A brain tissue cell line of anguilla japonica, its preparation and use

Abstract

The present application relates to a kind of Japanese eel brain tissue cell line AJ-B strain, preparation method and application, belong to the field of biotechnology, the cell line AJ-B strain has been preserved to China general microorganism strain preservation management center on April 23, 2026, and the preservation number is: CGMCC No.46802.The present application also provides the preparation method of the Japanese eel brain tissue cell line.The stable Japanese eel brain tissue cell line established in the present application, experimental results show that it is transmitted to 50 generations and remains stable, the cell line provided has excellent shape, high recovery efficiency, and can be used for molecular biology experiments such as plasmid transfection.The present application provides a new research model for analyzing Japanese eel nervous system development, neural immune regulation and pathogenic infection mechanism.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a Japanese eel brain tissue cell line AJ-B, its preparation method, and its application. Background Technology

[0002] Japanese eel ( Anguilla japonica The Japanese eel (Sinocyclocheilus rubriformes) belongs to the order Anguilliformes and the family Anguilliformes. It is an important warm-temperate, migratory, and economically important fish species in my country, widely distributed along the Chinese coast and in rivers connected to the sea. It has extremely high nutritional value and a significant export trade position. However, the artificial breeding technology for Japanese eels has not yet been fully mastered, and the source of seedlings has long relied on natural fishing. Its reproductive physiology, especially the mechanisms of sex determination and differentiation, has always been a difficult and hot topic in the field of basic aquatic research.

[0003] The brain, as the core center of neuroendocrine regulation in fish, plays a leading role in sex differentiation, gonadal development, and reproductive cycle regulation through the brain-pituitary-gonadal axis (BPG axis). Elucidating the neuroendocrine regulatory network of the Japanese eel's brain tissue is a crucial prerequisite for understanding its sex determination mechanism and overcoming the bottlenecks in artificial breeding. Currently, research on fish sex determination-related genes (such as...) dmrt1 , cyp19a1 Research on hormone receptor function (etc.) and other related functions relies heavily on stable and controllable in vitro expression systems.

[0004] In existing technologies, fish cell lines are mostly derived from peripheral tissues such as the spleen, kidney, and liver, or fibroblasts. For example, a Japanese eel spleen tissue cell line (accession number CCTCC NO: C202461) has been reported, which has shown good performance in viral proliferation, immune gene response, and plasmid transfection. However, peripheral tissue cell lines such as the spleen cannot replace cell models derived from brain tissue because: (1) brain tissue is rich in neurons and glial cells, and its in vitro survival and proliferation conditions (such as specific nutritional factors, osmotic pressure, and temperature) are significantly different from those of peripheral tissue cells; (2) brain tissue cells have unique electrophysiological characteristics and neuroendocrine functions, and peripheral cell lines cannot simulate the brain-specific gene expression profile and hormone feedback regulation mechanism; (3) neurons and glial cells are extremely difficult to passage for a long time in vitro and are prone to differentiation, aging, or loss of their original biological characteristics. Therefore, there are currently no successful reports on stable passaged cell lines derived from Japanese eel brain tissue at home and abroad.

[0005] In addition, existing primary culture methods for fish mostly employ simple tissue block adhesion or enzymatic digestion. However, for eel brain tissue, the tissue blocks have poor adhesion, long primary migration cycle, and are easily interfered with by excessive proliferation of glial cells, resulting in poor cell line uniformity and limited passage number, which makes it difficult to meet the needs of subsequent gene function research and long-term experiments.

[0006] Given the aforementioned technical bottlenecks, there is an urgent need to develop a Japanese eel brain tissue cell line that is of a clearly derived, genetically stable, highly proliferative, and capable of long-term passage. This would fill the gap in the field of brain-derived in vitro cell models and provide reliable tool cells for in-depth research on neuroendocrine regulatory mechanisms, the function of sex-determining genes, and the infection mechanisms of neurotropic pathogens. Summary of the Invention

[0007] The purpose of this invention is to provide a stable Japanese eel brain cell line and its preparation method, which has excellent characteristics, stable passage, and stable chromosome karyotype, so as to solve the problem of lack of stable Japanese eel neural cell models in the prior art.

[0008] To achieve the above objectives, the present invention provides a Japanese eel brain tissue cell line AJ-B, classified and named as the Japanese eel female brain cell line. Anguilla japonica It was deposited on April 23, 2026, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46802. The deposit address is: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0009] The present invention also provides a method for preparing the Japanese eel brain tissue cell line, comprising the following steps: 1) Obtain brain tissue from Japanese eels and perform preprocessing. The Japanese eel brain tissue is an intact brain tissue, and the pretreatment involves rinsing the intact brain tissue in pre-cooled PBS buffer containing 1% penicillin antibody to remove blood and impurities.

[0010] 2) Primary culture The brain tissue processed in step 1) was cut into small tissue blocks, repeatedly washed with PBS buffer containing antibiotics, and then transferred to sterile centrifuge tubes. The tissue blocks were digested with 0.25% trypsin-EDTA until loose but not completely dispersed to promote the release of nerve cells. After digestion, complete culture medium was added to stop the digestion, and the tissue blocks and cell pellet were collected by centrifugation. The tissue blocks were then evenly attached to the bottom of a cell culture flask, culture medium was added to moisten the bottom of the flask, and the flask was incubated at 27°C. + Incubate at 2℃ in an upright position; On the second day of primary culture, half a volume of culture medium was added. On the third day, half a volume of complete culture medium was added and replaced. On the fourth day, the entire culture medium was replaced. Thereafter, the culture medium was replaced every three days. The complete culture medium was L-15 medium containing 20% ​​fetal bovine serum (FBS), 1% antibiotics (antibiotics and antibiotics), and a final concentration of 10 ng / mL EGF, 10 ng / mL bFGF, and 50 mM β-mercaptoethanol. 3) Passage breeding When the primary cells migrated from the brain tissue of Japanese eel reached 80-90% confluence, the original culture medium was removed, and residual serum was washed away with PBS. At this time, the cells were digested and passaged using 0.25% trypsin-EDTA. It is preferred to use a 1:2 or 1:3 ratio for continuous passage culture to obtain a stably proliferating Japanese eel brain tissue cell line AJ-B.

[0011] Furthermore, the present invention also includes cell cryopreservation and thawing. The present invention also provides a method for cryopreserving the brain tissue cells AJ-B of the Japanese eel. Cells in good logarithmic growth phase are taken, digested with 0.25% trypsin-EDTA, and centrifuged at low speed to collect the cell pellet. Serum cryopreservation solution containing 10% DMSO (v / v) is slowly added, and the mixture is gently pipetted to ensure uniform dispersion of the cells in the cryopreservation solution. The cells are then aliquoted into cryovials, placed at 4°C for 1 h, and then placed in a gradient cooling cryopreservation box. The temperature is lowered to -80°C at a rate of 1°C / min and stored overnight. Finally, the cells are transferred to liquid nitrogen for long-term storage.

[0012] The present invention also provides a method for thawing the brain tissue cells AJ-B of the Japanese eel. The method involves taking the cryovial out of liquid nitrogen and quickly placing it in a 37°C water bath for rapid thawing, while gently shaking the cryovial continuously to ensure uniform thawing of the cells. After complete thawing, the cell suspension is transferred to a centrifuge tube containing complete culture medium, centrifuged to remove the cryovial medium, and then resuspended and seeded into a culture flask for culture at 27°C. After 24 hours, the cell suspension is replaced with fresh complete culture medium and culture continues.

[0013] This invention also provides the application of the AJ-B brain tissue cells of the Japanese eel in studies related to neuroimmune regulation, pathogen infection mechanisms, and Japanese eel brain development, which can be used for research on immune response mechanisms.

[0014] The beneficial effects of this invention compared to the prior art are as follows: This invention employs a tissue block dry-attach method for primary isolation and culture of Japanese eel brain tissue. Through continuous passage, cryopreservation, and resuscitation, a stable Japanese eel brain tissue cell line was established. Experimental results show that the cell line remained stable after 50 passages, exhibiting excellent morphology, high resuscitation efficiency, and suitability for molecular biology experiments such as plasmid transfection. This provides a new research model for elucidating the development of the Japanese eel's nervous system, neuroimmune regulation, and pathogen infection mechanisms. Attached Figure Description

[0015] Figure 1 Microscopic image of the Japanese eel brain cell line on day 8 of primary culture; Figure 2 Microscopic photograph of the 30th generation of primary culture of Japanese eel brain cell line; Figure 3Electrophoresis image of COI sequence amplified using AJ-B DNA template; lanes from left to right: DL2000MARKER; AJ-B cell sample; blank control; Figure 4 Chromosome analysis diagram of the Japanese eel brain cell line; Figure 5 The image shows the transfection efficiency of the Japanese eel brain cell line; A is a bright field image of the Japanese eel brain cell line transfected with eGFP-N1 plasmid for 24 hours, and B is a fluorescence image of the Japanese eel brain cell line transfected with eGFP-N1 plasmid for 24 hours. Figure 6 Growth curves of Japanese eel brain cell lines treated with different serum concentrations; Figure 7 This diagram shows the expression of neural cell marker genes in the brain cell line of Japanese eel; A represents the GFAP gene, and B represents the MAP2 gene. Figure 8 This is a diagram showing the expression of immune genes after LPS treatment of Japanese eel brain cell lines. A represents the TNF-α gene, and B represents the IL-1β gene. Detailed Implementation

[0016] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0017] Healthy Japanese eels used to construct the cell line were purchased from a fish farm in Fuqing, Fujian Province. They weighed approximately 150g and were about 45cm in length. Before the experiment, they were temporarily housed in a tank containing 1% antibiotics for 2 days to ensure adequate dissolved oxygen.

[0018] Example 1: Establishment of Japanese eel brain cell line The culture medium used in this example consists of the following composition: L15 medium + 20% fetal bovine serum (v / v) + 1% penicillin-antibody antibiotics (v / v) + 10 ng / mL FGF + 10 ng / mL EGF + 50 μM beta-mercaptoethanol.

[0019] 1) Obtaining brain tissue from Japanese eels: Juvenile Japanese eels, aged 10 months, measuring 25-40 cm in length and weighing 40-80 g, were obtained and disinfected by wiping their surfaces with sterile cotton balls soaked in 75% alcohol. The experimental fish were then transferred to a laminar flow hood, and their skulls were opened under aseptic conditions using pre-sterilized scissors and forceps to separate the intact brain tissue. The brain tissue was then rinsed 3-5 times in pre-cooled PBS buffer containing 1% penicillin and antibiotics to remove blood and impurities.

[0020] 2) Primary culture The following procedure was performed in a sterile laminar flow hood: the brain tissue processed in step 1) was cut into pieces approximately 1.0 mm thick. 3Small tissue fragments were repeatedly washed with PBS buffer containing 1% penicillin and antibiotics and then transferred to sterile centrifuge tubes. The fragments were digested with 0.25% trypsin-EDTA for 15 min to promote nerve cell release. After digestion, complete culture medium was added to stop the digestion, and the fragments and cell pellets were collected by centrifugation at 200×g for 5 min. The tissue fragments were then evenly attached to the bottom of a T25 cell culture flask and allowed to stand for 30 min using the dry-attach method. 1 ml of complete culture medium was slowly added to moisten the bottom of the flask, and primary culture was performed at 27±2°C. As a specific example, primary culture was performed at 27°C.

[0021] On the second day of primary culture, replace and add 1 / 2 volume of complete culture medium. On the third day, replace and add 1 / 2 volume of complete culture medium again. On the fourth day, replace all the culture medium for the first time and continue to maintain the culture. During the culture period, change the culture medium every 2-3 days and observe and record the cell migration status every day.

[0022] 3) Passage breeding When the primary cells emanating from the Japanese eel brain tissue reached 80-90% confluence, the original culture medium was aspirated, and residual serum was washed away with 1 ml of PBS. The cells were then digested and passaged using 0.25% trypsin-EDTA. Continuous passage at a ratio of 1:2 or 1:3 is preferred, followed by culture in passage medium to obtain a stably proliferating Japanese eel brain tissue cell line, AJ-B.

[0023] In step 3), the subculture medium is composed of the following: L15 medium + 10% fetal bovine serum (v / v) + 1% penicillin-dipeptide antibody (v / v) + 20 ng / mL FGF + 10 ng / mL EGF + 50 mM β-mercaptoethanol.

[0024] The Japanese eel brain cell line AJ-B provided by this invention is classified and named as the female Japanese eel brain cell line. Anguilla japonica The cell line was constructed using the method described above for preparing the brain tissue cell line of the Japanese eel and was deposited on April 23, 2026, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46802. The deposit address is: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0025] 4) Cell cryopreservation and thawing The present invention also provides a method for cryopreserving the AJ-B brain tissue cells of the Japanese eel. Cells in good logarithmic growth phase are taken, digested with 0.25% trypsin-EDTA, and centrifuged at low speed to collect the cell pellet. Serum cryopreservation solution containing 10% DMSO (purchased Gibco serum) is slowly added, and the mixture is gently pipetted to ensure uniform dispersion of the cells in the cryopreservation solution. The cells are then aliquoted into cryovials, placed at 4°C for 1 h, and then placed in a gradient cooling cryopreservation box. The temperature is lowered to -80°C at a rate of 1°C / min and stored overnight. Finally, the cells are transferred to liquid nitrogen for long-term storage.

[0026] Example 2: Cell morphology observation Morphological comparison of primary cells and 30th generation cells was conducted using an inverted microscope. Cells with 80%–90% confluence were selected for observation. Primary cells ( Figure 1 It contains cells of various morphologies, with most cells appearing as fibroblasts and polygons. The 30th generation cells ( Figure 2 The morphology is the same as that of the primary cells, with cells mainly consisting of fibroblasts and polygonal cells.

[0027] Example 3: Verification of Cell Resuscitation Viability (1) Remove the frozen cells from the liquid nitrogen and shake them rapidly in 37°C warm water to thaw them as quickly as possible. When most of the frozen cells have thawed and only a small part of the ice remains unmelted, remove the cells from the 30°C water bath.

[0028] (2) Centrifuge at 1000 rpm for 5 minutes. Discard the supernatant, resuspend the cells in culture medium, stain with trypan blue, and count the cells using an inverted microscope. Cells stained blue are dead cells, and those not stained are live cells. Calculate cell viability after counting. Table 1 shows that the cell viability was above 70% after resuscitation.

[0029] Table 1. Comparison of cell viability before cryopreservation and after thawing at different passages .

[0030] Example 4: Identification of mitochondrial COI gene by cell species (1) RNA was extracted from AJ-B cells cultured in T25 cell flasks using the Trizol method, and cDNA was obtained using a reverse transcription kit (Novizan). PCR amplification was performed using primers for the Japanese eel mitochondrial COI gene. The primers are as follows: upstream primer AjCOI-F (SEQ ID NO.1): GGTACCCTATATCTAGTATTTGGTG; downstream primer AjCOI-R (SEQ ID NO.2): TGGGTGACCAAAGAATCAGAATAG.

[0031] (2) Electrophoresis revealed a band approximately 681 bp in size. Figure 3The sequencing results are as follows (amplified sequence of subcultured cells from Japanese eel brain tissue, SEQ ID NO.3): ; (3) Using blast in the NCBI database to find the homologous columns of the above sequence, it was found that the homology of this sequence with multiple Japanese eel gene sequences in the database was greater than 99%, indicating that this cell line originated from Japanese eel.

[0032] Example 5: Karyotype analysis of Japanese eel brain cell line Two flasks of cells that had reached full T25 cell line were passaged 1:2 to four flasks and placed in an incubator for further culture. Once the cell density reached 70%-80%, colchicine was added to the culture medium at a final concentration of 1 μg / ml. After 6 hours of incubation, cells were collected by digestion with 0.25% trypsin-EDTA. Then, the cells were hypotonic with 4 mL of 0.075 M KCl solution for 30 minutes, followed by pre-fixation with 4 mL of pre-chilled Carnot fixative (methanol: glacial acetic acid = 3:1) for 3 minutes. After centrifugation and discarding the supernatant, another 4 mL of Carnot fixative was added for 20 minutes. This fixation was repeated 1-2 times. After centrifugation at 1000 rpm for 10 minutes, the cells were resuspended with a small amount of Carnot fixative and dropped onto a glass slide pre-chilled at -20°C in anhydrous ethanol at a height of approximately 1 meter. The slide was heated under an alcohol lamp for a few seconds, and the cell density and dispersion were observed under a microscope. The density was then adjusted, and the same procedure was repeated for dropping and heating the slide. The slide was then stained with Giemsa stain for 40 minutes, rinsed slowly with distilled water, and air-dried at room temperature. Chromosomes were then located and photographed under a microscope (chromosome counts were performed on 100 fragmented cells).

[0033] The results are shown in Table 2. The AJB chromosome had the highest proportion in 38 chromosomes, and the karyotype images are shown below. Figure 4 As shown, there are 19 pairs of normal diploid chromosomes. Therefore, the Japanese eel brain cell line obtained in this invention has the same chromosome number as individual Japanese eels.

[0034] Table 2 Chromosome Number Statistics .

[0035] Example 6: Transfection of Japanese eel brain cell line with pEGFP-N1 plasmid One flask of cells confluent with T25 culture was seeded into a six-well plate and cultured at 27°C until the cell density reached approximately 80%. Lipo8000™ transfection reagent, serum-free medium, and pEGFP-N1 were mixed using a liposome transfection method and added to the six-well plate. After 24 hours of culture, fluorescence was observed under a fluorescence microscope. Cells were digested with 0.25% trypsin-EDTA and collected into 1.5 mL centrifuge tubes. After washing away the medium with PBS buffer, the cell transfection efficiency was detected using a Beckman Coulter flow cytometer.

[0036] The results are as follows Figure 5 As shown, the transfection efficiency is approximately 9.30 ± 0.21%, therefore AJ-B can be used as a tool for gene overexpression.

[0037] Example 7: Growth curves of Japanese eels with different serum concentrations To screen the optimal fetal bovine serum concentration (FBS) concentration for culturing Japanese eel brain cells, 50th generation Japanese eel brain cells in good growth condition were selected. Single-cell suspensions were prepared after digestion with 0.25% trypsin-EDTA, and cell counts were performed using an automated cell counter. The cell density was adjusted to 1 × 10⁻⁶ cells / year. 4 Cells were seeded into 12-well cell culture plates, with 1 mL of cell suspension added to each well. Each treatment group was set up in 3 replicates and cultured at 27 ± 2 ℃ for 24 h to allow the cells to adhere fully.

[0038] After the cells adhered, the original culture medium was discarded and replaced with L-15 complete medium containing 5%, 10%, 15%, and 20% fetal bovine serum (FBS), respectively. Each group of medium contained 1% penicillin-streptomycin antibiotics and was cultured at 27 ± 2 ℃.

[0039] Cells from each group were collected on days 0, 1, 2, 3, 4, 5, 6, and 7 of culture. After discarding the culture medium, the cells were gently washed once with PBS buffer, and then digested with an appropriate amount of 0.25% trypsin. After the cells were completely detached, culture medium was added to stop the digestion, and the cells were thoroughly pipetted to prepare a single-cell suspension. The number of viable cells in each group was determined using an automated cell counter, and growth curves of Japanese eel brain cells under different serum concentration treatments were plotted based on the cell counts at each time point.

[0040] Experimental results are as follows Figure 6 As shown, Japanese eel brain cells could adhere and grow normally under different fetal bovine serum concentrations, but their cell proliferation capacity differed significantly. In the early stages of culture (0–2 days), the cell numbers varied little among the treatment groups; from day 3 onwards, all groups entered a rapid proliferation phase, with the 20% fetal bovine serum group showing the fastest proliferation rate, reaching its maximum cell number of approximately 1.7 × 10⁶ cells on day 6. 6 The cell / well ratio was significantly higher than in the other treatment groups. The 15% fetal bovine serum group showed the second-highest cell proliferation capacity, with approximately 1.2 × 10⁶ cells / well on day 6. 6 Cells / well; The cell proliferation rate in the 10% fetal bovine serum group was relatively slow, with a cell count of approximately 8.0 × 10⁶ on day 7. 5 Cells / well; The 5% fetal bovine serum group showed the slowest cell growth, and the cell number basically stabilized after day 5.

[0041] Based on the combined results of cell growth curves and cell morphology observations of each treatment group, 20% fetal bovine serum significantly promoted the proliferation of brain cells in Japanese eels, which is the optimal fetal bovine serum concentration for culturing this brain cell line.

[0042] Example 8: Validation of marker gene expression in Japanese eel brain cell line To verify the brain tissue origin of the established cell lines, the expression of neuronal cell-specific marker genes GFAP (Glial fibrillary acidic protein) and MAP2 (Microtubule-associated protein 2) was analyzed. Logarithmically growing Japanese eel brain and ovarian cell lines were collected, total RNA was extracted, and cDNA was obtained through reverse transcription. Using β-actin as an internal reference gene, the expression levels of GFAP and MAP2 genes were detected by quantitative real-time PCR (qRT-PCR). The relative expression levels were calculated using the 2^-ΔΔCt method, and statistical analysis was performed using GraphPad Prism software.

[0043] The results are as follows Figure 7 As shown, the GFAP and MAP2 genes were highly expressed in the Japanese eel brain cell line, with significantly higher expression levels than in the Japanese eel ovary cell line (P<0.001). This indicates that the cell line established in this invention retains the molecular biological characteristics of brain tissue cells and possesses typical neuronal markers, making it suitable for use as a Japanese eel brain cell line in research on neurobiology, sex differentiation regulation, and immune-related mechanisms.

[0044] Example 9: Expression of inflammatory factors and immune genes in the LPS-induced Japanese eel brain cell line AJ-B.

[0045] Two flasks of cells confluent with T25 culture were seeded into two six-well plates and cultured at 27°C until the cell density reached approximately 80%. LPS at a final concentration of 300 μg / ml was added to the six-well plates, and cells were collected at 0 h, 6 h, 12 h, and 24 h after infection. Total RNA was extracted using TRIzol reagent, and cDNA was synthesized using a reverse transcription kit (Novizan). Using the obtained cDNA as a template, real-time quantitative PCR (qRT-PCR) was performed using a SYBR Green (Toyobo) quantitative PCR kit to detect the expression of TNF-α, IL-1β, and immunogenes.

[0046] Figure 8 The expression of immune-related genes in Japanese eel brain cell lines after LPS stimulation at 0h, 6h, 12h, and 24h is presented. Figure 8 As can be seen, after LPS stimulation of AJ-B, the expression levels of IL-1β and TNF-α were significantly higher than those of the control group; and the expression levels showed a gradual upward trend with the increase of infection time, reaching the highest at 12h. These results indicate that AJ-B can be used as an in vitro research model of Japanese eel to study the pathogenic mechanism of the pathogen.

[0047] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements to the present invention by those skilled in the art should be included within the scope of protection defined by the claims of the present invention.

Claims

1. A Japanese eel brain tissue cell line, strain AJ-B, characterized in that, The cell line AJ-B was deposited with the China General Microbiological Culture Collection Center on April 23, 2026, with accession number CGMCC No. 46802.

Images