentation. The fermentation medium was methanol-Dleft medium with an initial methanol concentration of 10 g / L. The fermentation temperature was controlled at 30℃, pH 5.6 (automatically adjusted by adding 15% ammonia), and dissolved oxygen was maintained above 10% by adjusting the stirring speed (400-600 rpm) and aeration rate (0.5-2 vvm). A fed-batch methanol strategy was employed, with periodic sampling and HPLC analysis of the remaining methanol in the fermentation broth. The methanol concentration in the fermenter was maintained below 10 g / L by adjusting the peristaltic pump speed to reduce methanol volatilization and its inhibitory effect on methanol metabolism.

[0054] 2.3 Fermentation Results During fermentation, the strain maintained a strong growth trend, and after 240 hours of cultivation, the biomass OD... 600 The value reached approximately 180, and the fatty acid yield from the liquid sample reached 16 g / L. Figure 3 B). Because fatty acids easily precipitate in aqueous solutions and adsorb onto the fermenter walls, agitator, etc. ( Figure 3Therefore, a scraper was used to carefully scrape all the fatty acid solids into the fermentation medium, and the final fatty acid content was determined by whole-tank extraction with n-hexane. The total fatty acid yield in the tank reached 28.1 g / L, the production intensity reached 0.12 g / L / h, and the methanol conversion rate (yield) was 0.10 g / g methanol. Only a small amount of formaldehyde accumulated during the entire fermentation process, indicating that the strain has a strong methanol assimilation and metabolism capacity. The fatty acids synthesized by Pichia pastoris using methanol as a carbon source are mainly C16 (C16:0, C16:1) and C18 (C18:0, C18:1, C18:2) (…). Figure 3 D). Compared with the undomesticated starting strain PC103, the reverse metabolism engineered strain D372A showed a significantly enhanced acetyl-CoA flux, indicating that the domesticated chassis has excellent methanol metabolism and precursor supply capabilities.

[0055] Example 3 Construction of a high-yield 3-HP engineered strain Using the reverse metabolism engineered strain D372A and the domesticated strain X80RCH obtained in Example 1, as well as the wild-type strain G4RCH, as the starting chassis, the 3-HP synthesis module, the precursor enhancement module, the dissimilar pathway weakening module, and the product efflux module were gradually integrated to construct an engineered strain that synthesizes 3-HP efficiently.

[0056] 3.1 Introduction of the 3-HP synthesis module (metabolic conversion) The source of Flexibrio orange-green ( Chloroflexus aurantiacus The malonyl-CoA reductase gene MCR in Pichia pastoris underwent codon preference optimization, and the optimized nucleotide sequence is shown in SEQ ID NO: 1. This was performed using the Pichia pastoris strong promoter P... AOX1 P DAS2 or P GCW14 Driven by at least one of the following (the promoter used in this embodiment is P) AOX1 and P DAS2 ), integrated into the genomes of the different chassis strains used above (integration sites are PNSI-2 Then replenish the endogenous Pichia pastoris. FAA1 and FAA2 Genes, synchronously in FAA1t and FAA2t Site integration of multiple copies MCR Gene (in this example, a second or third copy can be obtained). Then, strains with different copies were verified by shake-flask fermentation at 30°C and 220 rpm using Delft medium containing 10 g / L methanol. The results showed that the wild-type source had a single copy. MCRThe gene-expressing strain XY45 achieved a 3-HP yield of 1.3 g / L, and when the MCR copy number increased to 2 copies, the 3-HP yield reached 1.5 g / L. Double-copy experiments were performed on strains derived from D372A and X80. MCR At that time, the yields of 3-HP reached 2.2 g / L and 2.0 g / L, respectively. Figure 4 A) shows that the domesticated strains all have a stronger chemical production potential than the wild-type strains.

[0057] Furthermore, the core catalytic function was overexpressed in double-copy strains (DXY09 and XXY08) derived from D372A and X80RCH, respectively. MCRC, Then, shake-flask incubation was performed at 30℃ and 220 rpm. When the surface... MCRC At that time, the yield of 3-HP decreased significantly, indicating that there may be some accumulation of toxic intermediates. The aforementioned integration of the third copy... MCR The 3-HP yields of strains DXY09NC and XXY08NC obtained during gene processing were both increased to 2.5 g / L. Figure 4 B).

[0058] 3.2 Central metabolic modification and weakening of catabolism pathway The above steps yielded strain DXY05 (this strain originated from strain D372A and was subsequently added back). FAA1 and FFA2 Genes that integrate two copies simultaneously MCR The (gene) strain was enhanced with precursor acetyl-CoA and reduced coenzyme supply, with strain XXY04 serving as a control. At least one of the following strategies was used to enhance precursor supply: (1) The strains obtained above were subjected to endogenous ATP-NADH kinase assay. UTR1 Gene overexpression was used to obtain strain DXY06; (2) The strains obtained above were overexpressed with the endogenous dihydroxyacetone phosphate synthase gene of Pichia pastoris. DAS2, Obtain DXY07; (3) The methanol dissimilatory pathway of each strain obtained above was weakened. Through promoter engineering, the formaldehyde dehydrogenase gene in each strain was... FLD1 The original promoter was replaced with a promoter P, which has a weaker expression intensity. TEF1 P PEX5 or P PMP20 One of them, moderately weakened FLD1 Expression, reducing the loss of methanol carbon source through dissimilatory pathways, Obtain DXY08.

[0059] (3) In chromosomes PNSIII-5 Site overexpression of phosphatidylcholine enzyme encoding geneBbXFPK (Derived from Bifidobacterium breve) Bifidobacterium breve (its nucleotide sequence is shown in SEQ ID NO: 2) or LmXFPK (Derived from Leuconostoc mesenteriae) Leuconostoc mesenteroides Its nucleotide sequence is shown in SEQ ID NO: 3), and it is related to the gene encoding phosphotransacetase. CkPTA (From Clostridium kraniliforme) Clostridium kluyveri (its nucleotide sequence is shown in SEQ ID NO: 4) was combined for expression, using P HTX1 Promoter-driven, strains DXY10 and DXY11 were obtained respectively; (4) The above-obtained treated strains were treated with the methanol-inducible strong promoter P. AOX1 or P GCW14 Expressing the gene encoding citrate lyase MmACL (Source: Little House Mouse) Mus musculus (The nucleotide sequences of which are shown in SEQ ID NO: 5) were used to obtain strains DXY12 and DXY13, respectively.

[0060] The strains obtained in the above steps were then cultured in shake flasks at 30℃ and 220 rpm. HPLC analysis of 3-HP accumulation showed that the introduction of the artificial XFPK-PTA pathway and overexpression of the transhydrogenase gene were effective. UTR1 Only a very small increase was achieved in 3-HP production during overexpression in strain XXY04. MmACL There was no beneficial effect on 3-HP accumulation; in fact, it led to a decrease in yield in the DXY05 strain. Similarly, overexpression of DAS, a key gene in the first step of formaldehyde assimilation, also resulted in a small accumulation of 3-HP in both chassis. The failure of the related central metabolic enhancement strategy for acetyl-CoA may be because the current chassis were acquired through adaptive evolution. During long-term continuous subculturing, the chassis cells have gradually adapted to the methanol metabolism pattern. Through adaptive regulation of the metabolic network, the methanol metabolism rate and the acetyl-CoA pathway may have reached a relatively stable mode. Further application of conventional central metabolic modification strategies may disrupt this balance, thereby affecting strain growth and the ability to synthesize acetyl-CoA derivatives. Considering the severe carbon loss caused by the dissimilar pathway, the strategy of weakening the methanol dissimilar pathway was still retained in the subsequent modification process. Figure 5 ).

[0061] 3.3 Overexpression of transport proteins enhances product efflux. Because 3-HP is acidic, excessive intracellular accumulation may affect cell metabolism and hinder further 3-HP production. To enhance the transport of 3-HP from intracellular to extracellular space, a carboxyltransfer protein, selected from the endogenous acetic acid transporter of Pichia pastoris, was overexpressed.ADY2-1 , ADY2-2 , ADY2-3 , ADY2-4 Monocarboxylic acid transporter JEN1 and from Aspergillus ( Aspergillus pseudoterreus At least one of the monocarboxylic acid transporter Apg2945 (whose nucleotide sequence is shown in SEQ ID NO: 6) was integrated into the chromosomes of the DXY09NC and XXY08NC strains obtained above. PNSIV- 9 The locus was used to obtain strains DXY14-19 and XXY12-17, which were then cultured in shake flasks at 30°C and 220 rpm. Figure 6 A).

[0062] The results of shake-flask fermentation validation showed that, regardless of whether the engineered strains were derived from the reverse metabolism engineered strain D372A or the domesticated strain X80RCH, overexpression of the Apg2945 transporter protein effectively increased the yield of 3-HP, with the yield of 3-HP in the fermentation broth increasing by 11% and 18% respectively compared to the control strain. Figure 6 (B) This study confirmed that 3-HP transport engineering effectively reduces the accumulation of intracellular chemicals, decreases metabolic stress on cells, and thus improves cell viability and 3-HP production capacity. To further verify the effect of the transport protein, fermentation tests were conducted using a higher concentration of methanol (20 g / L). The results showed that the 3-HP production of engineered strains DXY19 (derived from D372A) and XXY17 (derived from X80RCH) reached 5.1 g / L and 5.2 g / L, respectively. Furthermore, after expressing the transport protein, the remaining amount of methanol in the culture medium decreased; strains DXY19 and XXY17 essentially consumed all the methanol, thereby improving methanol utilization. This indicates that the transport protein alleviates cellular metabolic stress and prolongs cell lifespan. This may be because both domestication and reverse metabolic engineering enhance the robustness of cells and increase biomass, while also ensuring a more abundant supply of FFA and 3-HP precursor malonyl-CoA and cofactor NADPH, making them more suitable for the production of chemicals such as 3-HP. This further demonstrates that the previously identified targets play an important role in enhancing cell factory production and robustness.

[0063] Example 4: High-density fermentation verification of engineered strains 4.1 Fermentation conditions A 3 L bioreactor was used to verify the fed-batch fermentation of the final engineered strain DXY19 constructed in Example 3.

[0064] The fermentation medium was methanol-inorganic salt medium, with an initial fermentation volume of 1 L and an initial methanol concentration of 10 g / L. The fermentation temperature was controlled at 30℃, pH at 5.6 (adjusted automatically by adding 15% ammonia), and dissolved oxygen was maintained above 10% by adjusting the stirring speed and aeration rate.

[0065] A methanol feed-through strategy was adopted, in which the methanol concentration in the fermenter was maintained below 10 g / L by taking samples at regular intervals and combining them with HPLC detection, and 5 × Delft medium and pure methanol were used for feeding.

[0066] 4.2 Fermentation Results After 240 hours of fermentation, the bacterial biomass (OD) 600 The methanol yield reached 107 g / L, the final yield of 3-HP reached 127 g / L, the conversion rate (yield) was 0.30 g / g methanol, and the production intensity was 0.53 g / L / h. This demonstrates the strong methanol metabolism and chemical synthesis capabilities of the engineered strain constructed in this invention, providing an excellent example for the industrialization and promotion of methanol bioconversion.

[0067] SEQ ID NO: 1 SEQ ID NO:2 SEQ ID NO:3 SEQ ID NO:4 SEQ ID NO:5 SEQ ID NO:6 SEQ ID NO:7 The above description is merely a few embodiments of this application and is not intended to limit this application in any way. Although this application discloses preferred embodiments as described above, it is not intended to limit this application. Any changes or modifications made by those skilled in the art without departing from the scope of the technical solution of this application using the disclosed technical content are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

Claims

1. A yeast strain with high methanol tolerance, characterized in that: Using wild-type Pichia pastoris or fatty acid-producing Pichia pastoris as the starting strain, and modifying the conditions according to at least one of the following descriptions (a)-(h), a highly methanol-tolerant strain was obtained, wherein, (a) MIOX Gene knockout; (b) DMA2 Gene knockout; (c) MET17 Gene knockout; (d) BUB2 Gene knockout; (e) CLB4 Gene knockout; (f) UBP12 Gene knockout; (g) ZFP Gene knockout; (h) AOX1 Gene mutation.

2. The highly methanol-tolerant yeast chassis strain according to claim 1, characterized in that: The conditions for modification AOX1 Gene mutation AOX1 F419L / A207S / G625A .

3. A high-yield engineered bacterium of 3-hydroxypropionic acid, characterized in that: Using the strain obtained in claim 1 as the starting strain, at least one of the following modifications is further performed: (a) Introducing a 3-hydroxypropionic acid synthesis module; (b) Enhance the supply of precursor acetyl-CoA and / or reduced coenzyme NADPH; (c) Weakening the methanol dissociation pathway; (d) Overexpression of carboxylic acid transporter protein.

4. The engineered bacteria for high production of 3-hydroxypropionic acid according to claim 3, characterized in that: The 3-hydroxypropionic acid synthesis module is an overexpression of the malonyl-CoA reductase gene. MCR Among them, the MCR gene originates from *Flexobacter orangeii* (…). Chloroflexus aurantiacus Its nucleotide sequence is shown in SEQ ID NO:

1.

5. The engineered bacterium for high production of 3-hydroxypropionic acid according to claim 4, characterized in that: The MCR The copy number of the gene is 1-3.

6. The engineered bacterium for high production of 3-hydroxypropionic acid according to claim 3, characterized in that: The supply of the enhanced precursor acetyl-CoA and / or reduced coenzyme NADPH includes at least one of the following strategies: (1) Overexpression of endogenous ATP-NADH kinase UTR1 Gene; (2) Overexpression of the combination of the gene encoding phosphoketolase and the gene encoding phosphotransacetase; (3) Overexpression of the citrate lyase encoding gene; (4) Overexpression of dihydroxyacetone phosphate synthase gene DAS2 .

7. The engineered bacterium for high production of 3-hydroxypropionic acid according to claim 6, characterized in that: The phosphatosterolase encoding gene is selected from BbXFPK or LmXFPK The gene encoding the phosphoryltransferase is CkPTA ;in, BbXFPK Derived from Bifidobacterium breve ( Bifidobacterium breve Its nucleotide sequence is shown in SEQ ID NO: 2; LmXFPK Derived from Leuconostoc mesenteroides ( Leuconostoc mesenteroides Its nucleotide sequence is shown in SEQ ID NO: 3; CkPTA Derived from Clostridium kuristegia ( Clostridium kluyveri Its nucleotide sequence is shown in SEQ ID NO:

4.

8. The engineered bacterium for high production of 3-hydroxypropionic acid according to claim 6, characterized in that: The citrate lyase encoding gene is: MmACL It comes from house mice ( Mus musculus Its nucleotide sequence is shown in SEQ ID NO:

5.

9. The engineered bacterium for high production of 3-hydroxypropionic acid according to claim 3, characterized in that: The weakened methanol dissociation pathway includes the use of formaldehyde dehydrogenase genes. FLD1 The promoter was replaced with a promoter with weaker expression intensity; the promoter with weaker expression intensity was selected from P TEF1 P PEX5 or P PMP20 At least one of them.

10. The engineered bacterium for high production of 3-hydroxypropionic acid according to claim 3, characterized in that: The carboxylic acid transporter was selected from the endogenous acetic acid transporter of Pichia pastoris. ADY2-1 , ADY2-2 , ADY2-3 , ADY2-4 Monocarboxylic acid transporter JEN1 and from Aspergillus ( Aspergillus pseudoterreus At least one of the monocarboxylic acid transporters Apg2945.

11. The engineered bacterium producing high-yield 3-hydroxypropionic acid according to claim 3, characterized in that: The nucleotide sequence of Apg2945 is shown in SEQ ID NO:

6.

12. The use of the engineered bacteria for high production of 3-hydroxypropionic acid as described in claim 3 in the preparation of 3-hydroxypropionic acid or fatty acids.

13. A method for preparing 3-hydroxypropionic acid or fatty acids, characterized in that: The engineered bacteria described in claim 3 are used to ferment 3-hydroxypropionic acid or fatty acids using methanol as the sole carbon source.