InDel molecular marker related to salt tolerance of rice, PCR detection primer and application thereof

Abstract

The application discloses an InDel molecular marker related to salt tolerance of rice, a PCR detection primer and application thereof. The application finds that an InDel molecular marker in a LOC_Os05g31730 region of rice is related to a salt tolerance phenotype of rice, and the salt tolerance or salt sensitive phenotype materials of rice can be stably distinguished by detecting the InDel molecular marker. A specific primer is designed by using the InDel molecular marker related to the salt tolerance phenotype of rice, and a detection method is established. The detection method can directly determine the salt tolerance or salt sensitive phenotype of rice by PCR amplification fragment size without sequencing. The detection method can accurately and sensitively distinguish the salt tolerance phenotype of rice from the salt sensitive phenotype of rice. The detection system has high accuracy and stability, and is rapid, simple in operation, low in cost, and suitable for rice salt tolerance germplasm resource identification and molecular assisted breeding.

Description

Technical Field

[0001] This invention relates to molecular markers related to crop stress and abiotic stress, particularly to InDel molecular markers related to rice salt tolerance, PCR detection primers, detection kits, and their application in detecting rice salt tolerance phenotypes, belonging to the field of molecular markers related to rice salt tolerance and their applications. Background Technology

[0002] Rice (Oryza sativa L.) is one of the most important food crops in the world. With the continued growth of the global population and the increasing scarcity of arable land resources, improving rice yield and its ability to adapt to adversity is of great significance.

[0003] Salt stress is one of the important abiotic stress factors limiting rice yield. Globally, there are abundant saline-alkali land resources. Developing and utilizing salt-tolerant rice varieties is of great significance for improving the efficiency of saline-alkali land utilization and expanding the rice planting area.

[0004] Traditional methods for identifying salt tolerance in rice mainly rely on field or artificial salt stress phenotypic evaluations, which suffer from problems such as long cycles, significant environmental impact, poor reproducibility, and high costs. Therefore, establishing a stable and reliable molecular marker-assisted screening system is of great significance for improving the efficiency of salt-tolerant rice breeding.

[0005] Currently, although several QTLs or gene loci related to salt tolerance in rice have been reported, there is a lack of specific molecular markers in existing technologies that can stably distinguish between salt-tolerant and salt-sensitive materials and are suitable for large-scale molecular-assisted selection.

[0006] Therefore, developing a stable, accurate, and easy-to-operate molecular marker for detecting rice salt tolerance has significant application value. Summary of the Invention

[0007] The main objective of this invention is to provide an InDel molecular marker related to rice salt tolerance, specific detection primers designed using the InDel molecular marker, and a detection method or kit for establishing rice salt tolerance phenotypes, thereby solving the problems of low efficiency and poor stability in existing rice salt tolerance identification methods.

[0008] The above-mentioned objectives of the present invention are mainly achieved through the following technical solutions: One aspect of the present invention is to provide an InDel molecular marker associated with the salt tolerance phenotype of rice, wherein the physical location of the InDel molecular marker is chr5: 18478928-18479171 bp; there is a 62 bp indel variant located at an intron (position: 18479032-18479093 bp), wherein the nucleotide sequence without the 62 bp InDel molecular marker is shown in SEQ ID No. 1, and the nucleotide sequence with the 62 bp InDel molecular marker is shown in SEQ ID No. 2.

[0009] Another aspect of the present invention provides a specific PCR detection primer pair for detecting InDel molecular markers associated with rice salt tolerance phenotype, wherein the specific PCR detection primer pair consists of a forward primer with the nucleotide sequence shown in SEQ ID No. 3 and a reverse primer with the nucleotide sequence shown in SEQ ID No. 4.

[0010] Another aspect of the present invention is to provide a PCR detection kit for detecting salt tolerance phenotype in rice, comprising: a PCR detection primer pair, DNA polymerase, dNTPs, and ddH2O; wherein the PCR detection primer pair consists of a forward primer with the nucleotide sequence shown in SEQ ID No. 3 and a reverse primer with the nucleotide sequence shown in SEQ ID No. 4.

[0011] Another aspect of the present invention applies InDel molecular markers associated with rice salt tolerance phenotypes, specific PCR detection primer pairs for detecting said InDel molecular markers, or PCR detection kits containing said specific PCR detection primer pairs to the detection of rice salt tolerance / salt sensitivity phenotypes or rice salt tolerance molecular-assisted breeding, etc.

[0012] For reference, the present invention provides a method for detecting rice salt-tolerant or salt-sensitive phenotypes by applying the InDel molecular marker associated with the rice salt-tolerance phenotype, a specific PCR detection primer pair for detecting the InDel molecular marker, or a PCR detection kit containing the specific PCR detection primer pair, including: (1) DNA was extracted from the rice material to be tested as an amplification template, and a PCR amplification system was established using a specific PCR detection primer pair consisting of a forward primer with nucleotide sequence SEQ ID No. 1 and a reverse primer with nucleotide sequence SEQ ID No. 2. (2) If the amplified PCR product is 244bp, the rice material to be tested is salt-tolerant; if the amplified PCR product is 306bp, the rice material to be tested is salt-sensitive. The preferred salt-tolerant rice phenotype in this invention is a rice seedling survival time (SSD) ≥ 11 days under salt treatment, while the preferred salt-sensitive rice phenotype is a rice seedling survival time (SSD) < 11 days under salt treatment.

[0013] The SSD is calculated as follows: when the first rice seedling dies after salt treatment, the survival days (SSD) of the rice seedlings are recorded until the last seedling dies.

[0014] When rice seedlings show obvious salt tolerance phenotype differentiation, the salt stress level (SST) of each material is evaluated according to the rice standard evaluation system. The seedlings are divided into 1-9 levels according to the degree of damage caused by salt stress. The ratio of SSD to SST is used as the nutritional index (VGI) to comprehensively evaluate the salt tolerance of rice seedlings.

[0015] The preferred method of salt treatment is to treat the seedling with Yoshida nutrient solution containing 70 mM NaCl for 48 h, then increase the NaCl concentration to 140 mM until the last seedling dies.

[0016] The preferred cultivation conditions are: cultivation in a greenhouse with a daytime temperature of 28°C and a nighttime temperature of 22°C, and a relative humidity of 60%-68% (13h light / 11h darkness).

[0017] Compared with the prior art, the present invention has the following main advantages: 1. This invention is the first to discover that the InDel molecular marker in the LOC_Os05g31730 region is related to the salt-tolerant phenotype of rice. By detecting this InDel molecular marker, rice salt-tolerant or salt-sensitive phenotype materials can be stably distinguished. 2. This invention utilizes the InDel molecular markers established in relation to rice salt tolerance phenotypes to design specific primers and establish a detection method. Salt tolerance or salt sensitivity phenotypes can be directly determined by the size of PCR amplified fragments without sequencing. This detection method can accurately and sensitively distinguish between rice salt tolerance and salt sensitivity phenotypes. The detection system established in this invention has high accuracy and stability, is rapid, simple to operate, and low in cost, making it suitable for the identification of rice salt-tolerant germplasm resources and molecular-assisted breeding. Attached Figure Description

[0018] Figure 1 Electrophoretic detection results of PCR amplification products of genomic DNA from 75 salt-tolerant and salt-sensitive rice materials; M is the DNA maker, lanes 1-75 correspond to rice varieties numbered 1-75 in Table 1; lanes 1-16, 24-39, 47-54, and 62-69 each yielded a 244bp band, and lanes 17-23, 40-46, 55-61, and 70-75 each yielded a 306bp band.

[0019] Figure 2 Electrophoretic detection results of PCR amplification products of genomic DNA from 75 salt-tolerant and salt-sensitive rice materials using primer qST5-258-F / R.

[0020] Figure 3 Electrophoretic detection results of PCR amplification products of genomic DNA from 75 salt-tolerant and salt-sensitive rice materials using primers ZXM5-354-F / R, ZXM5-356-F / R, and ZXM5-357-F / R. Detailed Implementation

[0021] The present invention will be further described below with reference to specific experimental examples, and the advantages and features of the present invention will become clearer with the description. However, these experimental examples are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0022] biomaterials The rice materials used in the following examples or experimental cases have been publicly described in the reference (WANG. et.al, 2018. Genomic variation in 3,010 diverse accessions of Asian cultivated rice. Nature, 557(7703): 43-49. DOI: 10.1038 / s41586-018-0063-9.).

[0023] Example 1: Design of specific primers and establishment of detection method for predicting salt tolerance in rice. 1. Design specific primers based on Indel molecular markers associated with salt tolerance in rice. Extensive sequence analysis of the rice genome was performed, and predictions were made using the online website http: / / ricevarmap.ncpgr.cn / primer_by_region / to target genes. qST5 A total of 91 SNPs / indels were found in the gene region (5'-3': 18479480 – 18475523 bp). Among them, there is a 62 bp indel variant located at the intron (position: 18479032 – 18479093 bp). The nucleotide sequence without the 62 bp InDel molecular marker (salt-tolerant marker) is shown in SEQ ID No. 1, and the nucleotide sequence with the 62 bp InDel molecular marker (salt-sensitive marker) is shown in SEQ ID No. 2. Chr5: 18478928-18479171 GCAAGATGCTCAAGGTAGGCGTTGTTCCATCGAATATAATATCCAACAAAATAATAGGCCGTTGAATTTAGTTTTGTAATAATGTTTGACATATTTATTAAGTATAATTTGAATATAGCATGATGCTAATATACCTAAACAATTGCTACTAGTTTTACAATTAAGTGAGTTTACATCACCGGGTTTAAATGATCTATTTATTTTGTTAGGTATTAGATATATCGAGGGATTGACGTGGTCCAGTA (SEQ ID No.1) Chr5: 18478928-18479171 GCAAGATGCTCAAGGTAGGCGTTGTTCCATCGAATATAATATCCAACAAAATAATAGGCCGTTGAATTTAGTTTTGTAATAATGTTTGACATATTTATTAAGTA AGGTTAAAAAAATATGTTATTTTGCTTTTACAAATCATTG TTACACATATTTTTTAAAAGTA TAATTTGAATATAGCATGATGCTAATATACCTAAACAATTGCTACTAGTTTACAATTAAGTGAGTTAACATCACCGGGTTTAAATGATCTATTTATTTTGTTAGGTATTAGATATATCGAGGGATTGACGTGGTCCAGTA (SEQ ID No. 2) Note: The underlined sequence is the inserted 62bp sequence.

[0024] A specific primer pair F1 / R1 (5'→3') was designed around this variant site to detect the salt tolerance phenotype in rice. F1: GCAAGATGCTCAAGGTAGGC (SEQ ID No. 3); R1: TACTGGACCACGTCAATCCC (SEQ ID No. 4); 2. Establishment of a method for detecting salt tolerance in rice Genomic DNA was extracted from the rice samples to be tested. Using the genomic DNA as a template, PCR amplification was performed using the designed primer pair F1 / R1.

[0025] PCR amplification system (20 μL): template DNA 2 μL (50-300 ng), primer F1 1 μL, primer R1 1 μL, 2×Rapid Taq Master Mix 10 μL, and ddH2O 6 μL. The concentrations of primer F1 and primer R1 are both 10 µM.

[0026] The specific reaction program for PCR amplification is as follows: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 56℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ extension for 5 min.

[0027] If the amplified product fragment is 244bp, the rice variety to be tested is salt-tolerant rice; if the amplified fragment is 306bp, the rice variety to be tested is salt-sensitive rice.

[0028] The salt-tolerant rice mentioned in this invention can specifically be rice with an SSD ≥ 11 days, and the salt-sensitive rice can specifically be rice with an SSD < 11 days.

[0029] The SSD is calculated as follows: when the first rice seedling dies after salt treatment, the survival days (SSD) of the rice seedlings are recorded until the last seedling dies.

[0030] When rice seedlings show obvious salt tolerance phenotype differentiation, the salt stress level (SST) of each material is evaluated according to the rice standard evaluation system. The seedlings are divided into 1-9 levels according to the degree of damage caused by salt stress. The ratio of SSD to SST is used as the nutritional index (VGI) to comprehensively evaluate the salt tolerance of rice seedlings.

[0031] The salt treatment can specifically involve treating the seedling with Yoshida nutrient solution containing 70 mM NaCl for 48 h, then increasing the NaCl concentration to 140 mM until the last seedling dies.

[0032] The specific cultivation conditions can be as follows: place the plant in a greenhouse with a daytime temperature of 28°C and a nighttime temperature of 22°C, and a relative humidity of 60%-68% for cultivation (13h light / 11h darkness).

[0033] Experiment Example 2: Identification of Salt-Tolerant Genotypes in Rice Using Specific Primers 1. Experimental Methods

[0034] The salt tolerance PCR detection method established in Experiment 1 was used to test 75 rice materials. Among these 75 rice materials, 48 ​​were salt-tolerant and 27 were salt-sensitive (Table 1).

[0035] The PCR identification method established in Experiment 1 was used to amplify these 75 rice materials by PCR. The specific method is as follows: 1. Seventy-five rice samples were used as experimental materials. One hundred plump seeds were selected from each sample and dried in an oven at 50°C for three days. Each sample of seeds was divided into three replicates (each replicate contained 30 seeds).

[0036] 2. Soak the seeds from step 1 in a 5% sodium hypochlorite aqueous solution for 30 minutes, and then rinse them three times with distilled water.

[0037] 3. In 2019, the salt tolerance of rice seedlings was evaluated in a greenhouse at the Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing. The greenhouse conditions were set at 28°C during the day and 22°C at night, with a relative humidity of 60%-68%. Rice seedlings were cultivated using plastic boxes and 10 × 13-hole foam boards. Nylon mesh was attached to the bottom of each foam board to prevent seeds from falling off.

[0038] This experiment selected 75 rice materials. Plump rice seeds from each material were placed in a 50℃ oven for two days to break dormancy and ensure germination rate. The seeds were then disinfected by soaking in a 5% sodium hypochlorite solution for 20-25 minutes, carefully rinsed with distilled water, soaked for 24 hours, and germinated for 24 hours until the seeds showed white sprouts. Two uniformly sprouted seeds were selected and placed in the holes of a foam board. Ten holes were created per material, and three biological replicates were set up. The seedlings were initially cultured in tap water with a pH of 5.0 for 2 days. On the third day, Yoshida nutrient solution with a pH of 5.1-5.5 was applied, and the nutrient solution was changed every 5 days. At the three-leaf stage, a nutrient solution containing 70 mM NaCl was applied. After 2 days of culture, the NaCl concentration in the nutrient solution was increased to 140 mM NaCl, and culture continued until the last rice seedling died.

[0039] Table 1. Statistics on salt tolerance of rice

[0040] 4. Extract genomic DNA from rice varieties numbered 1-75 in Table 1 and perform PCR testing according to the method established in Experiment Example 1.

[0041] 2. Experimental Results PCR test results are shown below Figure 1 . Figure 1Lanes 1-75 correspond to rice varieties numbered 1-75 in Table 1. Among them, lanes 1-16, 24-39, 47-54, and 62-69 all yielded a 244bp band, while lanes 17-23, 40-46, 55-61, and 70-75 all yielded a 306bp band.

[0042] According to the detection criteria established in Experiment 1: rice materials that amplify a 244bp band are salt-tolerant phenotypes, and rice materials that amplify a 306bp band are salt-sensitive phenotypes (or genotypes).

[0043] according to Figure 1 The test results show that the specific primers F1 / R1 in Experiment 1 can accurately distinguish between salt-tolerant phenotypes or salt-sensitive phenotypes (or genotypes) of rice materials.

[0044] Comparative Test Example 1 Predictions were made using the online website http: / / ricevarmap.ncpgr.cn / primer_by_region / regarding the target gene. qST5 A total of 91 SNPs / indels were found in the gene region (5'-3': 18479480 - 18475523), including a 62 bp insertion at intron (location: 18479031). Additionally, the RiceSuperPIRdb website found [further details about the SNPs / indels]. qST5 There is a 258bp indel mutation at exon (location: 18476442-18476680). Therefore, primer pairs F1 / R1 and ST5-258-F / R were designed at these two locations respectively.

[0045] F1: GCAAGATGCTCAAGGTAGGC (SEQ ID No. 3); R1: TACTGGACCACGTCAATCCC (SEQ ID No. 4); ST5-258-F: GTTGGACACAGAATGGTATGAAG (SEQ ID No. 5); ST5-258-R:GAGGATGTACACCGGCGCGAG (SEQ ID No. 6); Simultaneously, based on the indel markers already preserved in the inventor's laboratory, randomly selected from... qST5 The three primer pairs within a 100kb range upstream and downstream of the gene are as follows: ZXM5-354-F: TGCAATTTGAAGTTGTCATGG (SEQ ID No. 7); ZXM5-354-R: TGAACAGTATGAGCATCTGAACCT (SEQ ID No. 8); ZXM5-356-F: CGTCGATTTCGACCTGTCA (SEQ ID No. 9); ZXM5-356-R: ACGTAAACGCCCGAATAAAT (SEQ ID No. 10); ZXM5-357-F: AGATCTTGGCATCATACATGGAC (SEQ ID No. 11); ZXM5-357-R: GTGAATGCCAAGTATATTCAGGTTT (SEQ ID No. 12).

[0046] The 75 rice materials in Table 1 of Experiment 2 were subjected to PCR amplification using the above 5 pairs of PCR primers. The PCR amplification system and reaction procedure are as follows: PCR amplification system (20 μL): template DNA 2 μL (50-300 ng), forward primer 1 μL, reverse primer 1 μL, 2×Rapid Taq Master Mix 10 μL and ddH2O 6 μL; the concentration of both forward and reverse primers is 10 µM.

[0047] The specific PCR amplification reaction procedure is as follows: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 56℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ extension for 5 min.

[0048] The amplification results of primer ST5-258-F / R are shown below. Figure 2 The amplification results of ZXM5-354-F / R, ZXM5-356-F / R, and ZXM5-357-F / R are shown in [the table below]. Figure 3 ,according to Figure 2 and Figure 3 The amplification results showed that primers ST5-258-F / R, ZXM5-354-F / R, ZXM5-356-F / R, and ZXM5-357-F / R could not accurately distinguish between salt-tolerant and salt-sensitive rice materials.

Claims

1. The application of PCR detection primer pairs for InDel molecular markers associated with rice salt tolerance phenotypes in detecting rice salt tolerance or salt sensitivity phenotypes, characterized in that, include: (1) DNA was extracted from the rice material to be tested as an amplification template, and a PCR amplification system was established using a specific PCR detection primer pair consisting of a forward primer with nucleotide sequence SEQ ID No. 3 and a reverse primer with nucleotide sequence SEQ ID No.

4. (2) If the amplified PCR product is 244bp, the rice material to be tested is salt-tolerant; if the amplified PCR product is 306bp, the rice material to be tested is salt-sensitive. The nucleotide sequences of the InDel molecular markers are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively.

2. The application of PCR detection primer pairs for InDel molecular markers associated with rice salt tolerance phenotype in molecularly assisted breeding of rice, characterized in that... The nucleotide sequences of the InDel molecular markers are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively.

3. The application according to claim 2, characterized in that, include: (1) DNA was extracted from the rice material to be tested as an amplification template, and a PCR amplification system was established using a specific PCR detection primer pair consisting of a forward primer with nucleotide sequence SEQ ID No. 3 and a reverse primer with nucleotide sequence SEQ ID No.

4. (2) If the amplified PCR product is 244bp, the rice material to be tested is salt-tolerant; if the amplified PCR product is 306bp, the rice material to be tested is salt-sensitive.

4. The application according to claim 1 or 3, characterized in that, The salt-tolerant phenotype of rice is defined as the survival time of rice seedlings under salt treatment being ≥11 days, while the salt-susceptible phenotype of rice is defined as the survival time of rice seedlings under salt treatment being <11 days.

5. A PCR detection kit for detecting salt tolerance phenotype in rice, comprising: The PCR detection primer pair, DNA polymerase, dNTP, and ddH2O are characterized in that the PCR detection primer pair consists of a forward primer with the nucleotide sequence shown in SEQ ID No. 3 and a reverse primer with the nucleotide sequence shown in SEQ ID No.

4.

6. The application of the PCR detection primer kit according to claim 5 in detecting salt-tolerant or salt-sensitive phenotypes in rice.

7. The application according to claim 6, characterized in that, include: (1) DNA was extracted from the rice material to be tested as an amplification template, and a PCR amplification system was established using a specific PCR detection primer pair consisting of a forward primer with nucleotide sequence SEQ ID No. 3 and a reverse primer with nucleotide sequence SEQ ID No.

4. (2) If the amplified PCR product is 244bp, the rice material to be tested is salt-tolerant; if the amplified PCR product is 306bp, the rice material to be tested is salt-sensitive.

8. The application according to claim 7, characterized in that, The salt-tolerant phenotype of rice is defined as the survival time of rice seedlings under salt treatment being ≥11 days, while the salt-susceptible phenotype of rice is defined as the survival time of rice seedlings under salt treatment being <11 days.

9. The application of the PCR detection kit according to claim 5 in molecular-assisted breeding of rice with salt tolerance.

Images