Genetically engineered coryneform bacteria for producing porphyrin-334 and use thereof
By constructing genetically engineered strains in Corynebacterium glutamicum, knocking out competing pathway genes and overexpressing key enzyme genes, the problem of low production efficiency of Porphyra-334 was solved, enabling large-scale production at high efficiency and low cost.
Patent Information
- Application Number
- CN202610809940.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-05
- Publication Date
- 2026-08-25
AI Technical Summary
Existing technologies make it difficult to produce the spore-like amino acid Porphyra-334 efficiently and at low cost, especially due to the lack of systematic genetic engineering strategies in Corynebacterium glutamicum, which limits its large-scale and stable supply.
By knocking out competing pathway genes in Corynebacterium glutamicum and overexpressing key enzyme genes on plasmids, a genetically engineered strain was constructed. Porphyra-334 was accumulated in Corynebacterium glutamicum using synthase genes from Nostoc linnyi, including knocking out threonine dehydratase and pyruvate dehydrogenase genes, thus achieving efficient synthesis of Porphyra-334.
Porphyra-334 accumulation reached 1.23 g/L in shake flasks and 7.08 g/L in a 50 L fermenter, significantly increasing yield and reducing production costs.
Smart Images

Figure FT_1
Abstract
Description
Technical Field
[0001] This invention relates to a genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid Porphyra-334 and its applications, belonging to the field of microbial metabolic genetic engineering. Background Technology
[0002] Mycosporine-like amino acids (MAAs) are a class of bioactive natural compounds with ultraviolet (UV) absorption capabilities, widely found in marine organisms, algae, and certain bacteria. Porphyra-334 (also written as porphyra-334, or simply P-334) is a typical MAAs and is one of the most thoroughly studied and promising water-soluble natural UV-protective small molecules in nature. It was first systematically identified and named in the marine red algae genus *Porphyra*, hence its name. Porphyra-334 possesses characteristic strong UV absorption, good photostability, and certain antioxidant activity, and is considered a new generation of natural "biological sunscreen factors" and photoprotective functional ingredients, with significant application value in sunscreen cosmetics, medical skin protection, functional foods, and plant photoprotection.
[0003] Porphyra-334 is a typical MAAs (Magnetic Acids) with a conjugated cyclic backbone centered on cyclohexenone / imidazolinone. Its structure can be viewed as a condensation of two amino acid residues on a mycosporine core, forming a highly polar, water-soluble molecule. Porphyra-334 can be obtained from natural algae, through chemical synthesis, and through microbial cell synthesis. Extracting Porphyra-334 from seaweed or microalgae involves numerous extraction and purification steps, requiring large amounts of organic solvents and adsorbents, resulting in high energy consumption and labor costs. Porphyra-334 can be synthesized by gradually building its cyclic backbone from simple small molecules and adding amino acid side chains through organic synthesis strategies. However, practical chemical synthesis faces challenges due to the complex structure of the cyclohexenone / imidazolinone conjugated backbone, requiring multi-step functional group introduction and stereochemical control. The overall route is long and costly, making it difficult to compete economically with microbial fermentation methods. While Porphyra-334, as a marine-derived natural UV-protective molecule, is attracting increasing attention in the market, its large-scale, stable supply remains limited by the aforementioned technological bottlenecks. With the development of synthetic biology, the introduction of exogenous genes and the acquisition of target products through expanded fermentation accumulation have made the synthesis of Porphyra-334 via microbial metabolism a promising and effective method.
[0004] Corynebacterium glutamicum is one of the core substrate bacteria for the industrial production of major amino acids (such as glutamic acid and lysine) globally, possessing advantages such as safety, mature fermentation processes, and convenient genetic manipulation. Introducing and optimizing the biosynthetic pathway of Porphyra-334 into Corynebacterium glutamicum to construct a genetically engineered cell factory capable of efficiently synthesizing Porphyra-334 holds promise for establishing a large-scale, low-cost production pathway for Porphyra-334, representing an important technological direction at the intersection of synthetic biology and industrial biotechnology. However, existing publicly available technologies mainly focus on physiological studies of the natural production of Porphyra-334 in algae and conceptual expression in laboratory hosts such as Escherichia coli, lacking systematic genetic engineering strategies for industrial substrate bacteria, especially Corynebacterium glutamicum, and complete solutions for their specific applications. Summary of the Invention
[0005] To address the challenges of obtaining Porphyra-334 naturally and the resulting low yields, this invention utilizes microbial metabolic genetic engineering to produce Porphyra-334. Producing Porphyra-334 using Corynebacterium glutamicum is a highly efficient and environmentally friendly method.
[0006] This invention provides a genetically engineered Corynebacterium glutamicum that produces Porphyra-334. Using Corynebacterium glutamicum ATCC 13032 as the host strain, the invention achieves the accumulation of Porphyra-334 by knocking out competing pathway genes, copying multiple copies of key synthase genes for Porphyra-334 from Nostoc linckia NIES-25 at multiple sites in the genome, knocking out acid production pathway genes and threonine dehydratase genes in the strain, and overexpressing key enzyme genes on plasmids.
[0007] Preferably, this invention provides a recombinant genetically engineered bacterium that produces Porphyra-334. Using *Corynebacterium glutamicum* ATCC 13032 as the starting strain, the 3-dehydroquinanate synthase gene (NlmysA), O-methyltransferase gene (NlmysB), ATP-grasp ligase gene (NlmysC), and D-alanine-D-alanine ligase gene (NlmysD) from *Nostoc linckia* NIES-25 are ligated into a gene cluster using RBS (CK1) and cloned into the pEC-XK99E plasmid. A competing pathway gene, tal, is knocked out, and a strong constitutive promoter P is used. tufThe key enzyme gene clusters mentioned above were activated and integrated into the genome at multiple chromosomal copies at the Cgl1036, lldA, nagB, and ppc sites. The threonine dehydratase genes ilvA and Cgl0978, pyruvate dehydrogenase gene poxB, and phosphorylacetyltransferase gene pta were knocked out of the *Corynebacterium glutamicum* genome to achieve efficient accumulation of Porphyra-334 in *Corynebacterium glutamicum*. After these modifications, the genetically engineered strain produced Porphyra-334 in shake flasks, accumulating 1.23 g / L in 72 h. Scale-up culture in a 50 L fed-batch fermenter ultimately reached 7.08 g / L.
[0008] The first objective of this invention is to provide plasmids that can efficiently express the genes NlmysA, NlmysB, NlmysC, and NlmysD.
[0009] In one implementation, the pEC-XK99E plasmid is used as the expression vector;
[0010] In one embodiment, genes NlmysA, NlmysB, NlmysC, and NlmysD are linked into a gene cluster via RBS and constructed onto the pEC-XK99E plasmid to obtain the recombinant plasmid pEC-XK99E-NlmysABCD.
[0011] A second objective of this invention is to provide a genetically engineered *Corynebacterium glutamicum* strain that synthesizes Porphyra-334. This strain integrates the NlmysA, NlmysB, NlmysC, and NlmysD gene clusters from *Nostoclinckia* NIES-25 at the genomic nagB and ppc sites, respectively. The *Corynebacterium glutamicum* also knocks out two threonine dehydratase genes, ilvA and Cgl0978; and knocks out the pyruvate dehydrogenase gene poxB and the phosphoacetyltransferase gene pta, thereby achieving further accumulation of Porphyra-334.
[0012] In one embodiment, the 3-dehydroquinanate synthase gene (NlmysA) is derived from *Nostoclinckia* NIES-25, and its encoded amino acid sequence is shown in SEQ ID NO.1, and its nucleotide sequence is shown in SEQ ID NO.7, powered by a strong constitutive promoter P. tuf Start the expression.
[0013] In one embodiment, the O-methyltransferase gene (NlmysB) is derived from *Nostoclinckia* NIES-25, and its encoded amino acid sequence is shown in SEQ ID NO.2, and its nucleotide sequence is shown in SEQ ID NO.8, powered by a strong constitutive promoter P. tuf Start the expression.
[0014] In one embodiment, the ATP-grasp ligase gene (NlmysC) is derived from *Nostoclinckia* NIES-25, and its encoded amino acid sequence is shown in SEQ ID NO.3, and its nucleotide sequence is shown in SEQ ID NO.9, powered by a strong constitutive promoter P. tuf Start the expression.
[0015] In one embodiment, the D-alanine-D-alanine ligase gene (NlmysD) is derived from *Nostoc linckia* NIES-25, and its encoded amino acid sequence is shown in SEQ ID NO.4, and its nucleotide sequence is shown in SEQ ID NO.10, with a strong constitutive promoter P. tuf Start the expression.
[0016] In one implementation, the strongly constitutive promoter P tuf It is an endogenous promoter of Corynebacterium glutamicum, and its nucleotide sequence is shown in SEQ ID NO.5.
[0017] In one embodiment, the RBS used to link the key enzyme gene is a universal RBS of Corynebacterium glutamicum, namely CK1, and the CK1 gene sequence is shown in SEQ ID NO.6.
[0018] In one embodiment, the NCBI sequence number of the threonine dehydratase gene ilvA is BAB99520.
[0019] In one embodiment, the NCBI sequence number of the threonine dehydratase gene Cgl0978 is BAB98371.
[0020] In one embodiment, the NCBI sequence number of the pyruvate dehydrogenase gene poxB is BAC00004.
[0021] In one embodiment, the NCBI sequence number of the phosphorylated acetyltransferase gene pta is BAC00147.
[0022] In one embodiment, the Corynebacterium glutamicum includes, but is not limited to, Corynebacterium glutamicum ATCC 13032.
[0023] A third objective of this invention is to provide a method for producing the spore-like amino acid Porphyra-334, wherein the method utilizes the genetically engineered Corynebacterium glutamicum to produce the spore-like amino acid Porphyra-334 through fermentation.
[0024] In one embodiment, Corynebacterium glutamicum is routinely cultured in BHIS medium at 30 °C and 220 rpm for 16–18 h.
[0025] In one embodiment, *Corynebacterium glutamicum* is fermented and cultured in a modified CGXII culture medium containing 40 g / L glucose, 5 g / L yeast extract, 5 g / L corn steep liquor, 20 g / L ammonium sulfate, 10 g / L urea, 1 g / L potassium dihydrogen phosphate, 1.0 g / L dipotassium hydrogen phosphate, 42 g / L 3-morpholinopropanesulfonic acid, and trace metal elements. The trace metal elements include: 250 mg / L magnesium sulfate heptahydrate, 10 mg / L ferrous sulfate heptahydrate, 10 mg / L manganese sulfate monohydrate, 1 mg / L zinc sulfate heptahydrate, 0.2 g / L anhydrous copper sulfate, 0.02 mg / L nickel chloride hexahydrate, 0.2 mg / L biotin, 10 mg / L calcium chloride, 30 mg / L protocatechuic acid, and 0.1 mg / L vitamin B1.
[0026] Shake flasks at 30 °C and incubate until OD. 600 =1.0±0.1, add IPTG to a final concentration of 0.8~1.2 mM, and continue induction culture at 30°C and 220 rpm for no less than 72 h;
[0027] The fermenter was operated at 30 °C, with a stirring speed of 200-800 r / min, an aeration rate of 2-6 vvm, and a pH of 7.0±0.2, until fermentation reached OD. 600 When the concentration is 15±0.5, add IPTG to a final concentration of 0.8~1.2mM and induce culture at 30 °C for no less than 72 h. If necessary, add antibiotics of appropriate concentration.
[0028] More preferably, the induction culture in the fermenter system shall be no less than 72 h.
[0029] In one embodiment, during the reaction, a mother liquor concentration of 500 g / L glucose is added to maintain its final concentration at 10-15 g / L, while 50% ammonia is added to bring the pH of the entire system to 7.0, thereby maintaining the production of the product Porphyra-334.
[0030] Preferably, when the glucose concentration in the reaction system is below 10 g / L, glucose is added at once to a final concentration of 10 g / L to ensure sufficient energy and normal cell growth, thereby promoting the continuous production of Porphyra-334.
[0031] In one embodiment, glucose is used as the carbon source to efficiently produce the spore-like amino acid Porphyra-334 using an exogenous gene derived from Nostoc linckia NIES-25.
[0032] The fourth objective of this invention is to provide the application of the genetically engineered Corynebacterium glutamicum in the preparation of the spore-like amino acid Porphyra-334.
[0033] The fifth objective of this invention is to provide the application of the genetically engineered Corynebacterium glutamicum in the fields of food, cosmetics, pharmaceutical development, and biomaterials.
[0034] The beneficial effects of this invention are:
[0035] This invention uses *Corynebacterium glutamicum* ATCC 13032 as the starting strain. By expressing and overexpressing the exogenous gene for synthesizing *Porphyra-334* derived from *Nostoc linnsis* on a plasmid, the resulting *Corynebacterium glutamicum* strain accumulated to 1.23 g / L in shake flasks after 72 hours. Scale-up culture in a 50 L fed-batch fermenter ultimately reached 7.08 g / L. Attached Figure Description
[0036] Figure 1 This is a schematic diagram of plasmid pEC-XK99E-NImysABCD. Detailed Implementation
[0037] 1. The plasmids, restriction enzymes, PCR enzymes, column DNA extraction kits, and DNA gel recovery kits used in the following examples are commercial products. The specific operations should be performed in accordance with the kit instructions.
[0038] 2. Routine procedures such as colony PCR, nucleic acid agarose gel electrophoresis, heat shock transformation, preparation of competent cells, and extraction and preservation of bacterial genomes were performed according to Molecular Cloning: A Laboratory Manual (Fourth Edition).
[0039] 3. The sequencing of plasmids and DNA products was completed by Shanghai Sangon Biotech Co., Ltd.
[0040] 4. Preparation of competent Escherichia coli cells: TAKARA kit.
[0041] 5. Reference for the preparation of competent cells of Corynebacterium glutamicum: Jiang, Y., Qian, F., Yang, J. et al. CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. NatCommun 8, 15179 (2017).
[0042] 6. Fermentation process and detection of Porphyra-334, a spore-like amino acid:
[0043] (1) BHIS liquid culture medium: BHI 37 g / L, D-sorbitol 91 g / L.
[0044] (2) BHIS solid medium: BHI 37 g / L, D-sorbitol 91 g / L, 15 g / L agar powder.
[0045] (3) Fermentation medium: 40 g / L glucose, 5 g / L yeast extract, 5 g / L corn steep liquor, 20 g / L ammonium sulfate, 10 g / L urea, 1 g / L potassium dihydrogen phosphate, 1.0 g / L dipotassium hydrogen phosphate, 42 g / L 3-morpholinopropanesulfonic acid and trace metal elements; the trace metal elements include: 250 mg / L magnesium sulfate heptahydrate, 10 mg / L ferrous sulfate heptahydrate, 10 mg / L manganese sulfate monohydrate, 1 mg / L zinc sulfate heptahydrate, 0.2 g / L anhydrous copper sulfate, 0.02 mg / L nickel chloride hexahydrate, 0.2 mg / L biotin, 10 mg / L calcium chloride, 30 mg / L protocatechuic acid, and 0.1 mg / L vitamin B1. When adding the plasmid for expression, kanamycin at a final concentration of 25 μg / mL and IPTG at a final concentration of 0.8~1.2 mM should be added to induce plasmid activity.
[0046] (4) Fermentation process for producing the spore-like amino acid Porphyra-334: The genetically engineered strain was inoculated into BHIS liquid medium, and kanamycin was added to a final concentration of 25 μg / mL. The culture was carried out overnight at 30 °C and 220 rpm for 16-18 h to obtain the seed culture. 2 mL of the seed culture was inoculated into 50 mL of fermentation medium and cultured at 30 °C and 220 rpm until the OD reached the target concentration. 600 =1.0±0.1, add IPTG to a final concentration of 0.9 mM, and continue induction culture at 30 °C and 220 rpm for 72 h. Take 1 mL of fermentation broth, centrifuge at 10,000 rpm for 10 min, collect the supernatant, and use it for HPLC analysis.
[0047] (5) HPLC detection conditions: High performance liquid chromatography (HPLC) system (Agilent); chromatographic column: ZORBAX Eclipse Plus C18; detector: Agilent UV detector; UV absorption wavelength: 310 nm; mobile phase: 0.25% formic acid aqueous solution; flow rate: 0.65 mL / min; column temperature: 35 °C; injection volume: 10 μL.
[0048] Example 1: Construction of expression plasmid pEC-XK99E-NlmysABCD
[0049] The genes NlmysA, NlmysB, NlmysC, and NlmysD were synthesized by a biotechnology company (Shanghai Diwin Biotechnology Co., Ltd.) according to the amino acid sequence on NCBI and cloned into the multiple cloning site of the vector pEC-XK99E, thereby obtaining the plasmid pEC-XK99E-NlmysA-NlmysB-NlmysC-NlmysD, hereinafter referred to as pEC-XK99E-NlmysABCD.
[0050] Example 2: Construction of genetically engineered strains of Corynebacterium glutamicum
[0051] The specific steps for constructing gene-editing plasmids and genetically engineered strains are as follows, taking ilvA knockout as an example. (The primer sequences involved in genome construction are shown in Table 1):
[0052] The gene ilvA, encoding threonine dehydratase, was knocked out in Corynebacterium glutamicum ATCC 13032 using a SacB-assisted CRISPR-FnCpf1 gene editing system. For the CRISPR / Cpf1 gene editing system, please refer to Zhang, J., et al. (2020). De Novo Engineering of Corynebacterium glutamicum for l-Proline Production. ACS Synthetic Biology. 9(7): 1897–1906.
[0053] The specific steps are as follows:
[0054] (1) Constructing plasmid pK18mobsacB-spec-ΔilvA
[0055] The ilvA gene was knocked out. Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, upstream and downstream fragments of the ilvA gene were amplified by PCR using ilvA-UH / DH-F / R primers (Table 1), and the fragments were then purified by gel extraction. Using pK18-F / pK18-R primers, the vector fragment was amplified using plasmid pK18mobsacB-spec as a template, and the fragment was purified by gel extraction. Homologous recombination was used at 50 °C for 30 min. The plasmid was chemically transformed into DH5α, and after successful culture, bacterial selection, plasmid extraction, and sequencing verification, the gene-editing plasmid pK18mobsacB-spec-ΔilvA was obtained for ilvA gene knockout.
[0056] (2) Constructing genetically engineered strains of Corynebacterium glutamicum
[0057] The constructed gene-editing plasmid was transformed into *Corynebacterium glutamicum* via electroporation at a concentration of 800–1000 ng, at 25 μF, 200 Ω, and 2.5 kV. The transformed strains were plated on spectinomycin-resistant BHIS plates. Single-crossover mutants were selected, and individual colonies of each mutant were cultured in BHIS medium for 16 h. Once single colonies appeared, the strains were picked and cultured overnight in test tubes to create competent cells. The constructed pJYS3-ilvA-N23 plasmid was then transformed into competent cells via electroporation. The cells were heat-shocked at 46 °C for 6 min, incubated on a shaker at 30 °C for 2 h, and plated onto BHIS plates containing kanamycin and sucrose. The plates were then incubated at 30 °C until single colonies appeared. Successfully grown single colonies were identified as double-crossover mutants. Colony PCR was used to verify the correct gene editing, and the cells were then sent to a sequencing company for further confirmation of gene integration. The successfully validated strains were inoculated into test tubes containing BHIS medium and cultured overnight at 34 °C to remove plasmids. The plasmids were then streaked onto BHIG agar plates containing kanamycin to screen for plasmid-free strains, ultimately yielding plasmid-free, antibiotic-free Corynebacterium glutamicum strains for use in the next round of editing or for fermentation validation.
[0058] (3) Constructing genetically engineered Corynebacterium glutamicum containing plasmids
[0059] The genetically engineered strain with successfully edited genes was prepared as an electroporation competent state. pEC-XK99E-NlmysABCD was transferred into the genetically engineered strain that had been successfully constructed by electroporation, as described in (2). Then, it was spread on a BHIS agar plate containing kanamycin resistance. After colonies grew, genetically engineered Corynebacterium glutamicum containing plasmid pEC-XK99E-NlmysABCD was obtained for the next round of fermentation verification and for the fermentation production of Porphyra-334.
[0060] Table 1 Primers used for plasmid and genome construction
[0061] tal-UH-F GACATGATTACGAATTCGGTATCCGTGAGCACGCTATG tal-UH-R CGTGCTGATTGTGCAAGATCATCAATGTGAGAC tal-DH-F GATCTTGCACAATCAGCACGCTGCATCAGTAACG tal-DH-R GCCAGTGCCAAGCTTGCACGAAAGAAATTGGTTCTTCCAT Cgl1036-UH-F GACATGATTACGAATTCCGCATGCAATTGCATCAGCGGAT Cgl1036-UH-R CGGATCTAAACGATCTCCACTCTTCTGCGCCCGTCACACG Cgl1036-DH-F GGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCGGTGACGTCCATCTCGAG Cgl1036-DH-R GCCAGTGCCAAGCTTCGCAAGTGGATTCTCCACCTTCTG NlmysA-F CCAGGAGGACATACAATGTCAATAGTACAGACAAAACTACAAG NlmysD-R ACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTAAATCATTTGGCTCAACTC lldA-UH-F CTATGACATGATTACGAATTCCAACGCCATCGGCATTTGGGCACC lldA-UH-R CTTCGGATCTAAACGATCTGGGTGGTTCCTTTCGGAGGG lldA-DH-F GGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATAAGTTTCTCTCCTTAGCTATT lldA-DH-R CCAGTGCCAAGCTTGTCCTAGGTGGGATGCGAGGNAGB-UH-FNAGB-UH-F tal-N23-F CGCCATGAGCATCGACGACGTTCATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC tal-N23-R GAACGTCGTCGATGCTCATGGCGATCTACAACAGTAGAAATTCGGATCCATTAT Cgl1036-N23-F ATACTGCGTCAGCCTGGCGCTTGATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC Cgl1036-N23-R CTCCCTCGAAGAACTCGAGCCACATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC PK18-cx-F GAGTTAGCTCACTCATTAGGCACCCC PK18-cx-R GCGATTAAGTTGGGTAACGCC I'm B-UH-F GCTATGACATGATTACGAATTCCACGGTGGAAACGGTGGCGCGTTTCC I'm B-UH-R CTTCGGATCTAAACGATCTGGTCGGACTCCTTTTATTATCAGGAAAG nagB-DH-F GGTAGAGCTGGGCGGTGATTAAAACAAAAAGGAAAGTAGTGTGT nagB-DH-R CCAGTGCCAAGCTTGCACCCCATCCTTCCCGTGCAACTGTT ppc-UH-F CTATGACATGATTACGAATTCCGGGAAACTTTTTTAAGAAAGG ppc-UH-R GATCTAAACGATCTTAACTACTTTAAACACTCTTTCAC ppc-DH-F TAGAGCTGGGCGGTGATTAATCCAGCCGGCTGGGTAGTACTCG ppc-DH-R CCAGTGCCAAGCTTGAAGTATTCAAGGGGATTTCCGATAATTCCC NlmysA-F CCAGGAGGACATACAATGTCAATAGTACAGACAAAACTACAAG NlmysD-R ACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTGTTAAATCATTTGGCTCAACTC poxB-UH-F GACATGATTACGAATTCCGTTAATGAGGAAAACCGAACCC poxB-UH-R TATCAATCATCACTGAACTCCTCAACGTTATGGCTATTGTGT poxB-DH-F TGAGGAGTTCAGTGATGATTGATACACCTGCTGTTCTCATTG poxB-DH-R GACGGCCAGTGCCAAGCTTGGTACGGAAAGTGCCATCGCT pta-UH-F GACATGATTACGAATTCTCACCGACACCGGCGGTGAACAC pta-UH-R TTCAGGCTGAAATTAGAAAGGCGATGTTGGCATTGGCACTTG pta-DH-F GAGTTCAAAACAAGTGCCAATGCCAACATCGCCTTTCTAAT pta-DH-R CAGTGCCAAGCTTTTCGCCAAAATACGAGCAACGTCCAACG ilvA-UH-F GACATGATTACGAATTCTCGACGTTGATGCCAAACTGGG ilvA-UH-R TAACGCAGCACAGATGCGGCAACGATACC ilvA-DH-F GCCGCATCTGTGCTGCGTTATGCGGAAAT ilvA-DH-R GGCCAGTGCCAAGCTTCGCAACCACGGCCGCCCT Cgl0978-UH-F TGACATGATTACGAATTCTGTTGTCCCGGGAGCGAAAG Cgl0978-UH-R TAAGAGAGGCGAACTCTGCTTTGATCCAGATTTGTGTG Cgl0978-DH-F AAAGCAGAGTTCGCCTCTCTTACCAGTGGAGCATAC Cgl0978-DH-R GGCCAGTGCCAAGCTTTTCCGAGGTGCAATCGTTGACCTGCC pK18-F AAGCTTGGCACTGGCCGTCGTT pK18-R GAATTCGTAATCATGTCATAGCTGTTTCCTGTG
[0062] Example 3: Production of Porphyra-334, a spore-like amino acid, by shake-flask fermentation
[0063] Based on Example 2, the successfully constructed genetically engineered strain was subjected to shake-flask fermentation for verification, maintained at 30°C and 220 rpm throughout, and cultured until OD (Organic Degree) was reached. 600 =1.0±0.1, add IPTG to a final concentration of 0.9 mM. Sample after 72 h of fermentation. Take 1 mL of fermentation broth, centrifuge at 10,000 rpm for 10 min, collect the supernatant, and use it for HPLC analysis.
[0064] Based on the genetically engineered strain Cgp-05, two copies of the key enzyme gene were integrated to increase the expression level of the key enzyme gene. In shake-flask fermentation, Porphyra-334 accumulated 0.81 g / L (Cgp-06). Porphyra-334 production uses threonine as a substrate. To reduce threonine consumption in biosynthesis and allocate more to product production, the threonine dehydratase genes ilvA and Cgl0978 were knocked out from the genetically engineered strain Cgp-07, resulting in the genetically engineered strain Cgp-09, which yielded 1.06 g / L in shake-flask verification. To maintain a favorable growth environment for the strain, the acid production pathway genes ΔpoxB and Δpta were knocked out to prevent excessive acidity during fermentation. After knocking out these two acid production pathway genes, the product accumulated to 1.23 g / L. Detailed information on the shake-flask fermentation of the genetically engineered strains is shown in Table 2.
[0065] Table 2. Detailed information on shake-flask fermentation of genetically engineered strains
[0066] Strain name Host genotype and plasmids included Porphyra-334 yield (g / L) Cgp-05 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NlmysABCD ΔlldA::P tuf -NlmysABCD carrying plasmid pEC-XK99E-NlmysABCD]]> 0.63 Cgp-06 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NlmysABCD ΔlldA::P tuf -NlmysABCD ΔnagB:: P tuf -NlmysABCD carrying plasmid pEC-XK99E-NlmysABCD]]> 0.81 Cgp-07 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NlmysABCD ΔlldA::P tuf -NlmysABCD ΔnagB:: P tuf -NlmysABCD Δppc:: P tuf -NlmysABCD carrying plasmid pEC-XK99E-NlmysABCD]]> 0.94 Cgp-08 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NlmysABCD ΔlldA::P tuf -NlmysABCD ΔnagB:: P tuf -NlmysABCD Δppc:: P tuf -NlmysABCD ΔilvA carrying plasmid pEC-XK99E-NlmysABCD]]> 0.98 Cgp-09 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NlmysABCD ΔlldA::P tuf -NlmysABCD ΔnagB:: P tuf -NlmysABCD Δppc:: P tuf -NlmysABCD ΔilvA ΔCgl0978 carrying plasmid pEC-XK99E-NlmysABCD]]> 1.06 Cgp-10 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NlmysABCD ΔlldA::P tuf -NlmysABCD ΔnagB:: P tuf -NlmysABCD Δppc:: P tuf -NlmysABCD ΔilvA ΔCgl0978 ΔpoxB carrying plasmid pEC-XK99E-NlmysABCD]]> 1.12 Cgp-11 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NlmysABCD ΔlldA::P tuf -NlmysABCD ΔnagB:: P tuf -NlmysABCD Δppc:: P tuf -NlmysABCD ΔilvA ΔCgl0978 ΔpoxB Δpta carrying plasmid pEC-XK99E-NlmysABCD]]> 1.23
[0067] Example 4: Synthesis of Porphyra-334 by fed-batch culture in a fermenter
[0068] Fed-batch fermentation experiments were conducted on the genetically engineered strain Porphyra-334 in a 50 L fermenter.
[0069] The genetically engineered Corynebacterium glutamicum Cgp-11 constructed in Example 2 was inoculated into liquid BHIS medium containing kanamycin and cultured overnight at 30 °C and 220 rpm for 16–18 h to obtain a primary seed culture. The primary seed culture was then inoculated into a new fermentation system for further expansion culture at 30 °C and 220 rpm. 600 =1.0±0.1, to obtain secondary seed culture, which was then inoculated into a 50 L fermenter to achieve a final culture volume of 20 L for fermentation. Fermentation was carried out at 30 °C, with a stirring speed of 220 r / min, an aeration rate of 1~2 vvm, and a pH of 7.0±0.2, until OD reached. 600 When the concentration of Porphyra-334 reached 15 ± 0.5, IPTG was added to a final concentration of 0.9 mM, and the mixture was induced and cultured at 30 °C for 72 h. Dissolved oxygen was controlled by adjusting the stirring speed to 220 rpm and the aeration rate (2–6 vvm). During the reaction, 500 g / L glucose was added to maintain a final concentration of 10–15 g / L, and 50% ammonia was added to maintain the pH of the entire system at 7.0, thereby ensuring the production of Porphyra-334.
[0070] After 72 hours of fermentation, the yield of Porphyra-334 reached 7.08 g / L, a 5.75-fold increase compared to shake flask production, with an OD of [missing value]. 600 The highest reached 114.
[0071] The preferred embodiments of the present invention disclosed above are merely illustrative of the invention. These preferred embodiments do not exhaustively describe all details, nor do they limit the invention to the specific implementations described. Clearly, many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention. The invention is limited only by the claims and their full scope and equivalents.
Claims
1. A genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid Porphyra-334, characterized in that, Using Corynebacterium glutamicum ATCC 13032 as the host strain, a competing pathway gene tal was knocked out. The 3-dehydroquinanate synthase gene NlmysA, the O-methyltransferase gene NlmysB, the ATP-grasp ligase gene NlmysC, and the D-alanine-D-alanine ligase gene NlmysD from Nostoc linckia NIES-25 were heterologously expressed on the plasmid. The genes NlmysA, NlmysB, NlmysC, and NlmysD were integrated into the host genome. The acid production genes poxB and pta were knocked out, as were the two threonine dehydratase genes ilvA and Cgl0978.
2. A genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid Porphyra-334, characterized in that, Using Corynebacterium glutamicum ATCC 13032 as the host strain, the method for modifying the host strain is as follows: (1) Knock out the transaldolase gene tal; (2) Knock out the short-chain dehydrogenase gene Cgl1036 and replace it with a gene generated by the strong constitutive promoter P. tuf The gene cluster NlmysABCD, which initiates the expression of mycotoxin-like amino acid synthesis, comprises genes NlmysA, NlmysB, NlmysC, and NlmysD. (3) Knock out the putative L-lactate dehydrogenase gene lldA and replace it with one generated by a strong constitutive promoter P tuf Initiate expression of the spore-like amino acid synthesis gene cluster NlmysABCD; (4) Knock out the N-acetylglucosamine-6-phosphate isomerase gene nagB and replace it with a gene from the strongly constitutive promoter P. tuf Initiate expression of the spore-like amino acid synthesis gene cluster NlmysABCD; (5) The host strain contains the plasmid pEC-XK99E-NlmysABCD; The gene cluster NlmysABCD contains the 3-dehydroquinanate synthase gene NlmysA, the O-methyltransferase gene NlmysB, the ATP-grasp ligase gene NlmysC, and the D-alanine-D-alanine ligase gene NlmysD, all derived from Nostoc linckia NIES-25.
3. The genetically engineered Corynebacterium glutamicum for producing the spore-like amino acid Porphyra-334 according to claim 2, characterized in that, The modifications to the host strain also included: knocking out the phosphoenolpyruvate carboxylase gene ppc and replacing it with a gene from the strongly constitutive promoter P. tuf The gene cluster NlmysABCD, which initiates the expression of spore-like amino acid synthesis genes, is used.
4. The genetically engineered Corynebacterium glutamicum for producing the spore-like amino acid Porphyra-334 according to claim 3, characterized in that, The modification method also includes: knocking out the threonine dehydratase gene ilvA.
5. The genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid Porphyra-334 according to claim 4, is characterized in that, The modification method also includes: knocking out the threonine dehydratase gene Cgl0978.
6. The genetically engineered Corynebacterium glutamicum for producing the spore-like amino acid Porphyra-334 according to claim 5, characterized in that, The modification method also includes: knocking out the pyruvate dehydrogenase gene poxB.
7. The genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid Porphyra-334 according to claim 6, is characterized in that, The modification method also includes: knocking out the phosphorylacetyltransferase gene pta.
8. The genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid Porphyra-334 according to any one of claims 2-7, characterized in that: (1) The amino acid sequence encoded by the 3-dehydroquinanate synthase gene NlmysA is shown in SEQ ID NO. 1; (2) The amino acid sequence encoded by the O-methyltransferase gene NlmysB is shown in SEQ ID NO. 2; (3) The amino acid sequence encoded by the ATP-grasp ligase gene NlmysC is shown in SEQ ID NO. 3; (4) The amino acid sequence encoded by the D-alanine-D-alanine ligase gene NlmysD is shown in SEQ ID NO. 4; (5) The strongly constitutive promoter P tuf The nucleotide sequence is shown in SEQ ID NO.
5.
9. A method for constructing a genetically engineered Corynebacterium glutamicum to produce the spore-like amino acid Porphyra-334, characterized in that: The construction method includes modifying Corynebacterium glutamicum ATCC 13032 as described in any one of claims 2-8.
10. The use of the genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid Porphyra-334 as described in any one of claims 1-8, or the genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid Porphyra-334 constructed by the construction method described in claim 9, in the production of Porphyra-334.