Recombinant yeast strain for relieving glucose repression effect and construction method thereof

Abstract

This invention belongs to the field of microbial technology, specifically relating to a recombinant yeast strain that overcomes glucose repression and its construction method. To address the problem of glucose repression in yeast strains utilizing straw-mixed sugars, this invention discloses a recombinant yeast strain that overcomes glucose repression and its construction method. The recombinant yeast strain of this invention uses *Saccharomyces cerevisiae* as the substrate strain and is knocked out using CRISPR / Cas9 gene editing technology. Mig1 The yeast obtained from the gene is Saccharomyces cerevisiae (Saccharomyces cerevisiae). Saccharomyces cerevisiae Accession number hj01, deposited on January 26, 2026, by the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 39135. This invention solves the bottleneck problem of low fermentation efficiency caused by glucose repression in yeast utilizing straw mixed sugars, and can provide technical support for the high-value utilization of straw by yeast and the promotion of the industrial application of straw biomass resources.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a recombinant yeast strain that relieves glucose repression and its construction method. Background Technology

[0002] my country has abundant straw biomass resources (crop straw such as rice, wheat, and corn), with an annual output of approximately 800 million tons. However, most of these resources are not effectively utilized, resulting in resource waste and environmental pollution. In recent years, significant progress has been made both domestically and internationally in utilizing yeast fermentation to convert straw biomass resources into high-value-added substances, including the production of biofuels (such as ethanol), single-cell proteins, and organic acids. However, yeast has a low utilization rate of straw biomass resources, and the following bottleneck problems need to be solved: (1) Uneven carbon source utilization, that is, the mixed sugars after straw hydrolysis mainly include glucose and pentose sugars (mainly xylose), etc. Yeast preferentially utilizes glucose, resulting in the delayed utilization or even complete non-glucose carbon sources being not metabolized, significantly prolonging the fermentation cycle; (2) Inhibition of metabolic gene expression, that is, when glucose is present, the expression of other sugar metabolism-related genes is inhibited, resulting in low uptake efficiency; (3) Accumulation and toxicity of by-products, that is, the large accumulation of other sugar metabolism intermediates inhibits cell growth and the yield of target products. The essence of the above problems is that yeast has a glucose repression effect when utilizing straw mixed sugars. The glucose repression effect is common in microorganisms and refers to the phenomenon that microorganisms preferentially utilize glucose in a mixed carbon source environment. It is also known as the catabolite repression effect. Glucose repression is a regulatory strategy employed by microorganisms to adapt to complex environments. Its core characteristic is the use of signal sensing and gene expression regulation networks to ensure the efficient utilization of glucose as a "preferred carbon source" while temporarily shutting down other metabolic pathways. When glucose is present, it is preferentially utilized; only after glucose is depleted do non-glucose pathways begin to be used. In industrial fermentation production, glucose repression leads to reduced product synthesis efficiency, prolonged fermentation cycles, and resource waste. Therefore, a thorough understanding of the glucose repression mechanism and its targeted regulation through biotechnology to overcome repression limitations are crucial for improving the efficiency of large-scale industrial production and addressing environmental and energy issues.

[0003] The mechanism of glucose repression in yeast is quite complex, involving the synergistic action of multiple repression mechanisms. Snf1-Mig1 is a key signaling pathway, with Mig1 (a transcriptional repressor) being the core regulator, whose activity is regulated by Snf1 (an AMP-activated serine / threonine protein kinase). The specific mechanism of action is as follows: When glucose is abundant, glucose metabolites (such as glucose-6-phosphate) can inhibit Snf1 activity, thereby dephosphorylating and activating Mig1. Mig1 enters the nucleus via nuclear localization signals and accumulates there. At this time, Mig1 recruits the repression complex Ssn6-Tup1 to bind to the promoter of the target gene, inhibiting transcription initiation and downregulating the expression of genes related to carbon repression metabolic pathways (tricarboxylic acid cycle, gluconeogenesis, and alternative carbon source metabolism, etc.). When glucose is depleted, low glucose leads to an increase in the AMP / ATP ratio, activating the upstream kinase of Snf1, which then phosphorylates Mig1, causing Mig1 inactivation. Mig1 is then transported from the nucleus to the cytoplasm, and the Ssn6-Tup1 complex dissociates from the promoter of the target gene, allowing the repressed target gene to restart transcription. Numerous studies have shown that the repression mechanisms of pentoses, disaccharides, trisaccharides, and polysaccharides are all closely related to the Snf1 / Mig1 pathway, and targeted inhibition of Mig1 activity will promote the co-utilization of mixed sugars.

[0004] Currently, the main measures to overcome the glucose repression effect of yeast fermentation of mixed sugars from straw include optimizing the fermentation process, carbon source substitution, and genetic engineering modification. Among these, genetically engineered fermentation strains are increasingly being promoted. However, current modification techniques mainly rely on traditional plasmid overexpression, mutant construction, and gene editing using homologous recombination. These techniques suffer from drawbacks such as plasmid loss and low editing efficiency, and all involve engineered yeast strains. No modifications have yet been made to wild-type Saccharomyces cerevisiae, making it difficult to meet the actual needs of industrial production. Summary of the Invention

[0005] To address the aforementioned technical challenges, CRISPR / Cas9 gene editing technology, with its simple design, high efficiency, multi-target approach, and low cost, has gradually become the mainstream tool for gene editing, greatly promoting the rapid development of basic research and agricultural improvement. This invention uses a wild-type yeast strain hj01 (CGMCC No. 39135) that can be produced by fermenting straw as the substrate strain, and uses CRISPR / Cas9 gene editing technology to knock out Mig1, a key molecule in glucose repression, to obtain a recombinant yeast knockout strain. The specific construction method is as follows: A suitable CRISPR / Cas9 dual plasmid editing system (Cas9-NAT and p426-SNR52-sgRNA-TEF-Hygro) was selected to establish a yeast plasmid electroporation method; the target sequence SgRNA for Mig1 was designed; the SgRNA was constructed into the p426-SNR52-sgRNA-TEF-Hygro plasmid using reverse PCR and sequenced for verification; the successfully introduced SgRNA p426-SNR52-sgRNA-TEF-Hygro plasmid was electroporated into yeast strain hj01 transformed with the Cas9-NAT plasmid to verify the SgRNA editing efficiency; Mig1 gene knockout positive clones were screened, verified, and obtained; the CRISPR / Cas9 dual plasmids in the knockout strains were removed; finally, the ability of the obtained Mig1 gene knockout strains to ferment and utilize glucose / xylose and straw mixed sugars was verified.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] One of the technical solutions provided by the present invention is a recombinant yeast strain, which is obtained by knocking out the Mig1 gene using Saccharomyces cerevisiae as the substrate strain through genetic engineering technology.

[0008] Furthermore, the nucleotide sequence of Mig1 is shown in SEQ ID NO.1.

[0009] Furthermore, the brewing yeast is Saccharomyces cerevisiae hj01, with a deposit date of January 26, 2026, deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 39135.

[0010] Furthermore, the genetic engineering technology includes CRISPR / Cas9 gene editing technology.

[0011] The second technical solution provided by the present invention is a method for constructing recombinant yeast as described in the first technical solution. Using Saccharomyces cerevisiae as the chassis strain, the key molecule Mig1 for glucose repression effect on the genome of the chassis strain is knocked out using CRISPR / Cas9 gene editing technology to obtain recombinant yeast.

[0012] Furthermore, the construction method includes the following steps:

[0013] 1) Starting with strain hj01;

[0014] 2) Transform Cas9-NAT into the starting strain to obtain yeast hj01 containing the Cas9-NAT plasmid;

[0015] 3) Design target sequence SgRNA for the Mig1 gene;

[0016] 4) Construct a recombinant plasmid containing the Mig1 target sequence SgRNA;

[0017] 5) The plasmid containing the Mig1 target sequence SgRNA obtained in step 4) is transferred into the yeast hj01 containing the Cas9-NAT plasmid in step 2) to obtain the Mig1 knockout strain.

[0018] Further, in step 4), the construction process is as follows: the SgRNA from step 3) is constructed into the p426-SNR52-sgRNA-TEF-Hygro plasmid using reverse PCR to obtain a recombinant plasmid containing the SgRNA of the Mig1 target sequence.

[0019] Furthermore, step 5) also includes the verification of the Mig1 knockout strain.

[0020] Furthermore, it also includes step 6), removing the CRISPR / Cas9 dual plasmids from the knockout strain: removing the Cas9-NAT and p426-SNR52-sgRNA-TEF-Hygro plasmids from the knockout strain cells using an antibiotic-free culture passage method.

[0021] The third technical solution provided by the present invention is the application of the recombinant yeast described in the first technical solution and the Mig1 knockout strain obtained by the construction method described in the second technical solution in relieving glucose repression.

[0022] The fourth technical solution provided by this invention is the application of the recombinant yeast described in the first technical solution and the Mig1 knockout strain obtained by the construction method described in the second technical solution in the simultaneous utilization of glucose and xylose.

[0023] The fifth technical solution provided by this invention is the application of the recombinant yeast described in the first technical solution and the Mig1 knockout strain obtained by the construction method described in the second technical solution in the utilization of straw mixed sugar.

[0024] Beneficial effects:

[0025] This invention, based on CRISPR / Cas9 gene editing technology, targets the key molecule Mig1 responsible for glucose repression, and modifies the genome of wild-type Saccharomyces cerevisiae hj01 (CGMCC No. 39135), which can utilize straw fermentation for production. This removes the glucose repression effect in the yeast, enabling the recombinant yeast to simultaneously and efficiently utilize mixed carbon sources (straw mixed sugars). Compared to wild-type yeast, the recombinant yeast strain of this invention significantly improves the utilization efficiency of mixed sugars of xylose and glucose, as well as mixed sugars from straw, which is beneficial for improving the overall utilization rate of carbon sources and promoting the industrial application of straw biomass resources.

[0026] Biological Preservation Instructions

[0027] Biological material: hj01, classified and named: Saccharomyces cerevisiae, was deposited on January 26, 2026 at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; accession number: CGMCC No. 39135. Attached Figure Description

[0028] Figure 1 This is a map of CRISPR / Cas9 plasmids.

[0029] in, Figure 1 (A) is the map of the Cas9-NAT(#64329) plasmid. Figure 1 (B) is the map of the p426-SNR52-sgRNA-TEF-Hygro plasmid;

[0030] Figure 2 Line graph showing the continuous passage of 5 wild-type Saccharomyces cerevisiae cultures in mixed sugars;

[0031] Figure 3 An evolutionary tree diagram of Saccharomyces cerevisiae hj01;

[0032] Figure 4 A statistical chart of gene annotations for carbohydrate enzymes in Saccharomyces cerevisiae hj01.

[0033] Figure 5 Photographs of CRISPR / Cas9 plasmid electroconversion plates in Saccharomyces cerevisiae hj01.

[0034] in, Figure 5 (A) is an image of a positive hj01-Cas9-NAT clone. Figure 5 (B) is a diagram of a positive clone of hj01-p426-SNR52-sgRNA-TEF-Hygro;

[0035] Figure 6 This is a diagram showing the results of reverse PCR nucleic acid electrophoresis.

[0036] Figure 7 Colony diagram of DH5α-p426-Mig1 positive transformants;

[0037] Figure 8 This is a diagram showing the sequencing alignment results of the recombinant SgRNA plasmid (a plasmid that successfully inserted the Mig1 target sequence SgRNA).

[0038] in, Figure 8 (A) is p426-Mig1-sg1, Figure 8 (B) is p426-Mig1-sg2. Figure 8 (C) is p426-Mig1-sg3. Figure 8 (D) is p426-Mig1-sg4;

[0039] Figure 9 This image shows the screening and validation results of gene knockout positive strains.

[0040] in, Figure 9 (A) Successful electroporation of the p426-SNR52-sgRNA-TEF-Hygro plasmid containing Mig1 SgRNA into hj01 positive clones for screening. Figure 9 (B) Verification of Mig1 gene knockout sequencing results;

[0041] Figure 10 Figure showing the removal of CRISPR / Cas9 plasmids in gene knockout strains;

[0042] Figure 11 This is a graph showing the results of the fermentation function verification of mixed sugars (glucose / xylose).

[0043] in, Figure 11 (A) is the fermentation growth curve of yeast mixed with sugar. Figure 11 (B) is a graph showing the residual glucose content versus time. Figure 11 (C) is a graph showing the residual xylose content versus time. Figure 11 (D) represents the rate of xylose utilization by yeast.

[0044] Figure 12 The figure shows the results of the verification of the fermentation function of straw mixed sugar.

[0045] in Figure 12(A) represents the reducing sugar content during the fermentation of mixed sugars from straw. Figure 12 (B) represents the difference in the amount of microbial cells fermenting mixed with straw and sugar. Figure 12 (C) represents the difference in crude protein content during fermentation of mixed sugars from straw. Detailed Implementation

[0046] The present invention will now be described through specific embodiments. All technical means not specifically described herein are methods well-known to those skilled in the art. Furthermore, the embodiments should be understood as illustrative, not limiting the scope of the invention; the essence and scope of the invention are defined only by the claims. For those skilled in the art, various changes or modifications to the material composition and dosage in these embodiments without departing from the essence and scope of the invention also fall within the protection scope of the present invention.

[0047] 1. All raw materials and reagents involved in the experiments of this invention can be purchased commercially.

[0048] Chassis cells: Saccharomyces cerevisiae hj01, with accession number CGMCC No.39135, was deposited at the China General Microbiological Culture Collection Center on January 26, 2026.

[0049] The plasmid Cas9-NAT was purchased from Wuhan Miaoling Biotechnology Co., Ltd.

[0050] The plasmid p426-SNR52-sgRNA-TEF-Hygro was purchased from Wuhan Miaoling Biotechnology Co., Ltd.

[0051] The plasmid maps of plasmids Cas9-NAT and p426-SNR52-sgRNA-TEF-Hygro are as follows: Figure 1 As shown.

[0052] 2. Information on some of the culture media used in this application:

[0053] YPD plate medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L, agar powder 20 g / L.

[0054] YPD liquid culture medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L.

[0055] Norrserin (NAT) resistance medium: 100 μg / mL Norrserin (NAT), 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, 20 g / L agar powder.

[0056] Hygromycin (Hygro) resistant medium: 200 μg / mL hygromycin (Hygro), yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L, agar powder 20 g / L.

[0057] Mixed sugar culture medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L, xylose 20 g / L.

[0058] 3. The sequence information of some genes or enzymes involved in this application is shown in Table 1.

[0059] Table 1

[0060] Mig1 Glucose-repressed transcriptional repressor gene NM_001180900.1 Snf1 AMP-activated serine / threonine protein kinase encoding gene NM_001180785.3

[0061] The nucleotide sequence of Mig1 is shown in SEQ ID NO.1:

[0062]

[0063] The nucleotide sequence of Snf1 is shown in SEQ ID NO.2:

[0064]

[0065] The present invention will be further explained and illustrated below through specific embodiments.

[0066] Example 1: Screening and Identification of hj01

[0067] I. Initial Screening

[0068] (1) Preparation of straw enzymatic hydrolysate: 40-mesh rice straw was enzymatically hydrolyzed using a compound enzyme (xylanase, glucanase, mannanase, polysaccharide lysin, and pectin lysin) at 30℃ for 30 h. 12000 g of the enzymatic hydrolysate was centrifuged for 10 min, the supernatant was collected, and the precipitate was dried in a 70℃ oven for 48 h for later use.

[0069] (2) Preparation of screening medium: 700 g of straw enzymatic hydrolysate, 21.43 g of urea and 10 g of yeast extract were added to 1 L of straw enzymatic hydrolysate supernatant. After mixing, the reducing sugar in the straw enzymatic hydrolysate was used as the carbon source to prepare a solid fermentation screening medium for yeast.

[0070] (3) Take 43 strains of wild-type Saccharomyces SC01-SC43 from different sources and inoculate them into the culture medium in step (2) at an inoculation rate of 1%. Ferment at 28°C and 180 r / min for 36 h.

[0071] (4) Take the fermentation product from step (3), calculate the biomass of yeast after fermentation using the plate coating counting method, and screen the 5 best brewing yeast strains.

[0072] The initial screening results of wild-type Saccharomyces cerevisiae SC01-SC43 are shown in Table 2 below:

[0073] Table 2. Biomass results of wild-type Saccharomyces cerevisiae SC01-SC43 after 36 hours of fermentation.

[0074] SC01 1.35 SC02 5.78 SC03 0.91 SC04 2.42 SC05 4.16 SC06 2.53 SC07 1.29 SC08 4.07 SC09 3.64 SC10 3.85 SC11 0.32 SC12 1.19 SC13 3.76 SC14 0.81 SC15 3.93 SC16 1.24 SC17 1.68 SC18 1.51 SC19 3.05 SC20 6.49 SC21 0.77 SC22 4.52 SC23 2.23 SC24 0.14 SC25 3.67 SC26 1.88 SC27 1.03 SC28 1.26 SC29 1.48 SC30 3.71 SC31 0.54 SC32 4.36 SC33 3.95 SC34 2.69 SC35 2.82 SC36 1.15 SC37 1.87 SC38 5.73 SC39 3.81 SC40 1.24 SC41 0.89 SC42 7.94 SC43 0.57

[0075] As shown in Table 2, the top 5 strains in terms of biomass were SC02, SC42, SC38, SC22, and SC20. These five strains were selected for subsequent rescreening experiments.

[0076] II. Secondary Screening

[0077] (5) Prepare a mixed sugar culture medium (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and 20 g / L xylose), sterilize and set aside for use.

[0078] (6) The five wild-type Saccharomyces cerevisiae strains (SC02, SC42, SC38, SC22 and SC20) obtained from the initial screening were fermented aerobically in a mixed sugar fermentation medium at 28℃ and 180 r / min for 24 h. After continuous subculturing, the optimal strain was selected based on biomass. The results are as follows: Figure 2 As shown.

[0079] Figure 2 Line graph showing continuous passage of 5 wild-type Saccharomyces cerevisiae cultures in mixed sugars, from Figure 2 As can be seen from the data, SC42 had the highest biomass after continuous subculturing and screening, and was named hj01.

[0080] III. Gene sequencing and taxonomic identification of strain hj01

[0081] Whole-genome sequencing was performed on hj01, and the sequencing results were compared with the genome data of Saccharomyces cerevisiae strains in NCBI. The results were then visualized using tools.

[0082] The evolutionary tree diagram of brewer's yeast hj01 is as follows: Figure 3 As shown, hj01 has 96.68% homology with the model strain S288C of Saccharomyces cerevisiae and is most closely related to the Saccharomyces cerevisiae strain Makgeolli. The strain hj01 is classified and named Saccharomyces cerevisiae. This strain was deposited at the China General Microbiological Culture Collection Center on January 26, 2026, with the accession number CGMCC No. 39135.

[0083] IV. Prediction of Genomic Carbohydrate Enzyme Function

[0084] The hj01 genome was compared with the CAZY database to predict and statistically analyze the gene proportions of carbohydrate enzymes in the hj01 genome. The results are as follows: Figure 4 As shown.

[0085] Figure 4 A statistical graph of carbohydrate enzyme gene annotation, from Figure 4 The results show that the hj01 genome contains abundant genes related to glycoside hydrolases, indicating its strong function in decomposing polysaccharides. Furthermore, among the carbohydrate metabolism-related genes in the hj01 genome, glycosyltransferases (45.77%) and glycoside hydrolases (40.85%) account for over 86% combined, indicating that its functions in glycosyl transfer (synthesis) and glycoside hydrolysis (degradation) are dominant.

[0086] V. Cultivation of Saccharomyces cerevisiae hj01

[0087] Yeast strain hj01 was cultured on Yeast Extract Peptone Dextrose Medium (YPD). Specifically, a small amount of yeast strain hj01, frozen at -80℃, was inoculated into 5 mL of liquid YPD medium using a sterilized inoculation loop. After incubation at 30℃ and 180 r / min overnight for 12 h with shaking, the culture was revived. Then, the inoculation was expanded at a 1:10 ratio to a conical flask containing 150 mL of YPD medium and incubated at 30℃ and 180 r / min for 24 h with shaking to obtain a yeast cell suspension.

[0088] Example 2 Construction of the yeast hj01 CRISPR / Cas9 gene editing system

[0089] 1. CRISPR / Cas9 gene editing plasmid

[0090] By searching the Addgene website for existing yeast CRISPR / Cas9 editing plasmids, and after screening and verification, we obtained CRISPR / Cas9 dual plasmid editing systems suitable for yeast hj01: Cas9-NAT (#64329) and p426-SNR52-sgRNA-TEF-Hygro.

[0091] Figure 1 This is a map of the CRISPR / CAS9 plasmid, in which... Figure 1 (A) is the map of the Cas9-NAT (#64329) plasmid. Figure 1 (B) is the map of p426-SNR52-sgRNA-TEF-Hygro plasmid.

[0092] 2. Preparation of hj01 competent cells

[0093] Yeast strain hj01, frozen at -80℃, was inoculated into a test tube containing 8 mL of YPD medium and incubated overnight at 30℃ and 180 r / min for revival. The activated yeast culture was then inoculated at a 1:10 ratio into an Erlenmeyer flask containing 40 mL of YPD medium and incubated at 30℃ with shaking at 180 r / min until the OD value reached 1.0–1.5 (use immediately). Immediately after incubation, the culture was removed from the flask and placed on ice for 30 min. The culture was then centrifuged at 4℃ and 3000×g for 5 min, the supernatant was discarded, and the cells were washed with 20 mL of pre-chilled sterile water, repeated three times. The cells were then resuspended in 20 mL of pre-chilled 1 mol / L sorbitol, centrifuged at 3000×g for 5 min, the supernatant was discarded, and this process was repeated twice. Finally, 500 µL of pre-chilled 1 mol / L sorbitol was added and mixed thoroughly by pipetting. The mixture was then aliquoted into 1.5 mL centrifuge tubes at 80 µL each and stored at -80℃ for later use.

[0094] 3. Electroconversion of CRISPR / Cas9 plasmids in yeast strain hj01

[0095] Remove the competent cells stored at -80℃, thaw them on ice, and then add 2 µL of Cas9-NAT and p426-SNR52-sgRNA-TEF-Hygro plasmids respectively. Gently mix with a pipette (do not repeatedly pipet, as this may damage the cells), and incubate on ice for 15 min. Following the operating procedure, correctly place the electroporation cuvette into the electroporator and electroporate at 1.5 kV for 5 msec. After successful electroporation, quickly add 1 mL of pre-chilled 1 mol / L sorbitol, gently mix, and transfer the cell mixture into a 1.5 mL centrifuge tube. Incubate at 30℃ for 2–3 h. The transformed cells were concentrated to 200 μL and spread onto antibiotic resistance medium (Cas9-NAT transformed cells to 100 µg / mL norsinoxin resistance medium, p426-SNR52-sgRNA-TEF-Hygro to 200 μg / mL hygromycin resistance medium). Positive clones were selected by static incubation at 30°C for 24-48 h (yeast containing Cas9-NAT plasmid hj01-Cas9-NAT, yeast containing p426-SNR52-sgRNA-TEF-Hygro plasmid hj01-p426-SNR52-sgRNA-TEF-Hygro).

[0096] Figure 5 These are images of CRISPR / Cas9 plasmids electroporated in yeast strain hj01. Figure 5 (A) is an image of a positive hj01-Cas9-NAT clone. Figure 5 (B) is an image of a positive clone of hj01-p426-SNR52-sgRNA-TEF-Hygro. From Figure 5 As can be seen, both Cas9-NAT and p426-SNR52-sgRNA-TEF-Hygro plasmids can be successfully electroporated into yeast hj01 with high transformation efficiency and clean background, indicating that the electroporation method is feasible and the plasmids are suitable for the yeast hj01 of this invention.

[0097] Example 3 Construction of Mig1 knockout strain (hj01-ΔMig1)

[0098] I. Design and Construction of Glucose Repression Molecule SgRNA

[0099] 1. Design of SgRNA

[0100] Search for the CDS coding sequence of Saccharomyces cerevisiae Mig1 (NM_001180900.1, Saccharomyces cerevisiae S288C) on NCBI and save it as a FASTA file. Log in to https: / / benchling.com / and import the Mig1 FASTA file to design SgRNAs. Select SgRNAs with high on-target and off-target scores, and cleavage sites as close to the 5' end as possible. Design four SgRNAs for each, as shown in Table 3 below:

[0101] Table 3 SgRNA sequence information

[0102] Mig1-Sg1 95(+) CAAAGTAGCTGCGAAGTCAG AGG 58.8 50 78-97 50% 53.4 Mig1-Sg2 115(-) TGACAGATAGGACAAGCATG TGG 71.8 50.0 112-131 45% 51.3 Mig1-Sg3 216(-) TGAACCTTTTCACACATCCG GGG 64.2 50.0 213-232 45% 52.7 Mig1-Sg4 285(+) CATACAAACTCCCACCCTCG AGG 67.8 49.8 268-287 55% 54.4

[0103] 2. Construct the target sequence SgRNA into the p426-SNR52-sgRNA-TEF-Hygro plasmid using reverse PCR.

[0104] The 20 bp sequence on the p426-SNR52-sgRNA-TEF-Hygro original plasmid was inserted and replaced by the SgRNA of the target gene using reverse PCR.

[0105] 2.1 Reverse PCR Primer Design

[0106] The primers are shown in Table 4 below:

[0107] Table 4 Primer Table

[0108] Mig1-Sg1-F <![CDATA[ CAAAGTAGCTGCGAAGTCAG GTTTTAGAGCTAGAAATAGCAAGTTAA AATAAG]]> Mig1-Sg1-R <![CDATA[ CTGACTTCGCAGCTACTTTG GATCATTTATCTTTCACTGCGGAG]]> Mig1-Sg2-F <![CDATA[ TGACAGATAGGACAAGCATG GTTTTAGAGCTAGAAATAGCAAGTTAA AATAAG]]> Mig1-Sg2-R <![CDATA[ CATGCTTGTCCTATCTGTCA GATCATTTATCTTTCACTGCGGAG]]> Mig1-Sg3-F <![CDATA[ TGAACCTTTTCACACATCCG GTTTTAGAGCTAGAAATAGCAAGTTAA AATAAG]]> Mig1-Sg3-R <![CDATA[ CGGATGTGTGAAAAGGTTCA GATCATTTATCTTTCACTGCGGAG]]> Mig1-Sg4-F <![CDATA[ CATACAAACTCCCACCCTCG GTTTTAGAGCTAGAAATAGCAAGTTAA AATAAG]]> Mig1-Sg4-R <![CDATA[ CGAGGGTGGGAGTTTGTATG GATCATTTATCTTTCACTGCGGAG]]>

[0109] 2.2 Reverse PCR

[0110] Reverse PCR of the p426-SNR52-sgRNA-TEF-Hygro plasmid was performed using NEB High-Fidelity Enzyme Q5® 2× Master Mix (M0492S). The reaction system and procedure are shown in Tables 5 and 6 below.

[0111] Table 5 PCR reaction system

[0112]

[0113] Table 6 PCR reaction procedure

[0114]

[0115] 2.3 DpnI Processing

[0116] After the PCR reaction was completed, 5 μL of PCR amplification product was taken and DpnI enzyme (Takara, Quickcut DpnI, 1609) was added according to the system shown in Table 7 below. The enzyme was digested at 37℃ for 60 min to degrade the methylated template plasmid.

[0117] Table 7

[0118] 10X QuickCut Buffer* 5 μL DNA 100 ng QuickCut Dpn I 1 μL Sterilized water Make up to 10 μL

[0119] 2.4 Sequencing verification of positive clones

[0120] The product treated with DpnI was transformed into Escherichia coli DH5α by heat shock, plated onto LB agar plates containing 100 μg / mL ampicillin (Amp), and cultured overnight. Positive clones DH5α-p426-Mig1 (DH5α-p426-Mig1-sg1, DH5α-p426-Mig1-sg2, DH5α-p426-Mig1-sg3, DH5α-p426-Mig1-sg4) were then picked.

[0121] The selected positive clones were amplified and preserved. PCR was performed using verification primers (Check-F: GCTAGCGGTAAAGGTGCGCA, Check-R: GCGTGAACGTAAGCGTGACA) and sent to a biotechnology company for sequencing. Strains that successfully inserted the Mig1 target sequence SgRNA were screened. Then, another 1 mL of the positive strain culture was used for full-length plasmid sequencing to confirm the absence of mutations. The strains were preserved, and plasmids (p426-Mig1-sg1, p426-Mig1-sg2, p426-Mig1-sg3, p426-Mig1-sg4) were extracted for yeast gene knockout.

[0122] 2.5 Verification Results

[0123] Figure 6 The image shows the results of reverse PCR nucleic acid electrophoresis. Using the reverse PCR primers for Mig1, the p426-SNR52-sgRNA-TEF-Hygro plasmid was amplified by PCR, resulting in four circular plasmids with a PCR product fragment size of 6946 bp, namely p426-Mig1-sg1, p426-Mig1-sg2, p426-Mig1-sg3, and p426-Mig1-sg4.

[0124] Figure 7 Colony images of DH5α-p426-Mig1 positive transformants. Colony images of DH5α-positive transformants from DpnI-treated PCR product circular plasmids transformed into competent E. coli cells. Figure 7The colonies are morphologically intact, the background is clean, and the number of colonies is relatively large, indicating that they have been successfully transferred into Escherichia coli.

[0125] Figure 8 This is a diagram showing the sequencing alignment results of the recombinant SgRNA plasmid (a plasmid that successfully inserted the Mig1 target sequence SgRNA). Figure 8 (A) is p426-Mig1-sg1, Figure 8 (B) is p426-Mig1-sg2. Figure 8 (C) is p426-Mig1-sg3. Figure 8 (D) is p426-Mig1-sg4. From Figure 8 The results show that the sequencing peaks are clear, the sequenced gene sequence is consistent with the designed gene sequence, and there are no mismatches, indicating that the SgRNA plasmid was successfully constructed.

[0126] II. Construction of Knockout Strains

[0127] 1. Electroporation of SgRNA plasmids

[0128] Four plasmids that successfully inserted the Mig1 target sequence SgRNA were electroporated into competent yeast cells containing the Cas9-NAT plasmid obtained in Example 2 according to the method in Section 3 of Example 2. After incubation for 1 h, the transformed cells were concentrated to 200 μL and plated onto YPD medium containing 100 μg / mL Norilskia natriuretic acid (NAT) and 200 μg / mL Hygromycin (Hygro) for 36 h at 30°C.

[0129] 2. Screening and validation of gene knockout positive strains

[0130] (1) Five positive clones were selected and cultured for 24 h. 0.5 mL of bacterial culture was taken into a 1.5 mL centrifuge tube and centrifuged at 10,000×g for 1 min to collect the bacteria and discard the supernatant. 0.5 mL of sterile water was added and vortexed to mix. The wall-breaking enzyme was added to a working concentration of 0.15 U / μL and enzymatically digested at 30℃ for 30 min. Then, the cell wall was broken by reacting at 95℃ for 10 min. Yeast DNA was extracted using a yeast genomic DNA rapid extraction kit.

[0131] (2) PCR was performed using Mig1 primers (Mig1-knock out-F: ATGCAAAGCCCATATC CAATG; Mig1-knockout-R: GAGACGGGAATCTTAGCC ATC).

[0132] (4) Perform agarose gel electrophoresis on the above PCR products, cut the gel to recover the target fragment, and send it to the biotechnology company for sequencing.

[0133] (5) Analyze the sequencing results as follows Figure 9 As shown, strains with non-3n mutations caused by non-homologous end linkage repair are selected, which are frameshift mutations, to achieve gene knockout. The gene knockout strains are then preserved.

[0134] Figure 9 This is a diagram showing the screening and validation results of gene knockout positive strains. Figure 9 (A) Successful electroporation of the p426-SNR52-sgRNA-TEF-Hygro plasmid containing Mig1 SgRNA into hj01 positive clones for screening. Figure 9 (B) Verification of Mig1 gene knockout sequencing results. Introducing or deleting non-3n bases into the gene sequence, causing a frameshift mutation, is considered to achieve the knockout objective. As shown in the figure, Figure 9 (B) Two bases were inserted at the site shown in the Mig1 gene sequence (obtained by p426-Mig1-sg1 targeting), thereby obtaining the Mig1 knockout strain.

[0135] 3. Removal of yeast CRISPR / Cas9 plasmids

[0136] After successful target site knockout, the Cas9-NAT and p426-SNR52-sgRNA-TEF-Hygro plasmids in the gene knockout strain cells were removed using an antibiotic-free culture passaging method. The specific steps are as follows:

[0137] (1) The knockout strain was inoculated into non-resistant YPD liquid medium and cultured at 30°C for 24 h.

[0138] (2) Take a portion of the bacterial culture and dilute it on a non-resistant YPD plate and streak it. Incubate at 30°C for 24-48 h.

[0139] (3) Select the above single clones and inoculate them into YPD plates with no antibiotic, norsulcin, hygromycin and norsulcin + hygromycin respectively, and incubate at 30°C for 24-48 h.

[0140] (4) Select a single clone that grows on antibiotic-free medium but does not grow on plates containing norsylmycin and hygromycin. This means that the CRISPR double plasmid has been removed, and the target knockout yeast strain hj01-ΔMig1 is obtained.

[0141] (5) The target knockout yeast strain (hj01-ΔMig1) was re-inoculated in non-resistant YPD liquid medium and cultured at 30℃ for 24 h. The bacterial culture was then stored at -80℃ with 20% glycerol.

[0142] Figure 10The image shows the CRISPR / Cas9 plasmid removal in the gene knockout strain; No antibiotic represents antibiotic-free YPD medium, NAT represents YPD medium with 100 μg / mL Norilskine, Hygro represents YPD medium with 200 μg / mL Hygromycin, and NAT+Hygro represents YPD medium with double antibiotics (100 μg / mL Norilskine + 200 μg / mL Hygromycin). Figure 10 As can be seen from the data, the colonies that grow on antibiotic-free medium but do not grow on NAT, Hygro, and double-antibiotic medium are yeast strains that have lost plasmids, thus obtaining the Mig1-deleted Saccharomyces cerevisiae strain hj01-ΔMig1.

[0143] III. Construction of hj01-ΔSnf1

[0144] The Saccharomyces cerevisiae strain hj01-ΔSnf1, which lacks the key molecule Snf1 for glucose repression, was constructed using the construction method described in Parts I and II of Example 3.

[0145] The designed SgRNAs are shown in Table 8 below:

[0146] Table 8

[0147] Snf1-Sg1 41(-) GTGGTGGCTAGAATTTGCAT TGG 63.3 99.1 38-57 45% 52.8 Snf1-Sg2 96(+) CACCACCATCACGGTCATGG CGG 67.6 99.7 79-98 60% 57.5 Snf1-Sg3 130(-) CCATCCGCTAAGGACGACTT GGG 61.3 50.0 127-146 55% 56.0 Snf1-Sg4 288(+) TTGGCAAAGAGTGATATGCA GGG 72.8 50.0 271-290 40% 51.7

[0148] The reverse PCR primers are shown in Table 9 below:

[0149] Table 9

[0150] Snf1-Sg1-F <![CDATA[ GTGGTGGCTAGAATTTGCAT GTTTTAGAGCTAGAAATAGCAAGTTAA AATAAG]]> Snf1-Sg1-R <![CDATA[ ATGCAAATTCTAGCCACCAC GATCATTTATCTTTCACT GCGGAG]]> Snf1-Sg2-F <![CDATA[ CACCACCATCACGGTCATGG GTTTTAGAGCTAGAAAA TAGCAAGTTAA AATAAG]]> Snf1-Sg2-R <![CDATA[ CCATGACCGTGATGGTGGTG GATCATTTATCTTTCACT GCGGAG]]> Snf1-Sg3-F <![CDATA[ CCATCCGCTAAGGACGACTT GTTTTAGAGCTAGAAATAGCAAGTTAA AATAAG]]> Snf1-Sg3-R <![CDATA[ AAGTCGTCCTTAGCGGATGG GATCATTTATCTTTCACTGCGGAG]]> Snf1-Sg4-F <![CDATA[ TTGGCAAAGAGTGATATGCA GTTTTAGAGCTAGAAATAGCAAGTTAA AATAAG]]> Snf1-Sg4-R <![CDATA[ TGCATATCACTCTTTGCCAA GATCATTTATCTTTCACT GCGGAG]]>

[0151] Finally, the Saccharomyces cerevisiae strain hj01-ΔSnf1 was obtained (obtained by targeting p426-Snf1-sg3).

[0152] Example 4: Functional Validation of Recombinant Yeast Strain Fermentation Utilizing Mixed Sugars (Glucose / Xylose)

[0153] 1. Test Methods

[0154] (1) Prepare a mixed sugar culture medium and sterilize it for later use.

[0155] (2) Wild-type yeast hj01 and gene knockout bacteria (hj01-ΔMig1, hj01-ΔSnf) were inoculated and revived into 5 mL of YPD liquid medium and cultured at 30℃ and 180 r / min for 12 h until the logarithmic growth phase.

[0156] (3) The seed culture of (2) was inoculated into the mixed sugar medium at a ratio of 1:20 and cultured at 30℃ and 180 r / min for 48h. During this period, 1 mL of sample was taken at 0, 2, 4, 6, 8h and every 4h after 8h and centrifuged (8000 ×g, 2 min) to separate the supernatant (for sugar analysis) and the bacterial cells (for biomass) for determination.

[0157] (4) Glucose content was detected by enzyme catalysis, xylose content was detected by acid hydrolysis, and biomass was assessed by OD600 using an enzyme-linked immunosorbent assay (ELISA) reader.

[0158] (5) Plot the above index curves and analyze the efficiency of mixed sugar co-utilization.

[0159] 2. Test Results

[0160] The test results are as follows Figure 11 As shown, Figure 11 The figure shows the results of the mixed sugar fermentation function verification. Figure 11 (A) is the fermentation growth curve of yeast mixed with sugar. Figure 11 (B) is a graph showing the residual glucose content versus time. Figure 11 (C) is a graph showing the residual xylose content versus time. Figure 11 (D) represents the rate of xylose utilization in yeast, and different letters indicate significant differences (P < 0.05).

[0161] Figure 11 As can be seen from (A), 0-8 h is the logarithmic growth phase of the three yeasts. During 0-6 h, the total number of yeast cells in hj01-ΔMig1 and hj01-ΔSnf1 is slightly lower than that in hj01. 8-48 h is the plateau phase. After 8 h, the total number of yeast cells in hj01-ΔMig1 is greater than that in hj01 and hj01-ΔSnf1. Figure 11 (B) The results showed that from 0 to 8 h, the glucose residue in hj01-ΔMig1 was higher than that in hj01 and hj01-ΔSnf1, and the glucose in all three bacteria was depleted after 8 h. Figure 11 (C) and Figure 11 (D) shows that from 0 to 48 h, the xylose utilization rate of hj01-ΔMig1 was significantly higher than that of hj01 (P < 0.05), while the xylose utilization rate of hj01-ΔSnf1 was significantly lower than that of hj01 (P < 0.05). These results indicate that knocking out Mig1 can successfully relieve the glucose repression effect in yeast and significantly improve the utilization efficiency of xylose.

[0162] Example 5: Functional Verification of Recombinant Yeast Strain Fermentation Utilizing Straw Mixed Sugars

[0163] 1. Test Methods

[0164] (1) Prepare the straw fermentation substrate according to the following formula: Dissolve 0.5 g CO(NH2)2, 0.1 g molasses, and 0.1 g compound enzyme in 5.0 mL sterile water and mix evenly with 5.0 g sterilized and dried 40 mesh rice straw.

[0165] (2) The experiment was divided into Con (negative control group, containing only straw fermentation substrate), hj01 and hj01-ΔMig1 groups, and inoculated with OD 600 200 μL of the expanded yeast culture (1.0) was added to the straw fermentation substrate and mixed thoroughly. The mixture was then incubated at 30℃ and 180 r / min with shaking for 48 h. After fermentation, samples were collected and the corresponding indicators were measured.

[0166] (3) The reducing sugar content in fermented straw was determined by the 3,5-dinitrosalicylic acid method (DNS method);

[0167] (4) The amount of microorganisms in fermented straw was determined by dilution coating method;

[0168] (5) Take 1.0 g of fermentation sample, wash with ultrapure water, centrifuge at 12000 ×g for 10 min, collect the precipitate, repeat 3 times, dry the sample at 80℃ for 24 h, and use the Kjeldahl method to determine the crude protein content in fermented straw.

[0169] 2. Test Results

[0170] Figure 12 The figure shows the results of the functional verification of straw mixed sugar fermentation. Figure 12 (A) represents the reducing sugar content during the fermentation of mixed sugars from straw. Figure 12 (B) represents the difference in the amount of microbial cells fermenting mixed with straw and sugar. Figure 12 (C) represents the difference in crude protein content during fermentation of mixed sugars from straw.

[0171] Depend on Figure 12 (A) It can be seen that the reducing sugar content of the Con group was 49.76 mg / g, the reducing sugar content of the wild yeast hj01 group decreased significantly to 12.22 mg / g, and the reducing sugar content of the gene knockout yeast HJ01-ΔMig1 group decreased to 5.85 mg / g. The difference between hj01-ΔMig1 and hj01 was significant (P< 0.01). Figure 12 (B) indicates that the bacterial count in group hj01-ΔMig1 is 1.19 × 10⁻⁶. 8 The CFU / g ratio was significantly higher in group HJ01 than in group HJ01 (2.95 × 10⁻⁶). 7 CFU / g)(P < 0.001); Figure 12(C) shows that the crude protein content in the fermentation product was 0.092 g / g in group Con, increased to 0.165 g / g in group hj01, and increased to 0.200 g / g in group hj01-ΔMig1. The crude protein content in group HJ01-ΔMig1 was significantly higher than that in group hj01 (P < 0.01). These results indicate that the gene knockout strain hj01-ΔMig1 has a significantly better ability to utilize straw mixed sugars than its wild-type strain.

[0172] In summary, the gene knockout strain hj01-ΔMig1 constructed in this invention has a significantly better ability to utilize xylose and straw mixed sugars than the wild-type strain.

[0173] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various changes, modifications, substitutions and variations in form and detail to these embodiments without departing from the spirit and principles of the present invention. The scope of the present invention is defined by the claims and their equivalents.

Claims

1. A recombinant yeast strain, characterized in that, The recombinant yeast strain uses Saccharomyces cerevisiae as the substrate strain and is knocked out using genetic engineering technology. Mig1 Obtained through genes.

2. The recombinant yeast strain as described in claim 1, characterized in that, The brewing yeast is Saccharomyces cerevisiae (Saccharomyces cerevisiae). Saccharomyces cerevisiae hj01, deposited on January 26, 2026, deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 39135.

3. The recombinant yeast strain as described in claim 1, characterized in that, The genetic engineering technologies mentioned include CRISPR / Cas9 gene editing technology.

4. The method for constructing a recombinant yeast strain according to any one of claims 1-3, characterized in that, Using *Saccharomyces cerevisiae* as the chassis strain, CRISPR / Cas9 gene editing technology was used to knock out key molecules of glucose repression in the genome of the chassis strain. Mig1 Recombinant yeast was obtained.

5. The method for constructing a recombinant yeast strain as described in claim 4, characterized in that, The construction method includes the following steps: 1) Starting with strain hj01; 2) The Cas9-NAT plasmid was transformed into the starting strain to obtain the yeast hj01 containing Cas9-NAT; 3) Design Mig1 The target sequence SgRNA; 4) Construct a structure containing Mig1 Recombinant plasmids containing the target sequence SgRNA; 5) Take the product obtained in step 4) containing Mig1 The plasmid containing the target sequence SgRNA was transferred into yeast strain hj01 containing the Cas9-NAT plasmid in step 2), resulting in recombinant yeast strain — Mig1 Knockout strains 。 6. The method for constructing a recombinant yeast strain as described in claim 5, characterized in that, In step 4), the construction process is as follows: the SgRNA from step 3) is constructed into the p426-SNR52-sgRNA-TEF-Hygro plasmid using reverse PCR, resulting in a plasmid containing... Mig1 Recombinant plasmids containing the target sequence SgRNA.

7. The method for constructing a recombinant yeast strain as described in claim 5, characterized in that, In step 5), it also includes Mig1 Validation of the knockout strain.

8. The method for constructing a recombinant yeast strain as described in claim 5, characterized in that, It also includes step 6), removing the CRISPR / Cas9 dual plasmids from the knockout strain: using antibiotic-free culture passage to remove the Cas9-NAT and p426-SNR52-sgRNA-TEF-Hygro plasmids from the knockout strain cells.

9. The recombinant yeast as described in any one of claims 1-3, or the yeast obtained by the construction method as described in any one of claims 4-8. Mig1 Application of knockout strains in relieving glucose repression.

10. The recombinant yeast as described in any one of claims 1-3, or the yeast obtained by the construction method as described in any one of claims 4-8. Mig1 Application of knockout strains in the simultaneous utilization of glucose, xylose and / or straw mixed sugars.

Images