Artificial micro rnas targeting huntington's disease

By designing artificial miRNA molecules that target HTT mRNA and delivering them to patients using an AAV vector, the lack of effective treatments for Huntington's disease has been addressed, resulting in significant improvements in quality of life and slowing disease progression.

CN122641682APending Publication Date: 2026-08-25GENZYME CORP
View PDF 14 Cites 0 Cited by

Patent Information

Application Number
CN202580011727.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-01-26
Filing Date
2025-01-24
Publication Date
2026-08-25

AI Technical Summary

Technical Problem

Currently, there is a lack of effective disease-modifying treatments to alleviate the neurodegeneration and cognitive impairment associated with Huntington's disease (HD), a fatal single-gene genetic disorder caused by the amplification of a trinucleotide repeat sequence in exon 1 of a gene.

Method used

We developed artificial microRNA (miRNA) molecules that target human HTT mRNA. By designing double strands with highly identical or complementary guide and non-guide regions, we aimed to reduce HTT protein expression and delivered them to patients using an AAV vector.

Benefits of technology

It significantly improves patients' quality of life and slows the progression of Huntington's disease, offering broad commercial applicability and therapeutic potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

Provided herein are artificial miRNA molecules for treating Huntington's Disease (HD). In some embodiments, these artificial miRNA molecules target the expression of the HTT protein. Further provided herein are expression constructs, vectors (e.g., rAAV), cells, viral particles, and pharmaceutical compositions capable of expressing these artificial miRNA molecules. Still further provided herein are methods and kits related to the use of these artificial miRNA molecules, e.g., for treating HD.
Need to check novelty before this filing date? Find Prior Art

Description

Cross-references to related applications

[0001] This application claims priority to U.S. Provisional Application No. 63 / 625,838, filed January 26, 2024, which is incorporated herein by reference in its entirety. Reference to electronic sequence list

[0002] The contents of the electronic sequence list (159792018841seqlist.xml; size: 95,548 bytes; and creation date: January 23, 2025) are incorporated herein by reference in their entirety. Technical Field

[0003] This invention relates to a method for treating Huntington's disease in patients in need. Background Technology

[0004] Huntington's disease (HD) is a fatal monogenic inherited disease caused by the amplification of a trinucleotide repeat sequence in exon 1 of a gene. The accumulation of mutant HTT protein is a key driver of HD-related neuropathology in the striatum and cortex, where neurodegeneration leads to progressive and ultimately fatal motor and cognitive impairment. Currently, there are no disease-modifying therapies for HD. Therefore, there is an urgent need to develop therapeutics to treat and / or alleviate HD-related symptoms. Summary of the Invention

[0005] This disclosure provides artificial microRNA (miRNA) molecules that target human HTT mRNA. Gene therapy using artificial miRNAs targeting HTT supports significant improvements in quality of life and slows disease progression. The constructs described herein have broad commercial applicability in Huntington's disease (HD).

[0006] In one aspect, this disclosure provides an artificial miRNA comprising a first strand and a second strand, wherein (a) the first strand and the second strand form a double strand; and (b) the first strand comprises a guide region containing a nucleotide sequence having at least about 90% or at least about 95% identity with the following sequence: SEQ ID NO: 1 (5'- UAUAGCGAUGCCCAGAAGUUU-3'), SEQ ID NO: 2 (5'- UUCGAGCUGUAACCUUGGAAG-3'), SEQ ID NO: 3 (5'- UUGGUCGGUGCAGCGGCUCCU-3'), SEQ ID NO: 4 (5'- AUUCGUCAGCCACCAUCCUGA-3'), SEQ ID NO: 5 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 6 (5'- GGACUCGAAGGCCUUCAUCAG-3'), SEQ ID NO: 7 (5'- UAUUCGUCAGCCACCAUCCUG-3'), SEQ ID NO: 8 (5'- UUCGUCAGCCACCAUCCUGAC-3'), SEQ ID NO: 9 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 10 (5'- UGCGUCAUCACUGCACAGCAG-3'), SEQ ID NO: 11 (5'- UACGGUCUUCUUGGUAGCUG-3'), SEQ ID NO: 12 (5'- UUGCGUCAUCACUGCACAGCA-3'), SEQ ID NO: 13 (5'- UUCGAAGGCCUUCAUCAGCUU-3'), SEQ ID NO: 14 (5'- AGCGAUGCCCAGAAGUUUCUG-3'), SEQ ID NO: 15 (5'- AACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 16 (5'- AACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 17 (5'- AACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 18 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 19 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 20 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 21 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 22 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 23 (5'- GACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 24 (5'- GACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 25 (5'- GACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 26 (5'- GACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 27 (5'- GACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 28 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 29 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 30 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 31 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 32 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 33 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 34 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 35 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 36 (5'- (AGUCGAGCUGUAACCUUGGA-3') or SEQ ID NO: 37 (5'- (aGCUCGAGCUGUAACCUUGGA-3'); and (c) the second strand (e.g., the lagging strand) contains a non-guided region containing a nucleotide sequence that is partially or completely complementary to the nucleotide sequence of the guided region.

[0007] In some embodiments, this document provides an artificial miRNA comprising a first strand and a second strand, wherein (a) the first strand and the second strand form a double strand; and (b) the first strand comprises a guide region containing the following nucleotide sequences: SEQ ID NO: 1 (5'-UAUAGCGAUGCCCAGAAGUUU-3'), SEQ ID NO: 2 (5'- UUCGAGCUGUAACCUUGGAAG-3'), SEQ ID NO: 3 (5'- UUGGUCGGUGCAGCGGCUCCU-3'), SEQ ID NO: 4 (5'- AUUCGUCAGCCACCAUCCUGA-3'), SEQ ID NO: 5 (5'- GACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 6 (5'- GGACUCGAAGGCCUUCAUCAG-3'), SEQ ID NO: 7 (5'- UAUUCGUCAGCCACCAUCCUG-3'), SEQ ID NO: 8 (5'- UUCGUCAGCCACCAUCCUGAC-3'), SEQ ID NO: 9 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 10 (5'- UGCGUCAUCACUGCACAGCAG-3'), SEQ ID NO: 11 (5'- UACGGUCUUUCUUGGUAGCCUG-3'), SEQ ID NO: 12 (5'- UUGCGUCAUCACUGCACAGCA-3'), SEQ ID NO: 13 (5'- UUCGAAGGCCUUCAUCAGCUU-3'), SEQ ID NO: 14 (5'- AGCGAUGCCCAGAAGUUUCUG-3'), SEQ ID NO: 15 (5'- AACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 16 (5'- AACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 17 (5'- AACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 18 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 19 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 20 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 21 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 22 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 23 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 24 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 25 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 26 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 27 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 28 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 29 (5'- AGCUCGAGCUGUAAACCUUGGA-3'), SEQ ID NO: 30 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 31 (5'- AGCUCGAGCUGUAAACCUUGGA-3'), SEQ ID NO: 32 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 33 (5'- AGCUCGAGCUGUAAACCUUGGA-3'), SEQ ID NO: 34 (5'- AGCUCGAGCUGUAAACCUUGGA-3'), SEQ ID NO: 35 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 36 (5'- (AGUCGAGCUGUAACCUUGGA-3') or SEQ ID NO: 37 (5'- (aGCUCGAGCUGUAACCUUGGA-3'); and (c) the second strand contains a non-guided region containing a nucleotide sequence that is partially or completely complementary to the nucleotide sequence of the guided region.

[0008] In one embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 1 (5'-UAUAGCGAUGCCCAGAAGUUU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 38 (5'-AAACUUCUGCAUCGCUAUG-3'). In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 1 (5'-UAUAGCGAUGCCCAGAAGUUU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 38 (5'-AAACUUCUGCAUCGCUAUG-3').

[0009] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 2 (5'-UUCGAGCUGUAACCUUGGAAG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 39 (5'-CUUCCAAGUACAGCUCGAG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 2 (5'-UUCGAGCUGUAACCUUGGAAG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 39 (5'-CUUCCAAGUACAGCUCGAG-3').

[0010] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 3 (5'-UUGGUCGGUGCAGCGGCUCCU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 40 (5'-AGGAGCCGGCACCGACUAA-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 3 (5'-UUGGUCGGUGCAGCGGCUCCU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 40 (5'-AGGAGCCGGCACCGACUAA-3').

[0011] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 4 (5'-AUUCGUCAGCCACCAUCCUGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 41 (5'-UCAGGAUGGGCUGACGAAU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 4 (5'-AUUCGUCAGCCACCAUCCUGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 41 (5'-UCAGGAUGGGCUGACGAAU-3').

[0012] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 5 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 42 (5'-GCUGAUGAGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 5 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 42 (5'-GCUGAUGAGCCUUCGAGUU-3').

[0013] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 6 (5'-GGACUCGAAGGCCUUCAUCAG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 43 (5'-CUGAUGAACCUUCGAGUUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 6 (5'-GGACUCGAAGGCCUUCAUCAG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 43 (5'-CUGAUGAACCUUCGAGUUU-3').

[0014] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 7 (5'-UAUUCGUCAGCCACCAUCCUG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 44 (5'-CAGGAUGGGCUGACGAAUG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 7 (5'-UAUUCGUCAGCCACCAUCCUG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 44 (5'-CAGGAUGGGCUGACGAAUG-3').

[0015] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 8 (5'-UUCGUCAGCCACCAUCCUGAC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 45 (5'-GUCAGGAUUGGCUGACGAA-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 8 (5'-UUCGUCAGCCACCAUCCUGAC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 45 (5'-GUCAGGAUUGGCUGACGAA-3').

[0016] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 9 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 46 (5'-UCCAAGGUCAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 9 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 46 (5'-UCCAAGGUCAGCUCGAGUU-3').

[0017] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 10 (5'-UGCGUCAUCACUGCACAGCAG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 47 (5'-CUGCUGUGGUGAUGACGUA-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 10 (5'-UGCGUCAUCACUGCACAGCAG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 47 (5'-CUGCUGUGGUGAUGACGUA-3').

[0018] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 11 (5'-UACGGUCUUUCUUGGUAGCUG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 48 (5'-CAGCUACCGAAAGACCGUG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 11 (5'-UACGGUCUUUCUUGGUAGCUG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 48 (5'-CAGCUACCGAAAGACCGUG-3').

[0019] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 12 (5'-UUGCGUCAUCACUGCACAGCA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 49 (5'-UGCUGUGCUGAUGACGUAG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 12 (5'-UUGCGUCAUCACUGCACAGCA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 49 (5'-UGCUGUGCUGAUGACGUAG-3').

[0020] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 13 (5'-UUCGAAGGCCUUCAUCAGCUU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 50 (5'-AAGCUGAUAGGCCUUCGAG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 13 (5'-UUCGAAGGCCUUCAUCAGCUU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 50 (5'-AAGCUGAUAGGCCUUCGAG-3').

[0021] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 14 (5'-AGCGAUGCCCAGAAGUUUCUG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 51 (5'-CAGAAACUUGGGCAUCGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 14 (5'-AGCGAUGCCCAGAAGUUUCUG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 51 (5'-CAGAAACUUGGGCAUCGUU-3').

[0022] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 15 (5'-AACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 52 (5'-GCUGAUGAGCCUUCGAGUC-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 15 (5'-AACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 52 (5'-GCUGAUGAGCCUUCGAGUC-3').

[0023] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 16 (5'-AACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 53 (5'-GCUGAUGAGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 16 (5'-AACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 53 (5'-GCUGAUGAGCCUUCGAGUU-3').

[0024] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 17 (5'-AACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 54 (5'-GCUGAUGAGCCUUCGAUUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 17 (5'-AACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 54 (5'-GCUGAUGAGCCUUCGAUUU-3').

[0025] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 18 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 55 (5'-GCUGAUGAAGCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 18 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 55 (5'-GCUGAUGAAGCUUCGAGUU-3').

[0026] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 19 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 56 (5'-GCUGAUGAACCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 19 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 56 (5'-GCUGAUGAACCUUCGAGUU-3').

[0027] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 20 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 57 (5'-GCUGAUGGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 20 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 57 (5'-GCUGAUGGGCCUUCGAGUU-3').

[0028] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 21 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 58 (5'-GCUGAUAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 21 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 58 (5'-GCUGAUAGGCCUUCGAGUU-3').

[0029] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 22 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 59 (5'-GCUGAAAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 22 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 59 (5'-GCUGAAAGGCCUUCGAGUU-3').

[0030] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 23 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 60 (5'-GCUGGAAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 23 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 60 (5'-GCUGGAAGGCCUUCGAGUU-3').

[0031] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 24 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 61 (5'-GCUUGAAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 24 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 61 (5'-GCUUGAAGGCCUUCGAGUU-3').

[0032] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 25 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 62 (5'-GCAUGAAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 25 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 62 (5'-GCAUGAAGGCCUUCGAGUU-3').

[0033] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 26 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 63 (5'-GGAUGAAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 26 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 63 (5'-GGAUGAAGGCCUUCGAGUU-3').

[0034] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 27 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 64 (5'-UGAUGAAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 27 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 64 (5'-UGAUGAAGGCCUUCGAGUU-3').

[0035] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 28 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 65 (5'-UCCAAGGUCAGCUCGAUUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 28 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 65 (5'-UCCAAGGUCAGCUCGAUUU-3').

[0036] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 29 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 66 (5'-UCCAAGGUUAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 29 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 66 (5'-UCCAAGGUUAGCUCGAGUU-3').

[0037] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 30 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 67 (5'-UCCAAGGACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 30 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 67 (5'-UCCAAGGACAGCUCGAGUU-3').

[0038] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 31 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 68 (5'-UCCAAGUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 31 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 68 (5'-UCCAAGUACAGCUCGAGUU-3').

[0039] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 32 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 69 (5'-UCCAAUUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 32 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 69 (5'-UCCAAUUACAGCUCGAGUU-3').

[0040] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 33 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 70 (5'-UCCAGUUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 33 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 70 (5'-UCCAGUUACAGCUCGAGUU-3').

[0041] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 34 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 71 (5'-UCCGGUUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 34 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 71 (5'-UCCGGUUACAGCUCGAGUU-3').

[0042] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 35 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 72 (5'-UCAGGUUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 35 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 72 (5'-UCAGGUUACAGCUCGAGUU-3').

[0043] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 36 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 73 (5'-UAAGGUUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 36 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 73 (5'-UAAGGUUACAGCUCGAGUU-3').

[0044] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 37 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 74 (5'-CAAGGUUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 37 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 74 (5'-CAAGGUUACAGCUCGAGUU-3').

[0045] In some embodiments, the artificial miRNA targets HTT mRNA.

[0046] In some embodiments, the binding of the guidance region to the coding sequence of the HTT mRNA reduces the expression of the HTT protein.

[0047] In some embodiments, this document provides an expression construct comprising a nucleic acid encoding the artificial miRNA.

[0048] In some embodiments, the nucleic acid encoding the artificial miRNA is operatively linked to a promoter.

[0049] In some embodiments, the nucleic acid encoding the artificial miRNA is cloned into a miRNA scaffold, wherein the transcription of the expression construct forms a stem-loop structure.

[0050] In some embodiments, this document provides a carrier that includes an expression construct as provided herein.

[0051] In some embodiments, the carrier is an rAAV carrier.

[0052] In some embodiments, this document provides viral particles containing the vector, wherein the viral particles are AAV particles capsidating the rAAV vector.

[0053] In some embodiments, the viral particle contains a modified AAV9 or AAV2 capsid protein.

[0054] In some embodiments, this document provides a method for treating or preventing HD in a patient in need, the method comprising administering to the patient a composition comprising a miRNA comprising a guide strand and a follower strand for binding HTT mRNA, wherein the guide strand comprises the following nucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26. SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 or SEQ ID NO: 37.

[0055] In some embodiments, this document provides a method for reducing HTT expression in a patient with HD, the method comprising administering to the patient a composition comprising a miRNA comprising a guide strand and a follower strand for binding HTT mRNA, wherein the guide strand comprises the following nucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26. SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 or SEQ ID NO: 37.

[0056] In any of the embodiments described herein, the guiding strand and the non-guiding strand may be joined by an RNA adapter capable of forming a loop structure. In some embodiments, the RNA adapter comprises 4 to 50 nucleotides. In some embodiments, the loop structure comprises 4 to 20 nucleotides.

[0057] In some embodiments of the above aspects and examples, these artificial miRNA molecules target the 3'-untranslated region (3'-UTR) of HTT mRNA. In some embodiments, these artificial miRNA molecules exhibit low off-target potential.

[0058] In some embodiments of the foregoing aspects and examples, this disclosure provides an expression construct comprising a nucleic acid encoding an artificial miRNA molecule described herein. In some embodiments, the nucleic acid encoding these artificial miRNA molecules is embedded in a miRNA scaffold. In some embodiments, the nucleic acid encoding the artificial miRNA is operatively linked to a promoter. In some embodiments, the promoter is selected from cytomegalovirus (CMV) immediate early promoter, RSV LTR, MoMLV LTR, phosphoglycerate kinase-1 (PGK) promoter, simian virus 40 (SV40) promoter, CK6 promoter, thyroxine transporter promoter (TTR), TK promoter, tetracycline-responsive promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter; cytomegalovirus enhancer / chicken β-actin / rabbit β-globin promoter (CAG) promoter, elongation factor 1-α promoter (EF1-α) promoter, human β-glucuronidase promoter, chicken β-actin (CBA) promoter, retroviral Rous sarcoma virus (RSV) LTR promoter, dihydrofolate reductase promoter, and 13-actin promoter. In some embodiments, the expression construct further includes introns. In some embodiments, the intron is a CBA intron or an hEF1α intron. In some embodiments, the intron is a chimeric intron. In some embodiments, the expression vector is a self-complementary vector, and the intron is a δ-chimeric intron. In some embodiments, the expression construct further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK polyadenylation signal.

[0059] In some embodiments, this disclosure provides a vector comprising any of the expression constructs described herein. In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the expression construct is flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the expression construct is flanked by two AAV ITRs. In some embodiments, these AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV serotype ITRs. In some embodiments, these AAV ITRs are AAV2 ITRs. In some embodiments, the vector further comprises a filler nucleic acid. In some embodiments, the filler nucleic acid is located upstream or downstream of the nucleic acid encoding the artificial miRNA. In some embodiments, the vector is a self-complementary rAAV vector. In some embodiments, the vector comprises a first nucleic acid sequence encoding the artificial miRNA and a second nucleic acid sequence encoding the complement of the artificial miRNA, wherein the first nucleic acid sequence may form intrastrand base pairs with the second nucleic acid sequence along most or all of its length. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion of the D region and a mutation comprising a terminal resolution sequence.

[0060] In some embodiments, this disclosure provides cells comprising any rAAV vector as described herein.

[0061] In some embodiments, this disclosure provides recombinant AAV particles comprising any rAAV vector as described herein. In some embodiments, the AAV virus particle comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1, AAVHSC15, AAVHSC17, goat AAV, AAV1 / AAV2 chimeric capsid, bovine AAV or mouse AAV capsid, or rAAV2 / HBoV1 serotype capsid. In some embodiments, the ITR and the capsid of the rAAV viral particle originate from the same AAV serotype. In some embodiments, the ITR and the capsid of the rAAV viral particle originate from different AAV serotypes. In some embodiments, the ITR originates from AAV2 and the capsid of the rAAV particle originates from AAV1.

[0062] In some embodiments, the capsid protein of the rAAV particle is a modified AAV9 capsid. In some such embodiments, the modified AAV9 capsid protein of the AAV viral particle contains targeting peptides inserted into the AAV9 capsid that alter the transduction and / or endosomal release of the viral particle upon administration to a patient. As disclosed herein, these rAAV particles containing modified AAV9 capsid proteins comprise three structural capsid proteins, VP1, VP2, and VP3. These three capsid proteins are alternative splice variants. In some embodiments, targeting peptides are inserted into the VP1, VP2, and VP3 capsid proteins within the rAAV particle.

[0063] In a particular embodiment, the modified AAV9 capsid targeting peptide is inserted after residue 588 of the AAV9 structural protein (numbered based on the VP1 number of AAV9). In some embodiments, the targeting peptide has SEQ ID NO: 100. In some embodiments, the targeting peptide is flanked by linker sequences at the N-terminus and C-terminus of the targeting peptide. In some embodiments, the linker sequence at the N-terminus has sequence AAA. In some embodiments, the linker sequence at the C-terminus is AS. In some embodiments, the complete sequence inserted after residue 588 of the AAV9 capsid structural protein has SEQ ID NO: 101. In some embodiments, the complete modified AAV9 capsid structural protein has SEQ ID NO: 102. In some embodiments, the intact modified AAV9 capsid structural protein is at least 90% (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%) identical to SEQ ID NO: 102, wherein the modified AAV9 structural capsid contains the targeting peptide of SEQ ID NO: 100. The capsid having SEQ ID NO: 102 may also be referred to herein as SAN006 or AAV.SAN006.

[0064] In some embodiments, this disclosure provides a composition comprising any of the rAAV particles described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0065] In some embodiments, this disclosure provides a kit comprising any artificial miRNA molecule described herein. In some embodiments, this disclosure provides a kit comprising any AAV particles described herein. In some embodiments, this disclosure provides a kit comprising any composition described herein. In some embodiments, the kit further comprises instructions for use.

[0066] In some respects, this disclosure provides methods for treating HD in patients in need, methods comprising administering to the patient a composition comprising an artificial miRNA comprising a guide strand and a non-guided (follower) strand that binds HTT mRNA, wherein the guide strand and the non-guided strand have sequences as disclosed herein.

[0067] In some respects, this disclosure provides methods for reducing HTT protein expression in patients with HD, methods comprising administering to the patient a composition comprising a miRNA comprising a guide strand and a non-guided (follower) strand that bind HTT mRNA, wherein the guide strand and the non-guided strand have sequences as disclosed herein. Attached Figure Description

[0068] Figures 1A-1B The results of artificial miRNA sequences reducing target HTT mRNA in human cells are shown according to some embodiments.

[0069] Figure 2 The results of artificial miRNA sequences exhibiting in vitro dose-dependent target binding in human cells, according to some embodiments, are described.

[0070] Figures 3A-3C The results show, according to some embodiments, the results of artificial miRNA sequences exhibiting chain bias and chain loading (e.g., chain processing) in human cells.

[0071] Figures 4A-4B The results of in vivo target binding of artificial miRNA sequences in the YAC128 model are shown according to some embodiments.

[0072] Figure 5 The results of in vivo target binding of artificial miRNA sequences in the BACHD model are shown according to some embodiments.

[0073] Figure 6 The following examples illustrate how artificial miRNA sequences exhibit in vivo strand bias. Detailed Implementation

[0074] In some respects, this document provides compositions, treatment methods, and kits for reducing HTT (e.g., HTT protein) levels. In some embodiments, artificial miRNAs targeting HTT act to reduce HTT mRNA and / or reduce HTT protein, with the aim of alleviating disease pathology. In some embodiments, the constructs described herein can provide therapeutic benefits in key HD-related brain regions. In some embodiments, the treatment methods can be commercially available to HD patient populations and can be used by both clinicians and patients.

[0075] In some embodiments, the artificial miRNA can target HTT mRNA via an AAV-artificial miRNA vector. In some embodiments, the artificial miRNA may have a lower seed-mediated off-target tendency, and / or have rationally designed sequence variations to optimize guide strand loading to increase potency and / or reduce off-target effects via a follower strand.

[0076] In some respects, this article provides constructs (e.g., therapeutic constructs) relevant to the fields of RNA inhibition, molecular biology, and central nervous system (CNS) gene therapy. In some embodiments, the construct can be configured to reduce the expression of the huntingtin protein (HTT) and can provide a method for treating Huntington's disease.

[0077] In some embodiments, this document provides artificial miRNA sequences. In some embodiments, the artificial miRNA may comprise a duplex containing a guide strand and / or a semi-complementary follower strand that target an antisense sequence of human HTT mRNA. I. General Technology

[0078] The techniques and procedures described or cited herein are generally well known to those skilled in the art and are typically employed using conventional methods, such as those widely used as described in the following literature: *Molecular Cloning: A Laboratory Manual* (Sambrook et al., 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2012); *Current Protocols in Molecular Biology* (edited by F.M. Usubel et al., 2003); *Methods in Enzymology* (Academic Press, Inc.); *PCR 2: A Practical Approach* (edited by M.J. MacPherson, B.H. Dames, and G.R. Taylor, 1995); *Antibodies, A Laboratory Manual* (edited by Harlow and Lane, 1988); *Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications*. [Animal Cell Culture: Basic Techniques and Specialized Applications] (RIFreshney, 6th Edition, J. Wiley and Sons, 2010); Oligonucleotide Synthesis (edited by MJ Gait, 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (edited by JECellis, Academic Press, 1998); Introduction to Cell and Tissue Culture (JP Mather and PE...)Roberts, Plenum Press, 1998); Celland Tissue Culture: Laboratory Procedures (edited by A. Doyle, J.B. Griffiths, and D.G. Newell, J. Wiley and Sons, 1993-8); Handbook of Experimental Immunology (edited by D.M. Weir and C.C. Blackwell, 1996); Gene Transfer Vectors for Mammalian Cells (edited by J.M. Miller and MP. Calos, 1987); PCR: The Polymerase Chain Reaction (edited by Mullis et al., 1994); Current Protocols in Immunology (edited by J.E. Coligan et al., 1991); Short Protocols in Molecular Biology (edited by Ausubel et al., J. Wiley and Sons). [John Willie & Son Publishing, 2002]); Immunobiology (CA Janeway et al., 2004); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty, ed., IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D.Lane, Cold Spring Harbor Laboratory Press, 1999; The Antibodies (edited by M. Zanetti and JD Capra, Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (edited by VT DeVita et al., JB Lippincott Company, 2011). II. Definition

[0079] As used in this article, “vector” refers to a recombinant plasmid or virus containing nucleic acid to be delivered to a host cell in vitro or in vivo.

[0080] As used herein, the term "polynucleotide" or "nucleic acid" refers to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Therefore, this term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases. The backbone of a polynucleotide may contain sugar and phosphate groups (as commonly seen in RNA or DNA) or modified or substituted sugar or phosphate groups. Alternatively, the backbone of a polynucleotide may contain polymers of synthetic subunits such as aminophosphates, and thus may be oligodeoxynucleotide aminophosphates (P-NH2) or mixed aminophosphate-phosphodiester oligomers. Furthermore, double-stranded polynucleotides can be obtained from chemically synthesized single-stranded polynucleotide products by synthesizing the complementary strand and annealing it under appropriate conditions, or by using a DNA polymerase to synthesize the complementary strand de novo with appropriate primers.

[0081] The terms “peptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length. Such polymers of amino acid residues can contain native or non-native amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and polymers of amino acid residues. Full-length proteins and fragments thereof are included in this definition. These terms also include post-expression modifications of peptides, such as glycosylation, sialylation, acetylation, phosphorylation, etc. Furthermore, for the purposes of this disclosure, “peptide” refers to a protein that includes modifications to its native sequence, such as deletions, additions, and substitutions (generally conserved in nature), provided that the protein maintains the desired activity. These modifications can be intentional, such as by site-directed mutagenesis, or accidental, such as by mutations in the host that produces the protein or by errors due to PCR amplification.

[0082] "Recombinant viral vector" refers to a recombinant polynucleotide vector containing one or more heterologous sequences (i.e., nucleic acid sequences not derived from viruses). In the case of recombinant AAV vectors, the recombinant nucleic acid is flanked by at least one (and in some embodiments, two) inverted terminal repeat (ITR) sequences.

[0083] “Recombinant AAV vector (rAAV vector)” refers to a polynucleotide vector containing one or more heterologous sequences (i.e., nucleic acid sequences not derived from AAV), flanked by at least one (and in this example two) AAV inverted terminal repeat (ITR) sequence. Such rAAV vectors can be replicated and packaged into infectious viral particles when present in host cells that are already infected with a suitable helper virus (or expressing a suitable helper function) and expressing AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When the rAAV vector is incorporated into a larger polynucleotide (e.g., into a chromosome or into another vector such as a plasmid used for cloning or transfection), it can be referred to as a “pro-vector”, which can be “rescued” by replication and capsidation in the presence of AAV packaging function and a suitable helper function. rAAV vectors can be in any of a variety of forms, including but not limited to plasmids, linear artificial chromosomes, lipid complexes, encapsulated in liposomes, and capsidated within viral particles, particularly AAV particles. The rAAV vector can be packaged into the capsid of the AAV virus to produce "recombinant adeno-associated virus particles (rAAV particles)".

[0084] "Heterologous" means originating from an entity that is genotypically different from the entity being compared to it or which is introduced or incorporated into it. For example, polynucleotides introduced into different cell types through genetic engineering are heterologous polynucleotides (and when expressed, can encode heterologous polypeptides). Similarly, cellular sequences (e.g., genes or portions thereof) incorporated into viral vectors are heterologous nucleotide sequences relative to the vector.

[0085] The term "transgenic" refers to a polynucleotide introduced into a cell that is capable of being transcribed into RNA and optionally translated and / or expressed under appropriate conditions. In some respects, it confers desired properties to the cell into which it is introduced, or otherwise produces desired therapeutic or diagnostic outcomes. In other respects, it can be transcribed into molecules that mediate RNA interference, such as miRNA, siRNA, or shRNA.

[0086] “Chicken β-actin (CBA) promoter” refers to a polynucleotide sequence derived from the chicken β-actin gene (e.g., Gallus gallus β-actin, represented by GenBank Entrez gene ID 396526). As used herein, “chicken β-actin promoter” can refer to a promoter containing a cytomegalovirus (CMV) early enhancer element, the promoter and first exon and intron of the chicken β-actin gene, and the splice acceptor of the rabbit β-globin gene, such as the sequence described in Miyazaki, J. et al. (1989) Gene [Gene] 79(2):269-77. As used herein, the term “CAG promoter” is used interchangeably. As used herein, the terms “CMV early enhancer / chicken β-actin (CAG) promoter” are used interchangeably.

[0087] The terms “genomic particles (gp),” “genomic equivalent,” or “genomic copy” used in relation to viral titers refer to the number of virions containing the recombinant AAV DNA genome, and are unrelated to infectivity or functionality. The number of genomic particles in a particular vector formulation can be measured using procedures as illustrated in the examples herein or described, for example, in the following literature: Clark et al. (1999) Hum. Gene Ther. [Human Gene Therapy], 10:1031-1039; Veldwijk et al. (2002) Mol. Ther. [Molecular Therapy], 6:272-278.

[0088] As used herein, the term "vector genome (vg)" can refer to one or more polynucleotides comprising a set of polynucleotide sequences of a vector (e.g., a viral vector). The vector genome may be capsidated within the viral particle. Depending on the specific viral vector, the vector genome may comprise single-stranded DNA, double-stranded DNA, or single-stranded RNA, or double-stranded RNA. The vector genome may include endogenous sequences associated with the specific viral vector and / or any heterologous sequences inserted into the specific viral vector via recombination techniques. For example, a recombinant AAV vector genome may include at least one ITR sequence flanking the promoter, filler sequence, target sequence (e.g., miRNA), and polyadenylated sequence. A complete vector genome may comprise a complete set of polynucleotide sequences of the vector. In some embodiments, the nucleic acid titer of the viral vector may be measured in vg / mL. Suitable methods for measuring such titers are known in the art (e.g., quantitative PCR).

[0089] As used herein, the term "inhibition" can refer to an action that blocks, reduces, eliminates, or otherwise antagonizes the presence or activity of a particular target. Inhibition can refer to partial or complete inhibition. For example, inhibiting gene expression can refer to any action that results in the arrest, reduction, elimination, or any other antagonism of gene expression, including a decrease in mRNA abundance (e.g., silencing mRNA transcription), mRNA degradation, inhibition of mRNA translation, etc. In some embodiments, inhibiting HTT protein expression can refer to the arrest, reduction, elimination, or any other antagonism of HTT protein expression, including a decrease in HTT mRNA abundance (e.g., silencing HTT mRNA transcription), HTT mRNA degradation, inhibition of HTT mRNA translation, etc. As another example, inhibiting protein accumulation in cells can refer to any action that results in the arrest, reduction, elimination, or other antagonism of protein expression, including a decrease in mRNA abundance (e.g., silencing mRNA transcription), mRNA degradation, inhibition of mRNA translation, protein degradation, etc. In some embodiments, inhibiting the accumulation of HTT protein in cells refers to blocking, reducing, eliminating, or other antagonistic effects on the expression of HTT protein in cells, including reducing the abundance of HTT mRNA (e.g., silencing HTT mRNA), degrading HTT mRNA, inhibiting HTT mRNA translation, and degrading HTT protein.

[0090] The terms “infectious unit (iu),” “infectious particle” or “replication unit” used in relation to viral titers refer to the number of infectious and reproducible recombinant AAV vector particles as measured by an infection center assay (also known as a replication center assay), as described, for example, in McLaughlin et al. (1988) J. Virol. [Journal of Virology], 62:1963-1973.

[0091] For example, the term “transduction unit (tu)” used in relation to viral titers refers to the number of infectious recombinant AAV vector particles that cause the production of functional transgenic products, as measured in functional assays such as those described in the examples herein or in, for example, the following literature: Xiao et al. (1997) Exp. Neurobiol. [Experimental Neurobiology], 144:113-124; or Fisher et al. (1996) J. Virol. [Journal of Virology], 70:520-532 (LFU assay).

[0092] "Inverted terminal repeat" or "ITR" sequence is a well-known term in the field, referring to a relatively short sequence with opposite orientation found at the end of a viral genome.

[0093] The term "AAV inverted terminal repeat (ITR)" is well-known in the art and refers to a sequence of approximately 145 nucleotides located at both ends of a natural single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two optional orientations, resulting in heterogeneity between different AAV genomes and between the two ends of a single AAV genome. These outermost 125 nucleotides also contain several shorter, self-complementary regions (named A, A', B, B', C, C', and D regions), allowing intrastrand base pairing to occur within this portion of the ITR.

[0094] The "terminal dissociation sequence" or "trs" is a sequence in the D region of the AAV ITR that is cleaved by the AAV rep protein during viral DNA replication. The mutant terminal dissociation sequence is resistant to AAV rep protein cleavage.

[0095] "AAV helper functions" refer to the functions that allow AAV to be replicated and packaged by the host cell. AAV helper functions can be provided in any of a variety of forms, including but not limited to helper viruses or helper virus genes that assist AAV replication and packaging. Other AAV helper functions are known in the art, such as genotoxic agents.

[0096] A "helper virus" in AAV refers to a virus that allows AAV (a defective parvovirus) to be replicated and packaged by host cells. Helper viruses provide the "accessory function" that allows AAV replication. Many such helper viruses have been identified, including adenoviruses, herpesviruses, and poxviruses such as vaccinia and baculoviruses. Adenoviruses encompass many different subgroups, but subgroup C-type 5 adenovirus (Ad5) is the most commonly used. Many adenoviruses of human, non-human mammalian, and avian origin are known and available from collections such as the ATCC. Herpesviruses also available from collections such as the ATCC include, for example, herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), and pseudorabies virus (PRV). Examples of adenovirus helper functions used for AAV replication include E1A, E1B, E2A, VA, and E4orf6 functions. Baculoviruses available from collections include the nucleopolyhedrovirus of the alfalfa silver-striped moth (Autographa californica).

[0097] If the ratio of infectious AAV particles to infectious helper virus particles is at least about 10... 2 : 1; at least about 10 4 1. At least about 10 6 : 1; or at least about 10 8 If the level is 1 or greater, the rAAV formulation is said to be "substantially free" of helper virus. In some embodiments, the formulation also does not contain an equivalent amount of helper virus proteins (i.e., proteins present due to this level of helper virus if the aforementioned helper virus particle impurities are present in cleaved form). Viral and / or cellular protein contamination can typically be observed as the presence of Coomassie staining bands on an SDS gel (e.g., the appearance of bands other than those corresponding to AAV capsid proteins VP1, VP2, and VP3).

[0098] The “sequence identity percentage (%)” for a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical to those in a reference polypeptide or nucleic acid sequence after sequence alignment and the introduction of vacancies (if necessary) to obtain the maximum sequence identity percentage, and without considering any conserved substitutions as part of the sequence identity. Alignments used to determine the amino acid or nucleic acid sequence identity percentage can be performed in various ways within the scope of the art, for example, using publicly available computer software programs, such as those described in Current Protocols in Molecular Biology (edited by Ausubel et al., 1987), Supplement 30, Chapter 7.7.18, Table 7.7.1, and including BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. A preferred alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania). Those skilled in the art can determine appropriate parameters for measuring alignments, including any algorithms required to achieve maximum alignment across the full length of the sequences being compared. For the purposes of this paper, the percentage of amino acid sequence identity between a given amino acid sequence A and, and, with respect to a given amino acid sequence B (which can be alternatively expressed as a given amino acid sequence A having or containing a certain percentage of amino acid sequence identity with, and, and, with respect to a given amino acid sequence B) is calculated as follows: 100 multiplied by the fraction X / Y, where X is the number of amino acid residues that are identified as identical matches in the alignment of A and B by a sequence alignment program, and Y is the total number of amino acid residues in B. It should be understood that when the lengths of amino acid sequences A and B are not equal, the percentage of amino acid sequence identity between A and B will not be equal to the percentage of amino acid sequence identity between B and A. For the purposes of this paper, the percentage of nucleic acid sequence identity between a given nucleic acid sequence C and, or with respect to a given nucleic acid sequence D (which can be alternatively expressed as a given nucleic acid sequence C having or containing a certain percentage of nucleic acid sequence identity with, or with respect to, a given nucleic acid sequence D) is calculated as follows: 100 multiplied by the fraction W / Z, where W is the number of nucleotides that are identified as identical matches in the alignment of C and D by the sequence alignment program, and Z is the total number of nucleotides in D. It should be understood that when the lengths of nucleic acid sequences C and D are not equal, the percentage of nucleic acid sequence identity between C and D will not be equal to the percentage of nucleic acid sequence identity between D and C.

[0099] "Isolated" molecules (e.g., nucleic acids or proteins) or cells mean that they have been identified and separated from and / or recovered from their natural environment.

[0100] An "effective dose" is a dose sufficient to achieve a beneficial or desired outcome (including clinical outcomes, such as symptom improvement, achievement of clinical endpoints, etc.). An effective dose can be administered once or multiple times. In terms of disease state, an effective dose is a dose sufficient to improve, stabilize, or delay disease progression.

[0101] "Individual" or "subject" is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In some embodiments, the individual or subject is a human.

[0102] As used herein, “treatment” is a method used to obtain a beneficial or desired clinical outcome. For the purposes of this disclosure, a beneficial or desired clinical outcome includes, but is not limited to, relief of symptoms, reduction of disease severity, stabilization of disease status (e.g., no worsening), prevention of disease spread (e.g., metastasis), delay or slowing of disease progression, improvement or mitigation of disease status, and remission (partial or complete), whether detectable or undetectable. “Treatment” may also mean prolonged survival compared to expected survival in the untreated condition.

[0103] As used herein, the term "preventive treatment" refers to treatment in which an individual is known or suspected of having a disorder or is at risk of developing a disorder, but has not yet exhibited symptoms of the disorder or has exhibited the minimum symptoms of the disorder. Individuals undergoing preventive treatment may receive treatment before symptoms develop.

[0104] A “miRNA scaffold” can refer to a polynucleotide containing: (i) a double-stranded sequence targeting a target gene for miRNA knockdown and (ii) an additional sequence forming a stem-loop structure similar to that of an endogenous miRNA. The target gene sequence (e.g., a short sequence of about 20 nt) can be linked to a sequence that produces a miRNA-like stem-loop and a sequence that base-pairs with the target sequence to form a double strand when the polynucleotide is assembled into a miRNA-like secondary structure. As described herein, this double strand may not be fully hybridized; for example, it may contain one or more unpaired or mispaired bases. When the polynucleotide is cleaved by Dicer, the double strand containing the target gene sequence can be unfolded and incorporated into the RISC complex. A miRNA scaffold can refer to the miRNA itself or to the DNA polynucleotide encoding the miRNA. An example of a miRNA scaffold is the miR-155 sequence (Lagos-Quintana, M. et al. (2002) Curr. Biol. [Current Biology] 12:735-9). Commercially available kits for cloning sequences into miRNA scaffolds are known in the art (e.g., Invitrogen™ BLOCK-iT™ Poll II miRNA interference expression vector kit, from Life Technologies, Thermo Fisher Scientific; Waltham, MA).

[0105] As used herein, a "bulge" refers to a region in a nucleic acid that is not complementary to its counterpart in the duplex nucleic acid. For example, a bulge can refer to a nucleic acid sequence that is not complementary to its counterpart in the duplex nucleic acid, where the flanks of the bulge are regions in the nucleic acid complementary to its counterpart in the duplex nucleic acid. In some instances, the length of a bulge can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 bases. In some instances, a bulge may be the result of mispairing (e.g., the counterpart contains non-complementary bases), or it may be the result of unpairing (e.g., the counterpart contains a nucleic acid complementary to the nucleic acid flanking the bulge, but the counterpart does not contain the nucleic acid opposite the bulge).

[0106] As used herein, the term "sense" nucleic acid is a nucleic acid that contains all or part of the sequence encoding a transgene. In some instances, the mRNA of a transgene is a sense nucleic acid.

[0107] As used in this article, "antisense" nucleic acid is a nucleic acid sequence that is complementary to "sense" nucleic acid. For example, antisense nucleic acid can be complementary to mRNA encoding transgenes.

[0108] As used in this article, the “guide region” of a miRNA is the strand of the miRNA that binds to the target mRNA, typically based on complementarity binding. The complementarity region may encompass all or part of the guide region. Typically, the complementarity region includes at least the seed region. In many cases, the antisense region of the miRNA is the guide region.

[0109] As used herein, the “lazy region” or “non-directing region” of a miRNA, which can be used interchangeably here, is a region of the miRNA that is complementary to the directing region. In many cases, the sense region of a miRNA is the lazy region.

[0110] As used in this article, the "seed region" of a miRNA is a region of approximately 1–8 nucleotides in length within the miRNA. In some instances, the seed region and its 3'-UTR of the target mRNA may be key determinants in miRNA recognition.

[0111] As used in this article, “off-target gene silencing” refers to the pairing of the seed region of a miRNA with a sequence in the 3'-UTR of an unintended mRNA, and the resulting translational repression and destabilization of those transcripts (e.g., reducing the expression of the unintended mRNA).

[0112] When this document refers to a value or parameter “about”, it includes (and describes) embodiments relating to that value or parameter itself. For example, a description of “about X” includes a description of “X”.

[0113] As used herein, unless otherwise indicated, the singular articles “a”, “an”, and “the” include plural indicators.

[0114] It should be understood that the aspects and embodiments described herein include “comprising aspects and embodiments,” “consisting of aspects and embodiments,” and / or “substantially consisting of aspects and embodiments.” III. Artificial miRNA molecules

[0115] In some aspects, this disclosure provides artificial miRNA molecules comprising the sequences disclosed herein. miRNAs are known in the art as RNA molecules that induce RNA interference in cells, comprising a short (e.g., 19-25 base pairs) sequence of a double-stranded RNA linked by a loop and one or more additional sequences containing one or more bumps (e.g., mispaired or unpaired base pairs) of the double-stranded RNA. In some embodiments, “miRNA” may refer to a primary miRNA (pri-miRNA) or a precursor miRNA. During miRNA processing, a primary miRNA transcript is produced. The primary miRNA is processed by Drosha-DGCR8 to produce a precursor miRNA by excising one or more sequences, leaving a precursor miRNA having: a 5' flanking region, a guiding strand, a loop region, an unguided strand, and a 3' flanking region; or a 5' flanking region, an unguided strand, a loop region, a guiding strand, and a 3' flanking region. The precursor miRNA is then exported to the cytoplasm and processed by Dicer to produce a miRNA having a guiding strand and an unguided (or lagging) strand. The RISC complex then uses a guide strand to catalyze gene silencing, for example by recognizing a target RNA sequence complementary to the guide strand. miRNA recognition of a target sequence is primarily determined by the pairing between the target and the miRNA seed sequence (e.g., nucleotides 1–8 (5' to 3') of the guide strand) (see, for example, Boudreau, RL et al. (2013) NucleicAcids Res. [Nucleic Acid Research] 41:e9).

[0116] In the primary / precursor miRNA structure, the guide strand:non-guide strand interface in the duplex is partially formed by complementary base pairing (e.g., Watson-Crick base pairing). However, in some embodiments, this complementary base pairing does not extend throughout the entire duplex. In some embodiments, a protrusion in this interface may be present at one or more nucleotide sites. As used herein, the term "protrusion" may refer to a region in the nucleic acid that is not complementary to its opposite nucleic acid in the duplex. In some embodiments, a protrusion is formed when regions of complementary nucleic acids bind to each other, while regions of the central non-complementary region do not bind. In some embodiments, a protrusion is formed when the two nucleic acid strands located between two complementary regions have different lengths. As described below, a protrusion may comprise one or more nucleotides. In some embodiments, the miRNA includes an internal protrusion created by deleting two bases (bases 9-10, counted from the start of the lagging strand) from the lagging strand of the miRNA.

[0117] In certain aspects, the artificial miRNA molecules described in this disclosure are inhibitory to HTT mRNA. In some embodiments, the HTT mRNA is human HTT mRNA. In some embodiments, the artificial mRNA targets the coding sequence of the HTT mRNA. In some embodiments, the artificial miRNA targets the 3'-UTR region of the mRNA encoding HTT. In some embodiments, the artificial miRNA inhibits HTT expression in a subject. In some embodiments, the artificial miRNA inhibits the accumulation of HTT protein in a subject. In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.

[0118] The safety of miRNA-based therapies can be hampered by the ability of miRNAs to bind to and reduce the expression of unintended mRNAs (an effect known as off-target gene silencing). Off-target effects primarily occur when the seed region (nucleotides 2–8 of the small miRNA) pairs with sequences in the 3'-UTR of the unintended mRNA, leading to translational repression and destabilization of those transcripts. Reduced off-target miRNAs can be engineered by substituting bases within both the guide and unguide sequences; for example, by generating CpG motifs. Potential substitutions that could produce significantly lower off-target scores can be evaluated using the SiSPOTR algorithm, a specificity-focused design algorithm that identifies candidate sequences with the lowest off-target potential and effective silencing ability (Boudreau et al., Nucleic Acids Res. 2013 Jan; 41(1) e9). Reduced SiSPOTR scores predict a lower number of potential human off-target sequences compared to the parental miRNA molecule. In some embodiments disclosed herein, miRNAs are modified to reduce off-target gene silencing. In some embodiments, the miRNA contains one or more CpG motifs. In some embodiments, the miRNA contains one or more CpG motifs in a seed region.

[0119] In some embodiments, the first and second strands are joined by an RNA capable of forming a loop structure (e.g., an RNA adapter). As is generally known in the art, RNA loop structures (e.g., stem-loops or hairpins) are formed when an RNA molecule contains two RNA sequences whose bases are paired together and separated by an RNA sequence whose bases are not paired together. For example, a loop structure can be formed in RNA molecule ABC if sequences A and C are complementary or partially complementary such that their bases are paired together, but the bases in sequence B are not paired together. In some embodiments, the loop sequence is 5'-GTTTTGGCCACTGACTGAC-3' (SEQ ID NO: 110) in DNA form or 5'-GUUUUGGCCACUGACUGAC-3' (SEQ ID NO: 111) in RNA form.

[0120] In some embodiments, the RNA capable of forming a loop structure comprises 4 to 50 nucleotides. In some embodiments, the RNA capable of forming a loop structure comprises 13 nucleotides. In some embodiments, the number of nucleotides in the RNA capable of forming a loop is 4 to 50 nucleotides or any integer between them. In some embodiments, 0-50% of the loop may be complementary to another portion of the loop. As used herein, the term "loop structure" is a sequence that connects two complementary strands of a nucleic acid. In some embodiments, 1-3 nucleotides of the loop structure are adjacent to the complementary strand of the nucleic acid and may be complementary to 1-3 nucleotides of the distal portion of the loop structure. For example, the three nucleotides at the 5' end of the loop structure may be complementary to the three nucleotides at the 3' end of the loop structure.

[0121] In some embodiments, the nucleic acid encoding the miRNA disclosed herein comprises a heterologous miRNA scaffold. In some embodiments, the use of the heterologous miRNA scaffold is used to regulate miRNA expression; for example, to increase or decrease miRNA expression. Any miRNA scaffold known in the art can be used. In some embodiments, the miRNA scaffold is derived from the miR-155 scaffold (see, for example, Lagos-Quintana, M. et al. (2002) Curr. Biol. [Current Biology] 12:735-9; and the Invitrogen™ BLOCK-iT™ Poll II miR RNA interference expression vector kit, from Life Technologies, Thermo Fisher Scientific; Waltham, MA).

[0122] In some embodiments, the artificial miRNA is selected from Table 1. Table 1

[0123] In some embodiments, the first strand comprises a nucleic acid sequence having more than one of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with any guide sequence. In some embodiments, the first strand comprises a nucleic acid sequence having more than one of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with any guide sequence, but maintaining the CpG motif. In some embodiments, the second strand comprises a nucleic acid sequence having more than one of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the corresponding follower sequence. In some embodiments, the second strand comprises a nucleic acid sequence having more than one of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the corresponding follower sequence, but maintaining the CpG motif.

[0124] In one aspect, this disclosure provides an artificial miRNA comprising a first strand and a second strand, wherein (a) the first strand and the second strand form a double strand; and (b) the first strand comprises a guide region containing a nucleotide sequence having at least about 90% or at least about 95% identity with the following sequence: SEQ ID NO: 1 (5'- UAUAGCGAUGCCCAGAAGUUU-3'), SEQ ID NO: 2 (5'- UUCGAGCUGUAACCUUGGAAG-3'), SEQ ID NO: 3 (5'- UUGGUCGGUGCAGCGGCUCCU-3'), SEQ ID NO: 4 (5'- AUUCGUCAGCCACCAUCCUGA-3'), SEQ ID NO: 5 (5'- GACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 6 (5'- GGACUCGAAGGCCUUCAUCAG-3'), SEQ ID NO: 7 (5'- UAUUCGUCAGCCACCAUCCUG-3'), SEQ ID NO: 8 (5'- UUCGUCAGCCACCAUCCUGAC-3'), SEQ ID NO: 9 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 10 (5'- UGCGUCAUCACUGCACAGCAG-3'), SEQ ID NO: 11 (5'- UACGGUCUUCUUGGUAGCUG-3'), SEQ ID NO: 12 (5'- UUGCGUCAUCACUGCACAGCA-3'), SEQ ID NO: 13 (5'- UUCGAAGGCCUUCAUCAGCUU-3'), SEQ ID NO: 14 (5'- AGCGAUGCCCAGAAGUUUCUG-3'), SEQ ID NO: 15 (5'- AACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 16 (5'- AACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 17 (5'- AACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 18 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 19 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 20 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 21 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 22 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 23 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 24 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 25 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 26 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 27 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 28 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 29 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 30 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 31 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 32 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 33 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 34 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 35 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 36 (5'- (AGUCGAGCUGUAACCUUGGA-3') or SEQ ID NO: 37 (5'- (aGCUCGAGCUGUAACCUUGGA-3'); and (c) the second strand (e.g., the lagging strand) contains a non-guided region containing a nucleotide sequence that is partially complementary to the nucleotide sequence of the guide region.

[0125] In some embodiments, this document provides an artificial miRNA comprising a first strand and a second strand, wherein (a) the first strand and the second strand form a double strand; and (b) the first strand comprises a guide region containing the following nucleotide sequences: SEQ ID NO: 1 (5'-UAUAGCGAUGCCCAGAAGUUU-3'), SEQ ID NO: 2 (5'- UUCGAGCUGUAACCUUGGAAG-3'), SEQ ID NO: 3 (5'- UUGGUCGGUGCAGCGGCUCCU-3'), SEQ ID NO: 4 (5'- AUUCGUCAGCCACCAUCCUGA-3'), SEQ ID NO: 5 (5'- GACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 6 (5'- GGACUCGAAGGCCUUCAUCAG-3'), SEQ ID NO: 7 (5'- UAUUCGUCAGCCACCAUCCUG-3'), SEQ ID NO: 8 (5'- UUCGUCAGCCACCAUCCUGAC-3'), SEQ ID NO: 9 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 10 (5'- UGCGUCAUCACUGCACAGCAG-3'), SEQ ID NO: 11 (5'- UACGGUCUUCUUGGUAGCUG-3'), SEQ ID NO: 12 (5'- UUGCGUCAUCACUGCACAGCA-3'), SEQ ID NO: 13 (5'- UUCGAAGGCCUUCAUCAGCUU-3'), SEQ ID NO: 14 (5'- AGCGAUGCCCAGAAGUUUCUG-3'), SEQ ID NO: 15 (5'- AACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 16 (5'- AACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 17 (5'- AACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 18 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 19 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 20 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 21 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 22 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 23 (5'- GACUCGAAGGCCCUUCAUCAGC-3'), SEQ ID NO: 24 (5'- GACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 25 (5'- GACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 26 (5'- GACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 27 (5'- GACUCGAAGGCCUUCAUCAGC-3'), SEQ ID NO: 28 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 29 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 30 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 31 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 32 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 33 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 34 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 35 (5'- AGCUCGAGCUGUAACCUUGGA-3'), SEQ ID NO: 36 (5'- (AGUCGAGCUGUAACCUUGGA-3') or SEQ ID NO: 37 (5'- (AGCUCGAGCUGUAACCUUGGA-3'); and (c) the second strand contains a non-guided region containing a nucleotide sequence that is partially complementary to the nucleotide sequence of the guided region.

[0126] In one embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 1 (5'-UAUAGCGAUGCCCAGAAGUUU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 38 (5'-AAACUUCUGCAUCGCUAUG-3'). In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 1 (5'-UAUAGCGAUGCCCAGAAGUUU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 38 (5'-AAACUUCUGCAUCGCUAUG-3').

[0127] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 2 (5'-UUCGAGCUGUAACCUUGGAAG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 39 (5'-CUUCCAAGUACAGCUCGAG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 2 (5'-UUCGAGCUGUAACCUUGGAAG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 39 (5'-CUUCCAAGUACAGCUCGAG-3').

[0128] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 3 (5'-UUGGUCGGUGCAGCGGCUCCU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 40 (5'-AGGAGCCGGCACCGACUAA-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 3 (5'-UUGGUCGGUGCAGCGGCUCCU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 40 (5'-AGGAGCCGGCACCGACUAA-3').

[0129] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 4 (5'-AUUCGUCAGCCACCAUCCUGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 41 (5'-UCAGGAUGGGCUGACGAAU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 4 (5'-AUUCGUCAGCCACCAUCCUGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 41 (5'-UCAGGAUGGGCUGACGAAU-3').

[0130] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 5 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 42 (5'-GCUGAUGAGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 5 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 42 (5'-GCUGAUGAGCCUUCGAGUU-3').

[0131] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 6 (5'-GGACUCGAAGGCCUUCAUCAG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 43 (5'-CUGAUGAACCUUCGAGUUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 6 (5'-GGACUCGAAGGCCUUCAUCAG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 43 (5'-CUGAUGAACCUUCGAGUUU-3').

[0132] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 7 (5'-UAUUCGUCAGCCACCAUCCUG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 44 (5'-CAGGAUGGGCUGACGAAUG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 7 (5'-UAUUCGUCAGCCACCAUCCUG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 44 (5'-CAGGAUGGGCUGACGAAUG-3').

[0133] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 8 (5'-UUCGUCAGCCACCAUCCUGAC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 45 (5'-GUCAGGAUUGGCUGACGAA-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 8 (5'-UUCGUCAGCCACCAUCCUGAC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 45 (5'-GUCAGGAUUGGCUGACGAA-3').

[0134] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 9 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 46 (5'-UCCAAGGUCAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 9 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 46 (5'-UCCAAGGUCAGCUCGAGUU-3').

[0135] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 10 (5'-UGCGUCAUCACUGCACAGCAG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 47 (5'-CUGCUGUGGUGAUGACGUA-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 10 (5'-UGCGUCAUCACUGCACAGCAG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 47 (5'-CUGCUGUGGUGAUGACGUA-3').

[0136] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 11 (5'-UACGGUCUUUCUUGGUAGCUG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 48 (5'-CAGCUACCGAAAGACCGUG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 11 (5'-UACGGUCUUUCUUGGUAGCUG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 48 (5'-CAGCUACCGAAAGACCGUG-3').

[0137] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 12 (5'-UUGCGUCAUCACUGCACAGCA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 49 (5'-UGCUGUGCUGAUGACGUAG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 12 (5'-UUGCGUCAUCACUGCACAGCA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 49 (5'-UGCUGUGCUGAUGACGUAG-3').

[0138] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 13 (5'-UUCGAAGGCCUUCAUCAGCUU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 50 (5'-AAGCUGAUAGGCCUUCGAG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 13 (5'-UUCGAAGGCCUUCAUCAGCUU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 50 (5'-AAGCUGAUAGGCCUUCGAG-3').

[0139] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 14 (5'-AGCGAUGCCCAGAAGUUUCUG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 51 (5'-CAGAAACUUGGGCAUCGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 14 (5'-AGCGAUGCCCAGAAGUUUCUG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 51 (5'-CAGAAACUUGGGCAUCGUU-3').

[0140] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 15 (5'-AACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 52 (5'-GCUGAUGAGCCUUCGAGUC-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 15 (5'-AACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 52 (5'-GCUGAUGAGCCUUCGAGUC-3').

[0141] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 16 (5'-AACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 53 (5'-GCUGAUGAGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 16 (5'-AACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 53 (5'-GCUGAUGAGCCUUCGAGUU-3').

[0142] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 17 (5'-AACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 54 (5'-GCUGAUGAGCCUUCGAUUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 17 (5'-AACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 54 (5'-GCUGAUGAGCCUUCGAUUU-3').

[0143] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 18 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 55 (5'-GCUGAUGAAGCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 18 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 55 (5'-GCUGAUGAAGCUUCGAGUU-3').

[0144] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 19 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 56 (5'-GCUGAUGAACCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 19 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 56 (5'-GCUGAUGAACCUUCGAGUU-3').

[0145] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 20 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 57 (5'-GCUGAUGGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 20 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 57 (5'-GCUGAUGGGCCUUCGAGUU-3').

[0146] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 21 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 58 (5'-GCUGAUAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 21 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 58 (5'-GCUGAUAGGCCUUCGAGUU-3').

[0147] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 22 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 59 (5'-GCUGAAAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 22 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 59 (5'-GCUGAAAGGCCUUCGAGUU-3').

[0148] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 23 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 60 (5'-GCUGGAAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 23 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 60 (5'-GCUGGAAGGCCUUCGAGUU-3').

[0149] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 24 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 61 (5'-GCUUGAAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 24 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 61 (5'-GCUUGAAGGCCUUCGAGUU-3').

[0150] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 25 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 62 (5'-GCAUGAAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 25 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 62 (5'-GCAUGAAGGCCUUCGAGUU-3').

[0151] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 26 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 63 (5'-GGAUGAAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 26 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 63 (5'-GGAUGAAGGCCUUCGAGUU-3').

[0152] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 27 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 64 (5'-UGAUGAAGGCCUUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 27 (5'-GACUCGAAGGCCUUCAUCAGC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 64 (5'-UGAUGAAGGCCUUCGAGUU-3').

[0153] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 28 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 65 (5'-UCCAAGGUCAGCUCGAUUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 28 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 65 (5'-UCCAAGGUCAGCUCGAUUU-3').

[0154] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 29 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 66 (5'-UCCAAGGUUAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 29 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 66 (5'-UCCAAGGUUAGCUCGAGUU-3').

[0155] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 30 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 67 (5'-UCCAAGGACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 30 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 67 (5'-UCCAAGGACAGCUCGAGUU-3').

[0156] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 31 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 68 (5'-UCCAAGUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 31 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 68 (5'-UCCAAGUACAGCUCGAGUU-3').

[0157] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 32 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 69 (5'-UCCAAUUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 32 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 69 (5'-UCCAAUUACAGCUCGAGUU-3').

[0158] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 33 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 70 (5'-UCCAGUUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 33 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 70 (5'-UCCAGUUACAGCUCGAGUU-3').

[0159] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 34 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 71 (5'-UCCGGUUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 34 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 71 (5'-UCCGGUUACAGCUCGAGUU-3').

[0160] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 35 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 72 (5'-UCAGGUUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 35 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 72 (5'-UCAGGUUACAGCUCGAGUU-3').

[0161] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 36 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 73 (5'-UAAGGUUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 36 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 73 (5'-UAAGGUUACAGCUCGAGUU-3').

[0162] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 37 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 74 (5'-CAAGGUUACAGCUCGAGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 37 (5'-AGCUCGAGCUGUAACCUUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 74 (5'-CAAGGUUACAGCUCGAGUU-3').

[0163] In some embodiments, the guiding region contains the sequence of SEQ ID NO: 1 and the non-guiding region contains the sequence of SEQ ID NO: 38. IV. miRNA Expression Constructs and Vectors

[0164] This disclosure provides expression constructs, vectors, and viral particles for expressing the miRNA molecules described herein.

[0165] In some embodiments, this document provides an expression construct comprising a nucleic acid encoding the artificial miRNA.

[0166] In some embodiments, the nucleic acid encoding the miRNA is operatively linked to a promoter.

[0167] In some embodiments, nucleic acids encoding artificial miRNAs are cloned into miRNA scaffolds, wherein transcription of the expression construct forms a stem-loop structure.

[0168] In some embodiments, this document provides a carrier that includes an expression construct as provided herein.

[0169] In some embodiments, the carrier is an rAAV carrier.

[0170] In some embodiments, the nucleic acid encoding the artificial miRNA disclosed herein comprises a heterologous miRNA scaffold. In some embodiments, the use of the heterologous miRNA scaffold is for regulating miRNA expression; for example, increasing or decreasing miRNA expression. Any miRNA scaffold known in the art can be used. In some embodiments, the miRNA scaffold is derived from the miR-155 scaffold (see, for example, Lagos-Quintana, M. et al. (2002) Curr. Biol. [Current Biology] 12:735-9; and Invitrogen™ BLOCK-iT™ Pol II miR RNA interference expression vector kit, from Life Sciences, Thermo Fisher Scientific, Waltham, MA). In some embodiments, the nucleic acid encoding the miRNA disclosed herein comprises a miRNA scaffold. In some embodiments, the miRNA scaffold comprises the sequence ctggaggcttgctgaaggctgtatgctgcaggacacaaggcctgttactagcactcacatggaacaaatggc (SEQ ID NO: 112), wherein the miRNA is inserted between bolded gc residues.

[0171] In some embodiments, the miRNA in the scaffold contains a sequence ctggaggcttgctgaaggctgtatgctg tacgatctaatatcgctcgttttggccactgac tgacgagcgatatgatcgtacga caggacacaaggcctgttactagcactcacatggaacaaatggc (SEQ ID NO: 113), where underlined plain text represents 5'-flank, italic text represents the guiding sequence, bold text represents the loop, underlined italic text represents the non-guiding sequence, and plain text represents 3'-flank.

[0172] In some embodiments, the miRNA targets RNA encoding a polypeptide associated with HD. In some embodiments, the polypeptide is HTT.

[0173] In some embodiments, the transgene (e.g., the miRNA disclosed herein) is operatively linked to a promoter. Exemplary promoters include, but are not limited to, the cytomegalovirus (CMV) immediate early promoter, RSV LTR, MoMLV LTR, phosphoglycerate kinase-1 (PGK) promoter, simian virus 40 (SV40) promoter and CK6 promoter, thyroxine transporter promoter (TTR), TK promoter, tetracycline-responsive promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter; cytomegalovirus enhancer / chicken β-actin / rabbit β-globin promoter (CAG promoter; Niwa et al., Gene [Gene], 1991, 108(2):193-9) and elongation factor 1-α promoter (EFl-α) promoter (Kim et al., Gene [Gene], 1990, 91(2):217-23 and Guo et al., Gene Ther. [Gene Therapy], 1996, 3(9):802-10). In some embodiments, the promoter comprises a human β-glucuronidase promoter or a cytomegalovirus enhancer linked to a chicken β-actin (CBA) promoter. The promoter may be a constitutive promoter, an inducible promoter, or a repressive promoter. In some embodiments, this disclosure provides a recombinant vector comprising a nucleic acid encoding a heterologous transgene of the present disclosure operatively linked to a CBA promoter. Exemplary promoters and descriptions can be found, for example, in U.S. Pre-Publication Publication 20140335054. In some embodiments, the promoter is a CBA promoter, a minimal CBA promoter, a CMV promoter, or a GUSB promoter. In some embodiments, the promoter is an hEF1a promoter.

[0174] Examples of constitutive promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with a CMV enhancer) [see, for example, Boshart et al., Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the 13-actin promoter, the glycerol phosphokinase (PGK) promoter, and the EFi promoter [Invitrogen].

[0175] Inducible promoters allow for the regulation of gene expression and can be modulated by the presence of exogenously supplied compounds, environmental factors (such as temperature), or specific physiological states, such as the acute phase, a specific differentiation state of the cell, or only in replicating cells. Inducible promoters and inducible systems are available from a variety of commercial sources, including but not limited to Ingenium, Clontech, and Ariad. Many other systems have been described and can be readily selected by those skilled in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline repressor system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline inducible system (Gossen et al., Science, 268:1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol. [Current Views in Chemical Biology]), 2:512-518 (1998)), the RU486 inducible promoter system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., GeneTher., 4:432-441 (1997)), and the rapamycin inducible promoter system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Other types of inducible promoters available in this context are promoters regulated by specific physiological states, such as temperature, acute phase, specific differentiation state of the cell, or only in replicating cells.

[0176] In another embodiment, a natural promoter or fragment thereof for transgene expression will be used. A natural promoter may be preferred when it is desired that transgene expression mimics natural expression. A natural promoter can be used when transgene expression must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimuli. In another embodiment, other natural expression control elements (such as enhancer elements, polyadenylation sites, or Kozak concordant sequences) may also be used to mimic natural expression.

[0177] In some embodiments, regulatory sequences confer tissue-specific gene expression capabilities. In some cases, tissue-specific regulatory sequences bind to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: neuron promoters, such as neuron-specific enolase (NSE) promoters (Andersen et al., Cell. Mol. Neurobiol., 13:503-15(1993)), neurofilament light chain gene promoters (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5(1991)), and neuron-specific vgf gene promoters (Piccioli et al., Neuron, 15:373-84(1995)). In some embodiments, the tissue-specific promoter is a promoter selected from the following genes: neuronal nucleus (NeuN), glial fibrillary acidic protein (GFAP), adenomatous colonic polyp (APC), and ionized calcium-binding adaptor molecule 1 (Iba-1). Other suitable tissue-specific promoters will be apparent to those skilled in the art. In some embodiments, the promoter is the chicken β-actin promoter.

[0178] In some embodiments, the promoter expresses a heterologous nucleic acid in cells of the CNS. Therefore, in some embodiments, the therapeutic peptides or therapeutic nucleic acids disclosed herein can be used to treat HD. In some embodiments, the promoter expresses a heterologous nucleic acid in brain cells. Brain cells can refer to any brain cells known in the art, including but not limited to neurons (such as sensory neurons, motor neurons, interneurons, dopaminergic neurons, medium-sized spinous neurons, cholinergic neurons, GABAergic neurons, pyramidal neurons, etc.), glial cells (such as microglia, macroglia, astrocytes, oligodendrocytes, ependymal cells, radial glial cells, etc.), brain parenchymal cells, microglia, ependymal cells, and / or Purkinje cells. In some embodiments, the promoter expresses a heterologous nucleic acid in neurons and / or glial cells. In some embodiments, neurons are medium-sized spinous neurons of the caudate nucleus, medium-sized spinous neurons of the putamen, neurons of cortical layer IV, and / or neurons of cortical layer V.

[0179] Various promoters for expressing transcripts (e.g., heterologous transgenes) in CNS cells, brain cells, neurons, and glial cells are known in the art and described herein. Such promoters may contain either a control sequence typically associated with the selected gene or a heterologous control sequence. Typically, useful heterologous control sequences include those derived from sequences encoding mammalian or viral genes. Examples include, but are not limited to, the SV40 early promoter, the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter (Ad MLP), the herpes simplex virus (HSV) promoter, cytomegalovirus (CMV) promoters (such as the CMV immediate early promoter region (CMVIE)), Rous sarcoma virus (RSV) promoters, synthetic promoters, heterozygous promoters, etc. Alternatively, sequences derived from non-viral genes (such as the mouse metallothionein gene) may also be used. Such promoter sequences are commercially available, for example, from Stratagene (San Diego, California). CNS-specific promoters and inducible promoters may be used. Examples of CNS-specific promoters include, but are not limited to, those isolated from CNS-specific genes such as myelin basic protein (MBP), glial fibrillary acidic protein (GFAP), and neuron-specific enolase (NSE). Examples of inducible promoters include, in particular, ecdysone, tetracycline, metallothionein, and hypoxia-responsive DNA elements.

[0180] This disclosure considers the use of recombinant viral genomes for introducing one or more nucleic acid sequences encoding artificial miRNAs as described herein, or for packaging into AAV viral particles. The recombinant viral genome may include any elements used to establish miRNA expression, such as promoters, heteronucleotides, ITRs, ribosome-binding elements, terminators, enhancers, selection markers, introns, polyA signals, and / or origins of replication. In some embodiments, the rAAV vector comprises one or more of enhancers, splice donor / acceptor pairs, matrix attachment sites, or polyadenylation signals.

[0181] In some embodiments, an effective amount of rAAV particles containing a vector encoding an artificial miRNA is applied at or near the application site (e.g., the striatum and / or cortex) or further away from the application site to transduce cells (e.g., CNS cells, brain cells, neurons, and / or glial cells). In some embodiments, more than one of about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 100% of neurons are transduced. In some embodiments, about 5% to about 100%, about 10% to about 50%, about 10% to about 30%, about 25% to about 75%, about 25% to about 50%, or about 30% to about 50% of neurons are transduced. Methods for identifying neurons transduced by recombinant viral particles expressing miRNA are known in the art; for example, expression can be detected using immunohistochemistry, RNA detection (e.g., qPCR, RNA blotting, RNA-seq, in situ hybridization, etc.) or the use of co-expressed markers (such as enhanced green fluorescent protein).

[0182] In some respects, this disclosure provides viral particles containing a recombinant self-complementary genome (e.g., a self-complementary rAAV vector). AAV viral particles having a self-complementary vector genome and methods using a self-complementary AAV genome are described in the following literature: U.S. Patent Nos. 6,596,535; 7,125,717; 7,465,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z. et al., (2003) Gene Ther [Gene Therapy] 10:2105-2111, each incorporated herein by reference in its entirety. rAAV containing a self-complementary genome will rapidly form a double-stranded DNA molecule using its partially complementary sequences (e.g., complementary coding and non-coding strands of a heterologous nucleic acid). In some embodiments, the vector comprises a first nucleic acid sequence encoding a heterologous nucleic acid and a second nucleic acid sequence encoding a complement of that nucleic acid, wherein the first nucleic acid sequence may form intra-strand base pairs with the second nucleic acid sequence along most or all of its length.

[0183] In some embodiments, a first heteronucleotide sequence encoding a miRNA and a second heteronucleotide sequence encoding a complement of that miRNA are linked by a mutated ITR (e.g., a right-hand ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5'-CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCC GGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG - 3' (SEQ ID NO: 114). The mutated ITR contains a deletion of the D region containing the terminal dissociation sequence. Therefore, during the replication of the AAV viral genome, the rep protein will not cleave the viral genome at the mutated ITR, and thus, a recombinant viral genome comprising the following in 5' to 3' order will be packaged in the viral capsid: AAV ITR, a first heteronucleotide sequence containing the regulatory sequence, the mutated AAV ITR, a second heteronucleotide sequence oriented opposite to the first heteronucleotide, and a third AAV ITR. V. Viral particles and methods of generating viral particles

[0184] This disclosure provides, in particular, recombinant viral particles comprising nucleic acids encoding the artificial miRNA disclosed herein, and methods of using them to treat diseases or disorders (e.g., HD) in mammals. Virus particles

[0185] This disclosure provides viral particles comprising miRNA molecules as disclosed herein. In some embodiments, this disclosure provides viral particles for delivering miRNA molecules as disclosed herein. For example, this disclosure provides a method for delivering miRNA using recombinant viral particles to treat diseases or disorders in mammals; for example, rAAV particles containing miRNA to treat HD. In some embodiments, the recombinant viral particle is a recombinant AAV particle. In some embodiments, the viral particle is a recombinant AAV particle containing nucleic acid comprising a sequence of an artificial miRNA of this disclosure flanked by one or two ITRs. The nucleic acid is capsidated in the AAV particle. The AAV particle also contains a capsid protein. In some embodiments, the nucleic acid comprises one or more target coding sequences (e.g., nucleic acids or miRNAs of this disclosure) and control sequences (including transcription start and stop sequences) operably linked in the transcriptional direction, thereby forming an expression construct. The expression construct is flanked by at least one functional AAV ITR sequence at the 5' and 3' ends. A “functional AAV ITR sequence” means an ITR sequence that functions as intended for the rescue, replication, and packaging of AAV virions. See Davidson et al., PNAS, 2000, 97(7):3428-32; Passini et al., J. Virol, 2003, 77(12):7034-40; and Pechan et al., Gene Ther, 2009, 16:10-16, all of which are incorporated herein by reference in their full text. In order to practice some aspects of this disclosure, the recombinant vector contains at least all the AAV sequences necessary for capsidation and the physical structure for rAAV infection. The AAV ITR used in the vectors of this disclosure does not need to have a wild-type nucleotide sequence (e.g., as described in Kotin, Hum. Gene Ther., 1994, 5:793-801) and can be altered by nucleotide insertion, deletion, or substitution, or the AAV ITR may be derived from any of several AAV serotypes. More than 40 AAV serotypes are currently known, and new serotypes and variants of existing serotypes continue to be identified. See Gao et al., PNAS, 2002, 99(18): 11854-6; Gao et al., PNAS, 2003, 100(10): 6081-6; and Bossis et al., J. Virol, 2003, 77(12): 6799-810. Any use of AAV serotypes is considered to be within the scope of this disclosure.In some embodiments, the rAAV vector is a vector derived from an AAV serotype, including but not limited to AAV ITRs such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV capsid serotypes. In some embodiments, the nucleic acid in the AAV contains the following ITRs: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV capsid serotypes. In some embodiments, the nucleic acid in the AAV further encodes a miRNA as described herein. In some embodiments, the rAAV particle comprises an AAV1, an AAV2HBKO capsid (e.g., as described in WO 2015168666), an AAV9 capsid, a PHP.B capsid, a PHP.eB capsid, or an Olig001 capsid.

[0186] For example, the nucleic acid in an AAV may contain at least one ITR of any AAV serotype considered herein, and may further encode a miRNA comprising a first strand and a second strand, wherein a) the first and second strands form a double helix; b) the first strand contains a guiding region; and c) the second strand contains a non-guiding region, wherein the non-guiding region contains a two-nucleotide deletion at bases 9 and 10 to create a protrusion in the guiding strand. In some embodiments, the vector may include a filler nucleic acid. In some embodiments, the filler nucleic acid may encode a green fluorescent protein. In some embodiments, the filler nucleic acid may be located between the promoter and the nucleic acid encoding the miRNA. In some embodiments, the filler nucleic acid is an A1AT filler nucleic acid.

[0187] Different AAV serotypes are used to optimize the transduction of specific target cells or to target specific cell types within specific target tissues (e.g., diseased tissues). rAAV particles may contain viral proteins and viral nucleic acids of the same or mixed serotypes. For example, in some embodiments, rAAV particles may contain an AAV1 capsid protein and at least one AAV2 ITR, or they may contain an AAV2 capsid protein and at least one AAV1 ITR. Any combination of AAV serotypes for generating rAAV particles is provided herein, as each combination is explicitly stated herein. In some embodiments, this disclosure provides rAAV particles containing an AAV1 capsid and a rAAV vector of this disclosure flanked by at least one AAV2 ITR (e.g., an expression construct containing nucleic acid encoding a miRNA of this disclosure). In some embodiments, this disclosure provides rAAV particles containing an AAV2 capsid. In some embodiments, the rAAV particle comprises an AAV1, an AAV2HBKO caption (e.g., as described in WO 2015168666), an AAV9 caption, a PHP.B caption, a PHP.eB caption, or an Olig001 caption.

[0188] In some respects, this disclosure provides viral particles containing recombinant self-complementary genomes. AAV viral particles with self-complementary genomes and methods for using self-complementary AAV genomes are described in the following literature: U.S. Patent Nos. 6,596,535; 7,125,717; 7,465,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z. et al., (2003) Gene Ther [Gene Therapy] 10:2105-2111, each incorporated herein by reference in its entirety. rAAV containing self-complementary genomes will rapidly form double-stranded DNA molecules using its partially complementary sequences (e.g., complementary coding and non-coding strands of the transgene). In some embodiments, this disclosure provides an AAV viral particle comprising an AAV genome, wherein the rAAV genome comprises a first heteropolynucleotide sequence (e.g., the miRNA disclosed herein) and a second heteropolynucleotide sequence (e.g., the antisense strand of the miRNA disclosed herein), wherein the first heteropolynucleotide sequence may form intrastrand base pairs with the second polynucleotide sequence along most or all of its length. In some embodiments, the first and second heteropolynucleotide sequences are linked by a sequence that promotes intrastrand base pairing (e.g., a hairpin DNA structure). Hairpin structures are known in the art, for example, in miRNA or siRNA molecules. In some embodiments, the first and second heteropolynucleotide sequences are linked by a mutated ITR (e.g., a right-hand ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5'-ttggccactccctctctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct-3' (SEQ ID NO: 115). The mutated ITR contains a deletion of the D region containing the terminal dissociation sequence. Therefore, during the replication of the AAV viral genome, the rep protein will not cleave the viral genome at the mutated ITR, and thus, the recombinant viral genome comprising the following in 5' to 3' order will be packaged in the viral capsid: AAVITR, a first heteropolynucleotide sequence containing the regulatory sequence, the mutated AAV ITR, a second heteropolynucleotide in the opposite orientation to the first heteropolynucleotide, and a third AAV ITR.In some embodiments, this disclosure provides an AAV viral particle comprising a recombinant viral genome comprising: a functional AAV2 ITR, a first polynucleotide sequence encoding the miRNA disclosed herein, a mutated AAV2 ITR comprising a deletion of the D region and lacking a functional terminal dissociation sequence, a second polynucleotide sequence comprising a complementary sequence of the first polynucleotide sequence encoding the miRNA disclosed herein, and the functional AAV2 ITR.

[0189] In some embodiments, this document provides viral particles containing the vector, wherein the viral particles are AAV particles capsidating the rAAV vector.

[0190] In some embodiments, the viral particle contains a modified AAV9 or AAV2 capsid protein. Production of viral particles

[0191] rAAV particles can be generated using methods known in the art. See, for example, U.S. Patent Nos. 6,566,118; 6,989,264; and 6,995,006. In practicing this disclosure, host cells used for generating rAAV particles include mammalian cells, insect cells, plant cells, microorganisms, and yeast. The host cell can also be a packaging cell in which the AAV rep and cap genes are stably maintained; or a production cell in which the AAV vector genome is stably maintained. Exemplary packaging and production cells are derived from 293 cells, A549 cells, or HeLa cells. The AAV vector is purified and formulated using standard techniques known in the art.

[0192] Methods known in the art for producing rAAV vectors include, but are not limited to, transfection, stable cell line production, and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al., (1997) J. Virology 71(11):8780-8789), and baculovirus-AAV hybrids. rAAV production cultures for producing rAAV viral particles require the following: 1) suitable host cells, including, in the case of baculovirus production systems, human cell lines such as HeLa, A549, or 293 cells, or insect cell lines such as SF-9; 2) suitable helper viral functions, provided by wild-type or mutant adenoviruses (e.g., temperature-sensitive adenoviruses), herpesviruses, baculoviruses, or plasmid constructs providing helper functions; 3) AAV rep and cap genes and gene products; 4) nucleic acids flanking at least one AAV ITR sequence (e.g., therapeutic nucleic acids); and 5) suitable culture media and culture medium components supporting rAAV production. In some embodiments, the AAV rep and cap gene products can be derived from any AAV serotype. Generally, but not necessarily, the AAV rep gene product has the same serotype as the ITR of the rAAV vector genome, provided that the rep gene product can function to replicate and package the rAAV genome. Suitable culture media known in the art can be used to generate rAAV vectors. These media include, but are not limited to, media produced by Hyclone Laboratories and JRH, including modified Eagle Medium (MEM), Durbeco Modified Eagle Medium (DMEM); custom formulations, such as those described in U.S. Patent No. 6,566,118; and Sf-900 II SFM medium as described in U.S. Patent No. 6,723,551, each of which is incorporated herein by reference in its entirety, particularly relating to custom culture medium formulations used in the generation of recombinant AAV vectors. In some embodiments, the AAV helper function is provided by adenovirus or HSV. In some embodiments, the AAV helper function is provided by baculovirus, and the host cell is an insect cell (e.g., Spodoptera frugiperda (Sf9) cells).

[0193] In some embodiments, rAAV particles can be generated via a triple transfection method, such as the exemplary triple transfection method provided below. In short, a plasmid containing the rep gene and capsid gene can be transfected (e.g., using the calcium phosphate method) together with a helper adenovirus plasmid into a cell line (e.g., HEK-293 cells), and the virus can be collected and optionally purified. Therefore, in some embodiments, rAAV particles are generated by triple transfecting a host cell with nucleic acid encoding the rAAV vector, nucleic acid encoding AAV rep and cap, and nucleic acid encoding AAV helper virus function, wherein transfecting the nucleic acid into the host cell produces host cells capable of producing rAAV particles.

[0194] In some embodiments, rAAV particles can be produced by a production cell line method, such as the exemplary production cell line method provided below (see also references in Martin et al., (2013) Human Gene Therapy Methods 24:253-269). Briefly, a cell line (e.g., HeLa cell line) can be stably transfected with a plasmid containing the rep gene, capsid gene, and promoter heterologous nucleic acid sequence. Cell lines can be screened to select a lead clone for rAAV production, which can then be amplified in a production bioreactor and infected with an adenovirus (e.g., wild-type adenovirus) as an assistant to initiate rAAV production. The virus can then be harvested, the adenovirus can be inactivated (e.g., by heating) and / or removed, and the rAAV particles can be purified. Thus, in some embodiments, rAAV particles are produced by a production cell line comprising one or more of the following: nucleic acids encoding an rAAV vector, nucleic acids encoding AAV rep and cap, and nucleic acids encoding AAV helper virus functions.

[0195] In some aspects, methods for generating any rAAV particles as disclosed herein are provided, the method comprising (a) culturing a host cell under conditions for generating rAAV particles, wherein the host cell contains (i) one or more AAV packaging genes, wherein each of the AAV packaging genes encodes an AAV replication and / or capsidation protein; (ii) an rAAV protovector containing a nucleic acid encoding a miRNA as disclosed herein, flanked by at least one AAV ITR; and (iii) an AAV helper function; and (b) recovering the rAAV particles generated by the host cell. In some embodiments, the at least one AAV ITR is selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV capsid serum ITR, etc. In some embodiments, the capsidated protein is selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (e.g., wild-type AAV6 capsid or variant AAV6 capsid such as ShH10, as described in U.S. Pre-Publication Publication 2012 / 0164106), AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 (e.g., wild-type AAV9 capsid, or modified AAV9 capsid as described in U.S. Pre-Publication Publication 2013 / 0323226), AAV10, AAVrh10, AAV11, AAV12, tyrosine capsid mutants, heparin-binding capsid mutants, AAV2R471A capsid, AAVAAV2 / 2-7m8 capsid, AAV... DJ costumes (e.g., AAV-DJ / 8 costume, AAV-DJ / 9 costume, or any other costume described in U.S. Pre-Grant Publication 2012 / 0066783), AAV2 N587A costume, AAV2 E548A costume, AAV2 N708A costume, AAV V708K costume, goat AAV costume, AAV1 / AAV2 chimeric costume, bovine AAV costume, mouse AAV costume, rAAV2 / HBoV1 costume, or AAV costumes as described in U.S. Patent No. 8,283,151 or International Publication No. WO / 2003 / 042397. In some embodiments, the AAV costume is the AAV2HBKO costume as described in WO 2015168666. In some embodiments, the AAV costume is the AAV9 costume. In some embodiments, the AAV costume is the PHP.B, PHP.eB, or Olig001 costume. In some embodiments, the mutant capsid protein retains the ability to form an AAV capsid.In some embodiments, the capsid protein is an AAV5 tyrosine mutant capsid protein. In another embodiment, the rAAV particle comprises a capsid protein from an AAV serotype derived from clade AF. In some embodiments, the rAAV particle comprises an AAV1 capsid and a recombinant genome containing an AAV2 ITR and nucleic acid encoding the miRNA disclosed herein. In yet another embodiment, the rAAV particle is purified. As used herein, the term "purified" includes a formulation of rAAV particles free from at least some other components that may also be present in the rAAV particle naturally present or where it was originally prepared. Thus, for example, purification techniques can be used to prepare isolated rAAV particles, enriching them from source mixtures such as culture lysates or production culture supernatants. Enrichment can be measured in a variety of ways, such as by the proportion of DNase-resistant particles (DRP) or genome copies (gc) present in solution or by infectivity, or it can be measured relative to a second potential interfering substance present in the source mixture, such as contaminants, including production culture contaminants or process contaminants, including helper viruses, culture medium components, etc.

[0196] Many methods for generating adenovirus vector particles are known in the art. For example, for internally disrupted adenovirus vectors, the adenovirus vector genome and the helper adenovirus genome can be transfected into a packaging cell line (e.g., the 293 cell line). In some embodiments, the helper adenovirus genome may contain recombination sites flanking its packaging signal, and both genomes can be transfected into a packaging cell line expressing recombinases (e.g., using the Cre / loxP system), such that the target adenovirus vector is packaged more efficiently than the helper adenovirus (see, for example, Alba, R. et al. (2005) Gene Ther. 12 Supplement 1:S18-27). Adenovirus vectors can be harvested and purified using standard methods, such as those described herein.

[0197] Many methods for generating lentiviral vector particles are known in the art. For example, for third-generation lentiviral vectors, a vector containing the target lentiviral genome with the gag and pol genes can be co-transfected with a vector containing the rev gene into a packaging cell line (e.g., the 293 cell line). The target lentiviral genome also contains a chimeric LTR that promotes transcription in the absence of Tat (see Dull, T. et al. (1998) J. Virol. [Journal of Virology] 72:8463-71). Lentiviral vectors can be harvested and purified using the methods described herein (e.g., Segura MM et al., (2013) Expert Opinion on Biology Ther. [Expert Opinion on Biology] 13(7):987-1011).

[0198] Many methods for generating HSV particles are known in the art. HSV vectors can be harvested and purified using standard methods, such as those described herein. For example, for replication-defective HSV vectors, the target HSV genome lacking all immediate early (IE) genes can be transfected into complementary cell lines that provide genes required for virus production, such as ICP4, ICP27, and ICP0 (see, for example, Samaniego, LA et al. (1998) J. Virol. [Journal of Virology] 72:3307-20). HSV vectors can be harvested and purified using methods described (e.g., Goins, WF et al., (2014) Herpes Simplex Virus Methods in Molecular Biology [Herpes Simplex Virus Methods in Molecular Biology] 1144:63-79).

[0199] This document also provides pharmaceutical compositions comprising recombinant viral particles and a pharmaceutically acceptable carrier, the recombinant viral particles containing a transgene encoding the miRNA disclosed herein. These pharmaceutical compositions are suitable for any of the administration methods described herein. Pharmaceutical compositions comprising recombinant viral particles encoding a nucleic acid encoding the miRNA disclosed herein can be introduced into the brain. For example, recombinant viral particles containing a nucleic acid encoding the miRNA disclosed herein can be administered intrastriatally. Any recombinant viral particles disclosed herein, including rAAV, adenovirus, lentivirus, and HSV particles, can be used.

[0200] In some embodiments, a pharmaceutical composition comprising recombinant viral particles and a pharmaceutically acceptable carrier is suitable for administration to humans, wherein the recombinant viral particles comprise a transgene encoding the miRNA disclosed herein. Such carriers are well known in the art (see, for example, Remington's Pharmaceutical Sciences, 15th edition, pp. 1035-1038 and 1570-1580). In some embodiments, a pharmaceutical composition comprising rAAV as described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, a pharmaceutical composition comprising recombinant lentiviral particles as described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, a pharmaceutical composition comprising recombinant adenovirus particles as described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, a pharmaceutical composition comprising recombinant HSV particles as described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration).

[0201] Pharmaceutically acceptable carriers of this type can be sterile liquids, such as water and oils, including those of petroleum, animal, plant, or synthetic origin, such as peanut oil, soybean oil, and mineral oil. Saline solutions, as well as aqueous solutions of dextran, polyethylene glycol (PEG), and glycerol, can also be used as liquid carriers, particularly for injectable solutions. Pharmaceutical compositions may further contain additional components such as preservatives, buffers, tonics, antioxidants and stabilizers, nonionic wetting or clarifying agents, thickeners, etc. The pharmaceutical compositions described herein can be packaged in single-unit doses or in multiple-dose formulations. These compositions are typically formulated as sterile and substantially isotonic solutions. VI. Treatment methods

[0202] Certain aspects of this disclosure relate to methods for treating HD in individuals in need by reducing HTT protein levels. In some embodiments, the invention provides a method for treating HD by administering an effective amount of an expression cassette (e.g., an expression cassette delivered in rAAV particles) for expressing the artificial miRNA disclosed herein.

[0203] Expression cassettes for expressing artificial miRNAs can be administered via various routes. In some embodiments, administration includes direct spinal injection and / or intracerebral administration. In some embodiments, administration is performed at sites selected from: the brain, medulla oblongata, pons, cerebellum, intracranial cavity, pericerebral meninges, dura mater, arachnoid mater, pia mater, cerebrospinal fluid (CSF) in the pericerebral subarachnoid space, deep cerebellar nuclei, cerebral ventricular system, subarachnoid space, striatum, cortex, septum, thalamus, hypothalamus, and brain parenchyma. In some embodiments, administration includes intraventricular injection into at least one lateral ventricle. In some embodiments, administration includes intrathecal injection in the cervical, thoracic, and / or lumbar regions. In some embodiments, administration includes intrastriatal injection. In some embodiments, administration includes intrathalamic injection.

[0204] In some embodiments, administration to the central nervous system may include an intraparenchymal route. In some embodiments, an intraparenchymal route may include the thalamus, striatum, or hippocampus. In some embodiments, administration to the central nervous system may include an intracerebrospinal fluid (CSF) route. In some embodiments, an intracerebrospinal fluid (CSF) route may include within the ventricles, cerebellomedullary cistern, or intrathecal. In some embodiments, administration to the central nervous system may include a peripheral route. In some embodiments, a peripheral route may include an intravenous route. In some embodiments, administration to the central nervous system may include an experimental route. In some embodiments, an experimental route may include an intranasal route.

[0205] In some embodiments, the route of administration (ROA) may include an intracerebrospinal fluid (CSF) ROA. In some embodiments, an intracerebrospinal fluid (CSF) ROA may include an intraventricular (ICV), intracerebellomedullary cistern (ICM), or intrathecal (IT) ROA.

[0206] An effective amount of rAAV (in particle form in some embodiments) is administered according to the treatment goal. For example, where a low transduction percentage can achieve the desired therapeutic effect, the treatment goal is typically met or exceeded. In some cases, this transduction level can be achieved by transducing: only about 1% to 5% of target cells of the desired tissue type, at least about 20% of cells of the desired tissue type in some embodiments, at least about 50% in some embodiments, at least about 80% in some embodiments, at least about 95% in some embodiments, and at least about 99% of cells of the desired tissue type in some embodiments. The rAAV composition can be administered by one or more administrations, which may be administered during the same procedure or at intervals of days, weeks, months, or years. One or more of any of the administration routes described herein may be used. In some embodiments, multiple carriers may be used to treat humans.

[0207] In some embodiments of the foregoing aspects, rAAV is administered by direct injection into the spinal cord, intrathecal injection, or intracisional injection. In some embodiments, rAAV is administered to more than one location in the spinal cord or cerebellomedullary cistern. In some embodiments, rAAV is administered to more than one location in the spinal cord. In some embodiments, rAAV is administered to one or more of the lumbar, thoracic, and cervical subarachnoid spaces of the spinal cord. In some embodiments, rAAV is administered to the cerebellomedullary cistern.

[0208] In some embodiments, the present invention provides a method for treating a person suffering from HD by administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding an artificial miRNA disclosed herein. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients.

[0209] In some embodiments, these methods include administering an effective amount of a pharmaceutical composition to the HD of an individual in need, the pharmaceutical composition comprising a recombinant viral vector encoding an artificial miRNA polypeptide disclosed herein. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 12 6 × 10 12 7 × 10 12 8 × 10 12 9 × 10 12 10 × 10 12 11 × 10 12 15 × 10 12 20 × 10 12 25 × 10 12 30 × 10 12 Or 50 × 10 12 Any one of the following: genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is approximately 5 × 10⁻⁶. 12 Up to 6 × 10 12 6 × 10 12 Up to 7 × 10 12 7 × 10 12 Up to 8 × 10 12 8 × 10 12 Up to 9 × 10 12 9 × 10 12 Up to 10 × 10 12 10 × 10 12 Up to 11 × 10 12 11 × 10 12 Up to 15 × 10 1215 × 10 12 Up to 20 × 10 12 20 × 10 12 Up to 25 × 10 12 25 × 10 12 Up to 30 × 10 12 30 × 10 12 Up to 50 × 10 12 Or 50 × 10 12 Up to 100 × 10 12 Any one of the following: genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is approximately 5 × 10⁻⁶. 12 Up to 10 × 10 12 10 × 10 12 Up to 25 × 10 12 Or 25 × 10 12 Up to 50 × 10 12 Any one of the following: genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 9 6 × 10 9 7 × 10 9 8 × 10 9 9 × 10 9 10 × 10 9 11 × 10 9 15 × 10 9 20 × 10 9 25 × 10 9 30 × 10 9 Or 50 × 10 9 Any one of the following: transduction units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is approximately 5 × 10⁻⁶. 9 Up to 6 × 10 9 6 × 10 9 Up to 7 × 10 9 7 × 10 9 Up to 8 × 10 9 8 × 10 9 Up to 9 × 10 9 9 × 10 9 Up to 10 × 10 9 10 × 10 9 Up to 11 × 10 9 11 × 10 9 Up to 15 × 10 915 × 10 9 Up to 20 × 10 9 20 × 10 9 Up to 25 × 10 9 25 × 10 9 Up to 30 × 10 9 30 × 10 9 Up to 50 × 10 9 Or 50 × 10 9 Up to 100 × 10 9 Any one of the following: transduction units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is approximately 5 × 10⁻⁶. 9 Up to 10 × 10 9 10 × 10 9 Up to 15 × 10 9 15 × 10 9 Up to 25 × 10 9 Or 25 × 10 9 Up to 50 × 10 9 Any one of the following: transduction units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 10 6 × 10 10 7 × 10 10 8 × 10 10 9 × 10 10 10 × 10 10 11 × 10 10 15 × 10 10 20 × 10 10 25 × 10 10 30 × 10 10 40 × 10 10 Or 50 × 10 10 Any of the following: infection units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 10 Up to 6 × 10 10 6 × 10 10 Up to 7 × 10 10 7 × 10 10 Up to 8 × 10 10 8 × 10 10 Up to 9 × 10 10 9 × 10 10 Up to 10 × 10 10 10 × 10 10Up to 11 × 10 10 11 × 10 10 Up to 15 × 10 10 15 × 10 10 Up to 20 × 10 10 20 × 10 10 Up to 25 × 10 10 25 × 10 10 Up to 30 × 10 10 30 × 10 10 Up to 40 × 10 10 40 × 10 10 Up to 50 × 10 10 Or 50 × 10 10 Up to 100 × 10 10 Any of the following: infection units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 10 Up to 10 × 10 10 10 × 10 10 Up to 15 × 10 10 15 × 10 10 Up to 25 × 10 10 Or 25 × 10 10 Up to 50 × 10 10 Any of the infection units / mL. In some embodiments, the viral particles are rAAV particles.

[0210] In some embodiments, the dose of viral particles administered to an individual is at least about 1 × 10⁻⁶. 8 From approximately 6 × 10 13 Any one of the following: genome copies / kg body weight. In some embodiments, the dose of viral particles administered to an individual is approximately 1 × 10⁻⁶. 8 Approximately 6×10 13 Any of the following: genome copies / kg body weight. In some embodiments, the dose of viral particles administered to an individual is approximately 1 × 10⁻⁶. 10 2×10 10 3×10 10 4×10 10 5×10 10 6×10 10 7×10 10 8×10 10 9×10 10 1×10 11 2×10 11 3×10 11 4×10 115×10 11 6×10 11 7×10 11 8×10 11 9×10 11 1×10 12 2×10 12 13×10 12 4×10 12 5×10 12 6×10 12 7×10 12 8×10 12 9×10 12 Or 1×10 13 Any of the following: genome copies / kg body weight.

[0211] In some embodiments, the total amount of viral particles administered to an individual is at least about 1 × 10⁻⁶. 9 From approximately 1 × 10 14 Any one of the genome copies. In some embodiments, the total amount of viral particles administered to an individual is approximately 1 × 10⁻⁶. 9 From approximately 1 × 10 14 Any one of the genome copies. In some embodiments, the total amount of viral particles administered to an individual is approximately 1 × 10⁻⁶. 11 2 × 10 11 3 × 10 11 4 × 10 11 5 × 10 11 6 × 10 11 7 × 10 11 8 × 10 11 9 × 10 11 1 × 10 12 2 × 10 12 3 × 10 12 4 × 10 12 5 × 10 12 6 × 10 12 7 × 10 12 8 × 10 12 9 × 10 12 1 × 10 13 2 × 10 13 13 × 10 13 4 × 10 13 5 × 10 13 6 × 10 13 7 × 10 13 8 × 1013 9 × 10 13 Or 1 × 10 14 Any one of the genome copies.

[0212] In some embodiments, this document provides a method for treating or preventing HD in a patient in need, the method comprising administering to the patient a composition comprising a miRNA comprising a guide strand and a follower strand for binding HTT mRNA, wherein the guide strand comprises the following nucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26. SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 or SEQ ID NO: 37.

[0213] In some embodiments, this document provides a method for reducing HTT expression in a patient with HD, the method comprising administering to the patient a composition comprising a miRNA comprising a guide strand and a follower strand for binding HTT mRNA, wherein the guide strand comprises the following nucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26. SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 or SEQ ID NO: 37.

[0214] In some respects, this paper provides various methods that include reducing the level of HTT protein in cells (e.g., cells of a human patient with HD). In some embodiments, the method may include introducing constructs expressing artificial miRNA sequences configured to reduce target (e.g., endogenous) HTT mRNA in human cells. The results of such methods provided herein can be seen in… Figures 1A-1B In some embodiments, the method may include using an artificial miRNA sequence as provided herein to target and reduce the level of human HTT (e.g., human HTT protein). In some embodiments, the artificial miRNA may be designed and sequenced based on factors including: (1) predicted on-target and off-target scores; (2) avoidance of known single nucleotide polymorphisms; (3) homology between human sequences and non-human primate sequences; or any combination thereof. According to some embodiments, Figure 1AResults were depicted for constructs expressing artificial miRNAs as described herein (e.g., SEQ ID NO: 1 - SEQ ID NO: 14). According to some embodiments, Figure 1B Results were depicted for constructs expressing artificial miRNAs as described herein (e.g., SEQ ID NO: 15 - SEQ ID NO: 37). For Figures 1A-1B The results shown, according to some embodiments, involve transfecting the artificial construct into cultured human HeLa cells. According to some embodiments, relative to... Figure 1A - The housekeeping gene marked "CTL" in Figure B was used to quantify human HTT mRNA using RT-dPCR. For Figures 1A-1B For each gene, the results are plotted as mean ± standard error of the mean (SEM). Dashed lines serve as references for the 0.75 and 0.5 fold change levels, respectively. One-way ANOVA and Dunnett's multiple comparisons with controls were used. The symbol defines the p values ​​of the group shown as follows, p <0.05, p <0.01, p <0.001 and p <0.0001.

[0215] In some respects, this article provides methods including artificial miRNAs for reducing target HTT in a dose-dependent manner, such as... Figure 2 The fold change of HTT mRNA relative to control (CTL) is depicted on the y-axis. Each artificial miRNA sequence is plotted along the y-axis. Figure 2 The x-axis represents the result. As described in this paper, almost all doses of the tested artificial miRNA sequences produced significant HTT mRNA knockdown relative to dose-matched controls.

[0216] In some embodiments, this document provides methods including artificial miRNAs configured to enhance strand bias and strand loading in human cells. In some embodiments, the strand loading characteristics of selected artificial miRNA sequences can be assessed in vitro by small RNA sequencing of total RNA isolated from transfected HeLa cells. Figures 3A-3CEach artificial miRNA can be expressed as a premiRNA hairpin loop containing a guide strand (antisense against the target) and / or a lagging strand. The premiRNA hairpin can be processed into its mature form such that one strand can be degraded, thereby allowing the other strand loaded into the RISC complex to permit target binding and / or degradation. In some embodiments, the preferred guide strand loaded into the RISC complex may be associated with the potential for reduced off-target activity via the lagging strand.

[0217] In some embodiments, a construct (e.g., gene, oligonucleotide sequence, expression construct, or expression cassette) expressing an artificial miRNA targeting HTT can be transfected into cultured human HeLa cells. In some embodiments, a small RNA library can be generated from each transfected well and sequenced to evaluate the efficacy of each miRNA. Figures 3A-3B The described chain bias and evaluation are as follows Figure 3C The 5' chain processing is described.

[0218] According to some embodiments, selected candidate artificial miRNAs are evaluated in vivo in rodent models of HD (YAC128 and BACHD) based on in vitro performance. In some embodiments, the method may include administration of the artificial miRNA via intraparenchymal injection. In some embodiments, intraparenchymal injection may include injection of a novel capsid AAV.SAN006 into the striatum (8E per YAC128 mouse). 10 One virus particle, and BACHD rat 1E 11 (Viral particles). Experimental results using the methods presented herein show that, after six weeks, all tested artificial miRNAs produced significant striatal knockdown of human HTT mRNA in the YAC128 model. Furthermore, for all tested HTT-targeting artificial miRNAs, a significant reduction in mutant HTT protein was observed in both rodent models, such as... Figures 4A-5 The description.

[0219] In some embodiments, various methods are described herein that include intrastriatal injection of SAN006-HTT artificial miRNA in a YAC128 mouse model of HD. Figures 4A-4B Results of such artificial miRNA sequences, as provided herein, based on some embodiments, are shown, demonstrating significant in vivo target binding in the YAC128 model. Figure 4A Transgenic human HTT mRNA quantified by RT-dPCR relative to a steward (e.g., a control or CTL) is shown. Figure 4BHuman mutant HTT protein was quantified by electrochemiluminescence assay (Meso Scale Diagnostics, LLC. or MSD) with specificity to the amplified multi-Q region.

[0220] Figure 5 This study demonstrates significant in vivo target binding of the artificial miRNA sequence in the BACHD model. The artificial miRNA-expressing SAN006-HTT was administered intrastriatally into a BACHD rat model of HD. Human mutant HTT protein was quantified by MSD electrochemiluminescence assay, which is specific to the amplified multi-Q region. Figure 5 The y-axis represents the fold change in total protein relative to the control (CTL) sequence at mHTT. The x-axis represents each artificial miRNA and also includes the CTL sequence. Data are plotted as mean ± standard error of mean (SEM), and each data point represents a single hemispherical striatum sample from each animal.

[0221] In some embodiments, various methods, including the use of artificial miRNAs provided herein, can improve the bias of the guide strand loading relative to the lagging strand relative to the in vitro strand bias of the guide strand. Results using examples of the various methods provided herein are shown in… Figure 6 In the diagram, the y-axis represents the percentage of guidance (e.g., total guidance + percentage of guidance in follower strands), and the x-axis represents each artificial miRNA. The in vivo guidance strand bias values ​​for the three artificial miRNAs (SEQ ID NO: 1, SEQ ID NO: 11, SEQ ID NO: 12) were >99%, while SEQ ID NO: 5 showed a guidance strand bias >98%. These results indicate a low probability that the predicted off-target effects of these sequences originate from follower strand activity. VII. Products and Reagent Kits

[0222] Kits or articles for use in the methods described herein are also provided. In each respect, the kits contain the compositions described herein in suitable packaging (e.g., recombinant viral particles of this disclosure, such as rAAV particles, containing nucleic acids encoding the miRNAs disclosed herein). Suitable packaging for the compositions described herein (such as striatal compositions) is known in the art and includes, for example, vials (e.g., sealed vials), containers, ampoules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), etc. These articles may be further sterilized and / or sealed.

[0223] This disclosure also provides kits comprising the compositions described herein, and may further include one or more instructions regarding methods of using the compositions, as described herein. The kits described herein may further include other materials deemed commercially and user-appropriate, including additional buffers, diluents, filters, needles, syringes, and packaging inserts with instructions for performing any of the methods described herein. For example, in some embodiments, the kit comprises: a composition comprising a recombinant viral particle encoding a transgenic miRNA of the disclosed herein, the composition being used to deliver at least 1 × 10⁻⁶ 1 / 2 ... 9 Delivery of a genome copy to the brain of a mammal such as those described herein (e.g., via intrastriatal administration) to a primate; a pharmaceutically acceptable carrier suitable for injection into the brain of a primate; and one or more of the following: a buffer, a diluent, a filter, a needle, a syringe, and a packaging insert having instructions for performing injection into the brain of a primate (e.g., intrastriatal administration). In some embodiments, the kit includes instructions for treating neurodegenerative disorders (e.g., HD) with the recombinant viral particles described herein. In some embodiments, the kit includes instructions for using the recombinant viral particles described herein according to any of the methods described herein. Example

[0224] This disclosure will be more fully understood by referring to the examples below. However, these examples should not be construed as limiting the scope of this disclosure. It should be understood that the examples and embodiments described herein are for illustrative purposes only, and various modifications or changes made based on these examples and embodiments will be conceived by those skilled in the art and should be included within the spirit and scope of this application and the appended claims. General Method plasmids for in vitro testing

[0225] Control or HTT-targeting artificial miRNAs were expressed from the construct as hairpins embedded in miR155, which were controlled by either the mammalian pGK promoter (artificial miRNAs SEQ ID NO: 1 - SEQ ID NO: 14) or the human CMV enhancer / chicken β-actin promoter (artificial miRNAs SEQ ID NO: 15 - SEQ ID NO: 37). HTT artificial miRNA sequences were designed and optimized to target the human HTT gene (SEQ ID NO: 103), which does not include the multi-Q region. Control sequences were designed for minimally seeded off-target gene regulation. HeLa cell culture and transfection

[0226] Wild-type human HeLa cells expressing endogenous levels of HTT mRNA were cultured in DMEM (Gibco #11965-092) + 10% FBS. Unless otherwise specified, cells were transfected with control or HTT-targeting artificial miRNA expression constructs using Opti-MEM serum-depleted medium (Gibco #31985062) and Lipofectamine 3000 (Invitrogen L300015) according to the manufacturer's instructions. At 72 h (SEQ ID NO: 15 - SEQ ID NO: 37) or 48 h (SEQ ID NO: 1 - SEQ ID NO: 14) post-transfection, the medium was aspirated and cells were lysed in QIAzol (QIAgen 79306) for RNA isolation. Dosage range experiments included dose-matched controls and normalization of total transfection contents using a carrier plasmid (Promega E488A). RNA isolation

[0227] After the addition of chloroform and phase separation, total RNA, including small RNAs <200 nt, was isolated from the aqueous phase. For samples intended for HTT mRNA screening, isolation was performed using the RNeasy 96 QIAcube HT kit (QIAgen #74171) according to the manufacturer's instructions. For samples intended for small RNA sequencing, total RNA (including fragments <200 nt) was isolated using the miRNeasy mini kit (QIAgen 217004) according to the manufacturer's instructions. RNA concentration and purity were assessed by measuring absorbance at A260 / A280 and A260 / A230 on a NanoDrop eight spectrophotometer (Thermo Scientific). Quantification of HTT mRNA by RT digital PCR (RTdPCR)

[0228] RNA samples were diluted to equal concentrations and tested using the QIAcuity 8 system (QIAgen) and the QIAcuity One-Step Virus RT-PCR Kit (QIAgen 1123145) for multiplex quantification of human HTT mRNA (IDT TaqMan Hs00918174_m1) and human TBP mRNA (IDT TaqMan Hs.PT.58v.39859774) via RT-dPCR. HTT mRNA values ​​were normalized relative to TBP levels and analyzed relative to control levels. Small RNA library generation and sequencing

[0229] Library generation and sequencing were performed using the Truseq Small RNA Library Kit (Azenta). Total RNA containing small RNA fractions was used to determine the strand processing of each artificial miRNA. Sequence reads were filtered based on size and quality and aligned against the host cell genome and a custom gene for each artificial miRNA. A custom Python script was used to extract data from the alignment files, generating a list of strand sequences and counts for each artificial miRNA, allowing for the calculation of guide-to-follower ratios and the highest-expressed guide sequence. ITR vector and AAV generation

[0230] To generate the recombinant AAV.SAN006 serotype vector encoding the artificial miRNA, the artificial miRNA cassette (e.g., an artificial construct or expression cassette) was cloned into a plasmid containing an AAV2 inverted terminal repeat (ITR), under the control of the human cytomegalovirus enhancer / chicken β-actin (CBA) promoter. The vector was provided by UMass Vector Core. In short, HEK293 cells were triple-transfected with three plasmids (containing ITR, AAV.SAN006 rep / cap, and Ad helper) in a 1:1:1 ratio. AAV purification was performed using cesium chloride ultracentrifugation, and the virus was titrated against the polyA sequence using qPCR and ddPCR. Animal models and care

[0231] All procedures were performed according to protocols approved by Sanofi's Institutional Animal Care and Use Committee (IACUC) and in accordance with the guidelines set forth in the NIH Laboratory Animal Care and Use Guidelines. One- to two-month-old YAC128 mice (Slow et al. 2003) or BACHD rats (Yu-Taeger et al. 2012) were housed in groups, except in stereotactic surgery studies where they were housed individually during recovery. The rodents were maintained in a 12-hour light / dark cycle with food and water readily available. Stereotactic injection using AAV-artificial miRNA vector

[0232] The surgery was performed under sterile conditions. The rodent was anesthetized with isoflurane exposure and secured to a stereotactic frame (Stoelting) with continuous isoflurane perfusion. The scalp was shaved, and a midline incision was made on the top of the head to expose the skull. A small burr hole was drilled in the skull above the desired location in the brain. The Hamilton syringe was attached to the micro-controlled stereotactic frame, and the needle was slowly lowered to the desired depth. For YAC128 intrastriatal injection, a syringe containing 4E... 104 μL of each particle was injected into each of two bilateral injection sites at an A / P ratio of 0.5, M / L ± 2.2, and D / V -3.0. For BACHD rats, the 5E-containing... 10 Five μL of each test sample was injected into each of two bilateral injection sites at an A / P ratio of 0.7, M / L ± 2.8, and D / V -5.5, determined proportionally based on the anterior fontanelle-zygos distance. Each test sample was injected at a rate of 0.5 μL / min. After injection, the syringe was left in the brain for one to two minutes to allow absorption of the test sample. The syringe was then lifted, and the incision was closed using a horizontal mattress suture pattern or a simple interrupted suture pattern. The animal was warmed and observed during recovery, and then isolated and monitored for 72 hours post-surgery. Six weeks after injection, the animal was euthanized by anesthesia with >150 mg / kg sodium pentobarbital. After the overdose, the animal was kept warm until cardiac perfusion with ice-cold PBS. striatal tissue homogenate

[0233] The striatal samples were physically homogenized in TE buffer (Omni Bead Ruptor or Fast-prep 24) and immediately aliquoted for RNA isolation. The total protein content of the striatal homogenate for protein quantification was assessed (Pierce BCA, Thermo Scientific). Quantification of human mHTT protein in the striatum using ECL (MSD)

[0234] Amplified human huntingtin (HTT) protein in mouse brain tissue lysates was determined using a semi-quantitative electrochemiluminescence (ECL) method. MSD plates were coated with monoclonal mouse antibodies generated targeting amino acids 1-17 of the HTT protein. The plates were then sealed, followed by loading standards and diluted samples. The HTT protein bound the immobilized antibody. Detection was performed using a biotinylated monoclonal mouse antibody (multi-Q region specific). A conjugated sulfotagged streptavidin was added to complete the assay. Finally, read buffer was added to the wells, and a voltage was applied to the plate electrodes via an MSD reader, causing the sulfotagged marker to emit light. The light intensity was then measured to quantify the HTT protein in the sample. A calibration curve was obtained by plotting the signal against a reference HTT protein concentration. The concentration of HTT protein in the sample was determined by interpolation and normalized to per mg of total homogenate protein. Example 1: Artificial miRNA sequences reduce endogenous HTT mRNA in human cells

[0235] Artificial miRNA (mRNA) sequences were engineered to target human HTT and were ordered based on: (1) predicted on-target and off-target scores (siSPOTR, Boudreau et al., 2013); (2) avoidance of known single nucleotide polymorphisms; and (3) homology between human sequences and non-human primate sequences. Thirty-seven mRNA sequences (e.g., SEQ ID NO: 1 - SEQ ID NO: 37) were selected for in vitro screening in wild-type HeLa human cell lines endogenously expressing HTT. Constructs of each mRNA candidate or control sequence in the miR155 scaffold were generated and transfected into cultured adherent HeLa cells. Of the thirty-seven mRNA sequences (SEQ ID NO: 1-SEQ ID NO: 37), thirty-one produced significantly knocked-down HTT mRNA relative to the control sequence, as determined by reverse transcription-digital polymerase chain reaction (RT-dPCR). Figures 1A-1B The results depicted are shown in the diagram. The constructs expressing artificial miRNAs SEQ ID NO: 1 - SEQ ID NO: 14 are depicted in the diagram. Figure 1A The results for artificial miRNAs SEQ ID NO: 15 - SEQ ID NO: 37 are depicted in [the table / text]. Figure 1B In the middle. The artificial construct was transfected into cultured human HeLa cells. Compared to in Figures 1A-1B The housekeeping gene marked "CTL" was used to quantify human HTT mRNA by RT-dPCR. Results for each gene were plotted as mean ± standard error of mean (SEM). Dashed lines serve as references for fold change levels of 0.75 and 0.5, respectively. One-way ANOVA and Dunnett multiple comparisons with controls were used. The symbol defines the p values ​​of the group shown as follows: p <0.05, p <0.01, p <0.001, and p <0.0001.

[0236] Selected artificial miRNA sequences with the highest HTT mRNA knockdown were chosen, and the dose-dependent nature of HTT mRNA knockdown was tested. Selected constructs expressing the artificial miRNA sequences SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 14 were transfected into cultured human HeLa cells. Control sequences (CTLs) were also used. Each sequence was administered at doses of 50 ng, 100 ng, and 150 ng. Dosing results are depicted in... Figure 2 The fold change in HTT mRNA relative to the control (CTL) is shown on the y-axis. Each artificial miRNA is shown on the x-axis. Almost all tested artificial miRNA sequences at nearly all doses produced significant HTT mRNA knockdown relative to the dose-matched control. Each data point is the mean of three technical replicates; solid lines represent the mean; dashed lines represent fold change levels of 0.75 and 0.5. Unless otherwise stated, all artificial miRNAs produced significant HTT mRNA reduction relative to the dose-specific CTL. For analysis, two-way ANOVA and Dunnett's multiple comparisons were used. P values ​​were as follows: 0.00001 < p < 0.05. Example 2: Artificial miRNA sequences exhibit excellent guide strand bias and 5' end processing in vitro.

[0237] The strand loading characteristics of selected artificial miRNA sequences were also evaluated in vitro by small RNA sequencing of total RNA isolated from transfected HeLa cells. Figures 3A-3C Each artificial miRNA was expressed as a premiRNA hairpin loop containing both a guide strand (antisense against the target) and a lagging strand. The premiRNA hairpin was processed into its mature form such that one strand was degraded, and the other strand loaded into the RISC complex allowed for target binding and degradation. The preferred guide strand loaded into the RISC complex was associated with the likelihood of reduced off-target activity via the lagging strand.

[0238] Selected constructs expressing artificial miRNAs targeting HTT were transfected into cultured human HeLa cells. Small RNA libraries were generated from each transfected well and sequenced to evaluate strand bias for each miRNA. Figures 3A-3B ) and 5' chain processing ( Figure 3C SEQ ID NO: 1, SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO: 24, and SEQ ID NO: 28 all show that >95% of the total artificial miRNA population is the guide strand, such as Figures 3A-3B As described. Additionally, 5' sequencing (e.g., 5' strand processing) of the guide strand population was evaluated for selected artificial miRNAs, and it was found to be accurate (>95%) for all sequences tested, such as... Figure 3C The description. Figures 3A-3C The data point representation technique in the text is repeated. Example 3: Artificial miRNA sequences reduce in vivo HTT after AAV-mediated intraparenchymal delivery.

[0239] Based on in vitro performance, selected candidate artificial miRNAs were evaluated in vivo in rodent models of hepatitis D (HD). YAC128 mice (Slow et al., 2003) and BACHD rats (Yu-Taeger et al., 2012) are well-characterized HD strains, each expressing full-length human mutant HTT, and are therefore suitable for evaluating in vivo target binding. In each of these strains, a novel capsid AAV.SAN006 (8E per YAC128 mouse) was used. 10 One particle, 1E per BACHD rat 11 (1 particle) The indicated artificial miRNA was delivered to the striatum via intraplasmic injection. Six weeks later, in the YAC128 model, all tested artificial miRNAs produced significant striatal knockdown of human HTT mRNA, and importantly, in both rodent models, a significant reduction in mutant HTT protein was observed for all tested HTT-targeting artificial miRNAs. Figures 4A-5 ).

[0240] Figures 4A-4B The artificial miRNA sequence exhibiting significant in vivo target binding in the YAC128 model is shown. The SAN006-HTT artificial miRNA was injected intrastriatally into the YAC128 mouse model of HD. Mean ± SEM, data points represent a single hemispherical striatal sample from each animal. One-way ANOVA, Dunnett multiple comparisons with control, p <0.05, p <0.01, p <0.001, p <0.0001. Figure 4A The transgenic human HTT mRNA, quantified by RT-dPCR relative to the housekeeper, is shown. Figure 4B The human mutant HTT protein was quantified by MSD electrochemiluminescence, which is specific to the amplified multi-Q region.

[0241] Figure 5 This study demonstrates significant in vivo target binding of the artificial miRNA sequence in the BACHD model. The artificial miRNA-expressing SAN006-HTT was administered intrastriatally into a BACHD rat model of HD. Human mutant HTT protein was quantified by electrochemiluminescence assay (MSD) with specificity to the amplified multi-Q region. Data are plotted as mean ± standard error of mean (SEM), and data points represent a single hemispherical striatal sample from each animal. For analysis, one-way ANOVA and Dunnett multiple comparisons with controls were used. P-values ​​are shown below: p <0.05, p <0.01, p <0.001, p <0.0001. Example 4: Artificial miRNA sequences show in vivo strand bias

[0242] In vivo strand loading of sequences tested in vivo via AAV.SAN006 striatal delivery in the HD YAC128 mouse model was also evaluated using small RNA sequencing. Total RNA (including fragments <200 nt) was isolated from striatal tissue samples from each animal and used to generate small RNA libraries. The small RNA libraries were then sequenced to evaluate strand bias.

[0243] For each artificial miRNA, the bias of the guide strand loading relative to the lagging strand was improved relative to the in vitro guide strand bias. Results were plotted in... Figure 6 In the diagram, the y-axis represents the percentage of guidance (total guidance + follower), and each artificial miRNA is shown on the x-axis. Three artificial miRNAs (SEQ ID NO: 1, SEQ ID NO: 11, SEQ ID NO: 12) showed in vivo guidance chain bias values ​​>99%, while SEQ ID NO: 5 showed a guidance chain bias >98%. These results suggest a low probability that these sequences originated from off-target effects of follower chain activity. Example Overview

[0244] Thirty-seven artificial miRNA sequences were designed to target human HTT based on their predicted on-target and off-target scores, avoidance of known single nucleotide polymorphisms, and homology between human and non-human primate sequences. These sequences were expressed in a human cervical cancer cell line (HeLa) expressing endogenous human HTT, and HTT mRNA knockdown was assessed by RT-dPCR. In this case, the chain loading of the selected sequences' artificial miRNAs (e.g., amiRNAs) was also evaluated by small RNA sequencing. These in vitro data enabled downselection of sequences for in vivo pharmacology experiments. Using the capsid AAV.SAN006, the selected artificial miRNAs were delivered via intrastriatal injection to two rodent models of HD (YAC128 mice and BACHD rats), and HTT mRNA and HTT protein knockdown in striatal tissues were evaluated after six weeks. In vivo chain loading of the selected artificial miRNAs was also evaluated in the YAC128 mouse model by small RNA sequencing of striatal RNA samples. Other sequence lists Target peptide amino acid sequence KGGGFHG (SEQ ID NO: 100) Target peptide-amino acid sequence with flanks as linkers AAAKGGGFHGAS (SEQ ID NO: 101) SAN0006 capsid amino acid sequence (complete structural protein) Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30 Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly 145 150 155 160 Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190 Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205 Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415 Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445 Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460 Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro 465 470 475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510 Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525 Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540 Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile 545 550 555 560 Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575 Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Ala Ala Lys 580 585 590 Gly Gly Gly Phe His Gly Ala Ser Ala Gln Ala Gln Thr Gly Trp Val 595 600 605 Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln Asp Arg Asp Val 610 615 620 Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn 625 630 635 640 Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met Lys His Pro Pro 645 650 655 Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asp Pro Pro Thr 660 665 670 Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr Gln Tyr Ser Thr 675 680 685 Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser 690 695 700 Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys Ser 705 710 715 720 Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val Tyr Ser Glu Pro 725 730 735 Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu(SEQ ID NO: 102) 740 745 Huntington protein (HTT) in Homo sapiens, transcript variant 1, mRNA NCBI Reference Sequence: NM_001388492.1 1 gctgccggga cgggtccaag atggacggcc gctcaggttc tgcttttacc tgcggcccag 61 agccccattc attgccccgg tgctgagcgg cgccgcgagt cggcccgagg cctccgggga 121 ctgccgtgcc gggcgggaga ccgccatggc gaccctggaa aagctgatga aggccttcga 181 gtccctcaag tccttccagc agcagcagca gcagcagcag cagcagcagc agcagcagca 241 gcagcagcag cagcaacagc cgccaccgcc gccgccgccg ccgccgcctc ctcagcttcc 301 tcagccgccg ccgcaggcac agccgctgct gcctcagccg cagccgcccc cgccgccgcc 361 cccgccgcca cccggcccgg ctgtggctga ggagccgctg caccgaccaa agaaagaact 421 ttcagctacc aagaaagacc gtgtgaatca ttgtctgaca atatgtgaaa acatagtggc 481 acagtctgtc agaaattctc cagaatttca gaaacttctg ggcatcgcta tggaactttt 541 tctgctgtgc agtgatgacg cagagtcaga tgtcaggatg gtggctgacg aatgcctcaa 601 caaagttatc aaagctttga tggattctaa tcttccaagg ttacagctcg agctctataa 661 ggaaattaaa aagaatggtg cccctcggag tttgcgtgct gccctgtgga ggtttgctga 721 gctggctcac ctggttcggc ctcagaaatg caggccttac ctggtgaacc ttctgccgtg 781 cctgactcga acaagcaaga gacccgaaga atcagtccag gagaccttgg ctgcagctgt 841 tcccaaatt atggcttctt ttggcaattt tgcaaatgac aatgaaatta aggttttgtt 901 aaaggccttc atagcgaacc tgaagtcaag ctcccccacc attcggcgga cagcggctgg 961 atcagcagtg agcatctgcc agcactcaag aggacacaa tatttctata gttggctact 1021 aaatgtgctc ttaggcttac tcgttcctgt cgaggatgaa cactccactctgctgattct 1081 tggcgtgctg ctcaccctga ggtatttggt gcccttgctg cagcagcaggtcaaggacac 1141 aagcctgaaa ggcagcttcg gagtgacaag gaaagaaatg gaagtctctccttctgcaga 1201 gcagcttgtc caggtttatg aactgacgtt acatcataca cagcaccaagaccacaatgt 1261 tgtgaccgga gccctggagc tgttgcagca gctcttcaga acgcctccacccgagcttct 1321 gcaaaccctg accgcagtcg ggggcattgg gcagctcacc gctgctaaggaggagtctgg 1381 tggccgaagc cgtagtggga gtattgtgga acttatagct ggagggggttcctcatgcag 1441 ccctgtcctt tcaagaaaac aaaaaggcaa agtgctctta ggagaagaagaagccttgga 1501 ggatgactct gaatcgagat cggatgtcag cagctctgcc ttaacagcctcagtgaagga 1561 tgagatcagt ggagagctgg ctgcttcttc aggggtttcc actccagggtcagcaggtca 1621 tgacatcatc acagaacagc cacggtcaca gcacacactg caggcggactcagtggatct 1681 ggccagctgt gacttgacaa gctctgccac tgatggggat gaggaggatatcttgagcca 1741 cagctccagc caggtcagcg ccgtcccatc tgaccctgcc atggacctgaatgatgggac 1801 ccaggcctcg tcgcccatca gcgacagctc ccagaccacc accgaagggcctgattcagc 1861 tgttacccct tcagacagtt ctgaaattgt gttagacggt accgacaaccagtatttggg 1921 cctgcagatt ggacagcccc aggatgaaga tgaggaagcc acaggtattcttcctgatga 1981 agcctcggag gccttcagga actcttccat ggcccttcaa caggcacatttattgaaaaa 2041 catgagtcac tgcaggcagc cttctgacag cagtgttgat aaatttgtgttgagagatga 2101 agctactgaa ccgggtgatc aagaaaacaa gccttgccgc atcaaaggtgacattggaca 2161 gtccactgat gatgactctg cacctcttgt ccattgtgtc cgccttttatctgcttcgtt 2221 tttgctaaca gggggaaaaa atgtgctggt tccggacagg gatgtgagggtcagcgtgaa 2281 ggccctggcc ctcagctgtg tgggagcagc tgtggccctc cacccggaatctttcttcag 2341 caaactctat aaagttcctc ttgacaccac ggaataccct gaggaacagtatgtctcaga 2401 catcttgaac tacatcgatc atggagaccc acaggttcga ggagccactgccattctctg 2461 tgggaccctc atctgctcca tcctcagcag gtcccgcttc cacgtgggagattggatggg 2521 caccattaga accctcacag gaaatacatt ttctttggcg gattgcattcctttgctgcg 2581 gaaaacactg aaggatgagt cttctgttac ttgcaagtta gcttgtacagctgtgaggaa 2641 ctgtgtcatg agtctctgca gcagcagcta cagtgagtta ggactgcagctgatcatcga 2701 tgtgctgact ctgaggaaca gttcctattg gctggtgagg acagagcttctggaaaccct 2761 tgcagagatt gacttcaggc tggtgagctt tttggaggca aaagcagaaaacttacacag 2821 aggggctcat cattatacag ggcttttaaa actgcaagaa cgagtgctcaataatgttgt 2881 catccatttg cttggagatg aagaccccag ggtgcgacat gttgccgcagcatcactaat 2941 taggcttgtc ccaaagctgt tttataaatg tgaccaagga caagctgatccagtagtggc 3001 cgtggcaaga gatcaaagca gtgtttacct gaaacttctc atgcatgagacgcagcctcc 3061 atctcatttc tccgtcagca caataaccag aatatataga ggctataacctactaccaag 3121 cataacagac gtcactatgg aaaataacct ttcaagagtt attgcagcagtttctcatga 3181 actaatcaca tcaaccacca gagcactcac atttggatgc tgtgaagctttgtgtcttct 3241 ttccactgcc ttcccagttt gcatttggag tttaggttgg cactgtggagtgcctccact 3301 gagtgcctca gatgagtcta ggaagagctg taccgttggg atggccacaatgattctgac 3361 cctgctctcg tcagcttggt tcccattgga tctctcagcc catcaagatgctttgatttt 3421 ggccggaaac ttgcttgcag ccagtgctcc caaatctctg agaagttcatgggcctctga 3481 agaagaagcc aacccagcag ccaccaagca agaggaggtc tggccagccctgggggaccg 3541 ggccctggtg cccatggtgg agcagctctt ctctcacctg ctgaaggtgattaacatttg 3601 tgcccacgtc ctggatgacg tggctcctgg acccgcaata aaggcagccttgccttctct 3661 aaaacccc ccttctctaa gtcccatccg acgaaagggg aaggagaaagaaccaggaga 3721 acaagcatct gtaccgttga gtcccaagaa aggcagtgag gccagtgcagcttctagaca 3781 atctgatacc tcaggtcctg ttacaacaag taaatcctca tcactggggagtttctatca 3841 tcttccttca tacctcaaac tgcatgatgt cctgaaagct acacacgctaactacaaggt 3901 cacgctggat cttcagaaca gcacggaaaa gtttggaggg tttctccgctcagccttgga 3961 tgttctttct cagatactag agctggccac actgcaggac attgggaagtgtgttgaaga 4021 gatcctagga tacctgaaat cctgctttag tcgagaacca atgatggcaactgtttgtgt 4081 tcaacaattg ttgaagactc tctttggcac aaacttggcc tcccagtttgatggcttatc 4141 ttccaacccc agcaagtcac aaggccgagc acagcgcctt ggctcctccagtgtgaggcc 4201 aggcttgtac cactactgct tcatggcccc gtacacccac ttcacccaggccctcgctga 4261 cgccagcctg aggaacatgg tgcaggcgga gcaggagaac gacacctcgggatggtttga 4321 tgtcctccag aaagtgtcta cccagttgaa gacaaacctc acgagtgtcacaaagaaccg 4381 tgcagataag aatgctattc ataatcacat tcgtttgttt gaacctcttgttataaaaagc 4441 tttaaaacag tacacgacta caacatgtgt gcagttacag aagcaggttttagatttgct 4501 ggcgcagctg gttcagttac gggttaatta ctgtcttctg gattcagatcaggtgtttat 4561 tggctttgta ttgaaaacagt ttgaatacat tgaagtgggc cagttcagggaatcagaggc 4621 aatcattcca aacatctttt tcttcttggt attactatct tatgaacgctatcattcaaa 4681 acagatcatt ggaattccta aaatcattca gctctgtgat ggcatcatggccagtggaag 4741 gaaggctgtg acacatgcca taccggctct gcagcccata gtccacgacctctttgtatt 4801 aagaggaaca aataaagctg atgcaggaaa agagcttgaa acccaaaaagaggtggtggt 4861 gtcaatgtta ctgagactca tccagtacca tcaggtgttg gagatgttcattctctctct 4921 gcagcagtgc cacaaggaga atgaagacaa gtggaagcga ctgtctcgacagatagctga 4981 catcatcctc ccaatgttag ccaaacagca gatgcacatt gactctcatgaagcccttgg 5041 agtgttaaat acattattg agattttggc cccttcctcc ctccgtccggtagacatgct 5101 tttacggagt atgttcgtca ctccaaacac aatggcgtcc gtgagcactgttcaactgtg 5161 gatatcggga attctggcca tttgagggt tctgatttcc cagtcaactgaagatattgt 5221 tctttctcgt attcaggagc tctccttctc tccgtattta atctcctgtacagtaattaa 5281 taggttaaga gatggggaca gtacttcaac gctagaagaa cacagtgaagggaaaaaaat 5341 aaagaatttg ccagaagaaa cattttcaag gtttctatta caactggttggtattcttt 5401 agaagacatt gttacaaaac agctgaaggt ggaaatgagt gagcagcaacatactttcta 5461 ttgccaggaa ctaggcacac tgctaatgtg tctgatccac atcttcaagtctggaatgtt 5521 ccggagaatc acagcagctg ccactaggct gttccgcagt gatggctgtggcggcagttt 5581 ctacaccctg gacagcttga acttgcgggc tcgttccatg atcaccacccacccggccct 5641 ggtgctgctc tggtgtcaga tactgctgct tgtcaaccac accgactaccgctggtgggc 5701 agaagtgcag cagaccccga aaagacacag tctgtccagc acaaagttacttagtcccca 5761 gatgtctgga gaagaggagg attctgactt ggcagccaaa cttggaatgtgcaatagaga 5821 aatagtacga agaggggctc tcattctctt ctgtgattat gtctgtcagaacctccatga 5881 ctccgagcac ttaacgtggc tcattgtaaa tcacattcaa gatctgatcagcctttccca 5941 cgagcctcca gtacaggact tcatcagtgc cgttcatcgg aactctgctgccagcggcct 6001 gttcatccag gcaattcagt ctcgttgtga aaacctttca actccaaccatgctgaagaa 6061 aactcttcag tgcttggagg ggatccatct cagccagtcg ggagctgtgctcacgctgta 6121 tgtggacagg cttctgtgca cccctttccg tgtgctggct cgcatggtcgacatccttgc 6181 ttgtcgccgg gtagaaatgc ttctggctgc aaatttacag agcagcatggcccagttgcc 6241 aatggaagaa ctcaacagaa tccaggaata ccttcagagc agcgggctcgctcagagaca 6301 ccaaaggctc tattccctgc tggacaggtt tcgtctctcc accatgcaagactcacttag 6361 tccctctcct ccagtctctt cccacccgct ggacggggat gggcacgtgtcactggaaac 6421 agtgagtccg gacaaagact ggtacgttca tcttgtcaaa tcccagtgttggaccaggtc 6481 agattctgca ctgctggaag gtgcagagct ggtgaatcgg attcctgctgaagatatgaa 6541 tgccttcatg atgaactcgg agttcaacct aagcctgcta gctccatgcttaagcctagg 6601 gatgagtgaa atttctggtg gccagaagag tgcccttttt gaagcagcccgtgaggtgac 6661 tctggcccgt gtgagcggca ccgtgcagca gctccctgct gtccatcatgtcttccagcc 6721 cgagctgcct gcagagccgg cggcctactg gagcaagttg aatgatctgtttggggatgc 6781 tgcactgtat cagtccctgc ccactctggc ccgggccctg gcagagtacctggtggtggt 6841 ctccaaactg cccagtcatt tgcaccttcc tcctgagaaa gagaaggacattgtgaaatt 6901 cgtggtgca acccttgagg cctgtcctg gcattgatc catgagcagatcccgctgag 6961 tctggatctc caggcaggggc tggactgctg ctgcctggcc ctgcagctgcctggctctg 7021 gagcgtgtc tcctccacag agtttgtgac ccacgctgc tcctcatctactgtgtgca 7081 cttcatcctg gaggccgttg cagtgcagcc tggagcag cttcttagtccagaagaag 7141 vakaaatacc ccaaagcca tcagcgagga gggaggaa gtagatccaacacacagaa 7201 tcctaagtat atcactgcag cctgtgagat gtggcagaa atggtggagtctctgcagtc 7261 gtgttggcc ttgggtcata aaggaatag cggcgtgccg gcgtttctcacgccattgct 7321 aaggaacatc atcatcagcc tggccgcct gccccttgtc aacagctacacacgtgtgcc 7381 cccactgtg tggagcttg gatggtcacc caaccggga ggggattttggcaccatt 7441 ccctgagatc cccgtggagt tcctccagga aaggaagtc ttaggagttcatctaccg 7501 catcacaca ctaggctgga ccagtcgtac tcagtttgaa gaacttgggccaccctcct 7561 tggtgtcctg gtgacgcagc cctcgtgat ggagcaggag gagagcccaccagagaagaaga 7621 cacagagagg acccagatca acgtcctggc cgtgcaggcc atcacctcactggtgctcag 7681 tgcaatgact gtgcctgtgg ccggcaaccc agctgtaagc tgcttggagcagcagccccg 7741 gaacaagcct ctgaaagctc tcgacaccag gtttgggagg aagctgagcattatcagagg 7801 gattgtggag caagagattc aagcaatggt ttcaaagaga gagaatattgccacccatca 7861 tttatatcag gcatgggatc ctgtcccttc tctgtctccg gctactacaggtgccctcat 7921 cagccacgag aagctgctgc tacagatcaa ccccgagcgg gagctgggggagcatgagcta 7981 caaactcggc caggtgtcca tacactccgt gtggctgggg aacagcatcacacccctgag 8041 ggaggaggaa tgggacgagg aagaggga ggaggccgac gcccctgcaccttcgtcacc 8101 acccacgtct ccagtcaact ccaggaaaca ccgggctgga gttgacatccactcctgttc 8161 gcagtttttg cttgagttgt acagccgctg gatcctgccg tccagctcagccaggaggac 8221 cccggccatc ctgatcagtg aggtggtcag atcccttcta gtggtctcagacttgttcac 8281 cgagcgcaac cagtttgagc tgatgtatgt gacgctgaca gaactgcgaagggtgcaccc 8341 ttcagaagac gagatcctcg ctcagtacct ggtgcctgcc acctgcaaggcagctgccgt 8401 ccttgggatg gacaaggccg tggcggagcc tgtcagccgc ctgctggagagcacgctcag 8461 gagcagccac ctgcccagca gggttggagc cctgcacggc gtcctctatgtgctggagtg 8521 cgacctgctg gacgacactg ccaagcagct catcccggtc atcagcgactatctcctctc 8581 caacctgaaa gggatcgccc actgcgtgaa cattcacagc cagcagcacgtactggtcat 8641 gtgtgccact gcgttttacc tcattgagaa ctatcctctg gacgtagggccggaattttc 8701 agcatcaata atacagatgt gtggggtgat gctgtctgga agtgaggagtccaccccctc 8761 catcatttac cactgtgccc tcagaggcct ggagcgcctc ctgctctctgagcagctctc 8821 ccgcctggat gcagaatcgc tggtcaagct gagtgtggac agagtgaacgtgcacagccc 8881 gcaccgggcc atggcggctc tgggcctgat gctcacctgc atgtacacaggaaaggagaa 8941 agtcagtccg ggtagaactt cagaccctaa tcctgcagcc cccgacagcgagtcagtgat 9001 tgttgctatg gagcgggtat ctgttctttt tgataggatc aggaaaggctttccttgtga 9061 agccagagtg gtggccagga tcctgcccca gtttctagac gacttcttcccaccccagga 9121 catcatgaac aaagtcatcg gagagtttct gtccaaccag cagccatacccccagttcat 9181 ggccaccgtg gtgtataagg tgtttcagac tctgcacagc accgggcagtcgtccatggt 9241 ccgggactgg gtcatgctgt ccctctccaa cttcacgcag agggccccggtcgccatggc 9301 cacgtggagc ctctcctgct tctttgtcag cgcgtccacc agcccgtgggtcgcggcgat 9361 cctcccacat gtcatcagca ggatgggcaa gctggagcag gtggacgtgaaccttttctg 9421 cctggtcgcc acagacttct acagacacca gatagaggag gagctcgaccgcagggcctt 9481 ccagtctgtg cttgaggtgg ttgcagcccc aggaagccca tatcaccggctgctgacttg 9541 tttacgaaat gtccacaagg tcaccacctg ctgagcgcca tggtgggagagactgtgagg 9601 cggcagctgg ggccggagcc tttggaagtc tgcgcccttg tgccctgcctccaccgagcc 9661 agcttggtcc ctatgggctt ccgcacatgc cgcgggcggc caggcaacgtgcgtgtctct 9721 gccatgtggc agaagtgctc tttgtggcag tggccaggca gggagtgtctgcagtcctgg 9781 tggggctgag cctgaggcct tccagaaagc aggagcagct gtgctgcaccccatgtgggt 9841 gaccaggtcc tttctcctga tagtcacctg ctggttgttg ccaggttgcagctgctcttg 9901 catctgggcc agaagtcctc cctcctgcag gctggctgtt ggcccctctgctgtcctgca 9961 gtagaaggtg ccgtgagcag gctttgggaa cactggcctg ggtctccctggtggggtgtg 10021 catgccacgc cccgtgtctg gatgcacaga tgccatggcc tgtgctgggccagtggctgg 10081 gggtgctaga cacccggcac cattctccct tctctctttt cttctcaggatttaaaattt 10141 aattatatca gtaaagagat taattttaac gtaactcttt ctatgcccgtgtaaagtatg 10201 tgaatcgcaa ggcctgtgct gcatgcgaca gcgtccgggg tggtggacagggcccccggc 10261 cacgctccct ctcctgtagc cactggcata gccctcctga gcacccgctgacatttccgt 10321 tgtacatgtt cctgtttatg cattcacaag gtgactggga tgtagagaggcgttagtggg 10381 caggtggcca cagcaggact gaggacaggc ccccattatc ctaggggtgcgctcacctgc 10441 agcccctcct cctcgggcac agacgactgt cgttctccac ccaccagtcagggacagcag 10501 cctccctgtc actcagctga gaaggccagc cctccctggc tgtgagcagcctccactgtg 10561 tccagagaca tgggcctccc actcctgttc cttgctagcc ctggggtggcgtctgcctag 10621 gagctggctg gcaggtgttg ggacctgctg ctccatggat gcatgccctaagagtgtcac 10681 tgagctgtgt tttgtctgag cctctctcgg tcaacagcaa agcttggtgtcttggcactg 10741 ttagtgacag agcccagcat cccttctgcc cccgttccag ctgacatcttgcacggtgac 10801 cccttttagt caggagagtg cagatctgtg ctcatcggag actgccccacggccctgtca 10861 gagccgccac tcctatcccc aggccaggtc cctggaccag cctcctgtttgcaggcccag 10921 aggagccaag tcattaaaat ggaagtggat tctggatggc cgggctgctgctgatgtagg 10981 agctggattt gggagctctg cttgccgact ggctgtgaga cgaggcaggggctctgcttc 11041 ctcagcccta gaggcgagcc aggcaaggtt ggcgactgtc atgtggcttggtttggtcat 11101 gcccgtcgat gttttgggta ttgaatgtgg taagtggagg aaatgttggaactctgtgca 11161 ggtgctgcct tgagaccccc aagcttccac ctgtccctct cctatgtggcagctggggag 11221 cagctgagat gtggacttgt atgctgccca catacgtgag ggggagctgaaagggagccc 11281 ctcctctgag cagcctctgc caggcctgta tgaggctttt cccaccagctcccaacagag 11341 gcctccccca gccaggacca cctcgtcctc gtggcggggc agcaggagcggtagaaaggg 11401 gtccgatgtt tgaggaggcc cttaagggaa gctactgaat tataacacgtaagaaaatca 11461 ccattccgta ttggttgggg gctcctgttt ctcatcctag ctttttcctggaaagcccgc 11521 tagaaggttt gggaacgagg ggaaagttct cagaactgtt ggctgctccccacccgcctc 11581 ccgcctcccc cgcaggttat gtcagcagct ctgagacagc agtatcacaggccagatgtt 11641 gttcctggct agatgtttac atttgtaaga aataacactg tgaatgtaaaacagagccat 11701 tcccttggaa tgcatatcgc tgggctcaac atagagtttg tcttctctcttgtttacgacg 11761 tgatctaaac cagtccttag caaggggctc agaacacccc gctctggcagtaggtgtccc 11821 ccacccccaa agacctgcct gtgtgctccg gagatgaata tgagctcattagtaaaatg 11881 acttcaccca cgcatataca taaagtatcc atgcatgtgc atatagacacatctataatt 11941 ttacacacac acctctcaag acggagatgc atggcctcta agagtgcccgtgtcggttct 12001 tcctggaagt tgactttcct tagacccgcc aggtcaagtt agccgcgtgacggacatcca 12061 ggcgtgggac gtggtcaggg cagggctcat tcattgccca ctaggatcccactggcgaag 12121 atggtctcca tatcagctct ctgcagaagg gaggaagact ttatcatgttcctaaaaatc 12181 tgtggcaagc acccatcgta ttatccaaat tttgttgcaa atgtgattaatttggttgtc 12241 aagttttggg ggtgggctgt ggggagattg cttttgtttt cctgctggtaatatcgggaa 12301 agattttaat gaaaccaggg tagaattgtt tggcaatgca ctgaagcgtgtttctttccc 12361 aaaatgtgcc tcccttccgc tgcgggccca gctgagtcta tgtaggtgatgtttccagct 12421 gccaagtgct ctttgttact gtccaccctc atttctgcca gcgcatgtgtcctttcaagg 12481 ggaaaatgtg aagctgaacc ccctccagac acccagaatg tagcatctgagaaggccctg 12541 tgccctaaag gacacccctc gcccccatct tcatggaggg ggtcatttcagagccctcgg 12601 agccaatgaa cagctcctcc tcttggagct gagatgagcc ccacgtggagctcgggacgg 12661 atagtagaca gcaataactc ggtgtgtggc cgcctggcag gtggaacttcctcccgttgc 12721 ggggtggagt gaggttagtt ctgtgtgtct ggtgggtgga gtcaggcttctcttgctacc 12781 tgtgagcatc cttcccagca gacatcctca tcgggctttg tccctcccccgcttcctccc 12841 tctgcgggga ggacccggga ccacagctgc tggccagggt agacttggagctgtcctcca 12901 gaggggtcac gtgtaggagt gagaagaagg aagatcttga gagctgctgagggaccttgg 12961 agagctcagg atggctcaga cgaggacact cgcttgccgg gcctgggcctcctgggaagg 13021 agggagctgc tcagaatgcc gcatgacaac tgaaggcaac ctggaaggttcaggggccgc 13081 tcttccccca tgtgcctgtc acgctctggt gcagtcaaag gaacgccttcccctcagttg 13141 tttctaagag cagagtctcc cgctgcaatc tgggtggtaa ctgccagccttggaggatcg 13201 tggccaacgt ggacctgcct acggagggtg ggctctgacc caagtggggcctccttgtcc 13261 aggtctcact gctttgcacc gtggtcagag ggactgtcag ctgagcttgagctcccctgg 13321 agccagcagg gctgtgatgg gcgagtcccg gagccccacc cagacctgaatgcttctgag 13381 agcaaaggga aggactgacg agagatgtat attaattttt ttaactgctgcaaacattgt 13441 acatccaaat taaaggaaaa aaatggaaac ca (SEQ ID NO: 103)。

Claims

1. An artificial miRNA comprising a first strand and a second strand, wherein... (a) The first chain and the second chain form a double chain; (b) The first strand contains a guide region that contains a nucleotide sequence having at least about 90% or at least about 95% identity with the following sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO:

14. SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO:

27. SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 or SEQ ID NO: 37; and (c) The second strand contains a non-guided region containing a nucleotide sequence that is partially complementary to the nucleotide sequence of the guided region.

2. An artificial miRNA comprising a first strand and a second strand, wherein... (a) The first chain and the second chain form a double chain; (b) The first strand contains a guide region comprising the following nucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO:

30. SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 or SEQ ID NO: 37; and (c) The second strand contains a non-guided region containing a nucleotide sequence that is partially complementary to the nucleotide sequence of the guided region.

3. The artificial miRNA as described in claim 1 or 2, wherein the guide region comprises (a) The sequence of SEQ ID NO: 1, and the non-guided region contains the sequence of SEQ ID NO: 38; (b) The sequence of SEQ ID NO: 2, and the non-guided region contains the sequence of SEQ ID NO: 39; (c) The sequence of SEQ ID NO: 3, and the non-guided region contains the sequence of SEQ ID NO: 40; (d) The sequence of SEQ ID NO: 4, and the non-guided region contains the sequence of SEQ ID NO: 41; (e) The sequence of SEQ ID NO: 5, and the non-guided region contains the sequence of SEQ ID NO: 42; (f) The sequence of SEQ ID NO: 6, and the non-guided region contains the sequence of SEQ ID NO: 43; (g) The sequence of SEQ ID NO: 7, and the non-guided region contains the sequence of SEQ ID NO: 44; (h) The sequence of SEQ ID NO: 8, and the non-guided region contains the sequence of SEQ ID NO: 45; (i) The sequence of SEQ ID NO: 9, and the non-guided region contains the sequence of SEQ ID NO: 46; (j) The sequence of SEQ ID NO: 10, and the non-guided region contains the sequence of SEQ ID NO: 47; (k) The sequence of SEQ ID NO: 11, and the non-guided region contains the sequence of SEQ ID NO: 48; (l) The sequence of SEQ ID NO: 12, and the non-guided region contains the sequence of SEQ ID NO: 49; (m) The sequence of SEQ ID NO: 13, and the non-guided region contains the sequence of SEQ ID NO: 50; (n) The sequence of SEQ ID NO: 14, and the non-guided region contains the sequence of SEQ ID NO: 51; (o) The sequence of SEQ ID NO: 15, and the non-guided region contains the sequence of SEQ ID NO: 52; (p) The sequence of SEQ ID NO: 16, and the non-guided region contains the sequence of SEQ ID NO: 53; (q) The sequence of SEQ ID NO: 17, and the non-guided region contains the sequence of SEQ ID NO: 54; (r) The sequence of SEQ ID NO: 18, and the non-guided region contains the sequence of SEQ ID NO: 55; (s) the sequence of SEQ ID NO: 19, and the non-guided region contains the sequence of SEQ ID NO: 56; (t) The sequence of SEQ ID NO: 20, and the non-guided region contains the sequence of SEQ ID NO: 57; (u) The sequence of SEQ ID NO: 21, and the non-guided region contains the sequence of SEQ ID NO: 58; (v) The sequence of SEQ ID NO: 22, and the non-guided region contains the sequence of SEQ ID NO: 59; (w) The sequence of SEQ ID NO: 23, and the non-guided region contains the sequence of SEQ ID NO: 60; (x) The sequence of SEQ ID NO: 24, and the non-guided region contains the sequence of SEQ ID NO: 61; (y) The sequence of SEQ ID NO: 25, and the non-guided region contains the sequence of SEQ ID NO: 62; (z) The sequence of SEQ ID NO: 26, and the non-guided region contains the sequence of SEQ ID NO: 63; (aa) The sequence of SEQ ID NO: 27, and the non-guided region contains the sequence of SEQ ID NO: 64; (bb) The sequence of SEQ ID NO: 28, and the non-guided region contains the sequence of SEQ ID NO: 65; (cc) The sequence of SEQ ID NO: 29, and the non-guided region contains the sequence of SEQ ID NO: 66; (dd) The sequence of SEQ ID NO: 30, and the non-guided region contains the sequence of SEQ ID NO: 67; (ee) The sequence of SEQ ID NO: 31, and the non-guided region contains the sequence of SEQ ID NO: 68; (ff) The sequence of SEQ ID NO: 32, and the non-guided region contains the sequence of SEQ ID NO: 69; (gg) The sequence of SEQ ID NO: 33, and the non-guided region contains the sequence of SEQ ID NO: 70; (hh) The sequence of SEQ ID NO: 34, and the non-guided region contains the sequence of SEQ ID NO: 71; (ii) The sequence of SEQ ID NO: 35, and the non-guided region contains the sequence of SEQ ID NO: 72; (jj) The sequence of SEQ ID NO: 36, and the non-guided region contains the sequence of SEQ ID NO: 73; or (kk) SEQ ID NO: 37 sequence, and the non-guided region contains the sequence of SEQ ID NO:

74.

4. The artificial miRNA as described in any one of claims 1-3, wherein the artificial miRNA targets HTT mRNA.

5. The artificial miRNA of claim 4, wherein the binding of the guidance region to the coding sequence of the HTT mRNA reduces the expression of the HTT protein.

6. An expression construct comprising a nucleic acid encoding an artificial miRNA as described in any one of claims 1-5.

7. The expression construct of claim 6, wherein the nucleic acid encoding the miRNA is operatively linked to a promoter.

8. The expression construct of claim 6 or claim 7, wherein the nucleic acid encoding the artificial miRNA is cloned into a miRNA scaffold, wherein the transcription of the expression construct forms a stem-loop structure.

9. A vector comprising the expression construct as described in any one of claims 6-8.

10. The carrier of claim 9, wherein the carrier is an rAAV carrier.

11. A viral particle comprising the vector as described in claim 10, wherein the viral particle is an AAV particle capsidating the rAAV vector.

12. The viral particle of claim 11, wherein the viral particle comprises a modified AAV9 or AAV2 capsid protein.

13. A method of treating or preventing HD in a patient in need, the method comprising administering to the patient a composition comprising a miRNA comprising a guide strand and a follower strand for binding HTT mRNA, wherein the guide strand comprises the following nucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 or SEQ ID NO:

37.

14. A method for reducing HTT expression in a patient with HD, the method comprising administering to the patient a composition comprising a miRNA comprising a guide strand and a follower strand for binding HTT mRNA, wherein the guide strand comprises the following nucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO:

1. NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 or SEQ ID NO: 37.

Citation Information

Patent Citations

  • Container for packaging the finished product

    RU239243U1

  • Methods for generating high titer helper-free preparations of released recombinant AAV vectors

    US6566118B1

  • Metabolically activated recombinant viral vectors and methods for the preparation and use

    US6596535B1

  • Production of adeno-associated virus in insect cells

    US6723551B2

  • Methods for generating high titer helper-free preparations of released recombinant AAV vectors

    US6989264B2