Application of a chicory cibhlh1 gene

Abstract

The application discloses an application of a chicory CibHLH1 gene and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the CibHLH1 gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2. The CibHLH1 gene is cloned from chicory, a plant overexpression vector thereof is constructed, and the chicory is transformed to obtain a transgenic plant. Experiments show that overexpression of the CibHLH1 gene can significantly up-regulate the expression of key enzyme genes in a sesquiterpene synthesis pathway and increase the accumulation amount of sesquiterpenes in chicory roots. The application provides a key gene and technical basis for cultivating a new chicory variety with high sesquiterpene content through transcription factor engineering.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and more specifically, relates to the application of the chicory CibHLH1 gene. Background Technology

[0002] Chicory is a perennial herbaceous plant belonging to the Asteraceae family, cultivated worldwide. Both its above-ground parts and roots possess medicinal properties, including anti-inflammatory, hepatoprotective, antioxidant, antibacterial, anticancer, and lipid-lowering effects. The main pharmacologically active components of chicory include sesquiterpenes, phenolic acids, flavonoids, and polysaccharides. Among these, sesquiterpenes have attracted widespread attention due to their sedative and antitumor effects. The entire process of chicory sesquiterpene biosynthesis involves the methyl erythritol 4-phosphate (MEP) and mevalonic acid (MVA) pathways jointly providing the precursor farnesyl pyrophosphate (FPP), which is cyclized to (+)-germacrene A under the catalysis of germacrene A synthase (GAS). (+)-Germacrene A is then oxidized to germacrene acid by germacrene A oxidase (GAO), and subsequently converted to (+)-costunolide via costunolide synthase (COS). (+)-Costunolide can be further converted to kauniolide by kauniolide synthase (KLS), while another unidentified enzyme catalyzes the conversion of costunolide to 11(S),13-dihydrocostunolide. Kauniolide and 11(S),13-dihydrocostunolide may further convert to currently undetected intermediates, which are crucial for the subsequent formation of guaianolide and dihydro-guaianolide-type sesquiterpene lactones by unidentified enzymes such as CYP450. The functional identification of members of the biosynthetic enzyme gene family, including CiKLSs, CiGASs, CiGAOs, and CiCOS, in chicory has been completed. However, the transcriptional regulatory network of these enzymes and the molecular mechanisms of sesquiterpene lactone biosynthesis in chicory are rarely reported.

[0003] Plant transcription factors can precisely regulate the initiation and efficiency of gene transcription by recognizing cis-acting elements on target gene promoters and binding to specific sequences, thereby regulating functions such as cell differentiation, tissue and organ development, metabolic networks, and responses to plant hormones and environmental factors. bHLH transcription factors play a crucial role in regulating plant growth and development as well as plant secondary metabolic biology. Currently, bHLH family transcription factors have been identified in model plants, but functional studies of bHLH transcription factors that specifically regulate chicory sesquiterpene synthesis and their expressed proteins have not yet been reported. Summary of the Invention

[0004] To address the aforementioned problems in the existing technology, the technical problem to be solved by this invention is to provide the chicory CibHLH1 gene. Another technical problem to be solved by this invention is to provide the expression protein of the chicory CibHLH1 gene. A further technical problem to be solved by this invention is to provide the application of the chicory CibHLH1 gene for regulating the synthesis of 8-deoxylactrin in plants.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0006] The application of a chicory CibHLH1 gene or a biological material containing the chicory CibHLH1 gene in increasing the content of chicory sesquiterpenes, wherein the biological material containing the chicory CibHLH1 gene is an expression cassette, recombinant vector, recombinant bacteria or recombinant cell containing the chicory CibHLH1 gene, and the nucleotide sequence of the chicory CibHLH1 gene is shown in SEQ ID NO.1.

[0007] In some embodiments, the sesquiterpene is 8-deoxylactrin.

[0008] A method for promoting the increase of chicory sesquiterpene content is to overexpress the chicory CibHLH1 gene in chicory, the nucleotide sequence of which is shown in SEQ ID NO.1, and the sesquiterpene is 8-deoxylactrin.

[0009] In some embodiments, the following steps are included:

[0010] S1: Construct the overexpression vector of the chicory CibHLH1 gene;

[0011] S2: Transform the constructed expression vector into chicory cells or tissues;

[0012] S3: Transgenic chicory with increased sesquiterpene content was obtained through breeding and screening.

[0013] In some embodiments, the overexpression vector is a plant expression vector.

[0014] In some embodiments, the transformation is mediated by Agrobacterium.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0016] 1) This invention constructs a plant expression vector of the chicory CibHLH1 gene and transforms it into chicory. After overexpressing the CibHLH1 gene, the transgenic chicory significantly increases the expression of key enzyme genes CiGAS1, CiKLS1 and CiCOS in the sesquiterpene synthase pathway, elucidating its regulatory mechanism at the transcriptional level.

[0017] 2) This invention constructs a protein expression vector for the chicory CibHLH1 gene, transforms it into competent E. coli BL21 cells, and obtains the His-tagged CibHLH1 protein after induction and purification. Gel migration arrest experiments demonstrate that the CibHLH1 protein can bind to the CACGTG cis-acting element with a biotin-labeled probe. This directly reveals the molecular mechanism by which chicory CibHLH1 acts as a transcription factor to regulate downstream target genes at the molecular interaction level.

[0018] 3) This invention, through genetic transformation technology, obtained chicory plants overexpressing CibHLH1, whose roots contained significantly higher sesquiterpene contents than the wild-type control. This demonstrates that by regulating a single key transcription factor, the accumulation of the target metabolite (8-deoxylactrin) can be effectively increased. This provides key genes and core technologies for the targeted improvement of chicory varieties and the cultivation of new industrial raw material varieties with high yields of 8-deoxylactrin (sesquiterpenes) through molecular breeding, and has excellent prospects for industrial application. Attached Figure Description

[0019] Figure 1 Images show the RNA extraction and CibHLH1 gene CDS clone electrophoresis detection. In the image, A is the RNA electrophoresis image (lane 1: root; lane 2: leaf; lane 3: stem; lane 4: flower); B is the CibHLH1 gene CDS clone electrophoresis detection image (M: DNA Marker; 1: full-length CibHLH1 gene CDS sequence).

[0020] Figure 2 The diagram shows the RNA level identification of CibHLH1 transgenic chicory positive lines. In the diagram, A is the PCR identification of the CibHLH1 gene in transgenic overexpressing plants; M: DNA Marker, transgenic lines 1-7; B is the PCR identification of the GFP gene tag in transgenic overexpressing plants; M: DNA Marker; 1-7: transgenic lines.

[0021] Figure 3This chart shows the changes in the expression levels of the OE3 / 6 / 7 genes and the content of 8-deoxylactrin in the CibHLH1 overexpressing chicory lines. Specifically, A is a statistical comparison of CibHLH1 gene expression between the empty vector and the overexpressing lines; B is a comparison of 8-deoxylactrin content between the empty vector and the overexpressing lines; and C is the analysis results of the expression levels of sesquiterpene biosynthetic pathway-related enzyme genes CibHLH1, CiGAS1, CiCOS1, and CiKLS1.

[0022] Figure 4 This is a dual-luciferase experiment; where A is the construction of the recombinant vector; B is the fluorescence imaging after tobacco injection and the relative expression abundance of firefly luciferase / renal luciferase.

[0023] Figure 5 This is a diagram of a yeast one-hybrid experiment. We analyzed the E-box and G-box cis-acting elements on the promoters of CiGAS1 and CiKLS1 synthase genes, constructed triplicate repeats of the promoter motif into the pLacZ vector, and analyzed the types of promoters that CibHLH1 binds to and the specific genes it regulates.

[0024] Figure 6 SDS-PAGE image of optimized conditions for CibHLH1 protein expression and purification;

[0025] Figure 7 The diagram shows the corresponding arrest bands generated when the CibHLH1 protein binds to the promoter of CiGAS1, a key enzyme gene in the sesquiterpene synthesis pathway. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is further described below with reference to specific embodiments. Unless otherwise specified, the technical means used in the following embodiments are all conventional means well known to those skilled in the art. The plant material used in this invention is chicory (Cichorium intybus L.), a plant of the genus Cichorium in the family Asteraceae, cultivated in the nursery of the Jiangsu Provincial Institute of Botany, Chinese Academy of Sciences, Xuanwu District, Nanjing City, Jiangsu Province.

[0027] Example 1

[0028] (1) Total RNA extraction and cDNA acquisition

[0029] Total RNA was extracted from different tissue parts (roots, leaves, stems, and flowers) of chicory using a plant tissue total RNA extraction kit (Sangon Biotech (Shanghai) Co., Ltd.). Figure 1 As shown in Figure A. Using extracted total RNA from leaves as a template, cDNA was synthesized using a cDNA one-strand synthesis kit (genomic de-generated) (Full Gold).

[0030] (2) Amplification of the CDS sequence of the chicory CibHLH1 gene

[0031] Based on the transcriptome sequence of the chicory CibHLH1 gene, the following primers were designed:

[0032] Forward: 5'-ATGGAGGATCTGATTGTCTCC-3' (SEQ ID NO.3);

[0033] Reverse: 5'-CTAGCGGTCTAATCCTAATG-3' (SEQ ID NO. 4).

[0034] The CDS sequence of the CibHLH1 gene was obtained by PCR, and the PCR amplification electrophoresis image is shown below. Figure 1 As shown in B.

[0035] The final sequencing yielded the CDS sequence of the CibHLH1 gene, as shown in SEQ ID NO.1, which is 1602 bp in length and encodes 533 amino acids, as shown in the sequence listing SEQ ID NO.2.

[0036] Example 2

[0037] 1. Construction of chicory CibHLH1 gene overexpression vector

[0038] Based on the CDS sequence of the CibHLH1 gene and the multiple cloning site of the overexpression vector pHellsgate8-GFP (XhoI was selected as the restriction site), amplification primers were designed, and the primer sequences are shown below:

[0039] Forward: 5'-TTTGGAGAGGACACGCTCGAGATGGAGGATCTGATTGTCTCC -3' (SEQ IDNO.5);

[0040] Reverse: 5'-GCTCACCATGAATTCCTCGAG CTAGCGGTCTAATCTCCTAATG -3' (SEQ ID NO. 6).

[0041] The target fragment of the CibHLH1 gene was amplified by PCR. The pHellsgate8-GFP vector was digested with XhoI at 37°C for 2 h. The PCR and digestion products were recovered using a gel extraction kit (Sangon Biotech (Shanghai) Co., Ltd.) to obtain the target fragment and the linearized vector fragment. The target fragment was ligated into the pHellsgate8-GFP linear vector using the ClonExpress II One Step Cloning Kit (Novizan) to construct a 35S::CibHLH1 overexpression vector. The ligation system is as follows:

[0042] 2 μL of 5× CE II buffer, approximately 200 ng of linearized vector, approximately 100 ng of insert fragment, 1 μL of Exnase II, and ddH2O to a final volume of 10 μL were added. The mixture was incubated at 37°C for 30 min and then immediately transferred to ice. After the *E. coli* DH5α competent cells thawed on ice, the recombinant product was added to the competent cells and mixed thoroughly. The cells were incubated on ice for 30 min, followed by heat shock at 42°C for 45 sec, and then cooled on ice for 5 min. 500 μL of LB medium was added, and the cells were incubated at 37°C with shaking for 1 h. The bacterial culture was then spread onto plates containing 100 mg / L spec+ and incubated upside down at 37°C for 12–16 h. Single colonies were validated using colony PCR. Positive colonies were picked and inoculated into LB liquid medium containing 100 mg / L spec+ and cultured at 200 rpm and 37°C for 24 h with shaking. Plasmids were extracted and digested for verification. After verification, sequencing was performed. The correctly sequenced vector was the 35S::CibHLH1 overexpression vector.

[0043] 2. Obtaining transgenic chicory lines using the root pruning method

[0044] Take 6-month-old chicory seedlings (non-sterile seedlings) cultivated at the base, leaving 5-8 tender leaves. Remove the soil, wash them with clean water, and set aside. Transform the constructed 35S::CibHLH1 recombinant plasmid into K599 Agrobacterium rhizogenes using the freeze-thaw method, using 100 mL of solution containing 50 mg·L⁻¹. -1 spec+ and 50 mg·L -1 Rifampicin LB liquid medium was cultured on a shaker at 28°C until the bacterial culture reached OD. 600Centrifuge the bacterial culture at 0.6-0.8 rpm for 5000 rpm, discard the supernatant, and resuspend the culture in an equal volume of MS salt containing AS. Cut chicory roots at a 45° angle to 5-10 cm and soak them in the above-mentioned Agrobacterium K599 containing recombinant plasmids for 15 min. Wipe dry with filter paper and place on moist vermiculite. Cover with a filter membrane (with holes for ventilation) for 1-2 weeks until callus or fibrous roots form, then transplant to seedling trays (soil:vermiculite = 3:1). After 4-6 weeks of routine management, use a portable fluorescent protein excitation light source LUYOR-3415RG to perform preliminary fluorescence identification of the formed fibrous roots. If the identification is successful, cut the fibrous roots (above 2.0 cm) and place them on moist vermiculite to continue growing until new leaves and complete plants form (4-6 weeks).

[0045] 3. Screening and identification of positive plants

[0046] The intact plants initially screened were further subjected to molecular identification. Positive lines were screened by PCR, and the 35S+CibHLH1 gene and GFP gene were identified. Figure 2 As shown, where, Figure 2 In Figure A, the PCR identification of the 35S+CibHLH1 gene in transgenic overexpressing plants was performed using cDNA as a template and 35S-F and CibHLH1R as primers (no specific band was observed in the control line). Figure 2 In section B, PCR identification of the GFP gene tag in transgenic overexpressing plants was performed using cDNA as a template and GFP-F and GFP-R as primers for amplification. Wild-type chicory was used as a negative control, and β-Actin was used as an internal reference gene. The expression level of the CibHLH1 gene in the transgenic lines was analyzed using qRT-PCR. Figure 3 As shown in Figure A, the expression levels of the overexpression line OE7 were all more than 10 times that of the control. All overexpression lines were used for subsequent content determination.

[0047] 4. Analysis of the effects of CibHLH1 gene overexpression on chicory sesquiterpene content and gene expression levels

[0048] The contents of seven sesquiterpenes (cichorioside B, 11β,13-dihydrolactucin, lactucin, crepidiaside B, 8-Deoxylactucin, jacquilenin, and lactucopicrin) were determined using the CibHLH1 overexpression line OE3 / 6 / 7. An Ultimate 3000 HPLC system was used, employing an ODS-AQ column (YMC-Pack, 4.6 × 250 mm, 5 μm, 12 nm) at a flow rate of 1.0 mL / min, an absorption wavelength of 254 nm (UV detector), and a column temperature of 25℃. Mobile phase A was acetonitrile solution, and mobile phase B was 0.34% phosphoric acid solution. The separation gradient mobile phase B was as follows: 90%–60% for 0–40 min; 60%–50% for 40–45 min; 50%–40% for 45–50 min; 40%–10% for 50–52 min; 10%–10% for 52–57 min; 10%–90% for 57–60 min; and 90% for 60–65 min. Three biological replicates were taken for each sample, and the results were compared with the above seven standards. Peak times were compared, and the results showed that the content of 8-deoxylactucin in the overexpressing plants was significantly higher than that in the empty vector control line, while the differences in other compounds were not significant. Figure 3 (Figure B) indicates that overexpression of CibHLH1 can promote the accumulation of 8-deoxylactrin, demonstrating the regulatory role of CibHLH1 in the biosynthesis of 8-deoxylactrin.

[0049] In the CibHLH1-OE7 overexpression line, the relative expression levels of three candidate chicory sesquiterpene biosynthesis pathway-related enzyme genes were analyzed by qRT-PCR. The results showed that ( Figure 3 In the overexpression lines, the expression levels of sesquiterpene biosynthetic enzyme genes: germacrene A synthase (CiGAS1) and kauniolide synthase (CiKLS1) were significantly increased compared to the empty vector control lines, indicating that overexpression of CibHLH1 may participate in the regulation of chicory sesquiterpene compound synthesis by regulating chicory sesquiterpene biosynthetic enzyme genes.

[0050] Example 3

[0051] First, Agrobacterium GV3101 was transformed using the CibHLH1-GFP expression vector. Simultaneously, the promoters of the germarene A synthase (CiGAS1), kauniolide synthase (CiKLS1), and costunolide synthase (CiCOS1) genes were cloned based on genomic data. Analysis using PlantCARE software revealed multiple E-boxes and G-boxes. Homologous recombination of the promoter sequences was performed and ligated into the pGREEN0800 vector. The GFP vector and pGREEN0800-rec vector were co-transformed into GV3101 cells with pSoup19, and cultured overnight to OD. 600 =1.0.2 mL. After mixing thoroughly, the mixture was left to stand in the dark for 2 hours and then injected into the underside of 8-week-old tobacco leaves. After culturing in the dark for 2-3 days, the Dual-LUC kit was used for analysis (the LUC / REN (firefly luciferase / renal luciferase) ratio was measured to assess gene expression levels, with an empty vector as a control; each experimental group was repeated three times). Observation was performed using a Tianneng imaging system. The results showed that CibHLH1 significantly promoted the expression of CiGAS1 and CiKLS1 genes. Figure 4 ).

[0052] It is known that members of the bHLH family can bind to multiple cis-acting elements such as E-box (CANNTG, including CACGTG, CAAATG, CATTTG, etc.). Therefore, CANTG was tandemly linked to a linearized pLacZ vector using three tandem repeats (insertion fragment analysis was performed via sequencing). Simultaneously, CibHLH1 was ligated to the pB42AD vector. Both vectors were co-transformed into the EGY48 yeast strain, and positive clones were selected using SD / -Ura / -Trp. Subsequently, the culture was transferred to SD / -Ura / -Trp + X-gal medium for colorimetric reaction, with each reaction repeated six times. Results showed that CibHLH1 can effectively bind to CACGTG and CATTTG motifs (…). Figure 5 Furthermore, a large number of E-box motifs were also found on the promoters of CiGAS1 and CiKLS1 genes, suggesting that CibHLH1 may affect the expression of functional genes by binding to cis-acting elements on the promoters of CiGAS1 and CiKLS1 genes.

[0053] Example 4

[0054] The CibHLH1 gene sequence was constructed into a His-tagged pCold(EcoRI) vector using homologous recombination to obtain the His-CibHLH1 recombinant vector. This recombinant vector was transformed into competent E. coli BL21(DE3) cells, and positive clones were screened after sequencing. Positive clones were picked and cultured overnight at 37°C in 20 mL of LB broth containing 100 mg / L Amp+. The culture was then transferred to a 1000 mL Erlenmeyer flask, and 400 mL of LB (Amp+) broth was added. The culture was then incubated for another 4 mL and the culture was continued at 37°C until OD was reached. 600 =0.4-0.6, take 2 mL as the pre-induction sample; add 400 μL 0.2M IPTG to the bacterial culture and incubate at 16 ℃ and 100 rpm for 18-20 h, take 2 mL as the post-induction sample; centrifuge at 8000 rpm and 4 ℃ for 10 min to collect the bacterial culture; resuspend the bacterial cells in 80 mL PBS buffer, centrifuge at 8000 rpm and 4 ℃ for 10 min, and discard the supernatant; continue to resuspend the bacterial cells in 80 mL PBS buffer, add 100 mM PMSF (working concentration is 1 mM), and vortex to mix; sonicate the bacterial cells (power 35%, 45 min) until clear; centrifuge at 12000 rpm and 4 ℃ for 20 min, and discard the precipitate. Add the supernatant solution to a Ni-NTA purification column (pre-equilibrated with two column volumes of 10 mM imidazole buffer), adjust the flow rate, and collect the flow-through. Add two column volumes of 10 mM imidazole buffer to the chromatography column to remove contaminating proteins. Elute sequentially with imidazole buffer (PBS as the stock solution) at concentrations of 25 mM, 50 mM, 75 mM, 100 mM, 150 mM, 200 mM, and 250 mM, adding 14 mL of each concentration. Collect the eluent in a 2 mL centrifuge tube. Analyze the protein before and after purification using SDS-PAGE. Figure 6 ).

[0055] The purified His-CibHLH1 protein was used to perform a gel migration assay to detect the interaction between CibHLH1 and proCiGAS1. The results showed that the probe could bind to His-CibHLH1 protein and produce a corresponding blocking band, indicating that CibHLH1 can bind to proCiGAS1 in vitro. Figure 7 This confirms at the molecular level that the upregulation of CiGAS1, a key gene for chicory sesquiterpene synthesis, in transgenic lines is directly regulated by increased levels of the CibHLH1 protein.

[0056] The above description is illustrative only and not restrictive of the present invention. Those skilled in the art will understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all such modifications, variations or equivalents will fall within the protection scope of the present invention.

Claims

1. The application of a chicory CibHLH1 gene or a biological material containing the chicory CibHLH1 gene in increasing the content of chicory 8-deoxylactone, characterized in that, The application is achieved by overexpressing the chicory CibHLH1 gene in chicory; the biological material containing the chicory CibHLH1 gene is an expression cassette, recombinant vector, recombinant bacteria or recombinant cell containing the chicory CibHLH1 gene and used for overexpressing the chicory CibHLH1 gene, and the nucleotide sequence of the chicory CibHLH1 gene is shown in SEQ ID NO.

1.

2. A method for promoting the increase of 8-deoxylactone content in chicory, characterized in that, The chicory CibHLH1 gene is overexpressed in chicory, and the nucleotide sequence of the chicory CibHLH1 gene is shown in SEQ ID NO.

1.

3. The method according to claim 2, characterized in that, Includes the following steps: S1: Construct the overexpression vector of the chicory CibHLH1 gene; S2: Transform the constructed expression vector into chicory cells or tissues; S3: Transgenic chicory with increased sesquiterpene content was obtained through breeding and screening.

4. The method according to claim 3, characterized in that, The overexpression vector is a plant expression vector.

5. The method according to claim 3, characterized in that, The transformation was mediated by Agrobacterium.

Images