Reduction of intron retention

Abstract

Disclosed herein are methods, compositions, polynucleic acid polymers, assays, and kits for inducing processing of partially processed mRNA transcripts to remove retained introns, thereby generating fully processed mRNA transcripts that encode a full-length functional form of a protein. Also described herein are methods and compositions for treating a disease or disorder characterized by impaired production of a full-length functional form of a protein in a subject or treating a disease or disorder characterized by defective splicing.

Description

[0001] This application is a divisional application of patent application No. 201580044067.8, filed on June 16, 2015, entitled "Reducing Intron Retention". Cross-referencing

[0002] This application claims the benefit of UK patent application No. 1410693.4, filed on 16 June 2014, which is incorporated herein by reference in its entirety. Background Technology

[0003] Alternative splicing is likely a common phenomenon in the human transcriptome. Intron retention is an example of alternative splicing in which partially processed mRNA retains at least one intron after partial splicing. In some cases, the presence of retained introns in partially processed mRNA can prevent or reduce the translation of functional proteins. Summary of the Invention

[0004] This invention relates to methods for reducing or preventing intron retention in transcripts (e.g., partially processed mRNA transcripts) and for treating or preventing diseases associated with unintentional intron retention.

[0005] In some aspects, the present invention discloses a method for preventing or treating a disease in a subject, comprising reducing the incidence of intron retention in a gene transcript, wherein the disease is induced by defective protein expression caused by the retention of the intron in the gene transcript.

[0006] In some aspects, the present invention discloses a method for regulating intron splicing in cells, comprising hybridizing a polynucleotide polymer with a region of pre-mRNA, wherein the region comprises or is composed of SEQ ID NO: 46 or a region having at least 95% identity with SEQ ID NO: 46.

[0007] In some aspects, the present invention discloses a method for regulating intron splicing in cells, comprising hybridizing a polynucleotide polymer with a region of pre-mRNA, wherein the region comprises or is composed of SEQ ID NO: 46 or a region having at least 95% identity with SEQ ID NO: 46.

[0008] In some aspects, the present invention discloses a method for regulating intron splicing in cells, comprising hybridizing a polynucleotide polymer with a region of pre-mRNA, wherein the region comprises or is composed of a region of SEQ ID NO: 3 or having at least 95% identity with SEQ ID NO: 3.

[0009] In some aspects, the present invention discloses a method for regulating intron splicing in cells, comprising hybridizing a polynucleotide polymer with a region of pre-mRNA, wherein said region comprises or is composed of a sequence complementary to or consisting of any of the sequences having at least 95% identity with any of the sequence group comprising SEQ ID NO: 47 to 434 or combinations thereof.

[0010] In some aspects, the present invention discloses a polynucleic acid polymer that is antisense for a region comprising SEQ ID NO: 46 or a polynucleic acid polymer thereof, or for at least a portion of a region comprising a sequence having at least 95% sequence identity with SEQ ID NO: 46 or a polynucleic acid polymer thereof.

[0011] In some aspects, the present invention discloses a polynucleic acid polymer that is antisense for a region comprising SEQ ID NO: 3 or a polynucleic acid polymer thereof, or for at least a portion of a region comprising a sequence having at least 95% sequence identity with SEQ ID NO: 3 or a polynucleic acid polymer thereof.

[0012] In some aspects, the present invention discloses a polynucleic acid polymer in which a region of the polynucleic acid polymer ( wherein the region comprises or is composed of a sequence complementary to or composed of any of the sequence groups comprising SEQ ID NO: 47 to 434 or combinations thereof); or optionally, at least a portion of the region of the polynucleic acid polymer comprising a sequence having at least 95% sequence identity with or composed of SEQ ID NO: 47 to 434 is antisense.

[0013] In some aspects, the present invention discloses a polynucleic acid polymer comprising or consisting of a nucleic acid sequence having at least 95% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof; and optionally wherein uracil nucleotides are replaced by thymine nucleotides.

[0014] In some aspects, the present invention discloses a polynucleic acid polymer comprising or consisting of a nucleic acid sequence having at least 95% identity with a sequence selected from the group consisting of any of SEQ ID NO: 47 to 434 or combinations thereof; and optionally wherein uracil nucleotides are replaced by thymine nucleotides.

[0015] In some aspects, the present invention discloses a pharmaceutical composition comprising a polynucleotide polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing a retained intron, wherein the target sequence is between two G quadruplexes, and wherein the polynucleotide polymer is capable of inducing the retained intron to be cleaved from the partially processed mRNA transcript; and a pharmaceutically acceptable excipient and / or delivery vector. In some cases, the polynucleotide polymer hybridizes to the retained intron of the partially processed mRNA transcript.

[0016] In some aspects, the present invention discloses a pharmaceutical composition comprising a polynucleotide polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the polynucleotide polymer hybridizes to an intron splicing regulatory element of the partially processed mRNA transcript, wherein the intron splicing regulatory element contains a first CCC motif, and wherein the polynucleotide polymer is capable of inducing the retained introns to be spliced ​​from the partially processed mRNA transcript; and a pharmaceutically acceptable excipient and / or delivery vector.

[0017] In some cases, the intron splicing regulatory element further comprises a second CCC motif. In some cases, the first CCC motif is located about three or more nucleotide bases from the second CCC motif. In some cases, the polynucleotide polymer hybridizes with an intron splicing regulatory element comprising a CCCAG or AGGCC motif.

[0018] In some aspects, the present invention discloses a pharmaceutical composition comprising a polynucleotide polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the polynucleotide polymer hybridizes to a binding motif of the partially processed mRNA transcript, wherein the binding motif does not form a G-quadruplex, and wherein the polynucleotide polymer is capable of inducing the retained introns to be cleaved from the partially processed mRNA transcript; and a pharmaceutically acceptable excipient and / or delivery vector.

[0019] In some cases, the polynucleotide polymer contains a pyridine nucleotide at the 3' end and / or the 5' end. In some cases, the polynucleotide polymer contains two consecutive pyridine nucleotides at the 3' end and / or the 5' end.

[0020] In some aspects, the present invention discloses a pharmaceutical composition comprising a polynucleotide polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the polynucleotide polymer hybridizes to a binding motif of the partially processed mRNA transcript, and wherein the binding motif forms a hairpin structure, wherein the polynucleotide polymer is capable of inducing the retained introns to be cleaved from the partially processed mRNA transcript; and a pharmaceutically acceptable excipient and / or delivery vector.

[0021] In some cases, the polynucleic acid polymer can also destabilize the hairpin structure. In some cases, the delivery carrier comprises cell-penetrating peptides or peptide-based nanoparticles. In some cases, the delivery carrier is complexed with the polynucleic acid polymer via ionic bonding.

[0022] In some cases, the polynucleotide polymer is about 10 to about 50, about 10 to about 45, about 10 to about 40, about 10 to about 30, about 10 to about 25, or about 10 to about 20 nucleotides in length. In some cases, the sequence of the polynucleotide polymer is at least 60%, 70%, 80%, 90%, 95%, or 100% complementary to the target sequence of the partially processed mRNA transcript. In some cases, the sequence of the polynucleotide polymer has four or fewer, three or fewer, two or fewer, or one or fewer mismatches with the target sequence of the partially processed mRNA transcript.

[0023] In some cases, the polynucleotide polymer is modified at the nucleoside moiety or the phosphate ester moiety. In some cases, the polynucleotide polymer contains one or more artificial nucleotide bases. In some cases, the one or more artificial nucleotide bases include locked nucleic acids (LNAs), vinyl nucleic acids (ENAs), peptide nucleic acids (PNAs), 1',5'-dehydrated hexadiol nucleic acids (HNAs), morpholine nucleotides, methylphosphonate nucleotides, mercaptophosphonate nucleotides, or 2'-fluoroN3-P5'-phosphamides modified with 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-AP, 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA). In some cases, the polynucleotide polymer is modified at the 2' hydroxyl group of the ribose moiety of the nucleoside portion of the polynucleotide polymer. In some cases, the modification at the 2' hydroxyl group is achieved via a 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T0-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA) moiety. In some cases, a methyl group is added to the 2' hydroxyl group of the ribose moiety to produce a 2'-O-methylribose moiety. In some cases, a methoxyethyl group is added to the 2' hydroxyl group of the ribose moiety to produce a 2'-O-methoxyethylribose moiety. In some cases, the modification at the 2' hydroxyl group is achieved by linking a methylene group to the 4' carbon. In some cases, the ribose ring is replaced by a six-membered morpholine ring to produce morpholine artificial nucleotide analogs. In some cases, the phosphate backbone is partially replaced by oligoglycine-like compounds to produce peptide nucleic acids (PNAs). In some cases, the phosphate backbone is modified with thiol or methyl groups. In some cases, the 5' end, 3' end, or a combination thereof is modified. In some cases, the modification protects the polynucleotide polymer from endogenous nucleases in the subject. In some cases, the modified polynucleotide polymer does not induce RNase H to cleave RNA or its ability to induce RNase H to cleave RNA is reduced. In some cases, the polynucleotide polymer is modified to improve its stability. In some cases, the hybridization is specific hybridization.

[0024] In some cases, the polynucleotide polymer hybridizes with an mRNA transcript having at least 80%, 85%, 90%, or 95% or 100% sequence identity with at least 13 consecutive bases of SEQ ID NO: 46. In some cases, the polynucleotide polymer hybridizes with an mRNA transcript containing at least 10 consecutive bases of SEQ ID NO: 46. In some cases, the polynucleotide polymer hybridizes with an mRNA transcript having at least 63%, 70%, 80%, 90%, or 95% sequence identity with a sequence selected from SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:36, SEQ ID NO:39, SEQ ID NO:42, SEQ ID NO:45, or combinations thereof. In some cases, the polynucleotide polymer hybridizes with an mRNA transcript having at least 55%, 60%, 70%, 80%, 90%, or 95% sequence identity with SEQ ID NO:3. In some cases, the polynucleic acid polymer is combined with a sample selected from SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 43, and SEQ ID NO: The sequence of 44 or combinations thereof has at least 63%, 70%, 80%, 90%, 95%, or 100% sequence identity, and optionally wherein uracil nucleotides are replaced by thymine nucleotides.In some cases, the polynucleotide polymer has at least 55%, 60%, 70%, 80%, 90%, or 95% sequence identity, or 100%, to a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, or combinations thereof, and optionally, uracil nucleotides are substituted with thymine nucleotides. In some cases, the polynucleotide polymer hybridizes with an mRNA transcript having at least 80%, 85%, 90%, or 95% sequence identity to at least 13 consecutive bases of a sequence selected from SEQ ID NO: 47-434, or combinations thereof.

[0025] In some cases, the polynucleic acid polymer is a synthetic polynucleic acid polymer.

[0026] In some cases, the pharmaceutical composition comprising the polynucleic acid polymer is used for intravenous or subcutaneous administration.

[0027] In some aspects, the present invention discloses a composition for treating a disease or condition in a patient in need, comprising administering the disclosed pharmaceutical composition to the patient. In some cases, the disease or condition is associated with or characterized by impaired protein production or defective splicing. In some cases, the disease or condition is a hereditary disease. In some cases, a subject with the hereditary disease has a genome containing copies of genes containing exons that, when properly transcribed into fully processed mRNA, encode the full-length functional form of the protein. In some cases, a subject with the hereditary disease has a genome containing copies of genes containing exons that, when properly transcribed into fully processed mRNA, encode the full-length functional form of the protein. In some cases, a subject with the hereditary disease has a genome containing defective copies of the genes that cannot produce the full-length functional form of the protein. In some cases, the disease or condition is diabetes. In some cases, the disease or condition is cancer. In some cases, the composition for use further includes selecting a subject for treating a disease or condition associated with impaired protein production, comprising (a) determining whether the subject suffers from a disease or condition associated with impaired protein production; and (b) if the subject suffers from a disease or condition associated with impaired protein production, administering the pharmaceutical composition of claims 42-82 to the subject. In some cases, the composition for use further includes selecting a subject for treating a disease or condition characterized by defective splicing, comprising (a) determining whether the subject suffers from a disease or condition characterized by defective splicing; and (b) if the subject suffers from a disease or condition characterized by defective splicing, administering the pharmaceutical composition of claims 42-82 to the subject.

[0028] In some aspects, the present invention discloses a method for treating a disease or condition characterized by impaired production of the full-length functional form of a protein in a subject of need, comprising: (a) administering a pharmaceutical composition to the subject, the pharmaceutical composition comprising: a therapeutic agent that induces enhanced intron splicing in partially processed mRNA transcripts; and a pharmaceutically acceptable excipient and / or delivery vector; wherein the subject has a pool of partially processed mRNA transcripts capable of encoding a copy of the full-length functional form of the protein, and each of the partially processed mRNA transcripts contains at least one retained intron that inhibits the translation of the partially processed mRNA transcript; and (b) contacting target cells of the subject with the therapeutic agent to induce a portion of the pool of partially processed mRNA transcripts to undergo splicing to remove the at least one retained intron from each of the partially processed mRNA transcripts in the portion, thereby producing a fully processed mRNA transcript, wherein the fully processed mRNA transcript is translated to express a copy of the full-length functional form of the protein, which treats the disease or condition.

[0029] In some cases, the therapeutic agent induces activation of one or more splicing protein complexes in the cell to remove at least one retained intron from each of the partially processed mRNA transcripts in the pool of partially processed mRNA transcripts. In some cases, the therapeutic agent inhibits proteins that regulate intron splicing activity. In some cases, the therapeutic agent activates proteins that regulate intron splicing activity. In some cases, the therapeutic agent binds to proteins that regulate intron splicing activity. In some cases, the therapeutic agent binds to target polynucleotide sequences of the partially processed mRNA transcripts. In some cases, the therapeutic agent is a polynucleotide polymer. In some cases, the therapeutic agent is a small molecule.

[0030] In some cases, the pharmaceutical composition is the pharmaceutical composition described herein.

[0031] In some cases, impaired production of the full-length functional form of the protein includes subnormal production of the full-length functional form. In some cases, impaired production of the full-length functional form of the protein is due to the absence of expression of the full-length functional form, or the expression level of the full-length functional form is low enough to cause the disease or condition. In some cases, impaired production of the full-length functional form of the protein includes the absence of protein production, or the production of a defective form of the protein. In some cases, the defective form of the protein is a truncated form, a misfolded form, or a form of the protein with abnormal target binding. In some cases, treatment of the subject results in increased expression of the full-length functional form of the protein.

[0032] In some aspects, the present invention discloses a method for inducing the processing of a partially processed mRNA transcript to remove retained introns to produce a fully processed mRNA transcript encoding the full-length functional form of a protein, comprising: (a) hybridizing a separated polynucleotide polymer with the partially processed mRNA transcript, the partially processed mRNA transcript being capable of encoding the full-length functional form of the protein and containing at least one retained intron; (b) removing the at least one retained intron from the partially processed mRNA transcript to produce a fully processed mRNA transcript encoding the full-length functional form of the protein; and (c) translating the full-length functional form of the protein from the fully processed mRNA transcript. In some cases, the method further comprises administering a pharmaceutical composition comprising the separated polynucleotide polymer to a subject in need.

[0033] In some cases, impaired production of the full-length functional form of the protein is associated with a disease or condition. In some cases, the disease or condition is a hereditary disease. In some cases, a subject with the hereditary disease has a genome containing copies of genes containing exons that, when properly transcribed into fully processed mRNA, encode the full-length functional form of the protein. In some cases, a subject with the hereditary disease has a genome containing copies of genes containing exons that, when properly transcribed into fully processed mRNA, encode the full-length functional form of the protein. In some cases, a subject with the hereditary disease has a genome containing defective copies of the gene that cannot produce the full-length functional form of the protein. In some cases, the disease or condition is diabetes. In some cases, the disease or condition is cancer.

[0034] In some cases, the polynucleotide polymer is an antisense sequence. In some cases, the antisense sequence hybridizes with retained introns of the partially processed mRNA transcript. In some cases, the antisense sequence hybridizes with intron splicing regulatory elements of the partially processed mRNA transcript. In some cases, the intron splicing regulatory elements contain a CCC motif. In some cases, the antisense sequence hybridizes with a binding motif of the partially processed mRNA transcript, wherein the binding motif does not form a G quadruple. In some cases, the antisense sequence hybridizes with a binding motif of the partially processed mRNA transcript, wherein the binding motif is between two G quadruples. In some cases, the antisense sequence hybridizes with a binding motif of the partially processed mRNA transcript, wherein the binding motif has a first CCC motif and a second CCC motif. In some cases, the first CCC motif is about 3 or more nucleotide bases away from the second CCC motif. In some cases, the sequence of the polynucleotide polymer is at least 60%, 70%, 80%, 90%, 95%, or 100% complementary to the target sequence of the partially processed mRNA transcript. In some cases, the sequence of the polynucleotide polymer has four or fewer, three or fewer, two or fewer, or one or fewer mismatches with the target sequence of the partially processed mRNA transcript. In some cases, the polynucleotide polymer is about 10 to about 50, about 10 to about 45, about 10 to about 40, about 10 to about 30, about 10 to about 25, or about 10 to about 20 nucleotides in length.

[0035] In some cases, the subject is a eukaryote. In other cases, the subject is a eukaryote selected from humans, mice, rats, non-human primates, or non-primate mammals.

[0036] In some aspects, a pharmaceutical composition is described comprising a polynucleic acid polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the polynucleic acid polymer induces the retained introns to be cleaved from the partially processed mRNA transcript; and a pharmaceutically acceptable excipient and / or delivery vector. Attached Figure Description

[0037] The novel features of the invention are specifically set forth in the appended claims. A better understanding of the features and advantages of the invention will be obtained by referring to the following detailed description and accompanying drawings, which illustrate illustrative embodiments utilizing the principles of the invention, in which: Figure 1 Location of SSO in the human proinsulin gene. (A) INSA schematic diagram of the reporter body and its mRNA product. SSO is shown as a black horizontal bar below the exons (numbered boxes) and intron 1 (line); their sequences are in Table 2. Start and stop codons are indicated by arrows. Standard (solid lines) and cryptic (dashed lines) splicing are shown above the primary transcript; the names of cryptic splicing sites are in gray. SSO targets intron 1 segments del4-del7, shown in the diagram below. (B) By INS The reporter gene construct produces mRNA isoforms (numbered 1-6). The description of isoforms that do not produce proinsulin is... mark.

[0038] Figure 2 SSO-induced INS Suppression of intron 1 retention. (A) Using indicated SSO INS The reporter gene construct (IC DF) was co-transfected into HEK293 cells. Figure 1 The splicing products described in B are shown on the right. The bars represent the percentage of intron-1-containing isoforms relative to the native transcript (top panel) or the percentage of splicing at the cryptic 3' splice sites relative to the total number of introns 2 (bottom panel). Error bars indicate SD; sc, scrambled control; SSO-, "no SSO" control. Final SSO concentrations were 1, 3, 10, and 30 nM, except for SSO6 and SSO8 (10 and 30 nM). (B) Promotion of SSO21-mediated intron 1 splicing in clones lacking the cryptic 3's of intron 2. RNA products are on the right. (C) Fold change in SSO21-induced intron 1 retention in transcripts containing and lacking the cryptic 3's of intron 2. The final SSO21 concentration was 30 nM in repeated transfections. The reporter gene construct name is at the bottom.

[0039] Figure 3 Targeting hidden 3' splice sites INS SSO. (A) Activation of the hidden 3'ss (cr3'ss+126) of intron 2 via SSO6; Figure 1 A) and exon 2 skipping was facilitated by SSO8. The concentrations of each SSO were 2, 10, 50, and 250 nM. SSOs are shown at the top, splice products at the right, and reporter bodies at the bottom. (B) INSPredicted stable hairpins between the true and hidden 3'ss of intron 2. Bases targeted by SSO6 are indicated by an asterisk, and predicted splice enhancer hexamers (listed on the right) are indicated by dashed lines. (C) SSO4 does not prevent activation of the hidden 3'ss 81 base pairs downstream of its true counterpart (cr3'ss+81) in cells depleted by U2AF35, but induces exon skipping. The final concentrations of each SSO in COS7 cells were 5, 20, and 80 nM. The final concentration of the siRNA duplex U2AF35ab(77) was 70 nM. The reporter variant is the same as in Figure A.

[0040] Figure 4 Optimization of intron retention targets by antisense microwalk at single nucleotide resolution. (A) Location of oligonucleotides. Microwalk SSOs and oligomers used for CD / NMR are represented by horizontal black bars below and above the primary transcript, respectively. Intron 1 sequences predicted to form RNA G-quadruplexes are highlighted in gray. Microwalk direction is indicated by gray arrows; winning oligomers are highlighted in black. Boxes indicate previously reported single nucleotide polymorphisms (20). (B) Intron retention levels of each microwalk SSO in two cell lines. Error bars represent SDs obtained from two independent co-transfections of reporter IC DF.

[0041] Figure 5 Biophysical characterization of RNA secondary structure formation. (A) Far-UV CD spectra of CD1 (19-mer) and CD2 (20-mer) RNA at 25 °C, showing the ellipticity maxima at 265 and 270 nm, respectively. (B) 1H NMR spectra of CD1 and CD2 recorded at 800 MHz and 298 K, showing the characteristic set of resonances from H-bonded G bases. (C) S-shaped CD melting curves of the two RNAs, showing the transition midpoints at 56.8 ± 0.2 °C and 69.0 ± 0.45 °C, respectively. For clarity, the two curves have been slightly shifted relative to each other. (D) Parallel quadruplex structure of CD1 with two stacked G-quadriplexes connected by a short circular sequence (top). The predicted hairpin structure of CD2 is shown in the bottom. G→C mutations are shown in red.

[0042] Figure 6 A quadruplex / hairpin conformational transition involving an antisense target. (A) A schematic balance is proposed between the hairpin (black) and quadruplex (dark blue) structures formed within a G-rich motif containing the oligonucleotide CD3. CD4 contains a CC→UU mutation (with... (Highlighted). (B) NMR spectra in the 9–15 ppm region show imine proton signals corresponding to hydrogen-bonded bases. Signals between 10 and 12 ppm are characteristic of Hoogsteen hydrogen-bonded G within the G-tetramer (Q box), while signals >12 ppm indicate Watson-Crick AU and GC base pairs within the hairpin structure (H box). In CD3, hairpin H1 is clearly filled, but a mutation in CD4 destabilizes H1, making H2 the dominant material, both in equilibrium with the tetramer structure. (C) Mfold predictions for two possible hairpins, consistent with NMR data. (D) Reduction in intron retention during hairpin structure destabilization via the CC→UU mutation. Error bars indicate the SD of repeat experiments using the reporter IC DC. Del5, IC DC reporter lacking segment del5 ( Figure 1 A); M1, a reporter containing two substitutions (Table 1A) that destabilize the G-quadruplex and stem-loop.

[0043] Figure 7 Intron retention was used to identify proteins that interact with pre-mRNA containing antisense targets. (A) Intron retention levels of wild-type and mutant reporter constructs (IC DC) after transient transfection into HEK293T cells. Mutations are shown in Table 1A. RNA products are on the right. The presence of predicted RNA quadruplexes, hairpin H1 / H2, and upstream and downstream C4 runs is shown below the gel plot. Error bars indicate SDs obtained from two replicate experiments. (B) Intron retention levels of the tested RNAs correlated with their predicted stability on antisense targets. (C) Western blot analysis using pull-down assays of the antibodies shown on the right. NE, nuclear extract; B, bead-only control; AV3, cytosine-containing control RNA oligomer run and 3'ss AG (7). The sequence of CD5 RNA is shown in the figure. Figure 4 In A.

[0044] Figure 8 Splicing patterns of small genes rich in and lacking quadruplexes when DHX36 is depleted. (A) Schematic diagram of reporter gene constructs. Predicted quadruplexes are represented by black rectangles; their densities are shown in Table 1. Exon (box) numbering; slashes indicate... F9 Shortening of intron 3 (24). F9 and TSC2The small genes contain branch point substitutions c.253-25C and c.5069-18C (24) that affect splicing. Cr5'ss-104; cryptic 5'ss 104 upstream of the true 5'ss of intron 2. (B) Immunoblotting with antibody against DHX36. sc, scrambled siRNA; c, untreated cells. Error bars are SDs of two transfection experiments. (CE) Indications of intron retention and exon skipping of the reporter. The final concentration of DHX36 siRNA was 50 nM. RNA products are schematically shown on the right. Error bars are SDs of two transfection experiments. Detailed Implementation

[0045] Eukaryotic genes contain intercalation sequences or introns that must be precisely removed from the primary transcript to produce functional mRNAs that encode proteins (1). This process alters the mRNA composition in a highly dynamic manner, utilizing the interdependent interactions of five small nuclear RNAs (snRNAs) (e.g., U1, U2, U4, U5, and U6) and numerous proteins with conserved but degenerate sequences in the pre-mRNA. In particular, introns can be defined by core splice site elements comprising a 5' splice site that may contain a conserved GU motif, a 3' splice site (3'ss) that may terminate at an invariant AG motif, a branching point sequence that may contain a conserved adenine base, and a polypyrimidine (Py) sequence. The splicing reaction can begin when the U1 snRNP binds to the conserved GU motif at the 5'ss, followed by the binding of the U2 snRNP at the conserved adenine base at the branching point, and finally the interactions of the U4, U5, and U6 snRNPs near the 5' and 3' splice sites. The complex formed by snRNP and its corresponding intron can be called the spliceosome. Other splicing factors, such as U2 small nuclear RNA helper 1 (U2AF35), U2AF2 (U2AF65), and splicing factor 1 (SF1), can help spliceosome assembly and promote splicing events.

[0046] Intron splicing typically promotes cross-species mRNA accumulation and protein expression (3-5). This process can be altered by intron mutations or variants, which can also weaken coupled gene expression pathways, including transcription, mRNA export, and translation. This is exemplified by introns in the 5' UTR, where naturally occurring variants or mutations that alter intron retention change the relative abundance of transcripts with upstream open reading frames (uORFs) or other regulatory motifs and significantly affect translation (6,7). Furthermore, impaired protein translation due to defective splicing (e.g., intron retention) has led to the onset and / or progression of diseases, such as genetic disorders or conditions (e.g., hereditary diseases or cancer). However, successful sequence-specific strategies for normalizing gene expression in such cases have not yet been developed.

[0047] Splice-switching oligonucleotides (SSOs) are antisense agents that regulate intron splicing by binding to splice sites to recognize or regulate sequences and competing for their targets with cis and trans-acting factors (8). They have been shown to restore aberrant splicing, alter the relative expression of existing mRNAs, or produce novel splice variants of aberrant expression (8). The increased stability of targeted SSO-RNA duplexes through extensive SSO modifications (e.g., 2'-O-methyl and 2'-O-methoxyethyl ribose) has facilitated research into their therapeutic potential for a growing number of human disease genes, including DMD in muscular dystrophy (9, 10), SMN2 in spinal muscular atrophy (11), ATM in ataxia-telangiectasia (12), and BTK in X-linked agammaglobulinemia (13). While these approaches come close to realizing their clinical potential for a limited number of diseases (8), the >300 Mendelian disorders and increasing number of complex traits resulting from mutation-induced aberrant splicing (14) may be well-suited for SSO-mediated correction of gene expression.

[0048] The etiology of type 1 diabetes has a strong genetic component conferred by human leukocyte antigen (HLA) and various modified non-HLA loci (15). The proinsulin gene on chromosome 11 (… INS The strongest modifier was identified in the region (referred to as IDDM2) (15). Further mapping of this region shows INS It is the most likely target of IDDM2 (16), consistent with the key role of this autoantigen in pathogenesis (17). The genetic risk of this disease at IDDM2 has been attributed to both susceptibility and protection. INS Differential homeostatic RNA levels in haplotypes may involve small satellite DNA sequences upstream of this gene (18, 19). However, for naturally occurring... INS Systematic testing of polymorphism revealed haplotype-specific proinsulin expression levels in reporter constructs lacking small satellite sequences, which were expressed by intron 1(7) in a gene terminology called IVS1+5ins4 (also known as...). rs3842740 or INS-69) and IVS1-6A / T ( rs689 INS-27 or HphThe two variants of I+ / - result in (16, 20). The former variant activates the hidden 5' splice site of intron 1, while the latter variant, located 6 nucleotides upstream of the 3' splice site (3'ss), promotes intron retention with adenine (A), thereby increasing the relative abundance of transcripts with an extended 5'UTR (21). Compared with thymine (T), the A allele of IVS1-6A / T reduces the affinity for pyrimidine-binding proteins in vitro and makes 3'ss more dependent on the U2 small nucleonucleotide protein cofactor (U2AF) (7) (a heterodimer required for U2 binding, spliceosome assembly, and 3'ss selection (22)). Transcripts containing intron 1 are overexpressed in IVS1-6A-derived cDNA libraries prepared from insulin-producing tissues (21), expiring from the nucleus (23), and containing a short human subfamily-specific uORF that co-evolves with the 3'ss relaxation of intron 1 in higher primates (7). Lower proinsulin expression conferred by the A allele may lead to suboptimal expression of proinsulin peptide in the fetal thymus and insufficient negative selection by autoreactive T cells, ultimately resulting in autoimmune destruction of insulin-producing β cells in the pancreas (7).

[0049] The object of this invention is to induce the processing of partially processed mRNA transcripts to remove retained introns, thereby producing fully processed mRNA transcripts in the full-length functional form encoding the protein. An additional object is to treat, in subjects in need, diseases or conditions characterized by impaired protein production and / or diseases or conditions characterized by defective splicing.

[0050] Another object of the present invention is to correct the inefficiency of removing INS intron 1 from pre-mRNA containing IVS1-6A and to reduce intron retention to levels observed against disease-protective T alleles. Another object of the present invention is to provide novel treatments for genetic diseases, including cancer, characterized by (or associated with) irregular or aberrant intron retention.

[0051] According to a first aspect of the invention, a method for preventing or treating a disease in a subject is provided, comprising correction of intron retention in a mature gene transcript, wherein the disease is induced by defective protein expression caused by intron retention in the gene transcript.

[0052] Retained introns Retained introns can be one of five types of alternative splicing, including exon skipping, selective 5' splicing sites, selective 3' splicing sites, and mutually exclusive exons. Exon skipping can occur when an exon is skipped or cut from the processed mRNA, and it is probably the most common type of alternative splicing. Selective 5'ss and selective 3'ss can represent alternative splicing sites, such as cryptic splicing sites or spurious splicing sites. Mutually exclusive exons can occur when only one of the two exons is retained in the post-splicing processed mRNA. Although intron retention may be less common than exon skipping, it has been shown to occur more frequently than previously thought. In fact, a study by De Souza's group on 21,106 human genes showed that approximately 15% of the genes tested exhibited intron retention (see Galante et al., "Detection and evaluation of intron retention events in the human transcriptome", Bioinformatics 10:757-765 (2004)). Furthermore, Moore's group's research has shown that approximately 35% of individuals carry introns in their 5'-UTR and approximately 16% in their 3'-UTR (Bicknell et al., "Introns in UTRs: Why we should stop ignoring them," Bioessays 34: 1025-1034 (2012)). Therefore, intron retention can occur in coding regions, in non-coding regions, at the 5'-UTR, or at the 3'-UTR. In coding regions, retained introns can encode amino acids within the frame, or they can be located in misalignments that can result in truncated or nonfunctional proteins due to stop codon or reading frame shifts. Additionally, introns can be located between two exons, at the 5'-UTR, or at the 3'-UTR.

[0053] Compared to non-reserved introns, reserved introns can be characterized by having shorter sequence lengths. The sequence length of reserved introns can be less than 5 kb, less than 4 kb, less than 3 kb, less than 2.5 kb, less than 2 kb, less than 1.5 kb, less than 1 kb, less than 0.5 kb, less than 0.4 kb, less than 0.3 kb, less than 0.2 kb, or less than 0.1 kb.

[0054] Furthermore, compared to non-reserved introns, retained introns can be characterized as having a G / C content of approximately 40% to approximately 60%. The G / C content of retained introns can be approximately 40%, 45%, 50%, 55%, or approximately 60%.

[0055] Introns can also be retained adjacent to weak 5' splice sites, weak 3' splice sites, or both. Weak splice sites can refer to splice sites that may require regulatory proteins (such as intron splicing enhancers) to function.

[0056] Furthermore, retained introns may contain lower levels of GGG motifs compared to non-retained introns. In some cases, GGG motifs are intron splicing enhancers.

[0057] Partially processed mRNA transcripts are mRNA transcripts that have undergone partial splicing and contain at least one retained intron. The at least one intron may be located within the 5' UTR, 3' UTR, or internally between two exons. Partially processed mRNA transcripts may not be translated to produce a functional or full-length protein.

[0058] Partially processed mRNA transcripts may contain introns characterized by short sequence lengths. Specifically, partially processed mRNA transcripts may contain introns with sequences less than 3 kb, less than 2.5 kb, less than 2 kb, less than 1.5 kb, less than 1 kb, less than 0.5 kb, less than 0.4 kb, less than 0.3 kb, less than 0.2 kb, or less than 0.1 kb.

[0059] Partially processed mRNA transcripts may contain introns characterized by a G / C content of approximately 40% to approximately 60%. Partially processed mRNA transcripts may contain introns characterized by a G / C content of approximately 40%, 45%, 50%, 55%, or approximately 60%.

[0060] Partially processed mRNA transcripts may contain introns of adjacent weak 5' splice sites, weak 3' splice sites, or both.

[0061] Partially processed mRNA transcripts may contain introns with a lower GGG motif relative to non-reserved introns.

[0062] In some cases, one or more introns are retained in the partially processed mRNA transcript. The partially processed mRNA may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more retained introns.

[0063] Fully processed mRNA transcripts are transcripts that have undergone splicing to remove introns (e.g., retaining introns) and are capable of being translated to produce proteins (e.g., full-length functional proteins). Partially processed mRNA transcripts with one or more retained introns can be spliced ​​to become fully processed mRNA.

[0064] A full-length functional protein has the same length and function as its wild-type form. A full-length functional protein can be a wild-type protein. A full-length functional protein can be an allotype of a wild-type protein with the same length. A full-length functional protein may contain mutations, such as amino acid substitutions of optional amino acid residues with similar properties, such that the protein's phenotype (e.g., function) is not altered by the mutation.

[0065] Exemplary amino acids with similar properties may include amino acids with charged side chains: positively charged arginine, histidine, and lysine; or negatively charged aspartic acid and glutamic acid; polar amino acid residues: serine, threonine, asparagine, glutamine, cysteine, and methionine; nonpolar amino acids: glycine, alanine, valine, leucine, isoleucine, and proline; and aromatic amino acids: phenylalanine, tyrosine, and tryptophan.

[0066] In some cases, partially processed mRNA transcripts lead to impaired protein production. Impaired protein production can be due to impaired production of the full-length functional form of the protein, which may include subnormal production of the full-length functional form. Impaired production of the full-length functional form of the protein may also include the production of defective forms of the protein. Defective forms of the protein may be truncated forms, misfolded forms, or forms containing abnormal target binding sites.

[0067] Polynucleic acid polymers The polynucleotide polymers described herein can be used to hybridize with partially processed mRNA transcripts to initiate the removal of retained introns. In some cases, the polynucleotide polymers are antisense polynucleotide polymers. Antisense polynucleotide polymers can hybridize with regions of partially processed mRNA transcripts having a high G / C content (e.g., regions containing approximately 40% to approximately 60%). Antisense polynucleotide polymers may contain a high G / C content, for example, approximately 40% to approximately 60%. Antisense polynucleotide polymers can hybridize with regions of partially processed mRNA transcripts located at, following, or near a weak 5' or weak 3' splice site. Antisense polynucleotide polymers can hybridize with regions of partially processed mRNA transcripts that may contain a low level of GGG motifs.

[0068] Antisense sequences of polynucleotide polymers can hybridize with retained introns of partially processed mRNA transcripts. Antisense sequences can hybridize with intron splicing regulatory elements of partially processed mRNA transcripts. Intron splicing regulatory elements may include intron splicing enhancers or intron splicing silencers. Antisense sequences can hybridize with intron splicing silencers. Intron splicing regulatory elements can regulate splicing by influencing early and / or intermediate steps of spliceosome assembly, such as when U1 and U2 snRNPs pair at exon-crossing splicing sites during exon confinement or during subsequent intron-crossing complex conversion. Exemplary intron splicing regulatory elements may include polypyrimidine sequence-binding proteins (PTB), U2AF65 and / or U2AF35, hnRNP L, and hnRNP A1.

[0069] Polynucleotide polymers (PNPs) can hybridize at the 5' splice site, 3' splice site, branching point, polypyrimidine sequence, or intron enhancer of introns. PNPs can also hybridize at distances of approximately 30, 25, 20, 15, 10, or 5 bases from the 5' splice site, 3' splice site, branching point, polypyrimidine sequence, or intron enhancer to promote or enhance splicing. Hybridization of PNPs at or near splice sites can promote or enhance splicing by recruiting splicing factors to the splice site, thereby initiating splicing.

[0070] Polynucleotide polymers can hybridize at intron silencing sites (e.g., de novo intron silencing sites), cryptic intron splicing sites, or sham splicing sites. Intron silencing sites can suppress silencing recognition by inhibiting the splicing response. Cryptonic intron splicing sites can be generated by mutations (e.g., substitution, deletion, or insertion). Cryptonic intron splicing sites can be cryptic 5' splicing sites or cryptic 3' splicing sites. Cryptonic intron splicing sites can be cryptic 5' splicing sites. Sham splicing sites can be weak splicing sites, where their activation can be caused by mutations in standard splicing sites. Sham splicing sites can be pseudo 5' splicing sites or pseudo 3' splicing sites. Hybridization at intron silencing sites can spatially block silencing binding and can help prevent disruption of spliceosome assembly and processing. Hybridization at cryptic intron splicing sites can redirect interactions to standard splicing sites, such as standard weak splicing sites.

[0071] Polynucleotide polymers can hybridize with the internal regions of introns. The internal regions of introns may not contain splicing sites, such as 5' splicing sites (e.g., standard, hidden, or pseudo-5' splicing sites), 3' splicing sites (e.g., standard, hidden, or pseudo-3' splicing sites), enhancer sites, or silencer sites. Hybridization of polynucleotide polymers at the internal regions can promote or enhance splicing by recruiting splicing factors to splicing sites (e.g., intron enhancer sites).

[0072] Polynucleotide polymers can hybridize with intron splicing regulatory elements of partially processed mRNA transcripts. These intron splicing regulatory elements may contain CCC motifs. Antisense sequences can hybridize with binding motifs of partially processed mRNA transcripts, wherein the binding motif does not form a G-quadruplex. Antisense sequences can hybridize with binding motifs of partially processed mRNA transcripts, wherein the binding motif is located between two G-quadruplexes. Antisense sequences can also hybridize with binding motifs of partially processed mRNA transcripts, wherein the binding motif has a first CCC motif and a second CCC motif. The first CCC motif may be approximately 3 or more nucleotide bases away from the second CCC motif.

[0073] Polynucleotide polymers can hybridize with binding motifs of partially processed mRNA transcripts, whereby the binding motifs form hairpin structures. Polynucleotide polymers can also destabilize hairpin structures.

[0074] Polynucleotide polymers may contain pyridine nucleotides at the 3' end and / or the 5' end. Polynucleotide polymers may also contain two consecutive pyridine nucleotides at the 3' end and / or the 5' end.

[0075] In some cases, polynucleotide polymers can be splice-converting oligonucleotides (SSOs). SSOs can hybridize with retained introns of partially processed mRNA transcripts. SSOs can also hybridize with intron splicing regulatory elements of partially processed mRNA transcripts.

[0076] Splice-switching oligonucleotides (SSOs) have been widely used to suppress exon usage, but antisense strategies that promote the removal of whole introns to increase splice-mediated gene expression have not yet been developed. Using a series of splice reporter variants containing the human proinsulin gene, it has been shown that reducing the binding of SSOs derived from transcripts expressing low levels of proinsulin haplotypes can reduce the binding of SSOs. INS Intron 1 is retained. SSO-assisted promotion of weak intron removal from the 5'UTR through competitive non-standard and standard RNA structures helps in the development of sequence-based antisense strategies to enhance gene expression.

[0077] The term "correction of intron retention" is understood as correcting irregular or anomalous intron retention. Correction can be complete or partial. Correction may include reducing the incidence of intron retention. Correction may include reducing anomalous intron retention.

[0078] In the context of protein expression caused by intron retention in gene transcripts, “defective” can refer to inadequate, defective, or aberrant protein expression.

[0079] Intron retention correction may include administering a polynucleotide polymer configured to hybridize with a gene transcript. Intron retention correction may include administering a polynucleotide polymer configured to hybridize with a gene transcript to alter higher-order structures within the gene transcript. Intron retention correction may include administering a polynucleotide polymer configured to hybridize with a gene transcript to interfere with one or more of the following: conformational transitions of classical RNA structures (stem-loop), non-classical RNA structures (G-quadruplex), interactions with trans-acting factors, and the rate of RNA-protein complex formation. Intron retention correction may include administering a polynucleotide polymer configured to hybridize with a gene transcript to interfere with (e.g., block) conformational transitions of classical (stem-loop) and / or non-classical (G-quadruplex) RNA structures. The polynucleotide polymer may be antisense for at least a portion of a target region containing or composed of an intron splicing regulatory element. The polynucleotide polymer may be antisense for at least a portion of a target region containing or composed of a mammalian conserved overlapping intron splicing regulatory element. Polynucleotide polymers may be antisense for at least a portion of the target region of a transcript containing an intronic segment or composed of a short pentamer to heptamer splicing regulatory motif. The splicing regulatory motif may contain CCCAG or AGGCC. The splicing regulatory motif may contain any of the motifs provided by Yeo GW ​​et al. (2007). PLoS Genet 3:e85 and / or Voelker RB, & Berglund JA (2007), Genome Res 17: 1023-1033, both cited and incorporated herein by reference. The target region may not contain C-runs to avoid G-quadruplex formation. The target region may not be adjacent to 5' and 3' splice sites, polypyrimidine sequences, branching sites, and / or superbranched regions.

[0080] Polynucleic acid polymers can provide the effects shown. INSA binding platform for splicing factors (including Tra2, SRSF3, or U2AF35, or other peptides, sense or antisense nucleic acids, small molecules, or other chemicals) that enable intron 1 and exon 2 splicing to facilitate the delivery of polynucleotide polymers and / or target nucleic acids to specific tissues, cells, or developmental stages. Such antisense strategies can help reduce pervasive intron retention in cancer cells, particularly those with somatic mutations in splicing factor genes, as first shown for specific substitutions in the zinc finger domain of U2AF35 in myeloproliferative disorders (76). These mutations occur in many tumors and lead to splicing defects that can contribute to malignant growth. This invention can help control cell proliferation and reduce malignant growth in cancer patients carrying a significant portion of mutations in splicing factors involving 3' splice site recognition (currently estimated at >15%) (76).

[0081] The sequence of the polynucleotide polymer can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.5% complementary to the target sequence of the partially processed mRNA transcript. The sequence of the polynucleotide polymer can be 100% complementary to the target sequence of the partially processed mRNA transcript.

[0082] The sequence of a polynucleotide polymer (PNP) may have four or fewer mismatches with the target sequence of a partially processed mRNA transcript. The sequence of a PNP may have three or fewer mismatches with the target sequence of a partially processed mRNA transcript. The sequence of a PNP may have two or fewer mismatches with the target sequence of a partially processed mRNA transcript. The sequence of a PNP may have one or fewer mismatches with the target sequence of a partially processed mRNA transcript.

[0083] Polynucleotide polymers can specifically hybridize with the target sequence of partially processed mRNA transcripts. Specificity can be defined as 95%, 98%, 99%, 99.5%, or 100% sequence complementarity between the polynucleotide polymer and the target sequence of the partially processed mRNA transcript. Hybridization can be performed under highly stringent hybridization conditions.

[0084] The polynucleotide polymer may be antisense for at least a portion of the target region comprising SEQ ID NO: 46 or a transcript thereof. The polynucleotide polymer may be antisense for at least a portion of the target region comprising a sequence having at least 99% identity with SEQ ID NO: 46 or a transcript thereof. The polynucleotide polymer may be antisense for at least a portion of the target region comprising a sequence having at least 98% identity with SEQ ID NO: 46 or a transcript thereof. The polynucleotide polymer may be antisense for at least a portion of the target region comprising a sequence having at least 95% identity with SEQ ID NO: 46 or a transcript thereof. The polynucleotide polymer may be antisense for at least a portion of the target region comprising a sequence having at least 90% identity with SEQ ID NO: 46 or a transcript thereof. The polynucleotide polymer may be antisense for at least a portion of the target region comprising a sequence having at least 85% identity with SEQ ID NO: 46 or a transcript thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 80% identity with SEQ ID NO: 46 or a transcript composed thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 75% identity with SEQ ID NO: 46 or a transcript composed thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 70% identity with SEQ ID NO: 46 or a transcript composed thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 65% identity with SEQ ID NO: 46 or a transcript composed thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 60% identity with SEQ ID NO: 46 or a transcript composed thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 55% identity with SEQ ID NO: 46 or a transcript composed thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 50% identity with SEQ ID NO: 46 or a transcript composed thereof.

[0085] The polynucleotide polymer can hybridize with an mRNA transcript having at least 80%, 85%, 90%, 95%, or 99% sequence identity with at least 13 consecutive bases of SEQ ID NO: 46. The polynucleotide polymer can hybridize with an mRNA transcript having 100% sequence identity with at least 13 consecutive bases of SEQ ID NO: 46.

[0086] The polynucleotide polymer can be antisense for at least a portion of the target region containing or composed of a transcript of SEQ ID NO: 3. The polynucleotide polymer can be antisense for at least a portion of the target region containing a sequence having at least 99% identity with or composed of a transcript of SEQ ID NO: 3. The polynucleotide polymer can be antisense for at least a portion of the target region containing a sequence having at least 98% identity with or composed of a transcript of SEQ ID NO: 3. The polynucleotide polymer can be antisense for at least a portion of the target region containing a sequence having at least 95% identity with or composed of a transcript of SEQ ID NO: 3. The polynucleotide polymer can be antisense for at least a portion of the target region containing a sequence having at least 90% identity with or composed of a transcript of SEQ ID NO: 3. The polynucleotide polymer can be antisense for at least a portion of the target region containing a sequence having at least 85% identity with or composed of a transcript of SEQ ID NO: 3. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 80% identity with SEQ ID NO: 3 or a transcript composed thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 75% identity with SEQ ID NO: 3 or a transcript composed thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 70% identity with SEQ ID NO: 3 or a transcript composed thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 65% identity with SEQ ID NO: 3 or a transcript composed thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 60% identity with SEQ ID NO: 3 or a transcript composed thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 55% identity with SEQ ID NO: 3 or a transcript composed thereof. The polynucleotide polymer may be antisense for at least a portion of the target region containing a sequence having at least 50% identity with SEQ ID NO: 3 or a transcript composed thereof.

[0087] Mentioning antisense for at least a portion of the target region of a transcript may include at least 5 consecutive nucleotides or at least 10 consecutive nucleotides. A polynucleotide polymer may be antisense for at least 5 consecutive nucleotides of the target region of a transcript comprising or consisting of SEQ ID NO: 46. A polynucleotide polymer may be antisense for at least 10 consecutive nucleotides of the target region of a transcript comprising or consisting of SEQ ID NO: 46. A polynucleotide polymer may be antisense for at least 15 consecutive nucleotides of the target region of a transcript comprising or consisting of SEQ ID NO: 46. A polynucleotide polymer may be antisense for at least 20 consecutive nucleotides of the target region of a transcript comprising or consisting of SEQ ID NO: 46.

[0088] The polynucleotide polymer can hybridize with mRNA transcripts containing at least 10 consecutive bases of SEQ ID NO: 46.

[0089] The polynucleotide polymer may be antisense for target regions containing sequences selected from or composed of transcripts from any of the following groups: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof.

[0090] The polynucleotide polymer may be antisense for target regions containing sequences having at least 99% sequence identity with sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof. The polynucleotide polymer may be antisense for target regions containing sequences having at least 98% sequence identity with sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof. The polynucleotide polymer may be antisense for target regions containing sequences having at least 95% sequence identity with sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof.The polynucleotide polymer may be antisense for target regions containing sequences having at least 90% sequence identity with sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof. The polynucleotide polymer may be antisense to the target region of a sequence or transcript containing at least 85% sequence identity with a sequence selected from any of the following groups: SEQ ID NO:3; SEQ ID NO:6; SEQ ID NO:9; SEQ ID NO:12; SEQ ID NO:15; SEQ ID NO:18; SEQ ID NO:21; SEQ ID NO:24; SEQ ID NO:27; SEQ ID NO:30; SEQ ID NO:33; SEQ ID NO:36; SEQ ID NO:39; SEQ ID NO:42; SEQ ID NO:45 or combinations thereof. The polynucleotide polymer may be antisense for target regions containing sequences having at least 80% sequence identity with sequences selected from the group consisting of any of the following: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof.The polynucleotide polymer may be antisense for target regions containing sequences having at least 75% sequence identity with sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof. The polynucleotide polymer may be antisense for target regions containing sequences having at least 70% sequence identity with sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof. The polynucleotide polymer may be antisense for target regions containing sequences having at least 65% sequence identity with sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof.The polynucleotide polymer may be antisense for target regions containing sequences having at least 63% sequence identity with sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof. The polynucleotide polymer may be antisense for target regions containing sequences having at least 60% sequence identity with sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof. The polynucleotide polymer may be antisense for target regions containing sequences having at least 50% sequence identity with sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof.

[0091] The polynucleotide polymer may be antisense for target regions comprising sequences or transcripts composed of any of the sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; and SEQ ID NO: 36, or combinations thereof. The polynucleotide polymer may be antisense for target regions comprising sequences having at least 99% identity with sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; and SEQ ID NO: 36, or combinations thereof. The polynucleotide polymer may be antisense for target regions comprising sequences having at least 98% identity with sequences selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; and SEQ ID NO: 36, or combinations thereof. The polynucleotide polymer may be antisense for target regions containing sequences having at least 95% identity with sequences selected from the group consisting of any of the following: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; and SEQ ID NO: 36 or combinations thereof.

[0092] The polynucleotide polymer can be antisense for target regions containing or composed of transcripts of SEQ ID NO: 3. The polynucleotide polymer can be antisense for target regions containing or composed of transcripts of SEQ ID NO: 6. The polynucleotide polymer can be antisense for target regions containing or composed of transcripts of SEQ ID NO: 9. The polynucleotide polymer can be antisense for target regions containing or composed of transcripts of SEQ ID NO: 36.

[0093] The polynucleotide polymer can be antisense for target regions containing sequences or transcripts having at least 99%, 98%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 63%, 60%, 55%, or 50% identity with SEQ ID NO: 3. The polynucleotide polymer can also be antisense for target regions containing sequences or transcripts having at least 99%, 98%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 63%, 60%, 55%, or 50% identity with SEQ ID NO: 6. The polynucleotide polymer can be antisense for target regions containing sequences or transcripts having at least 99%, 98%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 63%, 60%, 55%, or 50% identity with SEQ ID NO: 9. The polynucleotide polymer can also be antisense for target regions containing sequences or transcripts having at least 99%, 98%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 63%, 60%, 55%, or 50% identity with SEQ ID NO: 36.

[0094] The polynucleotide polymer may be antisense for regions containing sequences complementary to any of the sequences in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, or transcripts composed thereof. The polynucleotide polymer may be antisense for regions containing sequences having at least 99% identity with any of the sequences in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, or transcripts composed thereof. The polynucleotide polymer may be antisense for regions containing sequences having at least 98% identity with any of the sequences in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, or transcripts composed thereof. The polynucleotide polymer may be antisense for regions containing sequences having at least 95% identity with any of the sequences in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, or transcripts composed thereof. The polynucleotide polymer may be antisense for regions containing sequences having at least 90% identity with any of the sequences in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, or transcripts composed thereof. The polynucleotide polymer may be antisense for regions containing sequences or transcripts that are complementary to any sequence in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, having at least 85% identity. The polynucleotide polymer may be antisense for regions containing sequences or transcripts that are complementary to any sequence in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, having at least 80% identity. The polynucleotide polymer may be antisense for regions containing sequences or transcripts that are complementary to any sequence in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, having at least 75% identity. The polynucleotide polymer may be antisense for regions containing sequences or transcripts that are complementary to any sequence in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, having at least 70% identity. The polynucleotide polymer may be antisense for regions containing sequences or transcripts that are complementary to any sequence in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, having at least 65% identity. The polynucleotide polymer may be antisense for regions containing sequences or transcripts that are complementary to any sequence in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, having at least 60% identity. The polynucleotide polymer may be antisense for regions containing sequences or transcripts that are complementary to any sequence in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, having at least 55% identity. The polynucleotide polymer may be antisense for regions containing sequences or transcripts that are complementary to any sequence in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof, having at least 50% identity.Those skilled in the art will understand that uracil nucleotides can be replaced by thymine nucleotides (e.g., DNA forms of RNA having such sequences).

[0095] The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence selected from or composed of any of the following groups: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or a combination thereof.

[0096] The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 99% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 98% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof.The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 95% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 90% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof.The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 85% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 80% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof.The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 75% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 70% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof.The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 65% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 60% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof.The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 55% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 50% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof.

[0097] The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence selected from or composed of any of the following: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO 5; SEQ IN NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 99% identity with a sequence selected from or composed of any of the following: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO 5; SEQ IN NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 98% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO 5; SEQ IN NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 95% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO 5; SEQ IN NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 90% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ IN NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 85% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ IN NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof.The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 80% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO 5; SEQ IN NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 75% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO 5; SEQ IN NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 70% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ IN NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 65% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ IN NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof. The polynucleotide polymer may comprise or be composed of a polynucleotide polymer sequence having at least 60% identity with a sequence selected from any of the following: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof.The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 55% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO 5; SEQ IN NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 50% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO 5; SEQ IN NO: 7; SEQ ID NO: 8; SEQ ID NO: 34; and SEQ ID NO: 35, or combinations thereof.

[0098] The polynucleic acid polymer may contain or consist of SEQ ID NO: 1 or SEQ ID NO: 2. The polynucleic acid polymer may contain or consist of SEQ ID NO: 3 or SEQ ID NO: 4. The polynucleic acid polymer may contain or consist of SEQ ID NO: 7 or SEQ ID NO: 8. The polynucleic acid polymer may contain or consist of SEQ ID NO: 34 or SEQ ID NO: 35.

[0099] The polynucleotide polymer may contain or consist of a sequence having at least 99% identity with or consisting of SEQ ID NO: 1 or SEQ ID NO: 2. The polynucleotide polymer may contain or consist of a sequence having at least 98% identity with or consisting of SEQ ID NO: 1 or SEQ ID NO: 2. The polynucleotide polymer may contain or consist of a sequence having at least 95% identity with or consisting of SEQ ID NO: 1 or SEQ ID NO: 2. The polynucleotide polymer may contain or consist of a sequence having at least 90% identity with or consisting of SEQ ID NO: 1 or SEQ ID NO: 2. The polynucleotide polymer may contain or consist of a sequence having at least 85% identity with or consisting of SEQ ID NO: 1 or SEQ ID NO: 2. The polynucleotide polymer may contain or consist of a sequence having at least 80% identity with or consisting of SEQ ID NO: 1 or SEQ ID NO: 2. The polynucleotide polymer may contain or consist of a sequence having at least 75% identity with or consisting of SEQ ID NO: 1 or SEQ ID NO: 2. The polynucleotide polymer may contain or consist of a sequence having at least 70% identity with SEQ ID NO: 1 or SEQ ID NO: 2. The polynucleotide polymer may contain or consist of a sequence having at least 65% identity with SEQ ID NO: 1 or SEQ ID NO: 2. The polynucleotide polymer may contain or consist of a sequence having at least 60% identity with SEQ ID NO: 1 or SEQ ID NO: 2.

[0100] The polynucleotide polymer may contain or consist of a sequence having at least 99% identity with or consisting of SEQ ID NO: 3 or SEQ ID NO: 4. The polynucleotide polymer may contain or consist of a sequence having at least 98% identity with or consisting of SEQ ID NO: 3 or SEQ ID NO: 4. The polynucleotide polymer may contain or consist of a sequence having at least 95% identity with or consisting of SEQ ID NO: 3 or SEQ ID NO: 4. The polynucleotide polymer may contain or consist of a sequence having at least 90% identity with or consisting of SEQ ID NO: 3 or SEQ ID NO: 4. The polynucleotide polymer may contain or consist of a sequence having at least 85% identity with or consisting of SEQ ID NO: 3 or SEQ ID NO: 4. The polynucleotide polymer may contain or consist of a sequence having at least 80% identity with or consisting of SEQ ID NO: 3 or SEQ ID NO: 4. The polynucleotide polymer may contain or consist of a sequence having at least 75% identity with or consisting of SEQ ID NO: 3 or SEQ ID NO: 4. The polynucleotide polymer may contain or consist of a sequence having at least 70% identity with or consisting of SEQ ID NO: 3 or SEQ ID NO: 4. The polynucleotide polymer may contain or consist of a sequence having at least 65% identity with or consisting of SEQ ID NO: 3 or SEQ ID NO: 4. The polynucleotide polymer may contain or consist of a sequence having at least 60% identity with or consisting of SEQ ID NO: 3 or SEQ ID NO: 4.

[0101] The polynucleotide polymer may contain or consist of a sequence having at least 99% identity with or consisting of SEQ ID NO: 7 or SEQ ID NO: 8. The polynucleotide polymer may contain or consist of a sequence having at least 98% identity with or consisting of SEQ ID NO: 7 or SEQ ID NO: 8. The polynucleotide polymer may contain or consist of a sequence having at least 95% identity with or consisting of SEQ ID NO: 7 or SEQ ID NO: 8. The polynucleotide polymer may contain or consist of a sequence having at least 90% identity with or consisting of SEQ ID NO: 7 or SEQ ID NO: 8. The polynucleotide polymer may contain or consist of a sequence having at least 85% identity with or consisting of SEQ ID NO: 7 or SEQ ID NO: 8. The polynucleotide polymer may contain or consist of a sequence having at least 80% identity with or consisting of SEQ ID NO: 7 or SEQ ID NO: 8. The polynucleotide polymer may contain or consist of a sequence having at least 75% identity with or consisting of SEQ ID NO: 7 or SEQ ID NO: 8. The polynucleotide polymer may contain or consist of a sequence having at least 70% identity with or consisting of SEQ ID NO: 7 or SEQ ID NO: 8. The polynucleotide polymer may contain or consist of a sequence having at least 65% identity with or consisting of SEQ ID NO: 7 or SEQ ID NO: 8. The polynucleotide polymer may contain or consist of a sequence having at least 60% identity with or consisting of SEQ ID NO: 7 or SEQ ID NO: 8.

[0102] The polynucleotide polymer may contain or consist of a sequence having at least 99% identity with or consisting of the sequence of SEQ ID NO: 34 or SEQ ID NO: 35. The polynucleotide polymer may contain or consist of a sequence having at least 98% identity with or consisting of the sequence of SEQ ID NO: 34 or SEQ ID NO: 35. The polynucleotide polymer may contain or consist of a sequence having at least 95% identity with or consisting of the sequence of SEQ ID NO: 34 or SEQ ID NO: 35. The polynucleotide polymer may contain or consist of a sequence having at least 90% identity with or consisting of the sequence of SEQ ID NO: 34 or SEQ ID NO: 35. The polynucleotide polymer may contain or consist of a sequence having at least 85% identity with or consisting of the sequence of SEQ ID NO: 34 or SEQ ID NO: 35. The polynucleotide polymer may contain or consist of a sequence having at least 80% identity with or consisting of the sequence of SEQ ID NO: 34 or SEQ ID NO: 35. The polynucleotide polymer may contain or consist of a sequence having at least 75% identity with or consisting of the sequence of SEQ ID NO: 34 or SEQ ID NO: 35. The polynucleotide polymer may contain or consist of a sequence having at least 70% identity with or consisting of a sequence having at least 65% identity with or consisting of a sequence having at least 60 ...

[0103] The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence selected from or composed of any of the group consisting of SEQ ID NO: 47 to 434 or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence selected from or composed of any of the group consisting of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are replaced by thymine nucleotides (e.g., in the form of DNA from RNA having such a sequence).

[0104] The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 99% identity with a sequence selected from the group consisting of SEQ ID NO: 47 to 434 or combinations thereof. The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 99% identity with a sequence selected from the group consisting of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are replaced by thymine nucleotides (e.g., in the DNA form of RNA having such a sequence). The polynucleotide polymer may comprise or consist of a polynucleotide polymer sequence having at least 98% identity with a sequence selected from the group consisting of SEQ ID NO: 47 to 434 or combinations thereof. The polynucleotide polymer may comprise or be composed of a polynucleotide polymer sequence having at least 98% identity with a sequence selected from the group consisting of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are substituted with thymine nucleotides (e.g., in the DNA form of RNA having such a sequence). The polynucleotide polymer may comprise or be composed of a polynucleotide polymer sequence having at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 47 to 434 or combinations thereof. The polynucleotide polymer may comprise or be composed of a polynucleotide polymer sequence having at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are substituted with thymine nucleotides (e.g., in the DNA form of RNA having such a sequence). Polynucleotide polymers may comprise or be composed of polynucleotide polymer sequences having at least 90% identity with a sequence selected from the group consisting of any one of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are substituted with thymine nucleotides (e.g., in the DNA form of RNA having such a sequence). Polynucleotide polymers may comprise or be composed of polynucleotide polymer sequences having at least 85% identity with a sequence selected from the group consisting of any one of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are substituted with thymine nucleotides (e.g., in the DNA form of RNA having such a sequence). Polynucleotide polymers may comprise or be composed of polynucleotide polymer sequences having at least 80% identity with a sequence selected from the group consisting of any one of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are substituted with thymine nucleotides (e.g., in the DNA form of RNA having such a sequence).Polynucleotide polymers may comprise or be composed of polynucleotide polymer sequences having at least 75% identity with a sequence selected from the group consisting of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are substituted with thymine nucleotides (e.g., in the DNA form of RNA having such a sequence). Polynucleotide polymers may comprise or be composed of polynucleotide polymer sequences having at least 70% identity with a sequence selected from the group consisting of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are substituted with thymine nucleotides (e.g., in the DNA form of RNA having such a sequence). Polynucleotide polymers may comprise or be composed of polynucleotide polymer sequences having at least 65% identity with a sequence selected from the group consisting of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are substituted with thymine nucleotides (e.g., in the DNA form of RNA having such a sequence). Polynucleotide polymers may comprise or be composed of polynucleotide polymer sequences having at least 60% identity with a sequence selected from the group consisting of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are substituted with thymine nucleotides (e.g., in the DNA form of RNA having such a sequence). Polynucleotide polymers may comprise or be composed of polynucleotide polymer sequences having at least 55% identity with a sequence selected from the group consisting of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are substituted with thymine nucleotides (e.g., in the DNA form of RNA having such a sequence). Polynucleotide polymers may comprise or be composed of polynucleotide polymer sequences having at least 50% identity with a sequence selected from the group consisting of SEQ ID NO: 47 to 434 or combinations thereof, wherein uracil nucleotides are substituted with thymine nucleotides (e.g., in the DNA form of RNA having such a sequence).

[0105] Advantageously, the present invention identifies SSOs that reduce the relative abundance of intron transcripts (e.g., intron 1-retained transcripts) and describes optimized antisense targets at single nucleotide resolution.

[0106] Polynucleotide polymers may contain splice-conversion oligonucleotides (SSOs). Polynucleotide polymers can be approximately 50 nucleotides long. Polynucleotide polymers can be approximately 45 nucleotides long. Polynucleotide polymers can be approximately 40 nucleotides long. Polynucleotide polymers can be approximately 35 nucleotides long. Polynucleotide polymers can be approximately 30 nucleotides long. Polynucleotide polymers can be approximately 25 nucleotides long. Polynucleotide polymers can be approximately 20 nucleotides long. Polynucleotide polymers can be approximately 19 nucleotides long. Polynucleotide polymers can be approximately 18 nucleotides long. Polynucleotide polymers can be approximately 17 nucleotides long. Polynucleotide polymers can be approximately 16 nucleotides long. Polynucleotide polymers can be approximately 15 nucleotides long. Polynucleotide polymers can be approximately 14 nucleotides long. Polynucleotide polymers can be approximately 13 nucleotides long. Polynucleotide polymers can be approximately 12 nucleotides long. Polynucleotide polymers can be approximately 11 nucleotides long. Polynucleotide polymers can be approximately 10 nucleotides long. Polynucleotide polymers can range from approximately 10 to approximately 50 nucleotides in length. Polynucleotide polymers can be approximately 10 to 45 nucleotides in length. Polynucleotide polymers can be approximately 10 to 40 nucleotides in length. Polynucleotide polymers can be approximately 10 to 35 nucleotides in length. Polynucleotide polymers can be approximately 10 to 30 nucleotides in length. Polynucleotide polymers can be approximately 10 to 25 nucleotides in length. Polynucleotide polymers can be approximately 10 to 20 nucleotides in length. Polynucleotide polymers can be approximately 15 to 25 nucleotides in length. Polynucleotide polymers can be approximately 15 to 30 nucleotides in length. Polynucleotide polymers can be approximately 12 to 30 nucleotides in length.

[0107] Polynucleotide polymers (e.g., SSO) may contain RNA or DNA. Polynucleotide polymers (e.g., SSO) may contain RNA. Polynucleotide polymers (e.g., SSO) may contain natural or synthetic or artificial nucleotide analogs or bases having complementary effects equivalent to DNA or RNA. Polynucleotide polymers (e.g., SSO) may contain a combination of DNA, RNA, and / or nucleotide analogs. Nucleotide analogs may include PNA or LNA. In another embodiment, the nucleic acid (e.g., SSO) may contain or be composed of PMO.

[0108] In some cases, synthetic or artificial nucleotide analogs or bases may contain modifications at one or more sites in the ribose moiety, phosphate moiety, nucleoside moiety, or combinations thereof.

[0109] Nucleotide analogs or artificial nucleotide bases can constitute nucleic acids with modifications at the 2' hydroxyl group of the ribose moiety. The modification can be a 2'-O-methyl modification or a 2'-O-methoxyethyl (2'-O-MOE) modification. A 2'-O-methyl modification adds a methyl group to the 2' hydroxyl group of the ribose moiety, while a 2'-O-methoxyethyl modification adds a methoxyethyl group to the 2' hydroxyl group of the ribose moiety. The following figures illustrate exemplary chemical structures of adenosine with a 2'-O-methyl modification and uridine with a 2'-O-methoxyethyl modification.

[0110] 2'-O-methyl-adenosine 2'-O-methoxyethyluridine Further modifications at the 2' hydroxyl group may include a 2'-O-aminopropyl sugar conformation, which may involve an elongated amino group (containing a propyl linker that binds the amino group to the 2' oxygen). This modification can neutralize the total negative charge of the oligonucleotide molecule from its phosphate ester origin by introducing a positive charge from the amino group with each sugar, and can thereby improve cellular uptake properties due to its zwitterionic nature. An exemplary chemical structure of 2'-O-aminopropyl nucleotide phosphoramidide is illustrated below.

[0111] 2'-O-aminopropyl nucleoside phosphoramidone Further modifications at the 2' hydroxyl position may include locked or bridged ribose conformations (e.g., locked nucleic acids or LNAs), which may also involve the 4' ribose position. In this modification, the oxygen molecule bound at the 2' carbon can be linked to the 4' carbon via a methylene group, thereby forming a 2'- C ,4'- C -O-methylene linked bicyclic ribonucleotide monomers. The following illustrations illustrate exemplary representations of the chemical structure of LNA. The representation shown on the left highlights the chemical linkages of the LNA monomer. The representation shown on the right highlights the locked 3'-internal (3E) conformation of the furanose ring of the LNA monomer.

[0112] LNA (Locked Nucleic Acid) Further modifications at the 2' hydroxyl group may include ethylene nucleic acids (ENAs), such as 2'-4'-ethylene bridging nucleic acids, which lock the sugar conformation to the C3'-internal sugar fold conformation. ENAs are part of a class of bridging nucleic acids that also contain LNAs. Exemplary chemical structures of ENAs and bridging nucleic acids are illustrated below.

[0113] Further modifications at the 2' hydroxyl group may include 2'-deoxy, T-deoxy-2'-fluorine, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA).

[0114] Nucleotide analogs may further include morpholine nucleotides, peptide nucleic acids (PNAs), methylphosphonate nucleotides, mercaptophosphonate nucleotides, 2'-fluoroN3-P5'-phosphamide, 1',5'-dehydrated hexadiol nucleic acids (HNAs), or combinations thereof. Morpholine nucleotide or phosphorodiamidate morpholine nucleotide oligomers (PMOs) comprise synthetic molecules whose structure mimics the structure of native nucleic acids by deviating from the normal sugar and phosphate ester structures. Instead, the five-membered ribose ring can be replaced by a six-membered morpholine ring containing four carbons, one nitrogen, and one oxygen. The ribose monomers can be linked via phosphorodiamidate groups instead of phosphate ester groups. These skeletal alterations can remove all positive and negative charges, resulting in neutral morpholine nucleotide molecules that can cross cell membranes without the aid of cell delivery agents, such as those used by charged oligonucleotides.

[0115] Peptide nucleic acids (PNAs) do not contain sugar rings or phosphate ester linkages. Instead, bases are linked and appropriately spaced through oligoglycine-like molecules, thus eliminating skeletal charge.

[0116] Modifications to the phosphate backbone may also include methyl or thiol modifications, such as methylphosphonate nucleotides and methylphosphonate nucleotides. The following illustrations depict exemplary thiolphosphonate nucleotides (left) and methylphosphonate nucleotides (right).

[0117] Furthermore, an exemplary illustration of 2'-fluoroN3-P5'-phosphamide is shown below: .

[0118] An exemplary hexitol nucleic acid (or 1',5'-dehydrated hexitol nucleic acid (HNA)) is illustrated as follows: .

[0119] In addition to modifications to the ribose moiety, phosphate backbone, and nucleoside, nucleotide analogs can also be modified, for example, at the 3' or 5' end. For instance, the 3' end may include a 3' cationic group, or by flipping the nucleoside at the 3'-end with a 3'-3' linker. Alternatively, the 3'-end may be closed with an aminoalkyl group, such as 3'C5-aminoalkyl dT. The 5'-end may be closed with an aminoalkyl group, such as a 5'-O-alkylamino substituent. Other 5' conjugates can inhibit 5'-3' exonuclease cleavage. Other 3' conjugates can inhibit 3'-5' exonuclease cleavage.

[0120] In some cases, one or more artificial nucleotide analogs described herein are resistant to nucleases such as ribonucleases (e.g., RNase H), deoxyribonucleases (e.g., DNase), or exonucleases (e.g., 5'-3' and 3'-5' exonucleases) compared to natural polynucleotide polymers. In some cases, they contain 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAOE), etc. Artificial nucleotide analogs of LNA, ENA, PNA, HNA, morpholine nucleotides, methylphosphonate nucleotides, mercaptophosphonate nucleotides, 2'-fluoroN3-P5'-phosphinoamide, or combinations thereof modified with 2'-O-DMAP, TO-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA) are resistant to nucleases such as ribonucleases (e.g., RNase H), deoxyribonucleases (e.g., DNase), or exonucleases (e.g., 5'-3' and 3'-5' exonucleases). Polynucleotide polymers modified with 2'-O-methyl can also exhibit nuclease resistance (e.g., RNase H). Polynucleotide polymers modified with 2'-O-methoxyethyl (2'-O-MOE) may exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). Polynucleotide polymers modified with 2'-O-aminopropyl may exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). Polynucleotide polymers modified with 2'-deoxyethyl (2'-O-MOE) may exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). Exonuclease resistance). T-deoxy-2'-fluoro modified polynucleotide polymers can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). 2'-O-aminopropyl (2'-O-AP) modified polynucleotide polymers can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). 2'-O-dimethylaminoethyl (2'-O-DMAOE) modified polynucleotide polymers can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease).Polynucleotide polymers modified with 2'-O-dimethylaminopropyl (2'-O-DMAP) can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). Polynucleotide polymers modified with TO-dimethylaminoethoxyethyl (2'-O-DMAEOE) can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). Polynucleotide polymers modified with 2'-ON-methylacetamide (2'-O-NMA) can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). LNA-modified polynucleotide polymers can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). ENA-modified polynucleotide polymers can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). HNA-modified polynucleotide polymers can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). Morpholine nucleotides can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). PNA can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). Methylphosphonate nucleotide-modified polynucleotide polymers can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). Polynucleic acid polymers modified with thiophosphonate nucleotides can exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease). Polynucleic acid polymers containing 2'-fluoroN3-P5'-phosphoamide can also exhibit nuclease resistance (e.g., resistance to RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease).

[0121] In some cases, one or more artificial nucleotide analogs described herein exhibit enhanced binding affinity to their mRNA targets relative to equivalent natural polynucleotide polymers. One or more artificial nucleotide analogs comprising 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA) modified LNA, ENA, PNA, HNA, morpholine nucleotides, methylphosphonate nucleotides, mercaptophosphonate nucleotides, or 2'-fluoroN3-P5'-phosphinoamide can exhibit enhanced binding affinity to their mRNA targets relative to equivalent natural polynucleotide polymers. Polynucleotide polymers modified with 2'-O-methyl exhibit increased binding affinity to their mRNA targets compared to their equivalent natural counterparts. Polynucleotide polymers modified with 2'-O-methoxyethyl (2'-O-MOE) exhibit increased binding affinity to their mRNA targets compared to their equivalent natural counterparts. Polynucleotide polymers modified with 2'-O-aminopropyl exhibit increased binding affinity to their mRNA targets compared to their equivalent natural counterparts. Polynucleotide polymers modified with 2'-deoxy exhibit increased binding affinity to their mRNA targets compared to their equivalent natural counterparts. Polynucleotide polymers modified with T-deoxy-2'-fluorine exhibit increased binding affinity to their mRNA targets compared to their equivalent natural counterparts. Polynucleotide polymers modified with 2'-O-aminopropyl (2'-O-AP) exhibit increased binding affinity to their mRNA targets compared to their equivalent natural counterparts. Polynucleotide polymers modified with 2'-O-dimethylaminoethyl (2'-O-DMAOE) exhibit increased binding affinity to their mRNA targets compared to their equivalent natural polynucleotide polymers. Polynucleotide polymers modified with 2'-O-dimethylaminopropyl (2'-O-DMAP) exhibit increased binding affinity to their mRNA targets compared to their equivalent natural polynucleotide polymers. Polynucleotide polymers modified with TO-dimethylaminoethoxyethyl (2'-O-DMAEOE) exhibit increased binding affinity to their mRNA targets compared to their equivalent natural polynucleotide polymers. Polynucleotide polymers modified with 2'-ON-methylacetamide (2'-O-NMA) exhibit increased binding affinity to their mRNA targets compared to their equivalent natural polynucleotide polymers. LNA-modified polynucleotide polymers exhibit increased binding affinity to their mRNA targets compared to their equivalent natural polynucleotide polymers.ENA-modified polynucleotide polymers exhibit increased binding affinity to their mRNA targets compared to equivalent natural polynucleotide polymers. PNA-modified polynucleotide polymers exhibit increased binding affinity to their mRNA targets compared to equivalent natural polynucleotide polymers. HNA-modified polynucleotide polymers exhibit increased binding affinity to their mRNA targets compared to equivalent natural polynucleotide polymers. Morpholine-modified polynucleotide polymers exhibit increased binding affinity to their mRNA targets compared to equivalent natural polynucleotide polymers. Methylphosphonate nucleotide-modified polynucleotide polymers exhibit increased binding affinity to their mRNA targets compared to equivalent natural polynucleotide polymers. Thiophosphonate nucleotide-modified polynucleotide polymers exhibit increased binding affinity to their mRNA targets compared to equivalent natural polynucleotide polymers. Polynucleotide polymers containing 2'-fluoroN3-P5'-phosphite exhibit increased binding affinity to their mRNA targets compared to equivalent natural polynucleotide polymers. Increased affinity can be achieved with lower Kd and higher melting temperatures. T m (or a combination thereof)

[0122] In other cases, the polynucleotide polymers described herein can be modified to increase their stability. In embodiments where the polynucleotide polymer is RNA, the polynucleotide polymer can be modified to increase its stability. The polynucleotide polymer can be modified to increase its stability by one or more of the modifications described above. The polynucleotide polymer can be modified at the 2' hydroxyl position, for example by 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA), or by a locked or bridged ribose conformation (e.g., LNA or ENA). Polynucleotide polymers can be modified with 2'-O-methyl and / or 2'-O-methoxyethyl ribose. Polynucleotide polymers may also contain morpholine nucleotides, PNA, HNA, methylphosphonate nucleotides, mercaptophosphonate nucleotides, or 2'-fluoroN3-P5'-phosphamide to increase their stability. Suitable modifications to RNA to increase delivery stability will be apparent to those skilled in the art.

[0123] The polynucleotide polymers described herein can be constructed using procedures known in the art, employing chemical synthesis and / or enzymatic ligation reactions. For example, polynucleotide polymers can be chemically synthesized using naturally occurring nucleotides or diversely modified nucleotides designed to increase the biological stability of the molecule or the physical stability of the double strand formed between the polynucleotide polymer and the target nucleic acid. Exemplary methods may include those described in US 5,142,047; US 5,185,444; WO 2009099942; or EP 1579015. Other exemplary methods may include those described in the following literature: Griffey et al., “2'-O-aminopropyl ribonucleotides: a zwitterionic modification that enhances the exonuclease resistance and biological activity of antisense oligonucleotides”, J. Med. Chem. 39(26): 5100-5109 (1997); Obika et al., “Synthesis of 2′-O,4′-C-methyleneuridine and-cytidine. Novel bicyclic nucleosides having a fixed C3,-endo sugar puckering”, Tetrahedron Letters 38(50): 8735 (1997); Koizumi, M. “ENA oligonucleotides as therapeutics”, Current opinion inmolecular therapeutics 8(2): 144-149 (2006); and Abramova et al., “Novel oligonucleotide analogues based on morpholino nucleoside subunits-antisense technologies: new chemical Possibilities, Indian Journal of Chemistry 48B: 1721-1726 (2009). Alternatively, polynucleotide polymers can be biologically generated using expression vectors in which polynucleotide polymers have been subcloned in the antisense direction (i.e., RNA transcribed from the inserted polynucleotide polymer will have an antisense orientation toward the target polynucleotide polymer of interest).

[0124] Polynucleotide polymers (PNPs) can bind any nucleic acid molecule (e.g., another antisense molecule), peptide, or other chemical substances to facilitate PNP delivery and / or target nucleic acids to specific tissues, cell types, or stages of cell development. PNPs can bind proteins or RNA. Proteins bound to PNPs may contain splicing factors to enhance, inhibit, or regulate splicing and intron removal. RNA bound to PNPs may contain aptamers or any structures that enhance, inhibit, or regulate splicing and intron removal. PNPs can be isolated nucleic acids.

[0125] Polynucleotide polymers can be conjugated or bound to delivery vectors suitable for delivering polynucleotide polymers to cells. Cells can be specific cell types or specific developmental stages. Delivery vectors can be site-specific, tissue-specific, cell-specific, or developmental stage-specific delivery. For example, a delivery vector can be a cell-specific viral particle or a component thereof, or a cell-specific antibody particle or a component thereof. Polynucleotide polymers can be targeted for delivery to β cells in the pancreas. Polynucleotide polymers can be targeted for delivery to thymocytes. Polynucleotide polymers can be targeted for delivery to malignant cells. Polynucleotide polymers can be targeted for delivery to premalignant cells (known to develop into obvious malignant phenotypes, such as preleukemia and myelodysplastic syndromes, or histopathologically defined precancerous lesions or conditions).

[0126] In one embodiment, the polynucleic acid polymer can bind chemical molecules (e.g., molecules that are not peptides or nucleic acid groups), such as drugs. Drugs can be small molecules (e.g., having a molecular weight (MW) of less than 900 Da).

[0127] In one embodiment of the invention, the delivery vector may comprise a cell-penetrating peptide (CPP). For example, a polynucleotide polymer may be bound to or complexed with a CPP. Those skilled in the art will understand that any suitable CPP may be conjugated to a polynucleotide polymer to aid in the delivery of the polynucleotide polymer to cells and / or to cells. Such a CPP may be any suitable CPP technology described by Boisguérin et al. (2015, Advanced Drug Delivery Reviews doi: 10.1016 / j.addr.2015.02.008), which is incorporated herein by reference. Suitable delivery vectors for conjugation with polynucleotide polymers are also described by Lochmann et al. (European Journal of Pharmaceutics and Biopharmaceutics 58 (2004) 237-251), which is incorporated herein by reference.

[0128] CPPs can be peptides rich in arginine and / or lysine, for example, where most residues in the peptide are lysine or arginine. CPPs may contain poly-L-lysine (PLL). Alternatively, CPPs may contain polyarginine. Suitable CPPs can be selected from the following groups: penetratin; R6-penetratin; transportan; oligoarginine; F-3; B-peptide; B-MSP; Pip peptides, such as Pip1, Pip2a, Pip2b, Pip5e, Pip5f, Pip5h, Pip5j, Pip5k, Pip5l, Pip5m, Pip5n, Pip5o, Pip6a, Pip6b, Pip6c, Pip6d, Pip6e, Pip6f, Pip6g, or Pip6h; peptides with the sequence PKKKRKV; penatratin; Lys4; SPACE; Tat; Tat-DRBD (dsRNA-binding domain); (RXR)4; (RFF)3RXB; (KFF)3K; R g F2; T-cell derived CPP; Pep-3; PEGpep-3; MPG-8; MPG-8-Chol; PepFect6; P5RHH; R15; and Chol-R9; or functional variants thereof (see, for example, Boisguérin et al. (2015, Advanced Drug Delivery Reviews doi: 10.1016 / j.addr.2015.02.008).

[0129] In one embodiment, the CPP comprises or is composed of a Pip peptide. The Pip peptide may be selected from the group consisting of Pip1, Pip2a, Pip2b, Pip5e, Pip5f, Pip5h, Pip5j; Pip5k, Pip5l, Pip5m, Pip5n, Pip5o, Pip6a, Pip6b, Pip6c, Pip6d, Pip6e, Pip6f, Pip6g, and Pip6h.

[0130] In one embodiment of the invention, the delivery carrier may comprise peptide-based nanoparticles (PBNs) wherein multiple CPPs (e.g., one or more suitable CPPs discussed herein) form a complex with a polynucleic acid polymer through charge interactions. The size of such nanoparticles may be from about 50 nm to 250 nm. In one embodiment, the size of the nanoparticles may be about 70-200 nm. In another embodiment, the size of the nanoparticles may be about 70-100 nm or 125-200 nm.

[0131] In one embodiment, the polynucleic acid polymer can be complexed with a delivery carrier, for example, via ionic bonds. Alternatively, the polynucleic acid polymer can be covalently bound to the delivery carrier. Conjugation / binding methods are described in Lochmann et al. (European Journal of Pharmaceutics and Biopharmaceutics 58 (2004) 237-251, which are incorporated herein by reference). For example, a conjugation method may include introducing a suitable tether containing a reactive group (e.g., -NH2 or -SH2) into the polynucleic acid polymer and adding a delivery carrier, such as a peptide, as an active intermediate after synthesis, followed by a coupling reaction in an aqueous medium. Alternative methods may include conjugation in a linear mode on a single solid support.

[0132] The delivery carrier and the polynucleic acid polymer can be linked by thiols and / or maleimides, such as thiols-maleimides. The conjugation of the polynucleic acid polymer and the delivery carrier can be achieved through click chemistry, such as a reaction between an azide or 2'-O-propyne functional group and an alkynyl group on the respective molecule to be conjugated. In one embodiment, the delivery carrier and the polynucleic acid polymer can be linked by a thioether bridge. In another embodiment, the delivery carrier and the polynucleic acid polymer can be linked by a disulfide bridge. Those skilled in the art should readily determine suitable linking groups or reactions for conjugating the polynucleic acid polymer and the delivery carrier (e.g., a peptide).

[0133] Gene transcripts can encode proinsulin. Gene transcripts can... INS Gene transcription. Gene transcripts can originate from human haplotypes expressing low levels of proinsulin. Introns may contain... INS Intron 1.

[0134] Gene transcripts may be transcribed from a gene or an ORF, wherein the gene or ORF is selected from any of the following: ABCD4; ABCF3; ACADVL; ALKBH6; AP1G2; APEX1; ARFRP1; ATHL1; ATP1A3; ATP5D; ATP13A1; BAX; BDH2; BRD2; C1orf63; C1orf630; C1orf631; C1orf124; C2orf49; C8orf82; C16orf59; CAPRIN2; CDCA7; CEP164; CEP170; CLCN7; CPNE1; CPSF3L; DCXR; DENND4B; DFFA; DIS3L2; DNAJB12; DPF1; DRG2; DSN1; EML3; EWSR1; EWSR10; FGFR4; FTSJ1; GBAP1; GMPPA; GMPR2; GNPTG; GORASP1; GPATCH4; HGS; HMG2 0B; IFFO1; ISYNA1; KRI1; LOC148413; LZTR1; MAN2C1; MAP4K2; MCOLN1; MDP1; MIB2; MITD1; MOK; MOV10; MRPL35; MTMR11; MUS81; NAPEPLD; NBEAL2; ND RG4; NDUFB10; NFATC4; NFKBIB; NIT1; NKTR; NPRL2; NSUN5P1; NUDT22; PAN2; PDC1; PDLIM4; PHF1; PIK3CD; PITPNM1; PPIL2; PPP1R35; PPP4C; PQLC2; PRPF39; PSME2; PTPMT1; QARS; RAD52; RHOT2; RMND5B; RNF123; RPL10A; RPP21; RPS6KB2; RUSC1; SCRN2; SCYL1; SFR1; SGSM3; SIRT7; SLC25A3; SLC25A 3; SLC30A7; SLC37A4; STK19; STX10; TCF25; TOMM40; TP53I3; TRIM41; TRPT1; TSTA3; TTC14; TTC140; TUBGCP6; U2AF1L4; UCK1; UNC45A; VAMP1; VAMP1 0; VARS; VPS28; WDR24; WDR90; WRAP53; YDJC; YIPF3; YIPF3; ZCCHC8; ZCCHC18; ZFAND1; ZNF131; ZNF300; ZNF317; ZNF692; ZNF711; ZNRD1; ZWINT or combinations thereof.

[0135] The terms “polynucleic acid polymer” and “nucleic acid” are used interchangeably and can refer to polynucleic acid polymers with a length of about 10 to about 50 nucleotides.

[0136] disease The methods and compositions described herein can be used to treat diseases or conditions characterized by impaired protein production. The methods and compositions described herein can also be used to treat diseases or conditions characterized by defective splicing. A disease or condition can be a genetic disorder or condition. A genetic disorder or condition can be characterized by impaired protein production. A genetic disorder or condition can also be characterized by defective splicing. A genetic disorder or condition can be a hereditary disorder or a non-hereditary defect at one or more locations in the genome. A hereditary disorder can be a genetic disease. A hereditary disease can be characterized by impaired protein production. A hereditary disease can be characterized by defective splicing. A subject with a hereditary disease may have a genome that can contain copies of genes containing exons, which, when properly transcribed into fully processed mRNA, can encode the full-length functional form of a protein. A subject with a hereditary disease may have a genome that can contain copies of genes containing exons, which, when properly transcribed into fully processed mRNA, can encode the full-length functional form of a protein. A subject with a hereditary disease may have a genome that can contain defective copies of genes, which may not produce the full-length functional form of a protein.

[0137] Genetic disorders or conditions can be non-genetic defects at one or more locations in the genome. Non-genetic defects can be point mutations, deletions, insertions, or reading frame shifts. A characteristic of genetic disorders or conditions associated with non-genetic defects can be impaired protein production. A characteristic of genetic disorders or conditions associated with non-genetic defects can be defective splicing. A subject with a non-genetic defect may have a genome that contains copies of genes containing exons, which, when properly transcribed into fully processed mRNA, encode the full-length functional form of a protein. A subject with a non-genetic defect may have a genome that contains copies of genes containing exons, which, when properly transcribed into fully processed mRNA, encode the full-length functional form of a protein. A subject with a non-genetic defect may have a genome that contains defective copies of genes, which may not produce the full-length functional form of a protein.

[0138] Genetic disorders or conditions can be autosomal dominant, autosomal recessive, X-linked dominant, X-linked recessive, Y-linked, mitochondrial, or multifactorial or polygenic. Sometimes, the characteristics of a genetic disease can also be characterized as autosomal dominant, autosomal recessive, X-linked dominant, X-linked recessive, Y-linked, mitochondrial, or multifactorial or polygenic. The characteristics of autosomal dominant, autosomal recessive, X-linked dominant, X-linked recessive, Y-linked, mitochondrial, or multifactorial or polygenic disorders can include impaired protein production. The characteristics of autosomal dominant, autosomal recessive, X-linked dominant, X-linked recessive, Y-linked, mitochondrial, or multifactorial or polygenic disorders can include defective splicing. Individuals with autosomal dominant disorders, autosomal recessive disorders, X-linked dominant disorders, X-linked recessive disorders, Y-linked disorders, mitochondrial diseases, or multifactorial or polygenic disorders may have a genome that contains copies of genes containing exons, which, when properly transcribed into fully processed mRNA, encode the full-length functional form of a protein. Individuals with autosomal dominant disorders, autosomal recessive disorders, X-linked dominant disorders, X-linked recessive disorders, Y-linked disorders, mitochondrial diseases, or multifactorial or polygenic disorders may have a genome that contains copies of genes containing exons, which, when properly transcribed into fully processed mRNA, encode the full-length functional form of a protein. Individuals with autosomal dominant disorders, autosomal recessive disorders, X-linked dominant disorders, X-linked recessive disorders, Y-linked disorders, mitochondrial diseases, or multifactorial or polygenic disorders may have a genome that may contain defective gene copies, which may not produce the full-length functional form of a protein.

[0139] Exemplary hereditary disorders may include achondroplasia, hereditary hemochromatosis, Down syndrome, hereditary spherocytosis, Tay-Sachs disease, Usher syndrome, hereditary fructose intolerance, hemophilia, muscular dystrophy (e.g., Duchenne muscular dystrophy or DMD), polygenic disorders, breast cancer, ovarian cancer, Parkinson's disease, Balder-Biedel syndrome, Prad-Willi syndrome, diabetes, heart disease, arthritis, motor neuron disease, albinism, Cri-du-Chat syndrome, cystic fibrosis, and fragility. Trisomy X syndrome, galactosemia, Huntington's disease, Jackson-Weiss syndrome, Cranfield syndrome, Krabby's disease, Langer-Giedion syndrome, Lesch-Nair syndrome, Marfan syndrome, myotonic dystrophy, nail-patella syndrome, neurofibromatosis, Noonan syndrome, Trisomy X syndrome, osteogenesis imperfecta, Patau syndrome, phenylketonuria, porphyria, retinoblastoma, Rett syndrome, sickle cell disease, Turner syndrome, Usher syndrome, Von Hippel-Lindau syndrome, Waardenburg syndrome, Wilson's disease, xeroderma pigmentosum, XXXX syndrome or YY syndrome.

[0140] Exemplary hereditary disorders include achondroplasia, hereditary hemochromatosis, Down syndrome, hereditary spherocytosis, Tay-Sachs disease, Usher syndrome, hereditary fructose intolerance, hemophilia, muscular dystrophy (e.g., Duchenne muscular dystrophy or DMD), polygenic disorders, breast cancer, ovarian cancer, Parkinson's disease, Balder-Biedel syndrome, Prad-Willi syndrome, diabetes, heart disease, arthritis, motor neuron disease, albinism, Cri-du-Chat syndrome, cystic fibrosis, and fragility. Syndrome X, galactosemia, Huntington's disease, Jackson-Weiss syndrome, Cranfield syndrome, Krabby's disease, Langer-Giedion syndrome, Lesch-Nair syndrome, Marfan syndrome, myotonic dystrophy, nail-patella syndrome, neurofibromatosis, Noonan syndrome, trisomy X syndrome, osteogenesis imperfecta, Patau syndrome, phenylketonuria, porphyria, retinoblastoma, Rett syndrome, sickle cell disease, Turner syndrome, Usher syndrome, Von Hippel-Lindau syndrome, Waardenburg syndrome, Wilson's disease, xeroderma pigmentosum, and XXXX or YY syndromes are characterized by impaired or defective splicing of proteins. Exemplary hereditary disorders include achondroplasia, hereditary hemochromatosis, Down syndrome, hereditary spherocytosis, Tay-Sachs disease, Usher syndrome, hereditary fructose intolerance, hemophilia, muscular dystrophy (e.g., Duchenne muscular dystrophy or DMD), polygenic disorders, breast cancer, ovarian cancer, Parkinson's disease, Balder-Biedel syndrome, Prad-Willi syndrome, diabetes, heart disease, arthritis, motor neuron disease, albinism, Cri-du-Chat syndrome, cystic fibrosis, and fragility. Syndrome X, galactosemia, Huntington's disease, Jackson-Weiss syndrome, Cranfield syndrome, Krabby's disease, Langer-Giedion syndrome, Lesch-Nair syndrome, Marfan syndrome, myotonic dystrophy, nail-patella syndrome, neurofibromatosis, Noonan syndrome, trisomy X syndrome, osteogenesis imperfecta, Patau syndrome, phenylketonuria, porphyria, retinoblastoma, Rett syndrome, sickle cell disease, Turner syndrome, Usher syndrome, Von Hippel-Lindau syndrome, Waardenburg syndrome, Wilson's disease, xeroderma pigmentosum, XXXX syndrome or YY syndrome may contain gene copies containing exons that, when properly transcribed into fully processed mRNA, can encode a protein in their full-length functional form; may contain gene copies containing exons that, when properly transcribed into fully processed mRNA, can encode a protein in their full-length functional form; or may contain defective gene copies that may not produce a protein in their full-length functional form.

[0141] As mentioned above, genetic disorders or conditions can be autosomal dominant disorders, autosomal recessive disorders, X-linked dominant disorders, X-linked recessive disorders, Y-linked disorders, mitochondrial diseases, or multifactorial or polygenic disorders. These disorders or conditions can be characterized by impaired protein production or defective splicing.

[0142] Exemplary autosomal dominant disorders may include Huntington's disease, neurofibromatosis type 1, neurofibromatosis type 2, Marfan syndrome, hereditary nonpolyposis colorectal cancer, hereditary multiple exostosis, tuberous sclerosis, von Willebrand disease, or acute intermittent porphyria.

[0143] Autosomal dominant disorders such as Huntington's disease, neurofibromatosis type 1, neurofibromatosis type 2, Marfan syndrome, hereditary nonpolyposis colorectal cancer, hereditary multiple exostosis, tuberous sclerosis, von Willebrand disease, or acute intermittent porphyria can be characterized by impaired or defective splicing of proteins. These disorders may contain gene copies with exons that, when properly transcribed into fully processed mRNA, encode proteins in their full-length functional form; gene copies with exons that, when properly transcribed into fully processed mRNA, encode proteins in their full-length functional form; or defective gene copies that may not produce proteins in their full-length functional form.

[0144] Exemplary autosomal recessive disorders may include albinism, medium-chain acyl-CoA dehydrogenase deficiency, cystic fibrosis, sickle cell disease, Tay-Sachs disease, Niemann-Pick disease, spinal muscular atrophy, or Roberts syndrome.

[0145] Autosomal recessive disorders such as albinism, medium-chain acyl-CoA dehydrogenase deficiency, cystic fibrosis, sickle cell disease, Tay-Sachs disease, Niemann-Pick disease, spinal muscular atrophy, or Roberts syndrome can be characterized by impaired or defective splicing of proteins. These disorders may contain gene copies with exons that, when properly transcribed into fully processed mRNA, encode proteins in their full-length functional form; or they may contain defective gene copies that may not produce proteins in their full-length functional form.

[0146] Exemplary X-linked dominant disorders may include X-linked hypophosphatemic rickets, Rett syndrome, type 2 pigmentary disorders, Aicardi syndrome, or Cranfield syndrome.

[0147] X-linked dominant disorders such as X-linked hypophosphatemic rickets, Rett syndrome, type 2 pigmentary disorders, Aicardi syndrome, or Cranfeldt syndrome are characterized by impaired or defective splicing of proteins. X-linked dominant disorders such as X-linked hypophosphatemic rickets, Rett syndrome, type 2 pigmentary disorders, Aicardi syndrome, or Cranfeldt syndrome may contain gene copies with exons that, when properly transcribed into fully processed mRNA, encode a protein in its full-length functional form; may contain gene copies with exons that, when properly transcribed into fully processed mRNA, encode a protein in its full-length functional form; or may contain defective gene copies that may not produce a protein in its full-length functional form.

[0148] Exemplary X-linked recessive disorders may include hemophilia A, Duchenne muscular dystrophy, Lesch-Nair syndrome, or Turner syndrome.

[0149] X-linked recessive disorders such as hemophilia A, Duchenne muscular dystrophy, Lesch-Nair syndrome, or Turner syndrome can be characterized by impaired or defective splicing of proteins. X-linked recessive disorders such as hemophilia A, Duchenne muscular dystrophy, Lesch-Nair syndrome, or Turner syndrome may contain gene copies with exons that, when properly transcribed into fully processed mRNA, encode the full-length functional form of the protein; may contain gene copies with exons that, when properly transcribed into fully processed mRNA, encode the full-length functional form of the protein; or may contain defective gene copies that may not produce the full-length functional form of the protein.

[0150] Exemplary Y-linked disorders may include Swyer syndrome or a form of retinitis pigmentosa.

[0151] Y-linkage disorders, such as those in Swyer's syndrome or retinitis pigmentosa, can be characterized by impaired or defective splicing of proteins. These disorders may include gene copies containing exons that, when properly transcribed into fully processed mRNA, encode the protein in their full-length functional form; gene copies containing exons that, when properly transcribed into fully processed mRNA, encode the protein in their full-length functional form; or defective gene copies that may not produce the full-length functional form of the protein.

[0152] Exemplary mitochondrial diseases may include Leber's hereditary optic neuropathy.

[0153] Mitochondrial diseases such as Leber's hereditary optic neuropathy can be characterized by impaired or defective splicing of proteins. Mitochondrial diseases such as Leber's hereditary optic neuropathy may contain gene copies with exons that, when properly transcribed into fully processed mRNA, encode proteins in their full-length functional form; they may contain gene copies with exons that, when properly transcribed into fully processed mRNA, encode proteins in their full-length functional form; or they may contain defective gene copies that may not produce proteins in their full-length functional form.

[0154] Exemplary multifactorial or polygenic disorders may include heart disease, diabetes, autoimmune diseases (such as multiple sclerosis), inflammatory bowel disease, or cancer.

[0155] Multifactorial or polygenic disorders such as heart disease, diabetes, autoimmune diseases (e.g., multiple sclerosis), inflammatory bowel disease, or cancer can be characterized by impaired or defective splicing of proteins. These disorders may contain gene copies with exons that, when properly transcribed into fully processed mRNA, encode proteins in their full-length functional form; gene copies with exons that, when properly transcribed into fully processed mRNA, encode proteins in their full-length functional form; or defective gene copies that may not produce the full-length functional form of the protein.

[0156] In some cases, the compositions and methods described herein are used to treat genetic disorders or conditions (e.g., hereditary diseases). The compositions and methods described herein can be used to treat genetic disorders or conditions characterized by impaired protein production (e.g., hereditary diseases). The compositions and methods described herein can be used to treat genetic disorders or conditions characterized by defective splicing (e.g., hereditary diseases).

[0157] The compositions and methods described herein can also be used to treat genetic disorders or conditions, such as autosomal dominant disorders, autosomal recessive disorders, X-linked dominant disorders, X-linked recessive disorders, Y-linked disorders, mitochondrial diseases, or multifactorial or polygenic disorders. The compositions and methods described herein can be used to treat autosomal dominant disorders, autosomal recessive disorders, X-linked dominant disorders, X-linked recessive disorders, Y-linked disorders, mitochondrial diseases, or multifactorial or polygenic disorders characterized by impaired protein production. The compositions and methods described herein can be used to treat autosomal dominant disorders, autosomal recessive disorders, X-linked dominant disorders, X-linked recessive disorders, Y-linked disorders, mitochondrial diseases, or multifactorial or polygenic disorders characterized by defective splicing.

[0158] In some cases, the disease or condition includes muscular dystrophy, spinal muscular atrophy (SMA), ataxia-telangiectasia, X-linked agammaglobulinemia, diabetes, or cancer.

[0159] Muscular dystrophy is a group of muscle diseases that weaken the musculoskeletal system and impair movement. It is characterized by progressive skeletal muscle weakness, muscle protein deficiency, and the death of muscle cells and tissues. A common form of muscular dystrophy is Duchenne muscular dystrophy (DMD). Other forms of muscular dystrophy include Becker type, limb-girdle type, congenital type, facioscapulohumeral type, myotonic type, oculopharyngeal type, distal type, and Emery-Dreifuss type muscular dystrophy.

[0160] Spinal muscular atrophy (SMA) is an autosomal recessive disorder and one of the most common genetic causes of childhood death. The main characteristic of this disease is the progressive loss of spinal motor neurons, leading to skeletal muscle denervation, accompanied by subsequent weakening, atrophy, and paralysis of autonomic muscles. The SMA locus maps to a complex inverted repeat sequence of approximately 500 kb on chromosome 5q13 containing several genes. The primary cause of SMA may be the survival genes for motor neurons located within the inverted repeat sequence (…). SMN1 Homozygous loss of telomere copies. It can also transcribe repetitive genes within the centromere copy of inverted repeat sequences. SMN2 ),but SMN2 Incomplete genetic compensation SMN1 Loss of function.

[0161] Ataxia-telangiectasia (AT), or Louis-Barr syndrome, is a rare neurodegenerative genetic disorder. The term "ataxia" refers to poor coordination, and "telangiectasia" refers to small, dilated blood vessels. Both terms describe the characteristics of this disease. AT can damage the cerebellum and other areas of the brain that can cause impaired motor and coordination function. AT can also weaken the immune system, increasing the risk of infections, and can impair DNA repair, thus increasing the risk of cancer. AT can be linked to genes... ATM Defects in genes are associated with this. ATM It is responsible for managing cellular responses to various forms of stress.

[0162] X-linked agammaglobulinemia, also known as X-linked hypogammaglobulinemia, XLA, Bruton's agammaglobulinemia, Bruton's syndrome, or sex-linked agammaglobulinemia, is an X-linked genetic disorder that affects the body's ability to fight infection. Individuals with XLA lack mature B cells and therefore lack the necessary antibodies to fight infection. Bruton's tyrosine kinase (BTK) is involved in mediating B cell development and maturation, and... BTK Genes can be associated with XLA.

[0163] Diabetes mellitus (DM) (commonly known as diabetes) is a group of metabolic diseases characterized by prolonged high blood sugar levels. Symptoms of diabetes include weight loss, increased urination or frequent urination, increased thirst or frequent drinking, and increased appetite or hunger. Diabetes can be classified into four types: type 1, type 2, gestational diabetes, and other specific types of diabetes. Type 1 diabetes is characterized by the loss of insulin-producing beta cells in the islets of Langerhans in the pancreas, leading to insulin deficiency. Type 2 diabetes is characterized by insulin resistance, which can also be associated with reduced insulin secretion. Gestational diabetes may resemble type 2 diabetes and can involve a combination of insufficient insulin secretion and responsiveness. Other specific types of diabetes may include prediabetes, latent autoimmune diabetes in adults (LADA), and congenital diabetes.

[0164] Cancer can be a solid tumor or a hematologic malignancy. A solid tumor can be a sarcoma or a carcinoma. A sarcoma can be a cancer of bone, cartilage, fat, muscle, blood vessels, or hematopoietic tissue. Exemplary sarcomas may include alveolar rhabdomyosarcoma, alveolar soft tissue sarcoma, ameloblastoma, angiosarcoma, chondrosarcoma, chordoma, clear cell soft tissue sarcoma, dedifferentiated liposarcoma, desmoid fibrosarcoma, connective tissue proliferative small round cell tumor, embryonal rhabdomyosarcoma, epithelioid fibrosarcoma, epithelioid hemangioendothelioma, epithelioid sarcoma, nasal glioma, Ewing sarcoma, extrarenal rhabdomyosarcoma, extraosseous myxoid chondrosarcoma, extraosseous osteosarcoma, fibrosarcoma, giant cell tumor, hemangiopericytoma, infantile fibrosarcoma, inflammatory myofibroblastic tumor, Kaposi's sarcoma, bone leiomyosarcoma, liposarcoma, and osteolipoma. Sarcoma, Malignant fibrous histiocytoma (MFH), Malignant fibrous histiocytoma of bone (MFH), Malignant stromal tumor, Malignant peripheral nerve sheath tumor, Mesenchymal chondrosarcoma, Myxofibrosarcoma, Myxoid liposarcoma, Myxoid inflammatory fibroblastic sarcoma, Tumor with perivascular epithelioid cell differentiation, Osteosarcoma, Periosteal osteosarcoma, Tumor with perivascular epithelioid cell differentiation, Periosteal osteosarcoma, Pleomorphic liposarcoma, Pleomorphic rhabdomyosarcoma, PNET / extraosseous Ewing tumor, Rhabdomyosarcoma, Round cell liposarcoma, Small cell osteosarcoma, Solitary fibrous tumor, Synovial sarcoma, Capillary dilatational osteosarcoma.

[0165] Cancer can be cancer that originates from epithelial cells. Exemplary cancers may include adenocarcinoma, squamous cell carcinoma, adenosquamous carcinoma, anaplastic carcinoma, large cell carcinoma, small cell carcinoma, anal cancer, appendiceal cancer, bile duct cancer (i.e., cholangiocarcinoma), bladder cancer, brain tumor, breast cancer, cervical cancer, colon cancer, cancer of unknown primary origin (CUP), esophageal cancer, eye cancer, fallopian tube cancer, gastrointestinal cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, vaginal cancer, pituitary adenoma, prostate cancer, rectal cancer, skin cancer, stomach cancer, testicular cancer, laryngeal cancer, thyroid cancer, uterine cancer, vaginal cancer, or vulvar cancer.

[0166] Hematologic malignancies are malignant tumors of the blood system and can include both T-cell-based and B-cell-based malignancies. Exemplary hematologic malignancies may include myeloid leukemia, myeloproliferative neoplasms, peripheral nonspecific T-cell lymphoma (PTCL-NOS), anaplastic large cell lymphoma, angioimmunoblastic lymphoma, cutaneous T-cell lymphoma, adult T-cell leukemia / lymphoma (ATLL), blastic NK-cell lymphoma, enteropathy-type T-cell lymphoma, and hematosplenic γ-δ T-cell lymphoma, lymphoblastic lymphoma, nasal NK / T-cell lymphoma, treatment-related T-cell lymphoma, chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high-risk CLL, non-CLL / SLL lymphoma, prolymphocytic leukemia (PLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenström macroglobulinemia, multiple myeloma, extranodal marginal zone B-cell lymphoma, marginal zone B-cell lymphoma, Burkitt lymphoma, non-Burkitt high-grade B-cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasmacytoma, plasmacytoma, mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, primary exudative lymphoma or lymphoid granulomatosis.

[0167] In some cases, the compositions and methods described herein are used to treat muscular dystrophy, spinal muscular atrophy (SMA), ataxia-telangiectasia, X-linked agammaglobulinemia, diabetes, or cancer. The compositions and methods described herein can be used to treat muscular dystrophy, spinal muscular atrophy (SMA), ataxia-telangiectasia, X-linked agammaglobulinemia, diabetes, or cancer where the disease or disorder is associated with impaired protein production. The compositions and methods described herein can be used to treat muscular dystrophy, spinal muscular atrophy (SMA), ataxia-telangiectasia, X-linked agammaglobulinemia, diabetes, or cancer where the disease or disorder is characterized by defective splicing.

[0168] The disease can be any genetic condition caused by a mutation that results in the retention of the entire intron in the mature transcript. The disease can be diabetes. The disease can be type 1 diabetes. The disease can be type 2 diabetes. In another embodiment, the disease can be cancer. Cancer can be myeloid leukemia or myeloproliferative neoplasm. Cancer can maintain mutations in any spliceosomal component that promotes recognition of the 3' splice site. Polynucleic acid polymers can be used to increase endogenous expression in subjects with residual β-cell activity. Polynucleic acid polymers can be used to increase proinsulin expression in other diabetic patients, including those who have received transplanted β-cells. Polynucleic acid polymers can be used as antisense therapy for malignancies containing mutations in genes encoding the U2 component (e.g., >20% of myeloid leukemia).

[0169] In an implementation where the disease is diabetes, reducing the incidence of intron retention can be achieved during fetal development in the subject. For example, polynucleic acid polymers can be administered to the pregnant mother to reduce intron retention in the fetus.

[0170] Subjects can be eukaryotes. Subjects can be mammals. Subjects can be humans. Subjects can be non-human primates. Subjects can be non-primate mammals, such as rats, mice, ferrets, dogs, cats, or pigs. Subjects can be fetuses, such as human fetuses.

[0171] This method may include a step of determining, prior to treatment, whether the disease pathology is caused by intron retention in gene transcripts. This determination may be made using any suitable test or genetic analysis available to those skilled in the art.

[0172] In some cases, nucleic acid-based technologies such as in situ hybridization and RT-PCR are used for detection at the nucleic acid level. Sequencing technologies may include next-generation sequencing technologies such as Helicos True single-molecule sequencing (tSMS) (Harris TD et al., (2008) Science 320: 106-109); 454 sequencing (Roche) (Margulies, M. et al., 2005, Nature, 437, 376-380); SOLiD technology (Applied Biosystems); SOLEXA sequencing (Illumina); Pacific Biosciences' single-molecule real-time (SMRT™) technology; nanopore sequencing (Soni GV and Meller A. (2007) ClinChem 53: 1996-2001); semiconductor sequencing (Ion Torrent; Personal Genome Machine); DNA nanosphere sequencing; sequencing using technologies from Dover Systems (Polonator); and technologies that do not require amplification or additional transformation of natural DNA prior to sequencing (e.g., Pacific Biosciences and Helicos), such as nanopore-based strategies (e.g., Oxford Nanopore, Genia Technologies, and Nabsys). Sequencing technologies may also include Sanger sequencing, Maxam-Gilbert sequencing, shotgun sequencing, bridge PCR, mass spectrometry-based sequencing, microfluidic Sanger sequencing, microscopy-based sequencing, RNAP sequencing, or hybridization-based sequencing.

[0173] Sequencing of transcripts of the gene of interest may also include an amplification step. Exemplary amplification methods include, but are not limited to, polymerase chain reaction (PCR), nucleic acid sequence-based amplification (NASBA), self-sustaining sequence replication (3SR), loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), whole genome amplification, multiple displacement amplification, strand displacement amplification, helicase-dependent amplification, nickase amplification reaction, recombinant polymerase amplification, reverse transcription PCR, ligation-mediated PCR, or methylation-specific PCR.

[0174] Other methods that can be used to obtain nucleic acid sequences include, for example, whole-genome RNA expression arrays, enzyme-linked immunosorbent assay (ELISA), genome sequencing, de novo sequencing, Pacific Biosciences SMRT sequencing, immunohistochemistry (IHC), immunocytochemistry (ICC), mass spectrometry, tandem mass spectrometry, matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS), in situ hybridization, fluorescence in situ hybridization (FISH), chromogenic in situ hybridization (CISH), silver in situ hybridization (SISH), digital PCR (dPCR), reverse transcription PCR, quantitative PCR (Q-PCR), single-label qPCR, real-time PCR, nCounter analysis (Nanostring technology), Western blotting, DNA blotting, SDS-PAGE, gel electrophoresis, and RNA blotting.

[0175] In some cases, protein detection can be performed at the protein level using assays such as Western blotting or ELISA, based on immunoprecipitation. Additionally, methods such as electrophoresis and mass spectrometry can also be used to detect proteins of interest.

[0176] According to another aspect of the invention, a method for regulating intron splicing in a cell is provided, comprising hybridizing a polynucleotide polymer with a region of pre-mRNA, wherein said region comprises or is composed of SEQ ID NO: 46 or optionally a region having at least 95% identity with SEQ ID NO: 46. The region may have at least 98% or 99% identity with SEQ ID NO: 46.

[0177] According to another aspect of the invention, a method for regulating intron splicing in a cell is provided, comprising hybridizing a polynucleotide polymer with a region of pre-mRNA, wherein said region comprises or is composed of SEQ ID NO: 3 or optionally a region having at least 95% identity with SEQ ID NO: 3. The region may have at least 98% or 99% identity with SEQ ID NO: 3.

[0178] According to another aspect of the invention, a method for regulating intron splicing in a cell is provided, comprising hybridizing a polynucleotide polymer with a region of pre-mRNA, wherein said region comprises or is composed of a sequence complementary to or composed of any of the sequence groups comprising SEQ ID NO: 47 to 434 or combinations thereof.

[0179] According to another aspect of the invention, a method for regulating intron splicing in a cell is provided, comprising hybridizing a polynucleotide polymer with a region of pre-mRNA, said region comprising or consisting of a sequence complementary to or consisting of a sequence having at least 95% identity with any one of the sequence groups comprising SEQ ID NO: 47 to 434 or combinations thereof. The region may comprise or consisting of a sequence complementary to or consisting of a sequence having at least 98% identity with any one of the sequence groups comprising SEQ ID NO: 47 to 434 or combinations thereof. The region may comprise or consisting of a sequence complementary to or consisting of a sequence having at least 99% identity with any one of the sequence groups comprising SEQ ID NO: 47 to 434 or combinations thereof.

[0180] Cells can be grown in vitro. Cells can be isolated. Cells can be eukaryotic or prokaryotic. Cells can be eukaryotic. Cells can be mammalian cells derived from humans; non-human primates; or non-primate mammals such as cats, rats, mice, dogs, ferrets, or pigs. Cells can be human cells, such as epithelial cells, connective tissue cells, hormone-secreting cells, nerve cells, skeletal muscle cells, blood cells, or immune system cells. Cells can be tumor cells, such as solid tumor cells or hematologic malignancy cells.

[0181] According to another aspect of the invention, a polynucleic acid polymer is provided that is antisense for a region comprising or consisting of a polynucleic acid polymer of SEQ ID NO: 46, or optionally, a region comprising at least a portion of a sequence having at least 95% sequence identity with or consisting of a polynucleic acid polymer of SEQ ID NO: 46. This region may have at least 98% or 99% identity with SEQ ID NO: 46.

[0182] According to another aspect of the invention, a polynucleic acid polymer is provided that is antisense for a region comprising SEQ ID NO: 3 or a polynucleic acid polymer thereof, or optionally, for a region comprising at least a portion of a sequence having at least 95% sequence identity with SEQ ID NO: 3 or a polynucleic acid polymer thereof. This region may have at least 98% or 99% identity with SEQ ID NO: 3.

[0183] According to another aspect of the invention, a polynucleotide polymer is provided, wherein at least a portion of a region of the polynucleotide polymer is antisense, said region comprising or consisting of a sequence complementary to or composed of any of the sequence groups comprising SEQ ID NO: 47 to 434 or combinations thereof.

[0184] According to another aspect of the invention, a polynucleic acid polymer is provided, wherein at least a portion of a region of the polynucleic acid polymer is antisense, said region comprising or consisting of a sequence complementary to any of the sequence groups comprising SEQ ID NO: 47 to 434 or combinations thereof; or optionally, comprising or consisting of a region of a polynucleic acid polymer having at least 95% sequence identity with SEQ ID NO: 47 to 434. This region may have at least 98% or 99% identity with SEQ ID NO: 47 to 434.

[0185] When referring to at least a portion of the antisense of a region of a polynucleotide polymer, those skilled in the art will understand that it refers to a region of at least 5 consecutive nucleotides. When referring to at least a portion of the antisense of a region of a polynucleotide polymer, those skilled in the art will understand that it refers to a region of at least 10 consecutive nucleotides.

[0186] According to another aspect of the invention, a polynucleic acid polymer is provided, comprising or consisting of a nucleic acid sequence selected from or composed of any of the following: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ SEQ ID NO: 43; and SEQ ID NO: 44 or a combination thereof.

[0187] According to another aspect of the invention, a polynucleic acid polymer is provided, comprising or consisting of a nucleic acid sequence having at least 99% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 35; SEQ ID NO: 36; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 39; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 39; SEQ ID NO: 39; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 3 SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or a combination thereof. According to another aspect of the invention, a polynucleic acid polymer is provided, comprising or consisting of a nucleic acid sequence having at least 98% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40 ...6; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 39; SEQ ID NO: 39; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 3 SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or a combination thereof.According to another aspect of the invention, a polynucleic acid polymer is provided, comprising or consisting of a nucleic acid sequence having at least 95% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 35; SEQ ID NO: 36; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 39; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 35; SEQ ID NO: 36; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 39; SEQ ID NO: 3 SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or a combination thereof.

[0188] According to another aspect of the invention, a polynucleic acid polymer is provided comprising or composed of a nucleic acid sequence selected from the group consisting of any one of SEQ ID NO: 47 to 434 or combinations thereof. It should be understood that uracil nucleotides may be substituted with thymine nucleotides (e.g., in the form of DNA with RNA having such a sequence).

[0189] According to another aspect of the invention, a polynucleic acid polymer is provided, comprising or consisting of a nucleic acid sequence having at least 99% identity with a sequence selected from the group consisting of any one of SEQ ID NO: 47 to 434 or combinations thereof. According to another aspect of the invention, a polynucleic acid polymer is provided, comprising or consisting of a nucleic acid sequence having at least 98% identity with a sequence selected from the group consisting of any one of SEQ ID NO: 47 to 434 or combinations thereof. According to another aspect of the invention, a polynucleic acid polymer is provided, comprising or consisting of a nucleic acid sequence having at least 95% identity with a sequence selected from the group consisting of any one of SEQ ID NO: 47 to 434 or combinations thereof. It should be understood that uracil nucleotides can be substituted with thymine nucleotides (e.g., in the form of DNA with RNA having such a sequence).

[0190] The polynucleotide polymer can be a separate polynucleotide polymer. The polynucleotide polymer can be conjugated or bound to a delivery vector suitable for delivering the polynucleotide polymer to cells. The delivery vector can be capable of site-specific, tissue-specific, or cell-specific delivery. For example, the delivery vector can be a cell-specific viral particle or a component thereof, or a cell-specific antibody particle or a component thereof. The polynucleotide polymer can be targeted for delivery to β cells in the pancreas. The polynucleotide polymer can be targeted for delivery to thymocytes. The polynucleotide polymer can be targeted for delivery to malignant cells. The polynucleotide polymer can be modified to increase its stability. In embodiments where the polynucleotide polymer is RNA, the polynucleotide polymer can be modified to increase its stability. The polynucleotide polymer can be modified with 2'-O-methyl and 2'-O-methoxyethyl ribose. Suitable modifications for increasing the delivery stability of RNA will be apparent to those skilled in the art.

[0191] Polynucleotide polymers can be part of plasmid vectors. Polynucleotide polymers can be part of viral vectors. Polynucleotide polymers can encode on viral vectors.

[0192] According to another aspect of the invention, a vector comprising the polynucleotide polymer of the invention is provided. The vector may include a viral vector. The viral vector may include an adeno-associated virus vector. The vector may include any virus that targets the polynucleotide polymer to malignant cells or specific cell types.

[0193] According to another aspect of the invention, delivery carriers comprising or incorporating the polynucleotide polymer of the invention are provided. The delivery carrier may comprise lipid-based nanoparticles; cationic cell-penetrating peptides (CPPs); or linear or branched cationic polymers; or bioconjugates, such as cholesterol, bile acids, lipids, peptides, polymers, proteins, or aptamers, conjugated to the polynucleotide polymer for intracellular delivery and / or improved stability. The delivery carrier may be cell- or tissue-specific or developmental stage-specific. The delivery carrier may comprise an antibody or a portion thereof. The antibody may be specific to cell surface markers on the cells of interest to deliver the polynucleotide polymer to specific cells. For example, according to Ji Hoon Jeong et al. (Journal of Controlled Release 107 (2005) 562-570), which is incorporated herein by reference, the antibody may comprise an anti-GAD antibody for targeted delivery of a non-viral polynucleotide polymer to pancreatic β cells. For example, the anti-GAD antibody conjugates an anti-GAD Fab' fragment to a PEI via a PEG linker (PEI-PEG-Fab'). Other specific antibodies can be used for such conjugations to deliver polynucleotide polymers to target tissues.

[0194] Pharmaceutical compositions / formulations, administration and treatment regimens According to one aspect of the invention, a therapeutic agent is provided for treating a disease or condition characterized by impaired production of a protein's functional form, comprising administering a pharmaceutical composition to a subject, the pharmaceutical composition comprising a therapeutic agent that induces enhanced intron splicing in partially processed mRNA transcripts; wherein the subject has a pool of partially processed mRNA transcripts capable of encoding a copy of the full-length functional form of the protein and each of the partially processed mRNA transcripts contains at least one retained intron that inhibits translation of the partially processed mRNA transcript; and contacting a target cell of the subject with the therapeutic agent to induce a portion of the pool of partially processed mRNA transcripts to undergo splicing to remove the at least one retained intron from each of the partially processed mRNA transcripts in the portion, thereby producing a fully processed mRNA transcript, wherein the fully processed mRNA transcript is translated to express a copy of the full-length functional form of the protein, which treats the disease or condition.

[0195] The therapeutic agent can induce activation of one or more splicing protein complexes in a cell to remove at least one retained intron from each partially processed mRNA transcript in a pool of partially processed mRNA transcripts. The therapeutic agent can inhibit proteins that regulate intron splicing activity. The therapeutic agent can activate proteins that regulate intron splicing activity. The therapeutic agent can interact with or bind to proteins that regulate intron splicing activity. The therapeutic agent can interact with or bind to target polynucleotide sequences of partially processed mRNA transcripts. In some embodiments, the therapeutic agent can be a polynucleotide polymer, such as those described herein. In some embodiments, the therapeutic agent can be a small molecule.

[0196] Small molecules can be molecules smaller than 900 Daltons and can initiate one or more splicing protein complexes in the cell to remove at least one retained intron from each partially processed mRNA transcript in a pool of partially processed mRNA transcripts. Small molecules can inhibit proteins that regulate intron splicing activity. Small molecules can activate proteins that regulate intron splicing activity. Small molecules can interact with or bind to proteins that regulate intron splicing activity, or they can interact with or bind to target polynucleotide sequences of partially processed mRNA transcripts.

[0197] According to another aspect of the invention, compositions comprising the polynucleic acid polymers of the invention are provided. The compositions may be pharmaceutically acceptable. The compositions may contain a pharmaceutically acceptable carrier. The compositions may contain additional active agents, such as pharmaceuticals or prodrugs. The compositions may contain combinations of different polynucleic acid polymers (e.g., SSO) for therapeutic purposes.

[0198] In addition to the polynucleic acid polymer, the composition may also contain at least one other bioactive molecule. The bioactive molecule may be a drug or a prodrug. The bioactive molecule may contain nucleic acids or amino acids. The bioactive molecule may contain small molecules (e.g., molecules <900 Daltons).

[0199] The pharmaceutical compositions described herein may comprise a polynucleotide polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the target sequence is between two G quadruplexes, and wherein the polynucleotide polymer is capable of inducing the cleavage of the retained introns from the partially processed mRNA transcript; and a pharmaceutically acceptable excipient and / or delivery vector. The pharmaceutical compositions described herein may also comprise a polynucleotide polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the polynucleotide polymer hybridizes to an intron splicing regulatory element of the partially processed mRNA transcript, wherein the intron splicing regulatory element contains a first CCC motif, and wherein the polynucleotide polymer is capable of inducing the cleavage of the retained introns from the partially processed mRNA transcript; and a pharmaceutically acceptable excipient and / or delivery vector. Furthermore, the pharmaceutical compositions described herein may comprise a polynucleotide polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the polynucleotide polymer hybridizes to a binding motif of the partially processed mRNA transcript, wherein the binding motif does not form a G-quadruplex, and wherein the polynucleotide polymer is capable of inducing the retained introns to be cleaved from the partially processed mRNA transcript; and pharmaceutically acceptable excipients and / or delivery vectors.

[0200] The pharmaceutical compositions described herein may further comprise a polynucleotide polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the polynucleotide polymer hybridizes to a binding motif of the partially processed mRNA transcript, and wherein the binding motif forms a hairpin structure, wherein the polynucleotide polymer is capable of inducing the retained introns to be cleaved from the partially processed mRNA transcript; and pharmaceutically acceptable excipients and / or delivery vectors.

[0201] The pharmaceutical formulations described herein can be administered to subjects via a variety of routes of administration, including but not limited to parenteral (e.g., intravenous, subcutaneous, intramuscular), oral, intranasal, sublingual, topical, rectal, or transdermal routes. In some cases, the pharmaceutical compositions described herein are formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular) administration. In other cases, the pharmaceutical compositions described herein are formulated for oral administration. In still other cases, the pharmaceutical compositions described herein are formulated for intranasal administration.

[0202] The pharmaceutical formulations described herein may include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposome dispersions, aerosols, solid dosage forms, powders, immediate-release formulations, controlled-release formulations, rapidly melting formulations, tablets, capsules, pills, extended-release formulations, prolonged-release formulations, pulsatile-release formulations, multi-particle formulations, and mixtures of immediate-release and controlled-release formulations.

[0203] Pharmaceutical formulations may include a carrier or carrier material, which may include any excipient commonly used in pharmaceuticals and should be selected based on compatibility with the compositions disclosed herein and the release profile properties of the desired dosage form. Exemplary carrier materials include, for example, binders, suspending agents, disintegrants, fillers, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, etc. Pharmaceutically compatible carrier materials may include, but are not limited to, gum arabic, gelatin, colloidal silica, calcium glycerophosphate, calcium lactate, maltodextrin, glycerol, magnesium silicate, polyvinylpyrrolidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurine, phosphatidylcholine, sodium chloride, tricalcium phosphate, dipotassium hydrogen phosphate, cellulose and cellulose conjugates, sodium saccharide stearoyl lactylate, carrageenan, monoglycerides, diglycerides, pregelatinized starch, etc. See, for example, Remington: The Science and Practice of Pharmacy, 19th edition (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, HA and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, 7th edition (Lippincott Williams & Wilkins 1999).

[0204] Pharmaceutical formulations may include dispersants and / or viscosity modifiers, which may include materials or granulation or blending methods that control the diffusion and homogeneity of the drug in a liquid medium. In some embodiments, these agents also enhance the efficiency of coatings or etching matrices. Exemplary diffusion promoters / dispersants include, for example, hydrophilic polymers, electrolytes, and Tween. ®60 or 80, PEG, polyvinylpyrrolidone (PVP; commercially known as Plasdone) ® And carbohydrate-based dispersants, such as hydroxypropyl cellulose (e.g., HPC, HPC-SL, and HPC-L), hydroxypropyl methylcellulose (e.g., HPMC K100, HPMC K4M, HPMC K15M, and HPMC K100M), sodium carboxymethyl cellulose, methylcellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose phthalate, hydroxypropyl methylcellulose acetate stearate (HPMCAS), amorphous cellulose, magnesium aluminum silicate, triethanolamine, polyvinyl alcohol (PVA), vinylpyrrolidone / vinyl acetate copolymer (S630), 4-(1,1,3,3-tetramethylbutyl)-phenol polymers with ethylene oxide and formaldehyde (also known as tyloxacillin), poloxamer (e.g., Pluronics F68). ® F88 ® and F108 ® It is a block copolymer of ethylene oxide and propylene oxide; and poloxamine (e.g., Tetronic 908). ® Also known as Poloxamine 908 ® It is a tetrafunctional block copolymer (BASF) obtained by sequentially adding propylene oxide and ethylene oxide to ethylenediamine. Corporation, Parsippany, NJ), polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25 or polyvinylpyrrolidone K30, polyvinylpyrrolidone / vinyl acetate copolymer (S-630), polyethylene glycol, such as polyethylene glycol having a molecular weight of about 300 to about 6000, or about 3350 to about 4000 or about 7000 to about 5400, sodium carboxymethyl cellulose, methylcellulose, polysorbate-80, sodium alginate, gums, such as gum arabic and gum arabic, guar gum, xanthan gums, including xanthan gum, sugar, cellulose materials, such as sodium carboxymethyl cellulose, methylcellulose, sodium carboxymethyl cellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, polyethoxylated sorbitan monolaurate, povidone, carbomer, polyvinyl alcohol (PVA), alginate, chitosan and combinations thereof. Plasticizers such as cellulose or triethylcellulose can also be used as dispersants. Dispersants particularly suitable for liposome dispersions and self-emulsifying dispersions are dimyristic phosphatidylcholine, natural phosphatidylcholine derived from eggs, natural phosphatidylglycerol derived from eggs, cholesterol, and isopropyl myristate.

[0205] Pharmaceutical formulations may contain pH adjusters or buffers, which may include acids such as acetic acid, boric acid, citric acid, lactic acid, phosphoric acid, and hydrochloric acid; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate, and tris(hydroxymethyl)aminomethane; and buffers such as citrate / glucose, sodium bicarbonate, and ammonium chloride. Such acids, bases, and buffers are contained in amounts necessary to maintain the pH of the composition within an acceptable range.

[0206] Pharmaceutical formulations may also contain one or more salts in amounts required to bring the osmotic pressure of the composition to an acceptable range. Such salts may include salts having sodium, potassium, or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate, or bisulfite anions; suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite, and ammonium sulfate.

[0207] Pharmaceutical formulations may also contain diluents, which can be used to stabilize compounds because they provide a more stable environment. Salts dissolved in buffer solutions (which can also provide pH control or maintenance) can be used as diluents in the art, including but not limited to phosphate buffer solutions. In some cases, diluents increase the volume of the composition to aid in compression or to generate sufficient volume for capsule filling of homogeneous blends. Such compounds may include, for example, lactose, starch, mannitol, sorbitol, glucose, microcrystalline cellulose, such as Avicel. ® ; dicalcium hydrogen phosphate, dicalcium hydrogen phosphate dihydrate; tricalcium phosphate, calcium phosphate; anhydrous lactose, spray-dried lactose; pregelatinized starch, compressible sugars such as Di-Pac ® (Amstar); Mannitol, Hydroxypropyl Methylcellulose, Hydroxypropyl Methylcellulose Acetate Stearate, Sucrose-based Diluent, Confectioner's Sugar; Calcium Sulfate Monohydrate, Calcium Sulfate Dihydrate; Calcium Lactate Trihydrate, Dextrates; Hydrolyzed Cereal Solids, Amylose; Powdered Cellulose, Calcium Carbonate; Glycine, Kaolin; Mannitol, Sodium Chloride; Inositol, Bentonite, etc.

[0208] Pharmaceutical formulations may contain disintegrants or disintegrants that promote the breakdown or disintegration of a substance. The term "disintegration" can include the dissolution and dispersion of the dosage form upon contact with gastrointestinal fluids. Examples of disintegrants may include starches, such as natural starches (e.g., corn starch or potato starch), pregelatinized starches (e.g., National 1551 or Amijel), etc. ® ), or sodium starch glycolate (such as Promogel) ® Or Explotab ® ), cellulose (such as wood products), methyl crystalline cellulose (such as Avicel), ® Avicel ®PH101, Avicel ® PH102, Avicel ® PH105, Elcema ® P100, Emcocel ® Vivacel ® Ming Tia ® and Solka-Floc ® ), methylcellulose, croscarmellose cellulose or croscarmellose cellulose (such as croscarmellose sodium (Ac-Di-Sol)). ® Crosslinked carboxymethyl cellulose, or crosslinked croscarmellose, crosslinked starch (such as sodium starch glycolate), crosslinked polymers (such as croscarmellose, croscarmellose), alginates (such as alginate or salts of alginate, such as sodium alginate), clays (such as Veegum ® HV (magnesium aluminum silicate), gums (such as agar, guar gum, locust bean gum, carrageenan gum, pectin or tragacanth gum), sodium hydroxyacetate of starch, bentonite, natural sponges, surfactants, resins (such as cation exchange resins), citrus pomace, sodium lauryl sulfate, in combination with starch, etc.

[0209] Pharmaceutical formulations may contain fillers such as lactose, calcium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, glucose, glucose binders, dextran, starch, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, etc.

[0210] Pharmaceutical preparations may contain flavorings and / or sweeteners, such as gum arabic syrup, acesulfame K, arabinose, anise, apple, aspartame, banana, Bavarian cream, berries, blackcurrant, butterscotch flavored brown syrup, calcium citrate, camphor, caramel, cherry, cherry cream, chocolate, cinnamon, bubble gum, citrus, citrus punch, citrus cream, marshmallow, cocoa, cola, cold cherry, cold citrus, cyclosulfonates, cylamate, glucose, eucalyptus, eugenol, fructose, fruit juice, ginger, glycyrrhizic acid esters, licorice (licorice) syrup, grape, grapefruit, honey, isomaltitol, lemon, lime, lemon cream, monoammonium glyrrhizinate (MagnaSweet) ® Maltol, mannitol, maple, marshmallow, menthol, peppermint cream, mixed berries, neohesperidin DC, neotame, orange, pear, peach, peppermint, peppermint cream, prosweet ®Powder, raspberry, root juice, rum, saccharin, safrole, sorbitol, spearmint, spearmint cream, strawberry, strawberry cream, stevia, sucralose, sucrose, sodium saccharin, saccharin, aspartame, acesulfame potassium, mannitol, ankle protein, xylitol, sucralose, sorbitol, Swiss cream, tagatose, citrus, soma, guarana, vanilla, walnut, watermelon, wild cherry, wintergreen, xylitol, or any combination of these flavoring ingredients, such as anise-menthol, cherry-anise, cinnamon-orange, cherry-cinnamon, chocolate-mint, honey-lemon, lemon-lime, lemon-mint, menthol-eucalyptus, orange-cream, vanilla-mint, and mixtures thereof.

[0211] Lubricants and flow aids may also be included in the pharmaceutical formulations described herein, which can prevent, reduce, or inhibit adhesion or friction of materials. Exemplary lubricants may include, for example, stearic acid, calcium hydroxide, talc, sodium stearyl fumarate, hydrocarbons such as mineral oil, or hydrogenated vegetable oils such as hydrogenated soybean oil (Sterotex). ® Higher fatty acids and their alkali metal and alkaline earth metal salts such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearate, glycerol, talc, wax, Stearotate ® Boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, polyethylene glycol (e.g., PEG-4000) or methoxy polyethylene glycol such as Carbowax™, sodium oleate, sodium benzoate, glyceryl behenate, polyethylene glycol, magnesium or sodium lauryl sulfate, colloidal silica such as Syloid™, Cab-O-Sil ® Starch, such as corn starch, silicone oil, surfactants, etc.

[0212] Plasticizers are compounds used to soften microencapsulated materials or film coatings to make them less brittle. Suitable plasticizers include, for example, polyethylene glycols such as PEG 300, PEG 400, PEG 600, PEG 1450, PEG 3350 and PEG 800, stearic acid, propylene glycol, oleic acid, triethylcellulose and triacetin. Plasticizers can also be used as dispersants or wetting agents.

[0213] Solubilizers may include compounds such as triacetin, triethyl citrate, ethyl oleate, ethyl octanoate, sodium lauryl sulfate, sodium doccusate, vitamin E TPGS, dimethylacetamide, N-methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropyl methylcellulose, hydroxypropyl cyclodextrin, ethanol, n-butanol, isopropanol, cholesterol, bile salts, polyethylene glycol 200-600, tetraethylene glycol, diethylene glycol monoethyl ether, propylene glycol, and dimethyl isosorbide, etc.

[0214] Stabilizers may include compounds such as any antioxidants, buffers, acids, preservatives, etc.

[0215] The suspending agent may include compounds such as polyvinylpyrrolidone, for example, polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25 or polyvinylpyrrolidone K30, vinylpyrrolidone / vinyl acetate copolymer (S630), polyethylene glycol, for example, polyethylene glycol may have a molecular weight of about 300 to about 6000, or about 3350 to about 4000 or about 7000 to about 5400, sodium carboxymethyl cellulose, methylcellulose, hydroxypropyl methylcellulose, etc. Cellulose, hydroxymethyl cellulose acetate stearate, polysorbate-80, hydroxyethyl cellulose, sodium alginate, gums such as gum arabic and gum arabic, guar gum, xanthan gums including xanthan gum, sugars, cellulose materials such as sodium carboxymethyl cellulose, methyl cellulose, sodium carboxymethyl cellulose, hydroxypropyl methyl cellulose, hydroxyethyl cellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, polyethoxylated sorbitan monolaurate, povidone, etc.

[0216] Surfactants may include compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbate, poloxamer, bile salts, glyceryl monostearate, copolymer oxides of ethylene oxide and propylene, such as Pluronic acid. ® (BASF), etc. Other surfactants may include polyoxyethylene fatty acid glycerides and vegetable oils, such as polyoxyethylene (60) hydrogenated castor oil; and polyoxyethylene alkyl ethers and alkylphenyl ethers, such as octoxynol 10, octoxynol 40. Sometimes, surfactants may be included to enhance physical stability or for other purposes.

[0217] Viscosity enhancers may include, for example, methylcellulose, xanthan gum, carboxymethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, hydroxypropyl methylcellulose acetate stearate, hydroxypropyl methylcellulose phthalate, carbomer, polyvinyl alcohol, alginate, gum arabic, chitosan, and combinations thereof.

[0218] Wetting agents may include compounds such as oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, sodium docusate, sodium oleate, sodium lauryl sulfate, sodium docusate, triacetin, Tween 80, vitamin E TPGS, ammonium salts, etc.

[0219] Injectable formulations Preparations suitable for intramuscular, subcutaneous, or intravenous injection may include physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, as well as sterile powders for recombination into sterile injectable solutions or dispersions. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (propylene glycol, polyethylene glycol, glycerol, levofloxacin, etc.), suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters such as ethyl oleate. Appropriate flowability can be maintained, for example, by using coatings such as lecithin, by maintaining the desired particle size in the case of dispersions, and by using surfactants. Preparations suitable for subcutaneous injection may also contain additives such as preservatives, wetting agents, emulsifiers, and dispersants. Prevention of microbial growth can be ensured by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, etc. The inclusion of isotonic agents, such as sugars, sodium chloride, etc., may also be desirable. Prolonged absorption of injectable drug forms can be achieved by using agents that delay absorption, such as aluminum monostearate and gelatin.

[0220] For intravenous injection, the compounds described herein can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffer. For mucosal administration, a permeabilizing agent suitable for the barrier to be penetrated is used in the formulation. Such permeabilizing agents are generally known in the art. For other parenteral injections, suitable formulations may include aqueous or non-aqueous solutions, preferably using physiologically compatible buffers or excipients. Such excipients are generally known in the art.

[0221] Parenteral injection may include bolus injection or continuous infusion. Formulations for injection may be available in unit dosage forms, such as ampoules or multi-dose containers, with added preservatives. The pharmaceutical compositions described herein may be suitable for parenteral injection as sterile suspensions, solutions, or emulsions in oily or aqueous media, and may contain formulations such as suspending agents, stabilizers, and / or dispersants. Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compound in a water-soluble form. Furthermore, suspensions of the active compound may be prepared as suitable oily injectable suspensions. Suitable lipophilic solvents or media include fatty oils, such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injectable suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or reagents that increase the solubility of the compound to allow for the preparation of highly concentrated solutions. Alternatively, the active ingredient may be in powder form that is reconstituted with a suitable medium (e.g., sterile, pyrogen-free water) before use.

[0222] oral preparations Pharmaceutical preparations for oral use can be obtained by mixing one or more solid excipients with one or more compounds described herein, optionally grinding the resulting mixture, and, if necessary, processing the granular mixture after adding suitable excipients to obtain a tablet or sugar pill core. Suitable excipients may include, for example, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, microcrystalline cellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose; or others such as polyvinylpyrrolidone (PVP or povidone) or calcium phosphate. If desired, disintegrants such as cross-linked croscarmellose sodium, polyvinylpyrrolidone, agar, or alginate or its salts, such as sodium alginate, may be added.

[0223] The core of the sugar pill can have a suitable coating. For this purpose, a concentrated sugar solution can be used, which may optionally contain gum arabic, talc, polyvinylpyrrolidone, carbomer gel, polyethylene glycol and / or titanium dioxide, lacquer solution, and suitable organic solvents or solvent mixtures. Dyes or pigments can be added to the tablet or sugar pill coating to identify or characterize combinations of different active compound dosages.

[0224] Solid dosage forms can be in the form of tablets (including suspension tablets, fast-melting tablets, bite-disintegrating tablets, rapidly disintegrating tablets, effervescent tablets, or capsules), pills, powders (including aseptically packaged powders, dispensable powders, or effervescent powders), capsules (including soft or hard capsules, such as capsules made from animal-derived gelatin or plant-derived HPMC, or “sprinkle capsules”), solid dispersions, solid solutions, bioerectible dosage forms, controlled-release formulations, pulse-release formulations, multi-particle dosage forms, granules, pellets, or aerosols. In other cases, the pharmaceutical formulation is in powder form. In still other cases, the pharmaceutical formulation is in tablet form, including but not limited to fast-melting tablets. Additionally, the pharmaceutical formulations described herein can be administered as single or multiple capsules. In some cases, the pharmaceutical formulation is administered as two, three, or four capsules or tablets.

[0225] Solid dosage forms of pharmaceuticals may comprise the compositions described herein and one or more pharmaceutically acceptable additives, such as compatible carriers, binders, fillers, suspending agents, flavoring agents, sweeteners, disintegrants, dispersants, surfactants, lubricants, colorants, diluents, solubilizers, humectants, plasticizers, stabilizers, penetration enhancers, wetting agents, antifoaming agents, antioxidants, preservatives, or one or more combinations thereof. In some other respects, standard coating procedures are used, such as those described in Remington's Pharmaceutical Sciences, 20th edition (2000).

[0226] Suitable carriers for solid dosage forms may include, but are not limited to, gum arabic, gelatin, colloidal silica, calcium glycerophosphate, calcium lactate, maltodextrin, glycerol, magnesium silicate, sodium caseinate, soybean lecithin, sodium chloride, tricalcium phosphate, dipotassium hydrogen phosphate, sodium stearoyl lactylate, carrageenan, monoglycerides, diglycerides, pregelatinized starch, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose acetate stearate, sucrose, microcrystalline cellulose, lactose, mannitol, etc.

[0227] Suitable fillers for solid dosage forms may include, but are not limited to, lactose, calcium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, glucose, glucose binder, dextran, starch, pregelatinized starch, hydroxypropyl methylcellulose (HPMC), hydroxypropyl methylcellulose phthalate, hydroxypropyl methylcellulose acetate stearate (HPMCAS), sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, etc.

[0228] Binders impart binding properties to solid oral dosage forms: for powder-filled capsules, they facilitate embolization, which can be filled into soft-shell or hard-shell capsules, and for tablets, they ensure that the tablets remain intact after compression and help ensure homogeneity of mixing prior to the compression or filling step. Suitable materials for use as binders in the solid dosage forms described herein include, but are not limited to, carboxymethyl cellulose, methylcellulose (e.g., Methocel), etc. ® ), hydroxypropyl methylcellulose (e.g., Hypromellose USP Pharmacoat-603), hydroxypropyl methylcellulose acetate stearate (Aqoate HS-LF and HS), hydroxyethyl cellulose, hydroxypropyl cellulose (e.g., Klucel), ® ), ethyl cellulose (e.g., Ethocel) ® ) and microcrystalline cellulose (e.g., Avicel) ® Microcrystalline glucose, amylose, magnesium aluminum silicate, polysaccharide acid, bentonite, gelatin, polyvinylpyrrolidone / vinyl acetate copolymer, crosslinked povidone, povidone, starch, pregelatinized starch, tragacanth gum, dextrin, sugars such as sucrose (e.g., Dipac) ® ), glucose, molasses, mannitol, sorbitol, xylitol (e.g., Xylitab) ® Lactose, natural or synthetic gums such as gum arabic, gum tragali, ghatti gum, isapola shell adhesive, starch, polyvinylpyrrolidone (e.g., Povidone) ® CL, Kollidon ® CL, Polyplasdone ®XL-10, and Povidone ® K-12), larch arabinogalactan, Veegum ® Polyethylene glycol, wax, sodium alginate, etc.

[0229] Suitable lubricants or flow aids for use in solid dosage forms may include, but are not limited to, stearic acid, calcium hydroxide, talc, corn starch, sodium stearyl fumarate, alkali metal and alkaline earth metal salts such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearate, magnesium stearate, zinc stearate, waxes, and Stearot. ® Boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, polyethylene glycol or methoxy polyethylene glycol, such as Carbowax™, PEG 4000, PEG 5000, PEG 6000, propylene glycol, sodium oleate, glyceryl behenate, glyceryl palmitoyl stearate, glyceryl benzoate, magnesium lauryl sulfate or sodium lauryl sulfate, etc.

[0230] Suitable diluents for solid dosage forms may include, but are not limited to, sugars (including lactose, sucrose, and glucose), polysaccharides (including glucose binders and maltodextrin), polyols (including mannitol, xylitol, and sorbitol), cyclodextrins, etc.

[0231] Suitable wetting agents for solid dosage forms may include, for example, oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, and quaternary ammonium compounds (e.g., Polyquat 10). ® Sodium oleate, sodium lauryl sulfate, magnesium stearate, sodium docusate, triacetin, vitamin E, TPGS, etc.

[0232] Suitable surfactants for solid dosage forms may include, for example, sodium lauryl sulfate, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbate, poloxamer, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, such as Pluronic. ® (BASF), etc.

[0233] Suitable suspending agents for solid dosage forms may include, but are not limited to, polyvinylpyrrolidone, such as polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25 or polyvinylpyrrolidone K30; polyethylene glycol, for example, polyethylene glycol may have a molecular weight of about 300 to about 6000, or about 3350 to about 4000 or about 7000 to about 5400; vinylpyrrolidone / vinyl acetate copolymer (S630); sodium carboxymethyl cellulose; and so on. Cellulose, hydroxypropyl methylcellulose, polysorbate-80, hydroxyethylcellulose, sodium alginate, gums such as gum arabic and gum arabic, guar gum, xanthan gums including xanthan gum, sugars, cellulose materials such as sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, hydroxypropyl methylcellulose, hydroxyethylcellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, polyethoxylated sorbitan monolaurate, povidone, etc.

[0234] Suitable antioxidants for solid dosage forms include, for example, butylated hydroxytoluene (BHT), sodium ascorbate, and tocopherol.

[0235] Liquid dosage forms for oral administration can be aqueous suspensions selected from, but not limited to, pharmaceutically acceptable aqueous oral dispersions, emulsions, solutions, elixirs, gels, and syrups. See, for example, Singh et al., Encyclopedia of Pharmaceutical Technology, 2nd edition, pp. 754-757 (2002). Additionally, the liquid dosage form may contain additives such as: (a) disintegrants; (b) dispersants; (c) wetting agents; (d) at least one preservative; (e) viscosity enhancers; (f) at least one sweetener; and (g) at least one flavoring agent. In some embodiments, the aqueous dispersion may further contain a crystallization inhibitor.

[0236] The aqueous suspensions and dispersions described herein can be maintained in a homogeneous state for at least 4 hours as defined in the USP Pharmacist's Guide (2005 edition, Chapter 905). Homogeneity should be determined by sampling methods consistent with those used to determine the homogeneity of the entire composition. In one embodiment, the aqueous suspension can be resuspended into a homogeneous suspension by physical agitation for less than 1 minute. In another aspect, the aqueous suspension can be resuspended into a homogeneous suspension by physical agitation for less than 45 seconds. In yet another aspect, the aqueous suspension can be resuspended into a homogeneous suspension by physical agitation for less than 30 seconds. In yet another embodiment, agitation is not required to maintain a homogeneous aqueous dispersion.

[0237] In another aspect, the dosage form may include a microencapsulated formulation. In some embodiments, one or more additional compatible materials are present in the microencapsulation material. Exemplary materials include, but are not limited to, pH adjusters, erosion promoters, defoamers, antioxidants, flavoring agents, and carrier materials such as binders, suspending agents, disintegrants, fillers, surfactants, solubilizers, stabilizers, lubricants, wetting agents, and diluents.

[0238] Exemplary microencapsulation materials that can be used to delay the release of formulations containing the compounds described herein include, but are not limited to, hydroxypropyl cellulose ethers (HPCs), such as Klucel. ® Or Nisso HPC, low-substituted hydroxypropyl cellulose ether (L-HPC), hydroxypropyl methylcellulose ether (HPMC), such as Seppifilm-LC, Pharmacoat ® Metolose SR, Methocel ® -E, Opadry YS, PrimaFlo, Benecel MP824 and Benecel MP843, methylcellulose polymers such as Methocel ® -A, Hydroxypropyl methylcellulose acetate stearate Aqoat (HF-LS, HF-LG, HF-MS) and Metolose ® Ethyl cellulose (EC) and its mixtures, such as E461, Ethocel ® Aqualon ® -EC, Surelease ® Polyvinyl alcohol (PVA), such as Opadry AMB; hydroxyethyl cellulose, such as Natrosol. ® Carboxymethyl cellulose and salts of carboxymethyl cellulose (CMC), such as Aqualon ® -CMC, a copolymer of polyvinyl alcohol and polyethylene glycol, such as Kollicoat IR ® Monoglycerides (Myverol), triglycerides (KLX), polyethylene glycol, modified food starch, acrylic polymers and mixtures of acrylic polymers with cellulose ethers, such as Eudragit. ® EPO, Eudragit ® L30D-55, Eudragit ® FS 30D Eudragit ® L100-55, Eudragit ® L100, Eudragit ® S100, Eudragit ® RD100, Eudragit ® E100, Eudragit® L12.5, Eudragit ® S12.5, Eudragit ® NE30D and Eudragit ® NE 40D, cellulose acetate phthalate, sepifilms, such as mixtures of HPMC and stearic acid, cyclodextrin, and mixtures of these materials.

[0239] Plasticizers may include polyethylene glycol, such as PEG 300, PEG 400, PEG 600, PEG 1450, PEG 3350, and PEG 800, stearic acid, propylene glycol, oleic acid, and triacetin, which are incorporated into the microencapsulation material. In another embodiment, the microencapsulation material for delaying the release of the pharmaceutical composition is derived from the USP or the National Formulary (NF). In still other embodiments, the microencapsulation material is Klucel. In yet another embodiment, the microencapsulation material is methylcellulose.

[0240] Microencapsulated compositions can be formulated using methods known to those skilled in the art. Such known methods include, for example, spray drying, rotating disk-solvent methods, thermal melting, spray cooling, fluidized bed, electrostatic deposition, centrifugal extrusion, rotary suspension separation, polymerization at liquid-gas or solid-gas interfaces, pressure extrusion, or spray solvent extraction baths. In addition to these, several chemical techniques can be used, such as composite coagulation, solvent evaporation, polymer-polymer incompatibility, interfacial polymerization in liquid media, in-situ polymerization, drying in liquids, and desolvation in liquid media. Furthermore, other methods can be used, such as rolling, extrusion / spheronization, coagulation, or nanoparticle coating.

[0241] Intranasal preparations Intranasal formulations are known in the art and described, for example, in U.S. Patent Nos. 4,476,116 and 6,391,452. Formulations comprising the compositions described herein, prepared according to the above and other techniques known in the art, using benzyl alcohol or other suitable preservatives, fluorocarbons, and / or other solubilizers or dispersants known in the art, are prepared as solutions in saline. See, for example, Ansel, HC et al., Pharmaceutical Dosage Forms and Drug Delivery Systems, 6th Edition (1995). Preferably, these compositions and formulations are prepared with suitable, non-toxic, pharmaceutically acceptable ingredients. These ingredients are known to those skilled in the art in preparing nasal dosage forms, and some of these ingredients can be found in the standard reference book in the art, Remington: The Science and Practice of Pharmacy, 21st Edition, 2005. The choice of a suitable carrier depends highly on the exact properties of the desired nasal dosage form (e.g., solution, suspension, ointment, or gel). In addition to the active ingredient, nasal dosage forms typically contain a significant amount of water. Small amounts of other ingredients may also be present, such as pH adjusters, emulsifiers or dispersants, preservatives, surfactants, gelling agents or buffers, and other stabilizers and solubilizers. Nasal formulations should be isotonic with nasal secretions.

[0242] For inhalation administration, the pharmaceutical compositions described herein may be in the form of aerosol, mist, or powder. The pharmaceutical compositions described herein are conveniently delivered as an aerosol spray from a pressurized package or nebulizer using a suitable propellant, such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. In the case of pressurized aerosols, the dosage unit can be determined by providing a valve to deliver a measured amount. Capsules and cartridges made of gelatin, for example (by way of example only), for inhalers or blowpipes, can be formulated containing a powder mixture of the compounds described herein with a suitable powder matrix (such as lactose or starch).

[0243] Treatment plan The composition can be applied for therapeutic use or as maintenance therapy, such as for patients in remission. The composition can be applied once daily, twice daily, three times daily, or more frequently. The composition can be applied daily, every other day, five days a week, once a week, every other week, two weeks a month, three weeks a month, once a month, twice a month, three times a month, or more frequently. The composition can be applied for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, or more.

[0244] If the patient's condition does improve, the compound may be administered continuously, at the physician's discretion; or the dosage may be temporarily reduced or temporarily discontinued for a period of time (i.e., a "medication holiday"). The length of a medication holiday can vary between 2 days and 1 year, including (for example only) 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. Dosage reduction during a drug holiday can be 10%-100%, including (for example only) 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0245] Once improvement in the patient's condition has occurred, a maintenance dose may be administered if necessary. Subsequently, the dose or frequency, or both, may be reduced as symptoms improve until the level of improvement in the disease, disorder, or condition is maintained. However, the patient may require long-term intermittent treatment following any recurrence of symptoms.

[0246] The amount of a given reagent corresponding to such a quantity will vary depending on factors such as the specific compound, the severity of the disease, and the characteristics of the subject or host requiring treatment (e.g., weight), but can still be routinely determined in a manner known in the art based on the specific circumstances surrounding the case, including, for example, the specific agent administered, the route of administration, and the subject or host being treated. The desired dose may conveniently exist as a single dose or as separate doses administered simultaneously (or over a short period of time) or at appropriate intervals, such as two, three, four, or more sub-dose per day.

[0247] The pharmaceutical compositions described herein may be unit dosage forms suitable for precise single-dose administration. In a unit dosage form, the formulation is divided into unit doses containing appropriate amounts of one or more compounds. The unit dose may be in the form of packaging containing discrete amounts of the formulation. Non-limiting examples are packaged tablets or capsules, and powders in vials or ampoules. Aqueous suspension compositions may be packaged in single-dose, non-resealable containers. Alternatively, multi-dose, resealable containers may be used, in which case preservatives are typically included in the composition. By way of example only, formulations for parenteral injection may be present in unit dosage forms (including, but not limited to, ampoules) or multi-dose containers containing added preservatives.

[0248] The above ranges are merely suggestive, as the number of variables relating to individual treatment regimens is vast, and significant deviations from these recommended values ​​are not uncommon. Such dosages can vary depending on a multitude of variables, including but not limited to the activity of the compound used, the disease or condition being treated, the mode of administration, the individual subject's needs, the severity of the disease or condition being treated, and the physician's judgment.

[0249] The toxicity and therapeutic efficacy of such treatment regimens can be determined in cell cultures or laboratory animals using standard pharmaceutical procedures, including but not limited to determining the LD50 (the dose that is 50% lethal to the population) and ED50 (the dose that is therapeutically effective in 50% of the population). The dose ratio between toxicity and therapeutic effect is the therapeutic index, and it can be expressed as the ratio between LD50 and ED50. Compounds exhibiting a high therapeutic index are preferred. Data obtained from cell culture experiments and animal studies can be used to determine the dosage range for human use. The dosage of such compounds is preferably within the range of cyclic concentrations (including ED50) with minimal toxicity. The dosage can vary within this range depending on the dosage form and route of administration used.

[0250] According to another aspect of the invention, a method for selecting a subject for treatment is provided, comprising determining whether the subject suffers from a disease induced by defective protein expression caused by intron retention in a gene transcript, wherein, upon positive confirmation, the subject is selected for treatment; and optionally, the subject is treated.

[0251] Treatment may include correcting intron retention in gene transcripts. Treatment may include hybridizing a polynucleotide polymer according to the invention with a gene transcript to induce the removal of introns from the gene transcript.

[0252] According to another aspect of the invention, there is a use for normalizing gene expression by using antisense polynucleotide polymers through correction of intron retention in cancer cells.

[0253] According to another aspect of the invention, a polynucleic acid polymer according to the invention, a composition according to the invention, a carrier according to the invention, or a delivery carrier according to the invention are provided for treating or preventing diseases.

[0254] According to another aspect of the invention, a polynucleic acid polymer according to the invention, a composition according to the invention, a carrier according to the invention, or a delivery carrier according to the invention are provided for the production of medicaments for treating or preventing diseases.

[0255] The disease could be diabetes or cancer.

[0256] When referring to polynucleotide polymer sequences, those skilled in the art should understand that one or more substitutions are permissible within the sequence, optionally two substitutions, such that it maintains its ability to hybridize with the target sequence, or, if the substitution is within the target sequence, maintains its ability to be identified as the target sequence. Regarding sequence identity, it can be determined using standard / default parameters via BLAST sequence alignment (www.ncbi.nlm.nih.gov / BLAST / ). For example, the sequence can have 99% identity and still function according to the invention. In another embodiment, the sequence can have 98% identity and still function according to the invention. In yet another embodiment, the sequence can have 95% identity and still function according to the invention.

[0257] When referring to a reduction or correction of intron retention, the reduction can be complete, such as 100%, or it can be partial. The reduction can be clinically significant. The reduction / correction can be the level of intron retention relative to untreated subjects or the amount of intron retention relative to a similar population of subjects. The reduction / correction can be at least 10% less intron retention relative to the average subject or the pre-treatment subject. The reduction / correction can be at least 20% less intron retention relative to the average subject or the pre-treatment subject. The reduction / correction can be at least 40% less intron retention relative to the average subject or the pre-treatment subject. The reduction / correction can be at least 50% less intron retention relative to the average subject or the pre-treatment subject. The reduction / correction can be at least 60% less intron retention relative to the average subject or the pre-treatment subject. The reduction / correction can be at least 80% less intron retention relative to the average subject or the pre-treatment subject. The reduction / correction can be at least 90% less intron retention relative to the average subject or the pre-treatment subject.

[0258] reagent kits / products This document provides kits and preparations for use with one or more of the methods described herein. The kit may contain one or more of the polynucleic acid polymers described herein, for example identified as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 43 or SEQ ID NO: 44. The kit may also contain one or more polynucleotide polymers antisense to the polynucleotide polymers described herein, such as SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42, SEQ ID NO: 45, SEQ ID NO: 46, or SEQ ID NO: 47-434. The kit may further contain reagents and buffers necessary for the formation and delivery of the polynucleotide polymers.

[0259] The kit may also include a carrier, package, or container divided to receive one or more containers (e.g., vials, tubes, etc.), each container containing one of the individual components to be used in the methods described herein, such as a polynucleotide polymer and reagents. Suitable containers include, for example, bottles, vials, syringes, and test tubes. Containers can be formed from various materials, such as glass or plastic.

[0260] The articles described herein contain packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, bottles, tubes, bags, containers, vials, and any packaging materials suitable for the selected formulation and the intended mode of administration and treatment.

[0261] Kits typically include a label listing the contents and / or instructions for use, as well as a packaging insert with instructions for use. A set of instructions will also usually be included.

[0262] Those skilled in the art will understand that, where appropriate, optional features of one embodiment or aspect of the invention may be applied to other embodiments or aspects of the invention.

[0263] Embodiments of the present invention will now be described in more detail with reference to the accompanying drawings, by way of example only.

[0264] Example These embodiments are provided for illustrative purposes only and are not intended to limit the scope of the claims provided herein.

[0265] Example 1 Most eukaryotic genes contain intercalation sequences or introns that must be precisely removed from the primary transcript to produce functional mRNAs capable of encoding proteins (1). This process alters mRNA composition in a highly dynamic manner, utilizing the interdependent interactions of five small nuclear RNAs and a large number of proteins with conserved but degenerate sequences in the pre-mRNA (2). Intron splicing generally promotes cross-species mRNA accumulation and protein expression (3–5). This process can be altered by intron mutations or variants, which can also weaken coupled gene expression pathways, including transcription, mRNA export, and translation. This is best exemplified by introns in the 5' untranslated region (5'UTR), where altered intron-retention native variants or mutations change the relative abundance of transcripts with upstream open reading frames (uORFs) or other regulatory motifs and significantly affect translation (6, 7). However, successful sequence-specific strategies for normalizing gene expression in such cases have not yet been developed.

[0266] Splice-switching oligonucleotides (SSOs) are antisense agents that regulate intron splicing by binding to splice sites to recognize or regulate sequences and competing for their targets with cis and trans-acting factors (8). They have been shown to restore aberrant splicing, alter the relative expression of existing mRNAs, or produce novel splice variants (8). Enhancing the stability of targeted SSO-RNA duplexes through extensive SSO modifications (e.g., 2'-O-methyl and 2'-O-methoxyethyl ribose) has facilitated research exploring their therapeutic potential for a growing number of human disease genes, including DMD in muscular dystrophy (9, 10), SMN2 in spinal muscular atrophy (11), ATM in ataxia-telangiectasia (12), and BTK in X-linked agammaglobulinemia (13). While these approaches come close to realizing their clinical potential for a limited number of diseases (8), the >300 Mendelian disorders and an increasing number of complex traits resulting from mutation-induced aberrant splicing (14) may be well-suited for SSO-mediated correction of gene expression.

[0267] The etiology of type 1 diabetes has a strong genetic component conferred by human leukocyte antigen (HLA) and various modified non-HLA loci (15). The proinsulin gene on chromosome 11 (… INS The strongest modifier was identified in the region (referred to as IDDM2) (15). Further mapping of this region shows... INS It is the most likely target of IDDM2 (16), consistent with the key role of this autoantigen in pathogenesis (17). The genetic risk of this disease at IDDM2 has been attributed to both susceptibility and protection. INS Differential homeostatic RNA levels in haplotypes may involve small satellite DNA sequences upstream of this gene (18, 19). However, for naturally occurring... INS Systematic testing of polymorphism revealed haplotype-specific proinsulin expression levels in reporter constructs lacking small satellite sequences, which were expressed by intron 1(7) in a gene terminology called IVS1+5ins4 (also known as...). rs3842740 or INS -69) and IVS1-6A / T ( rs689 , INSThe two variants (-27 or HphI+ / -) resulted (16, 20). The former variant activated the hidden 5' splice site of intron 1, while the latter variant, located 6 nucleotides upstream of the 3' splice site (3'ss), promoted intron retention with adenine (A), thereby increasing the relative abundance of transcripts with an extended 5'UTR (21). Compared with thymine (T), the A allele of IVS1-6A / T reduced the affinity for pyrimidine-binding proteins in vitro and made 3'ss more dependent on the U2 small nucleonucleotide protein cofactor (U2AF) (7) (a heterodimer required for U2 binding, spliceosome assembly, and 3'ss selection (22)). Transcripts containing intron 1 were overexpressed in IVS1-6A-derived cDNA libraries prepared from insulin-producing tissues (21), effluent from the nucleus (23), and contained a short human subfamily-specific uORF that co-evolved with the 3'ss relaxation of intron 1 in higher primates (7). Lower proinsulin expression conferred by the A allele may lead to suboptimal expression of proinsulin peptide in the fetal thymus and insufficient negative selection by autoreactive T cells, ultimately resulting in autoimmune destruction of insulin-producing β cells in the pancreas (7). However, attempts have not been made to correct the removal of IVS1-6A-containing pre-mRNA. INS The inefficiency of intron 1 and the reduction of intron retention to levels observed against disease-protective T alleles.

[0268] This study began by searching for ways to increase pre-mRNA levels. INS SSOs that enhance proinsulin expression by inhibiting intron 1 splicing efficiency and suppressing splicing silencers or decoy splicing sites were identified. SSOs that reduce the relative abundance of transcripts with reduced intron 1 retention were identified, demonstrating optimized antisense targets at single-nucleotide resolution, and evidence was shown of the formation of parallel G-quadruplexes of adjacent antisense target sequences and the identification of proteins binding to this region.

[0269] Materials and methods antisense oligonucleotides SSOs were purchased from MWG Biotech (Germany). All SSOs and the disordered control had a full-length phosphate-thioester backbone with a 2'-O-methylribonucleotide at the second ribose position. Except for INS In addition to SSOs and their disordered versions, we used SSOs targeting other human genes as additional control groups, as described in (13). The location of each SSO is as follows: Figure 1 As shown in A, and its sequence is shown in Table 2.

[0270] Splicing reporter gene construct Previously, wild-type splice reporter variants carrying type 1 diabetes-related haplotypes, known as IC, were reported (7,21). Each construct contains all INSExons and complete introns were found, but the lengths of the last exons differed. IC reporter clones were used with primers DC, DF, and DB; IC DB lacked the hidden 3'ss of intron 2. The relative abundance of isoforms spliced ​​to this site was lower for IC DF compared to IC DC (7,21). To test SSO targeting the hidden 5' splice site of intron 1, [the following was performed]. rs3842740 The IC construct was modified with a 4-nt insertion at the position to produce a reporter construct called ICIVS1+5ins4. This was previously reported. TSC2 and F9 Constructs (24). Plasmids were amplified in E. coli strain DH5α and plasmid DNA was extracted using the Wizard Plus SVMiniprep kit (Promega, USA). Their insert fragments were fully sequenced to confirm the identity of each of the 14 natural variants within the genes and to exclude unwanted mutations.

[0271] Cell culture and transfection Human embryonic kidney 293 (HEK293), human hepatocellular carcinoma HepG2, and African green monkey COS7 cells were cultured in Dulbecco's modified Eagle medium, 10% fetal bovine serum, and penicillin / streptomycin (Lifetechnologies, USA). Transient transfection was performed using jetPRIME (Polyplus, USA) as described in (13), following the manufacturer's recommendations. As previously reported (7, 25), U2AF35 was downregulated via RNA interference (RNAi) to induce the occult 3'ss of intron 1 by two small interfering RNA (siRNA) U2AF35ab challenges; siRNA duplexes targeting DHX36 were as described in (26). The second challenge was applied 24 hours before the addition of SSO and / or reporter constructs. Cell cultures were harvested 24 hours after the addition of reporter constructs.

[0272] splice product analysis Total RNA was extracted using TRI reagent and treated with DNase (Life Technologies, USA). First-strand cDNA was reverse transcribed using oligo(dT)15 primers and Moloney mouse virus reverse transcriptase (Promega, USA). Polymerase chain reaction (PCR) was performed using a combination of vector-specific primer PL3 and primer E targeting the 3'UTR, as previously reported (7). PCR products were isolated on polyacrylamide gels and their signal intensities were measured as described in (27). The identity of each mRNA isoform was confirmed by Sanger nucleotide sequencing.

[0273] Circular dichroism and nuclear magnetic resonance spectroscopy Oligonucleotides used for circular dichroism (CD) and nuclear magnetic resonance (NMR) were purchased from Thermo Scientific, deprotected, lyophilized, and stored at -20°C according to the manufacturer's instructions. Stock solutions were prepared from desalted lyophilized samples by resuspending them to a final concentration of 2–4 μM in milliQ water or KCl buffer (100 mM KCl, 10 mM K2HPO4 / KH2PO4, pH 7.0, milliQ water). CD spectra were obtained using a PiStar-180 spectrophotometer (Applied Photophysics Ltd, Surrey, UK) equipped with an LTD6G circulating water bath (Grant Instruments, UK) and a thermoelectric temperature controller (Melcor, USA). Samples were heated to 95°C for a total of 15 minutes in a chamber and then annealed by allowing them to cool to room temperature for at least 4 hours. CD spectra were recorded in the 215–340 nm wavelength range and at the indicated temperature using strain-free quartz cuvettes with a 1 cm path length. Data points were recorded at 1 nm intervals. A 3 nm bandwidth was used, and 5000 counts were acquired at each point to enable adaptive sampling. Each trace is shown as the average of three scans (±SD). The CD temperature rise was obtained at 265 nm, corresponding to the maximum value of the folded tetraploid material. Points were acquired at 0.5 °C intervals, using a range from 5 to 99 °C, with time steps of 120–180 s between 0.5 °C increments. Points were acquired at 10,000 counts to enable adaptive sampling. Heating and cooling studies were compared to examine hysteresis and overall reversibility. NMR spectra (1H) were acquired at 800 MHz using a Bruker Avance III spectrometer with a triple resonance cryopreservation probe. Standard Bruker acquisition parameters were used. Data were acquired using Topspin (version 3.0) and processed in CCPN analysis (version 2.1).

[0274] Pull-down assay and Western blotting In vitro transcription was performed using MEGAshortscript™ T7 (Life Technologies, USA) and the T7-labeled PCR product amplified with primers 5'-ATTAATACGACTCACTATAGGGCTCAGGGTTCCAGG and 5'-TGCAGCAGGGAGGACG and the DNA of the plasmid shown as a template. The synthesized RNA shown was purchased from Eurofins UK. 500 pmol of each RNA was used with 5 mM... m- Sodium periodate treatment and binding to adipic acid dehydrazide agarose beads (Sigma, USA). Beads with bound RNA were washed three times in 2 ml of 2M NaCl and three times in buffer D (20 mM HEPES-KOH, pH 7, 6.5% v / v glycerol, 100 mM KCl, 0.2 mM EDTA, 0.5 mM dithiothreitol), and incubated with HeLa nuclear extract and buffer D containing heparin to a final concentration of 0.5 mg / ml. Unbound proteins were washed five times with buffer D. Bound proteins were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and analyzed by Coomassie blue staining and / or Western blot analysis on nitrocellulose membranes.

[0275] Western blot analysis was performed as described in (7). Antibodies were purchased from Sigma (hnRNP E1 / E2, product number R4155, U2AF65, product number U4758, and SFRS2, product number S2320), Abcam (DHX36, product number ab70269), and Millipore (SC35, clone 1SC-4F11). Antisera against hnRNP F and hnRNP H were provided by Professor Douglas Black, UCLA.

[0276] Mass spectrometry analysis After trypsin digestion, the samples were lyophilized and resuspended in 25 μl of 5% ACN / 0.1% formic acid for mass spectrometry (MS). Peptides were analyzed by LC / MS / MS using the Surveyor LC system and LCQ Deca XP Plus (ThermoScientific). The raw data files were converted to mascot universal files using the MassMatrix file conversion tool (version 2.0; http: / / www.massmatrix.net) for input into the Mascot search algorithm (Matrix Science).

[0277] Enzyme structure detection RNA secondary structure determination using limited V1 RNase (Ambion), T1 RNase (Ambion), and S1 nuclease (Fermentas) digestion has been described in detail elsewhere (28). Briefly, a 1 μg sample of RNA from pre-insertion and pre-delion mRNA was digested in 100 μl at 30 °C with 0.002 U RNase V1, 0.05 U RNase T1, and 19 U S1 nuclease for 10 min. An enzyme-free sample was used as a control (C). The cleaved RNA was reverse transcribed according to a standard protocol using an antisense primer labeled with [32P]-ATP at the 5' end.

[0278] result Antisense oligonucleotides that promote pre-mRNA splicing of weak introns in the 5'UTR In order to identify and reduce INS To preserve intron 1 and enhance splice-mediated translation, we designed a series of 2'-O-methyl-modified phosphate-thioester SSOs. Each SSO was co-expressed individually in HEK293 cells with a splice reporter construct carrying a haplotype IC, and the relative abundance of exogenous mRNA products was examined. Figure 1 A and B). The IC haplotypes in the report body did not contain small satellite sequences and contained a total of 14 polymorphic sites (7, 20), including rs689 The A allele. This allele represses intron 1 splicing and produces lower proinsulin levels compared to the more common T allele (21). SSOs targeting intron 1 and exon 2 were selected from regions showing the most pronounced alterations in exon inclusion or intron retention in previous systematic deletion analyses of these sequences (7). The SSO in exon 3 is located between the true 3'ss of intron 2 and a strongly competitive 126nt downstream cryptic 3'ss to identify altered pre-mRNA motifs ( Figure 1 A). 15 samples tested in HEK293 cells. INS In the initial set of SSOs, 11 showed reproducible changes in the relative abundance of mRNA isoforms (Table 2). Intron 1 retention was significantly reduced by the single oligonucleotide SSO21 (P < 0.01, Mann-Whitney rank-sum test); Figure 2 A). SSO21 targets intron 1 positions 59-74, including the motif previously found to confer the greatest reduction in intron retention upon deletion (referred to as del5) (7). The reduction in intron retention induced by SSO21 is dose-dependent. Figure 2 A), and also in HepG2 cells and black-faced green monkeys (A), and also in HepG2 cells and black Chlorocebus aethiopsIn COS7 cells, the expression and high evolutionary conservation of spliceosome components using helper splicing sequences were observed (1, 2). In addition to reducing intron 1 retention, SSO21 promotes the concealment of intron 2's 3'ss ( Figure 2 A). However, for other... INS SSO and disordered order comparison ( Figure 3 This effect was also observed in Table 2, indicating a non-specific interaction. To confirm that the enhancement of intron 1 splicing induced by SSO21 was not promoted by the occlusion of intron 2 3'ss, we co-transfected the SSO with a shorter reporter variant that lacked this site and retained only the first 89 nucleotides of exon 3. Figure 2 B shows that SSO21 can promote intron 1 splicing to the same extent as reporters with longer exon 3. Conversely, no reduction in SSO21-induced intron retention was observed in reporters lacking the del5 segment. In addition to intron retention, an increase in exon 2 skipping (cr3'ss+81) was observed for all five SSOs (including SSO8, which binds downstream of the hidden 3'ss of intron 1). Figure 1 and 3 C, Table 2). This cryptic 3'ss is induced by RNAi-mediated depletion of the small subunit of U2AF (U2AF35) and is not reversed in cells lacking U2AF35 by bridging oligonucleotides (SSO4); instead, exon 2 skipping is observed. Figure 3 C). Depletion of U2AF35 also inhibits the concealment of intron 2's 3'ss. Overall, reduced [something] was identified in several primate cell lines. INS A single SSO is retained by intron 1.

[0279] Optimization of intron-preserving targets at the single nucleotide level Interestingly, other SSOs designed to target the del5 segment do not reduce intron 1 retention, except for the small effect of SSO20. Figure 1 (A and 2A). To test the importance of nucleotides flanking SSO21 and to map the optimal target at single-base resolution, a detailed antisense microwalk was performed in this region. INS The reporter variant, consisting of 1-9 nucleotides that bind individually to the additional 18 hexamers at the 5' and 3' of SSO21, was co-transfected into HEK293 cells, and its RNA product was examined. Intron 1 was most repressed by SSO21 and SSO21 that shifted 1-2 nucleotides in each direction. Figure 4 Consistent with the initial screening, SSOs targeting more than one cytosine (C4, see SSO1 and SSO2) were observed during upstream runs of the four Cs. Figure 1 A) Not valid (SSO21-3r to SSO21-10r, Figure 4In the opposite direction, targeting the continuous G in intron splicing enhancers (29-31) increases intron retention via SSO. Therefore, it is used to reduce... INS The optimal antisense target for the retention of intron 1 was mapped at single nucleotide resolution to the region previously identified as the most repressed by systematic deletion analysis of the entire intron (7).

[0280] Intron-retained antisense targets are adjacent to the parallel RNA quadruplex. Note that the target is sandwiched between two intronic segments (nucleotides 36-61 and 78-93 of intron 1) that are predicted to form a stable RNA guanine (G) tetramer. Figure 4 (Highlighted in A). These structures are generated by stacking G-quartets (32) consisting of four Gs arranged in a cyclic Hoogsteen hydrogen bond configuration, and have been involved in important cellular processes, including replication, recombination, transcription, translation (33, 34), and RNA processing (35–39). To test whether they form in vitro, synthetic ribonucleotides derived from this region were used in CD spectroscopy analysis, which has been widely used in vitro to characterize DNA and RNA quadruplex structures (40–43). The CD spectrum of the downstream 19-mer (referred to as CD1), recorded between 215 and 330 nm at 25 °C, shows a strong positive ellipticity at 265 nm and a negative intensity at approximately 240 nm, indicating a parallel quadruplex ( Figure 5 A). To confirm the presence of a quadruplex rather than other stable secondary structure motifs, UV absorption spectra were recorded at 5 °C and 95 °C. The differential UV absorption spectra at the two temperatures (below and above the melting transition point) showed a characteristic hyperchromic shift at ~295 nm and dual maxima at 240 nm and 280 nm, providing evidence for the in vitro formation of a stable parallel-stranded RNA quadruplex. This was confirmed by 1H NMR studies of CD1. Figure 5 B), which shows a characteristic envelope of the signal between 10 and 12 ppm, corresponding to the Hoogsteen H-bonded G within the G-quadruplex structure. Thermal stability measurements via CD yielded a highly reversible S-shaped cooperative unwinding transition. T m =56.8±0.2℃ Figure 5 C). Figure 5 D (top image) shows the possible arrangement of 19mers into two stacked G-tetramers linked by a relatively short circular sequence of 1–4 nucleotides.

[0281] INS Conformational transition model of splicing repression sequence in intron 1 The synthetic 20-mer CD (referred to as CD2) originating from the region upstream of the antisense target also showed evidence of stable structure formation, giving a wider absorption envelope centered at 270 nm and an S-shaped thermal decomposition transition ( T m =69.0±0.45℃; Figure 5 A). Unlike the downstream oligomeric CD1, no hyperchromic shift was observed in the UV in the thermal differential spectrum. However, a distinct set of sharp signals in the 1H NMR spectrum between 12 and 14 ppm, unlike CD1, indicates the formation of Watson-Crick H-bonded base pairs characteristic of double-stranded RNA. Figure 5 B). Secondary structure prediction using overlapping intron segments of Mfold indicates that the pre-mRNA forms a stable local stem-loop; one of these is through a G→C mutation (called G2) that increases intron 1 retention. Figure 5 D, below) and further stabilized (7). Another G→C substitution located further downstream and destabilizing the quadruplex structure (called G3) Figure 5 D (see above) also inhibits intron splicing (7). Finally, CD2 oligonucleotides containing A or G at single nucleotide polymorphisms (D, above) also inhibit intron splicing. Figure 4 A and (20) show very similar CD spectra, with clear unwinding transitions and T m The value indicates that the G and A alleles form the same structure.

[0282] To further test the importance of the transient equilibrium between standard and non-standard structures in intron splicing, a combination of CD, NMR, and mutation experiments was used. Figure 6 Synthesize the oligonucleotide CD3 containing the 5' end of the intron-retaining target and predict the stem-loop / quadriplex (). Figure 4 A and 6A). A mutant form of CD4 was also synthesized, carrying two C→U transitions, which destabilized the hairpin but maintained the stability of the tetramer. The same mutation was also introduced in the IC reporter construct transfected into HEK293 cells. NMR spectroscopy of CD3 revealed the coexistence of signals from both the balanced G-tetramer and the standard base-paired hairpin structure (designated H1 and H2). Figure 6 (B and C). Mg was studied by adding 2 mM and then 6 mM MgCl2 to a buffer solution containing 100 mM KCl. 2+ The effect on the conformational equilibrium between the tetrachain and the hairpin. As reported by Bugaut et al. (57), the conformational equilibrium was not affected by the addition of Mg in the presence of KCl. 2+ And significantly disrupted. Therefore, we observed RNA hairpins and quadruplex structures mimicking the K... + and Mg 2+The formation of ions in a cellular environment where they exist at high concentrations. The CD melting curve shows a broad transition (…). T m =79.9℃, consistent with multiple conformational states with different stabilizations. The CC→UU mutation in CD4 leads to the loss of NMR signal in H1 ( Figure 6 B), and T m A 13°C decrease, consistent with the selective destabilization of the more stable hairpin H1, leads to an increase in the H2 population in equilibrium with the quadruplex. Transient transfection showed that the CC→UU mutation improves intron 1 splicing, while the mutation known as M1, predicted to destabilize both the quadruplex and hairpin, has only a small effect. Figure 6 D, Table 1A).

[0283] To investigate how the balance of these structures more systematically affects intron splicing, a series of mutant constructs were prepared to destabilize / retain the predicted quadruplex, H1 / H2 structure, and two cytosine runners (Table 1A). Their transcripts showed significant differences in intron retention levels. Figure 7 P = 0.0001, rank-based Kruskal-Wallis one-way ANOVA. First, elimination of the G-quadruplex increased intron 1 retention, which was further enhanced by the removal of each cytosine run (compare mutations 4–6 with wild type, P = 0.0004). These mutations appeared to have an additive effect on intron retention (compare wild type with mutations 1 or 9; 3 vs. 2 and 4 vs. 5). Second, the increased intron retention in the absence of the G-quadruplex was not altered by the removal of H1 and H2, but their elimination enhanced exon skipping (compare isoform 2 of mutation 4 vs. 6). Third, removal of H1 slightly improved intron 1 splicing when only one of the two C4 runs was present (compare 8 vs. 9), consistent with the statistically significant correlation between intron retention and the predicted stability of the RNA tested. Figure 7 B). The efficiency of intron splicing is therefore controlled by the conformational transition between balanced standard and non-standard structures.

[0284] Table 1A. Altering predicted RNA G quadruplex, stem-loop, and two cytosine operations in plasmid constructs INS Intron 1 mutation

[0285] Protein-RNA interactions in the region targeted by the winning SSO To identify proteins that interact with standard and non-standard structures containing antisense targets and / or associated features, pull-down assays were performed using wild-type and del5 RNA transcribed from T7-tagged PCR products, synthetic RNA representing the target sequence (CD5), and a control oligomer called AV3 containing 3'ss CAG. Western blot analysis showed that both wild-type and del5 transcripts bound to hnRNP F / H, but this binding was absent for CD5. Figure 7 C). These proteins were also detected by MS / MS analysis of differentially stained fragments from wild-type and del5 RNA via pull-down gels, compared to a control containing only pearls. Two antibodies against SRSF2 showed the highest scores for putative binding activity among several SR proteins, failing to detect any specific interactions. Figure 7 C). Although for del5, the signal from hnRNP E1 / E2, which constitutes the major polymer (C) binding activity (44) in mammalian cells, is higher than the background ( Figure 7 (C), but no changes in intron retention were observed in cells lacking hnRNP E1 / E2.

[0286] splicing modes of rich G and poor G report bodies when DHX36 is exhausted RNA G-quadruplex binding helicase DHX36 can convert quadruplex RNA into a stable double strand and is the main source of quadruplex degradation activity in HeLa cells (26, 45). DHX36 and ATM Intron splicing enhancer crosslinks in pre-mRNA (46), and can be unlinked TERC The four-chain structure within the 5' region (26). To test whether DHX36 depletion could affect INS Splicing, instantaneously transfecting reporter variants of poor and rich G-quadruplexes ( Figure 8 A, Table 1) to depleted cells. A control construct was selected to give approximately equal performance of the splice products, achieved by weakening the branching site (24), thus providing a sensitive in vitro splicing assay. However, despite the presence of effective DHX36 depletion ( Figure 8 B), but it was not seen in either short or long constructs. INS The statistically significant change in intron 1 retention was not observed in either the low-G or high-G controls. Figure 8 CE). These results contrast with the previous lack of significant enrichment of quadruplex sequences in transcripts downregulated in DHX36 depleted cells (47) and the absence of knockdown. ATM The reaction phase is consistent (46).

[0287] INS SSO-induced inhibition of population-specific hidden 5' splice sites in intron 1 remove rs689 outside, INS Intron 1 is cleaved near the natural 5'ss rs3842740 The effects of the polymorphic TTGC insertion at [location] (21). This insertion is present in a quarter of all African chromosomes but not in the IC haplotype of Caucasians (20). This insertion activates the downstream hidden 5' ( Figure 1 A) The 5'UTR of the resulting mRNA was further extended by 26 nucleotides and proinsulin expression was suppressed (7, 21). To test whether the new 5'ss could be effectively suppressed by SSO, the same insertion was introduced into the IC construct and into wild-type and mutant reporter constructs co-expressed with a bridging oligonucleotide called SSO10. Although cryptic splicing was suppressed, standard splicing of intron 1 was not fully restored even at high SSO10 concentrations, most likely as a result of suboptimal recognition of the true 5'ss weakened by the insertion.

[0288] To gain preliminary insight into the folding of the 5'UTR sequence with and without this insertion, enzymatic structural probing was performed using partial RNA digestion with single-stranded and double-stranded specific RNases. The overall cut location and intensity detected for wild-type RNA were generally consistent with mfold prediction, where the two main stem-loop regions (SL1 and SL2) were interrupted by several internal protrusions. Both structural probing and mfold prediction indicated that... rs3842740 The insertion at this point extends the central protrusion in SL1 because the number of T1 and S1 cuts is increased in this region compared to the rest of SL1 and SL2. Finally, the transcript is not digested by RNase V1 in the region showing the formation of the quadruplex outside the body.

[0289] discuss INS Antisense intron retention target in intron 1 splice silencing This demonstrates for the first time the use of antisense technology to reduce the retention of whole introns in mature transcripts and the use of SSO to alter haplotype dependence. INS Expression. Through systematic mutagenesis of intron 1 (7) and through macroscopic ( Figure 1 ) and micro-walking ( Figure 4 This strategy facilitates the identification of winning SSOs that compensate for the adverse effects of the A allele at rs689 on efficient RNA processing. Interestingly, the target sequence contains a tandem CAG (G / C) motif, which is similar to a 3'ss consensus sequence. Figure 4Such “pseudo-receptors” have previously been experimentally involved in splice site inhibition (27) and are overexpressed in splice silencers. For example, these two tetramers are more common in 102 high-confidence intron splice silencers (49) and depleted in 109 enhancers identified by fluorescence activation screening of random decimers (50). YAG motifs are also more frequent than expected in QUEPASA splice silencers (51), suggesting they are important functional components of the retention target. Intermediate cytosine sequences may also play an important role, as C4 runs at ~2-fold higher frequencies in QUEPASA silencers than expected. These motifs were also found in 4% of intron splice regulatory elements identified by systematic screening of sequences inserted at -62 / -51 positions relative to the tested 3'ss (52). This study identified an element called ISS22 (AAATAGAGGCCCCAG) which shares a 3' nonamer with the optimal intron retention target SFI (underlined). However, unlike the optimal 3'ss recognition sequence for AV3, our pull-down experiments with Western blot coupling showed only very weak (if any) binding for U2AF65. Figure 7 C).

[0290] Conformational transition between the quadruplex and hairpin in RNA processing control The antisense target was identified precisely upstream of the potential G-quadruplex-forming RNA, and its structure was subsequently confirmed by CD and NMR analysis. Figure 1 A and 5). RNA tetras are more stable than their DNA counterparts and have been increasingly involved in the regulation of RNA metabolism (33, 34, 41, 42), and have provided unique pathways for drug development (53). 2-Tetrad tetras are thermodynamically less stable than their 3- or 4-tetrad counterparts and may be more kinetically variable, but they still exhibit remarkable stability and can be used in response to the cellular environment’s more compliant and dynamic switching between tetrad and non-tetrad structures (54–56). Winning SSOs can block interactions with trans-acting factors, alter higher-order structures, the rate of RNA-protein complex formation, or impair the conformational transition between 2-tetrad tetras and H1 / H2 ( ). Figure 5 Similar transitions have recently been described for unpredictable quadruplexes (57), increasing the likelihood that additional sequences in G-rich intron 1 may be involved in balancing near antisense targets, potentially involving multiple quadruplex motifs and competing stem-loops.

[0291] The combination of increased intron 1 retention following hnRNP F / H depletion and the opposite effect on hnRNP F / H overexpression ( Figure 7C) and functional experiments (7) showed that these proteins interact with key splicing auxiliary sequences in this intron. Contrary to previous reports that hnRNP F directly binds to RNA quadruplexes (58), it has been shown that hnRNP F prevents RNA quadruplex formation by exclusively binding to single-stranded G sequences (59). Predictions based on the primate genome suggest that most putative quadruplexes likely fold into a standard structure (60). These proteins reduce pre-mRNA occupancy, presumably promoting quadruplex formation (59) and potentially reducing splicing efficiency.

[0292] Coupled splicing and translation of RNA quadruplexes in gene expression control RNA quadruplexes were predicted in ~8.0% of the 5'UTR and have been proposed to act as a universal translation inhibitor (60, 61). INS Intron 1 was weakly spliced ​​and was U2AF35-dependent (7), and a significant portion of the intron 1-containing transcript was exported from the nucleus (23). This suggests that the CD1-formed RNA G-quadruplex, containing a triamino acid uORF specific to the human subfamily, can influence the translation of these mRNAs (7). This uORF significantly inhibited proinsulin expression and was located just a few base pairs downstream, suggesting the concept that the G-quadruplex can facilitate translation by isolating the uORF. Activity of the internal ribosome entry site requires a functional 2-quadruplex (54).

[0293] Table 1. Predicted density of RNA G-quadruplexes in reporter gene constructs

[0294] a As described in (78), the length of the non-overlapping quadchain sequence and its G score are calculated.

[0295] Antisense strategies for dependency in splice site selection In addition to the standard mRNA isoform 4, isoforms 2, 3, and 6 have been found in expression sequence tag databases derived from cDNA libraries from insulin-producing tissues. Figure 1 (B)(21). This indicates that the hidden splicing sites generated by the reporter construct are recognized in vivo, and that our haplotype-dependent reporter system accurately reproduces these events in cultured cells, regardless of whether the cells express endogenous insulin. In addition to inhibiting transcripts that retain intron 1, optimal SSO increases the utilization of the hidden 3'ss of exon 3 (B)(21 ... Figure 2This undesirable effect can be explained by the synergistic splicing of adjacent exons and introns, previously observed both for individual genes and globally (63-67). Furthermore, G-rich downstream transcription start sites have been associated with RNA polymerase II pause sites (68). While the two strongly competing 3'ss of intron 2 may respond to nonspecific signals affecting RNA folding (… Figure 3 (Table 2), but it may alleviate the observed dependence and reduce the activation of hidden 3'ss by using SSO combination at the splice site of the linker and examine its synergistic or antagonistic effects, thus benefiting from the use of whole-genome constructs as opposed to small genes.

[0296] Multifunctional antisense oligonucleotides to reduce INS Retention of intron 1 Since its initial use, 2'-O-methyl-phosphothiophosphate SSO (69) has been successfully employed in numerous in vitro and in vivo applications (9, 10, 70). To further fine-tune the expression of mRNA isoforms, optimized SSOs can be designed to bind suitable trans-acting splicing factors to their target sequences (11, 71). A prime candidate for this system is U2AF35, as intron 1 is weak due to the relaxation of 3'ss in higher primates and is... rs689 The A allele at this location is further weakened, making this intron highly U2AF35 dependent. Figure 3 (7). In addition to U2AF35, future dual-function or multi-function antisense strategies can adopt the previously shown effects. INS The binding plateau of splicing factors (e.g., Tra2β or SRSF3) of intron 1 and exon 2 splicing (7). Tra2β may bind to the SSO6 target, which forms a predicted stable hairpin structure with an effective GAA splicing enhancer in the terminal loop ( Figure 3 B). SRSF3 is required for the inhibition of the cryptic 3'ss of intron 2 (7) and binds to a pyrimidine-rich sequence with a shared sequence (A / U)C(A / U)(A / U)C (72). The CAUC motif (73) that interacts with the RNA recognition motif of SRSF3 is located just upstream of the cryptic 3'ss.

[0297] Normalizing the level of intron retention in human genetic diseases These results provide insights into the use of non-genetic methods to compensate for lower splicing efficiency and lower [hypertrophicity] in haplotypes derived from susceptible type 1 diabetes. INS An opportunity to express oneself.

[0298] Common variations such as rs689This largely contributes to the heritability of complex traits (including autoimmune diseases) (74), but their functional and structural consequences remain largely unknown. If optimized... INS SSO can be safely and effectively introduced into the developing thymus, a pathway that could provide a novel preventative approach to promote tolerance to major autoantigens in type 1 diabetes. For such an intervention, the most prominent candidates are HLA and... INS Mothers of affected children who are homozygous for the disease susceptibility allele at both loci. Such genotypes are associated with a very high risk of disease in siblings (75). In addition to initial prevention of type 1 diabetes, future SSO-based therapies may be applied to patients with significant residual β-cell activity at diagnosis and those eligible for β-cell transplantation, who could benefit from intron-mediated enhancement of proinsulin expression from transplanted cells. It is also envisioned that this modality of therapy could be used in other diabetic patients by targeting multiple splicing regulatory motifs with multifunctional SSOs through intron splicing and more significant enhancement of proinsulin expression. SSOs are effective in thymic epithelial cells and 13-cells, providing a more natural system for testing their effects on exogenous and endogenous proinsulin expression. Finally, similar antisense strategies could help reduce the pervasive intron retention in cancer cells caused by somatic mutations in splicing factor genes, as illustrated by specific substitutions in the zinc finger domain of U2AF35 in myeloproliferative disorders (76).

[0299] Reduce intron retention in malignant cells RNAseq data from replicated, polyA-selected samples were used to select a set of 146 intron sequences preferentially retained in U2AF-deficient HEK293 cells, and each intron retention event was then examined in a genome browser. These sequences were masked for duplication using a sensitive version of RepeatMasker (available at http: / / www.repeatmasker.org / cgi-bin / WEBRepeatMasker). This was done to reduce... INS The optimal antisense targets conserved by intron 1 [Kralovicova J et al., (2014). Nucleic Acids Res doi: 10.1093 / nar / gku507, published on June 17, 2014] overlap with intron splicing regulatory elements conserved in mammals [Yeo GW ​​et al., (2007). PLoS Genet 3: e85], including CCCAG, AGGCC (Kralovicova et al., 2014). Figure 4Antisense targets and independently derived intron splicing regulatory motifs containing these short pentamer to heptamer motifs [Voelker RB, & Berglund JA (2007). Genome Res 17: 1023-1033] were selected to increase the chances of oligonucleotides interacting with these targets to influence RNA processing. Target sequences underwent conventional antisense oligonucleotide design, including removal of sequences containing C-runs to avoid G-quadruplex formation. Both 5' and 3' splice sites, polypyrimidine sequences, branching sites, and the vicinity of superbranched regions were also avoided. This selection yielded a set of 388 compounds (Table 3), covering ~15% of the total length of U2AF-sensitive introns and representing ~0.001% of all intron sequences. Thus, this set of oligonucleotide target regions was enriched for splicing repressive sequences in U2-dependent introns that do not receive sufficient help from cofactors in malignant cells that maintain the U2 pathway with mutations or deletions.

[0300] Insulin-related sequences Candidate SSO sequences Note: Use " "The candidates for the tag are in" Figure 4 Winning oligomers discussed in CD5 RNA form - CUGCAGAGCUGGGGCCUG (SEQ ID NO: 1) DNA form - CTGCAGAGCTGGGGCCTG (SEQ ID NO: 2) Combined with caggccccagcucugcag (SEQ ID NO: 3) SSO21 RNA form - UGCAGAGCUGGGGCCU (SEQ ID NO: 4) DNA form- TGCAGAGCTGGGGCCT (SEQ ID NO: 5) Combined with aggccccagcucugca (SEQ ID NO: 6) SSO21-2r RNA form - GCAGAGCUGGGGCCUG (SEQ ID NO: 7) DNA form - GCAGAGCTGGGGCCTG (SEQ ID NO: 8) Combined with caggccccagcucugc (SEQ ID NO: 9) SSO21-3r RNA form - CAGAGCUGGGGCCUGG (SEQ ID NO: 10) DNA form - CAGAGCTGGGGCCTGG (SEQ ID NO: 11) Combined with ccaggccccagcucug (SEQ ID NO: 12) SSO21-4r RNA form - AGAGCUGGGGCCUGGG (SEQ ID NO: 13) DNA form - AGAGCTGGGGCCTGGG (SEQ ID NO: 14) Combined with cccaggccccagcucu (SEQ ID NO: 15) SSO21-5r RNA form - GAGCUGGGGCCUGGGG (SEQ ID NO: 16) DNA form - GAGCTGGGGCCTGGGG (SEQ ID NO: 17) Combined with ccccaggccccagcuc (SEQ ID NO: 18) SSO21-6r RNA form - AGCUGGGGCCUGGGGU (SEQ ID NO: 19) DNA form - AGCTGGGGCCTGGGGT (SEQ ID NO: 20) Combined with accccaggccccagcu (SEQ ID NO: 21) SSO21-7r RNA form - GCUGGGGCCUGGGGUC (SEQ ID NO: 22) DNA form - GCTGGGGCCTGGGGTC (SEQ ID NO: 23) Combined with gaccccaggccccagc (SEQ ID NO: 24) SSO21-8r RNA form - CUGGGGCCUGGGGUCC (SEQ ID NO: 25) DNA form - CTGGGGCCTGGGGTCC (SEQ ID NO: 26) Combined with ggaccccaggccccag (SEQ ID NO: 27) SSO21-9r RNA form - UGGGGCCUGGGGUCCA (SEQ ID NO: 28) DNA form - TGGGGCCTGGGGTCCA (SEQ ID NO: 29) Combined with uggaccccaggcccca (SEQ ID NO: 30) SSO21-10r RNA form - GGGGCCUGGGGUCCAG (SEQ ID NO: 31) DNA form - GGGGCCTGGGGTCCAG (SEQ ID NO: 32) Combined with cuggaccccaggcccc (SEQ ID NO: 33) SSO21-14f RNA form - CUGCAGAGCUGGGGCC (SEQ ID NO: 34) DNA form - CTGCAGAGCTGGGGCC (SEQ ID NO: 35) Combined with ggccccagcucugcag (SEQ ID NO: 36) SSO21-15f RNA form - GCUGCAGAGCUGGGGC (SEQ ID NO: 37) DNA form - GCTGCAGAGCTGGGGC (SEQ ID NO: 38) Combined with gccccagcucugcagc (SEQ ID NO: 39) SSO21-16f RNA form-UGCUGCAGAGCUGGGG (SEQ ID NO: 40) DNA form - TGCTGCAGAGCTGGGG (SEQ ID NO: 41) Combined with ccccagcucugcagca (SEQ ID NO: 42) SSO21-17f RNA form - CUGCUGCAGAGCUGGG (SEQ ID NO: 43) DNA form - CTGCTGCAGAGCTGGG (SEQ ID NO: 44) Combined with cccagcucugcagcag (SEQ ID NO: 45) The sequence of the target region of the pre-mRNA transcript (e.g., for binding SSO). cuggaccccaggccccagcucugcagcag (SEQ ID NO: 46) Table 2

[0301] 1 The sequence of deleted segments (del) is in Figure 2 The middle shows Cancer-related sequences The sequences in Table 3 below may also have thymine residues (e.g., in DNA form) that replace uracil residues. Each sequence in the table below can be an embodiment of the polynucleotide polymer of the present invention. Each gene or ORF mentioned under “Compound Name” in Table 3 below may contain a gene target for correcting intron retention.

[0302] Table 3

[0303] While preferred embodiments of the invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Many variations, modifications, and substitutions will occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in the practice of the invention. The scope of the invention is intended to be defined by the following claims, and is thereby intended to cover the methods and structures within the scope of these claims and their equivalents.

[0304] The specific methods, compositions, and kits described herein may vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting, as the scope of the invention will be limited only by the appended claims.

[0305] When values ​​are provided, it is understood that each value may be expressed as “about” a specific value or range. “About” may also include an exact quantity. For example, “about 5 μL” may mean “about 5 μL” or “5 μL”. Typically, the term “about” may include a quantity expected to be within 10% of the stated value.

[0306] The chapter titles used in this article are for organizational purposes only and should not be construed as limiting the subject matter described.

[0307] Unless otherwise defined, all technical and scientific terms used herein may have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. The description herein is merely exemplary and illustrative and does not limit any of the claimed subject matter. In this application, the use of the singular may include the plural unless otherwise specified. Unless the context clearly requires, the singular forms “a,” “an,” and “the” as used in this specification and the appended claims may include plural indicators. In this application, the use of “or” may mean “and / or” unless otherwise specified. Furthermore, the use of the term “comprising” and other forms (e.g., “including,” “comprises,” and “included”) is not restrictive.

[0308] By incorporating references All publications, patents and patent applications mentioned in this specification are incorporated herein by reference in their entirety, to the extent that each individual publication, patent or patent application is specifically and individually indicated to be incorporated by reference.

[0309] 1. Smith, CW and Valcarcel, J. (2000) Alternative pre-mRNA splicing: the logic of combinatorial control. Trends Biochem. Sci. ,25, 381–388. 2. Wahl, M.C., Will, C.L. and Luhrmann, R. (2009) The spliceosome: design principles of a dynamic RNP machine. Cell ,136, 701–718. 3. Callis, J., Fromm, M. and Walbot, V. (1987) Introns increase gene expression in cultured maize cells. Genes Dev. ,1, 1183–1200. 4. Buchman, A.R. and Berg, P. (1988) Comparison of intron-dependent and intron-independent gene expression. Mol. Cell. Biol. ,8, 4395–4405. 5. Le Hir, H., Nott, A. and Moore, M.J. (2003) How introns influence and enhance eukaryotic gene expression. Trends Biochem. Sci. ,28, 215–220. 6. Cazzola, M. and Skoda, R.C. (2000) Translational pathophysiology: a novel molecular mechanism of human disease. Blood ,95, 3280–3288. 7. Kralovicova, J. and Vorechovsky, I. (2010) Allele-dependent recognition of the 3' splice site of INS intron 1. Hum. Genet. ,128, 383–400. 8. Kole, R., Krainer, A.R. and Altman, S. (2012) RNA therapeutics: beyond RNA interference and antisense oligonucleotides. Nat. Rev. Drug Discov , 11, 125–140. 9. Aartsma-Rus, A. and van Ommen, G.J. (2007) Antisense-mediated exon skipping: a versatile tool with therapeutic and research applications. RNA , 13, 1609–1624. 10. Goyenvalle, A., Seto, J.T., Davies, K.E. and Chamberlain, J. (2012) Therapeutic approaches to muscular dystrophy. Hum. Mol. Genet. , 20, R69–78. 11. Hua, Y., Sahashi, K., Hung, G., Rigo, F., Passini, M.A., Bennett, C.F. and Krainer, A.R. (2010) Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes Dev. , 24, 1634–1644. 12. Du, L., Pollard, J.M. and Gatti, R.A. (2007) Correction of prototypic ATM splicing mutations and aberrant ATM function with antisense morpholino oligonucleotides. Proc. Natl Acad. Sci. USA , 104, 6007–6012. 13. Kralovicova, J., Hwang, G., Asplund, A.C., Churbanov, A., Smith, C.I. and Vorechovsky, I. (2011) Compensatory signals associated with the activation of human GC 5' splice sites. Nucleic Acids Res. , 39, 7077–7091. 14. Buratti, E., Chivers, M.C., Hwang, G. and Vorechovsky, I. (2011) DBASS3 and DBASS5: databases of aberrant 3' and 5' splice sites in human disease genes. Nucleic Acids Res. , 39, D86–D91. 15. Davies, J.L., Kawaguchi, Y., Bennett, S.T., Copeman, J.B., Cordell, H.J., Pritchard, L.E., Reed, P.W., Gough, S.C., Jenkins, S.C., Palmer, S.M. et al. (1994) A genome-wide search for human type 1 diabetes susceptibility genes. Nature , 371, 130–136. 16. Barratt, B.J., Payne, F., Lowe, C.E., Hermann, R., Healy, B.C., Harold, D., Concannon, P., Gharani, N., McCarthy, M.I., Olavesen, M.G. et al. (2004) Remapping the insulin gene / IDDM2 locus in type 1 diabetes. Diabetes , 53, 1884–1889. 17. Zhang, L., Nakayama, M. and Eisenbarth, G.S. (2008) Insulin as an autoantigen in NOD / human diabetes. Curr. Opin. Immunol. , 20, 111–118. 18. Vafiadis, P., Bennett, S.T., Todd, J.A., Nadeau, J., Grabs, R., Goodyer, C.G., Wickramasinghe, S., Colle, E. and Polychronakos, C. (1997) Insulin expression in human thymus is modulated by INS VNTR alleles at the IDDM2 locus. Nat. Genet. , 15, 289–292. 19. Pugliese, A., Zeller, M., Fernandez, A. Jr, Zalcberg, L.J., Bartlett, R.J., Ricordi, C., Pietropaolo, M., Eisenbarth, G.S., Bennett, S.T. and Patel, D.D. (1997) The insulin gene is transcribed in the human thymus and transcription levels correlated with allelic variation at the INS VNTR-IDDM2 susceptibility locus for type 1 diabetes. Nat. Genet. , 15, 293–297. 20. Stead, J.D., Hurles, M.E. and Jeffreys, A.J. (2003) Global haplotype diversity in the human insulin gene region. Genome Res. , 13, 2101–2111. 21. Kralovicova, J., Gaunt, T.R., Rodriguez, S., Wood, P.J., Day, I.N.M. and Vorechovsky, I. (2006) Variants in the human insulin gene that affect pre-mRNA splicing: is -23 Hph I a functional single nucleotide polymorphism at IDDM2 ? Diabetes , 55, 260–264. 22. Ruskin, B., Zamore, P.D. and Green, M.R. (1988) A factor, U2AF, is required for U2 snRNP binding and splicing complex assembly. Cell , 52, 207–219. 23. Wang, J., Shen, L., Najafi, H., Kolberg, J., Matschinsky, F.M., Urdea, M. and German, M. (1997) Regulation of insulin preRNA splicing by glucose. Proc. Natl Acad. Sci. USA , 94, 4360–4365. 24. Kralovicova, J., Haixin, L. and Vorechovsky, I. (2006) Phenotypic consequences of branchpoint substitutions. Hum. Mutat. , 27, 803–813. 25. Pacheco, T.R., Gomes, A.Q., Barbosa-Morais, N.L., Benes, V., Ansorge, W., Wollerton, M., Smith, C.W., Valcarcel, J. and Carmo-Fonseca, M. (2004) Diversity of vertebrate splicing factor U2AF35: identification of alternatively spliced U2AF1 mRNAS. J. Biol. Chem. , 279, 27039–27049. 26. Booy, E.P., Meier, M., Okun, N., Novakowski, S.K., Xiong, S., Stetefeld, J. and McKenna, S.A. (2012) The RNA helicase RHAU (DHX36) unwinds a G4-quadruplex in human telomerase RNA and promotes the formation of the P1 helix template boundary. Nucleic Acids Res. , 40, 4110–4124. 27. Lei, H. and Vorechovsky, I. (2005) Identification of splicing silencers and enhancers in sense Alu s: a role for pseudo-acceptors in splice site repression. Mol. Cell. Biol. , 25, 6912–6920. 28. Buratti, E., Muro, A.F., Giombi, M., Gherbassi, D., Iaconcig, A. and Baralle, F.E. (2004) RNA folding affects the recruitment of SR proteins by mouse and human polypurinic enhancer elements in the fibronectin EDA exon. Mol. Cell. Biol.,24, 1387–1400. 29. Nussinov, R. (1988) Conserved quartets near 5' intron junctions in primate nuclear pre-mRNA. J. Theor. Biol. ,133, 73–84. 30. Sirand-Pugnet, P., Durosay, P., Brody, E. and Marie, J. (1995) An intronic (A / U)GGG repeat enhances the splicing of an alternative intron of the chicken beta-tropomyosin pre-mRNA. Nucleic Acids Res. ,23, 3501–3507. 31. Kralovicova, J. and Vorechovsky, I. (2006) Position-dependent repression and promotion of DQB1 intron 3 splicing by GGGG motifs. J. Immunol. ,176, 2381– 2388. 32. Neidle, S. and Balasubramanian, S. (2006) Quadruplex Nucleic Acids . RSC Biomolecular Sciences, Cambridge, UK. 33. Bugaut, A. and Balasubramanian, S. (2012) 5'-UTR RNA G-quadruplexes: translation regulation and targeting. Nucleic Acids Res. ,40, 4727–4741. 34. Millevoi, S., Moine, H. and Vagner, S. (2012) G-quadruplexes in RNA biology. Wiley Interdiscip. Rev. RNA ,3, 495–507. 35. Gomez, D., Lemarteleur, T., Lacroix, L., Mailliet, P., Mergny, J.L. and Riou, J.F. (2004) Telomerase downregulation induced by the G-quadruplex ligand 12459 in A549 cells is mediated by hTERT RNA alternative splicing. Nucleic Acids Res. , 32, 371–379. 36. Didiot, M.C., Tian, Z., Schaeffer, C., Subramanian, M., Mandel, J.L. and Moine, H. (2008) The G-quartet containing FMRP binding site in FMR1 mRNA is a potent exonic splicing enhancer. Nucleic Acids Res. , 36, 4902–4912. 37. Hai, Y., Cao, W., Liu, G., Hong, S.P., Elela, S.A., Klinck, R., Chu, J. and Xie, J. (2008) A G-tract element in apoptotic agents-induced alternative splicing. Nucleic Acids Res. , 36, 3320–3331. 38. Marcel, V., Tran, P.L., Sagne, C., Martel-Planche, G., Vaslin, L., Teulade-Fichou, M.P., Hall, J., Mergny, J.L., Hainaut, P. and Van Dyck, E. (2011) G-quadruplex structures in TP53 intron 3: role in alternative splicing and in production of p53 mRNA isoforms. Carcinogenesis , 32, 271–278. 39. Melko, M., Douguet, D., Bensaid, M., Zongaro, S., Verheggen, C., Gecz, J. and Bardoni, B. (2011) Functional characterization of the AFF (AF4 / FMR2) family of RNA-binding proteins: insights into the molecular pathology of FRAXE intellectual disability. Hum. Mol. Genet. , 20, 1873–1885. 40. Balagurumoorthy, P., Brahmachari, S.K., Mohanty, D., Bansal, M. and Sasisekharan, V. (1992) Hairpin and parallel quartet structures for telomeric sequences. Nucleic Acids Res. , 20, 4061–4067. 41. Derecka, K., Balkwill, G.D., Garner, T.P., Hodgman, C., Flint, A.P. and Searle, M.S. (2010) Occurrence of a quadruplex motif in a unique insert within exon C of the bovine estrogen receptor alpha gene (ESR1). Biochemistry (Mosc.). 49, 7625–7633. 42. Balkwill, G.D., Derecka, K., Garner, T.P., Hodgman, C., Flint, A.P. and Searle, M.S. (2009) Repression of translation of human estrogen receptor alpha by G-quadruplex formation. Biochemistry (Mosc.). 48, 11487–11495. 43. Garner, T.P., Williams, H.E., Gluszyk, K.I., Roe, S., Oldham, N.J., Stevens, M.F., Moses, J.E. and Searle, M.S. (2009) Selectivity of small molecule ligands for parallel and anti-parallel DNA G-quadruplex structures. Org. Biomol. Chem. , 7, 4194–4200. 44. Thisted, T., Lyakhov, D.L. and Liebhaber, S.A. (2001) Optimized RNA targets of two closely related triple KH domain proteins, heterogeneous nuclear ribonucleoprotein K and alphaCP-2KL, suggest distinct modes of RNA recognition. J. Biol. Chem. , 276, 17484–17496. 45. Creacy, S.D., Routh, E.D., Iwamoto, F., Nagamine, Y., Akman, S.A. and Vaughn, J.P. (2008) G4 resolvase 1 binds both DNA and RNA tetramolecular quadruplex with high affinity and is the major source of tetramolecular quadruplex G4-DNA and G4-RNA resolving activity in HeLa cell lysates. J. Biol. Chem. , 283, 34626–34634. 46. Pastor, T. and Pagani F. (2011) Interaction of hnRNPA1 / A2 and DAZAP1 with an Alu-derived intronic splicing enhancer regulates ATM aberrant splicing. PLoS One , 6, e23349. 47. Iwamoto, F., Stadler, M., Chalupnikova, K., Oakeley, E. and Nagamine, Y. (2008) Transcription-dependent nucleolar cap localization and possible nuclear function of DExH RNA helicase RHAU. Exp. Cell Res. , 314, 1378–1391. 48. Singh, N.N., Hollinger, K., Bhattacharya, D. and Singh, R.N. (2010) An antisense microwalk reveals critical role of an intronic position linked to a unique long-distance interaction in pre-mRNA splicing. RNA , 16, 1167–1181. 49. Wang, Y., Xiao, X., Zhang, J., Choudhury, R., Robertson, A., Li, K., Ma, M., Burge, C.B. and Wang, Z. (2012) A complex network of factors with overlapping affinities represses splicing through intronic elements. Nat. Struct. Mol. Biol. , 20, 36–45. 50. Wang, Y., Ma, M., Xiao, X. and Wang, Z. (2012) Intronic splicing enhancers, cognate splicing factors and context-dependent regulation rules. Nat. Struct. Mol. Biol. ,19, 1044–1052. 51.Ke, S., Shang, S., Kalachikov, S.M., Morozova, I., Yu, L., Russo, J.J., Ju, J. and Chasin, L.A. (2011) Quantitative evaluation of all hexamers as exonic splicing elements. Genome Res. ,21, doi 10.1101 / gr.119628.119110. 52.Culler, S.J., Hoff, K.G., Voelker, R.B., Berglund, J.A. and Smolke, C.D. (2010) Functional selection and systematic analysis of intronic splicing elements identify active sequence motifs and associated splicing factors. Nucleic Acids Res. ,38, 5152–5165. 53.Collie, G.W. and Parkinson, G.N. (2011) The application of DNA and RNA G-quadruplexes to therapeutic medicines. Chem. Soc. Rev. , doi 10.1039 / c1cs15067g. 54.Morris, M.J., Negishi, Y., Pazsint, C., Schonhoft, J.D. and Basu, S. (2010) An RNA G-quadruplex is essential for cap-independent translation initiation in human VEGF IRES. J. Am. Chem. Soc. ,132, 17831–17839. 55.Wieland, M. and Hartig, J.S. (2007) RNA quadruplex-based modulation of gene expression. Chem. Biol. ,14, 757–763. 57. Zhang, A.Y. and Balasubramanian, S. (2012) The kinetics and folding pathways of intramolecular g-quadruplex nucleic acids. J. Am. Chem. Soc. ,134, 19297– 19308. 58. Bugaut, A., Murat, P. and Balasubramanian, S. (2012) An RNA hairpin to g-quadruplex conformational transition. J. Am. Chem. Soc. ,134, 19953–19956. 59. Decorsiere, A., Cayrel, A., Vagner, S. and Millevoi, S. (2011) Essential role for the interaction between hnRNP H / F and a G quadruplex in maintaining p53 pre-mRNA 3’-end processing and function during DNA damage. Genes Dev. ,25, 220– 225. 60. Samatanga, B., Dominguez, C., Jelesarov, I. and Allain, F.H. (2013) The high kinetic stability of a G-quadruplex limits hnRNP F qRRM3 binding to G-tract RNA. Nucleic Acids Res. ,41, 2505–2516. 60. Lorenz, R., Bernhart, S.H., Qin, J., Honer Zu Siederdissen, C., Tanzer, A., Amman, F., Hofacker, I.L. and Stadler, P.F. (2013) 2D meets 4G: G-quadruplexes in RNA secondary structure prediction. IEEE / ACM Trans. Comput. Biol. Bioinform . 61. Beaudoin, J.D. and Perreault, J.P. (2010) 5'-UTR G-quadruplex structures acting as translational repressors. Nucleic Acids Res. , 38, 7022–7036. 62. Fred, R.G., Sandberg, M., Pelletier, J. and Welsh, N. (2011) The human insulin mRNA is partly translated via a cap- and eIF4A-independent mechanism. Biochem. Biophys. Res. Commun. , 412, 693–698. 63. Schwarze, U., Starman, B.J. and Byers, P.H. (1999) Redefinition of exon 7 in the COL1A1 gene of type I collagen by an intron 8 splice-donor-site mutation in a form of osteogenesis imperfecta: influence of intron splice order on outcome of splice-site mutation. Am. J. Hum. Genet. , 65, 336–344. 64. Xing, Y., Resch, A. and Lee, C. (2004) The multiassembly problem: reconstructing multiple transcript isoforms from EST fragment mixtures. Genome Res. , 14, 426–441. 65. Fededa, J.P., Petrillo, E., Gelfand, M.S., Neverov, A.D., Kadener, S., Nogues, G., Pelisch, F., Baralle, F.E., Muro, A.F. and Kornblihtt, A.R. (2005) A polar mechanism coordinates different regions of alternative splicing within a single gene. Mol. Cell , 19, 393–404. 66. Emerick, M.C., Parmigiani, G. and Agnew, W.S. (2007) Multivariate analysis and visualization of splicing correlations in single-gene transcriptomes. BMC Bioinformatics , 8, 16. 67. Peng, T., Xue, C., Bi, J., Li, T., Wang, X., Zhang, X. and Li, Y. (2008) Functional importance of different patterns of correlation between adjacent cassette exons in human and mouse. BMC Genomics , 9, 191. 68. Eddy, J., Vallur, A.C., Varma, S., Liu, H., Reinhold, W.C., Pommier, Y. and Maizels, N. (2011) G4 motifs correlate with promoter-proximal transcriptional pausing in human genes. Nucleic Acids Res. , 39, 4975–4983. 69. Mayeda, A., Hayase, Y., Inoue, H., Ohtsuka, E. and Ohshima, Y. (1990) Surveying cis -acting sequences of pre-mRNA by adding antisense 2'-O-methyloligoribonucleotides to a splicing reaction. J. Biochem. , 108, 399–405. 70. Dominski, Z. and Kole, R. (1993) Restoration of correct splicing in thalassemic pre-mRNA by antisense oligonucleotides. Proc. Natl Acad. Sci. U.S.A. , 90, 8673–8677. 71. Baughan, T.D., Dickson, A., Osman, E.Y. and Lorson, C.L. (2009) Delivery of bifunctional RNAs that target an intronic repressor and increase SMN levels in an animal model of spinal muscular atrophy. Hum. Mol. Genet. , 18, 1600–1611. 72. Cavaloc, Y., Bourgeois, C.F., Kister, L. and Stevenin, J. (1999) The splicing factors 9G8 and SRp20 transactivate splicing through different and specific enhancers. RNA , 5, 468–483. 73. Hargous, Y., Hautbergue, G.M., Tintaru, A.M., Skrisovska, L., Golovanov, A.P., Stevenin, J., Lian, L.Y., Wilson, S.A. and Allain, F.H. (2006) Molecular basis of RNA recognition and TAP binding by the SR proteins SRp20 and 9G8. EMBO J. , 25, 5126–5137. 74. Hunt, K.A., Mistry, V., Bockett, N.A., Ahmad, T., Ban, M., Barker, J.N., Barrett, J.C., Blackburn, H., Brand, O., Burren, O. et al. (2013) Negligible impact of rare autoimmune-locus coding-region variants on missing heritability. Nature , 498, 232–235. 75. Aly, T.A., Ide, A., Jahromi, M.M., Barker, J.M., Fernando, M.S., Babu, S.R., Yu, L., Miao, D., Erlich, H.A., Fain, P.R. et al. (2006) Extreme genetic risk for type 1A diabetes. Proc. Natl Acad. Sci. U.S.A. , 103, 14074–14079. 76. Yoshida, K., Sanada, M., Shiraishi, Y., Nowak, D., Nagata, Y., Yamamoto, R., Sato, Y., Sato-Otsubo, A., Kon, A., Nagasaki, M. et al. (2011) Frequent pathway mutations of splicing machinery in myelodysplasia. Nature , 478, 64–69. 77.Pacheco, TR, Moita, LF, Gomes, AQ, Hacohen, N. and Carmo-Fonseca, M. (2006) RNA interference knockdown of hU2AF35 impairs cell cycleprogression and modulates alternative splicing of Cdc25 transcripts. Mol. Biol. Cell ,17, 4187– 4199. 78.Kikin, O., D_Antonio, L. and Bagga, PS (2006) QGRS Mapper: a web-based server for predicting G-quadruplexes in nucleotide sequences. Nucleic Acids Res. ,34, W676–W682. Preferred implementation schemes include: 1. A method for preventing or treating a disease in a subject, comprising correcting intron retention in a mature gene transcript, wherein the disease is induced by defective protein expression caused by intron retention in the gene transcript.

[0310] 2. The method according to Project 1, wherein correction of intron retention comprises applying a polynucleotide polymer configured to hybridize with the gene transcript.

[0311] 3. The method according to Project 1 or Project 2, wherein the correction of intron retention comprises applying a polynucleotide polymer configured to hybridize with the gene transcript and configured to interfere with one or more of the following: conformational changes of classical RNA structures (stem-loop), non-classical RNA structures (G quadruplexes), interactions with trans-acting factors, and the rate of RNA-protein complex formation.

[0312] 4. The method according to any one of the preceding items, wherein the polynucleic acid polymer is antisense for at least a portion of the target region containing an intron splicing regulatory element or a transcript thereof.

[0313] 5. The method according to any one of the preceding items, wherein the polynucleic acid polymer is antisense for at least a portion of the target region comprising SEQ ID NO: 46 or a sequence having at least 95% identity with SEQ ID NO: 46 or a transcript thereof.

[0314] 6. The method according to any one of the preceding items, wherein the polynucleic acid polymer is antisense for at least a portion of the target region comprising SEQ ID NO: 3 or a sequence having at least 95% identity with SEQ ID NO: 3 or a transcript thereof.

[0315] 7. The method according to any one of the preceding items, wherein the polynucleotide polymer is antisense for a target region comprising a sequence having at least 95% sequence identity with a sequence selected from the group consisting of: SEQ ID NO: 3; SEQ ID NO: 6; SEQ ID NO: 9; SEQ ID NO: 12; SEQ ID NO: 15; SEQ ID NO: 18; SEQ ID NO: 21; SEQ ID NO: 24; SEQ ID NO: 27; SEQ ID NO: 30; SEQ ID NO: 33; SEQ ID NO: 36; SEQ ID NO: 39; SEQ ID NO: 42; SEQ ID NO: 45 or combinations thereof.

[0316] 8. The method according to any one of items 1 to 4, wherein the polynucleotide polymer is antisense for regions comprising sequences or transcripts having at least 95% identity with sequences in the sequence set including SEQ ID NO: 47 to 434 or combinations thereof.

[0317] 9. The method according to any one of items 1 to 7, wherein the polynucleotide polymer comprises or is composed of a polynucleotide polymer sequence, the polynucleotide polymer sequence having at least 95% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof; and optionally wherein uracil nucleotides are replaced by thymine nucleotides.

[0318] 10. The method according to any one of items 1 to 4 or 8, wherein the polynucleotide polymer comprises or is composed of a polynucleotide polymer sequence having at least 95% identity with a sequence selected from the group consisting of any one of SEQ ID NO: 47 to 434 or combinations thereof; and optionally wherein uracil nucleotides are replaced by thymine nucleotides.

[0319] 11. The method according to any one of the foregoing items, wherein the length of the polynucleic acid polymer is about 10 to about 30 nucleotides.

[0320] 12. The method according to any one of the preceding items, wherein the polynucleic acid polymer is modified to increase its stability.

[0321] 13. The method according to any one of the preceding items, wherein the polynucleic acid polymer is bound to a protein or aptamer, wherein the protein is a splicing factor that enhances, inhibits, or regulates splicing and intron removal.

[0322] 14. The method according to any one of the preceding items, wherein the polynucleic acid polymer is conjugated or combined with a delivery vector suitable for delivering the polynucleic acid polymer to cells or tissues and / or delivering it to cells or tissues.

[0323] 15. The method according to any one of items 1 to 7, 9 or 11 to 14, wherein the gene transcript encodes proinsulin.

[0324] 16. The method according to any one of items 1 to 4, 8, or 10 to 14, wherein the gene transcript is transcribed from a gene or ORF, said gene or ORF being selected from any of the following genes or ORFs: ABCD4, ABCF3; ACADVL; ALKBH6; AP1G2; APEX1; ARFRP1; ATHL1; ATP1A3; ATP5D; ATP13A1; BAX; BDH2; BRD2; C1orf63; C1orf630; C1orf631; C1orf124; C2orf49; C8orf82; C16orf59; CAPRIN2; CASKIN2; CDCA7; CEP164; CEP170; CLCN7; CPNE1; CPSF3L; DCXR; DENND4B; DFFA; DIS3L2; DNAJB12; DPF1; DRG2; DSN1; EML3; EWSR1; EWSR10; FGFR4; FTSJ1; GBAP1GMPPA; GMPR2; GN PTG; GORASP1; GPATCH4; HGS; HMG20B; IFFO1ISYNA1; KRI1; LOC148413; LZTR1; MAN2C1; MAP4K2; MCOLN1; MDP1; MIB2; MITD1; MOK; MOV10; MRPL35; MTMR1 1; MUS81; NAPEPLD; NBEAL2; NDRG4NDUFB10; NFATC4; NFKBIB; NIT1; NKTR; NPRL2; NSUN5P1; NUDT22; PAN2; PDDC1; PDLIM4; PHF1; PIK3CD; PITPNM1; PPIL 2; PPP1R35; PPP4C; PQLC2; PRPF39; PSME2; PTPMT1; QARS; RAD52; RHOT2; RMND5B; RNF123; RPL10A; RPP21; RPS6KB2RUSC1; SCRN2; SCYL1; SFR1; SGSM3; S IRT7; SLC25A3; SLC30A7; SLC37A4; STK19; STX10; TCF25; TOMM40; TP53I3; TRIM41; TRPT1; TSTA3; TTC14; TTC140; TUBGCP6; U2AF1L4UCK1; UNC45A; VAM P1; VAMP10; VARS; VPS28; WDR24; WDR90; WRAP53; YDJC; YIPF3; ZCCHC8; ZCCHC18; ZFAND1; ZNF131; ZNF300; ZNF317; ZNF692; ZNF711; ZNRD1; ZWINT or combinations thereof.

[0325] 17. The method according to any one of items 1 to 7, 9 or 10 to 15, wherein the disease is diabetes.

[0326] 18. The method according to any one of items 1 to 4, 8, 10 to 14, or 16, wherein the disease is cancer.

[0327] 19. The method according to any one of the preceding items, wherein the method further comprises the step of determining, prior to treatment, whether the disease pathology is caused by intron retention in the gene transcript.

[0328] 20. A method for regulating intron splicing in a cell, comprising hybridizing a polynucleotide polymer with a region of pre-mRNA, wherein said region comprises or is composed of a region having at least 95% identity with SEQ ID NO: 46.

[0329] 21. A method for regulating intron splicing in a cell, comprising hybridizing a polynucleotide polymer with a region of pre-mRNA, wherein the region comprises or consists of a region having at least 95% identity with SEQ ID NO: 3.

[0330] 22. A method for regulating intron splicing in a cell, comprising hybridizing a polynucleotide polymer with a region of pre-mRNA, wherein the region comprises or consists of a sequence complementary to or composed of a sequence having at least 95% identity with any of the sequences comprising SEQ ID NO: 47 to 434 or combinations thereof.

[0331] 23. A polynucleic acid polymer that is antisense for a region comprising or consisting of a polynucleic acid polymer of SEQ ID NO: 46 or thereof, or for at least a portion of a region comprising a sequence having at least 95% sequence identity with or consisting of a polynucleic acid polymer of SEQ ID NO: 46.

[0332] 24. A polynucleic acid polymer that is antisense for a region comprising or consisting of a polynucleic acid polymer of SEQ ID NO: 3 or thereof, or for at least a portion of a region comprising a sequence having at least 95% sequence identity with or consisting of a polynucleic acid polymer of SEQ ID NO: 3.

[0333] 25. A polynucleic acid polymer, wherein at least a portion of a region of the polynucleic acid polymer is antisense, said region comprising or consisting of a sequence complementary to any of the sequence groups comprising or consisting of SEQ ID NO: 47 to 434 or combinations thereof; or optionally, at least a portion of a region of the polynucleic acid polymer comprising or consisting of a sequence having at least 95% sequence identity with or consisting of SEQ ID NO: 47 to 434 is antisense.

[0334] 26. A polynucleotide polymer comprising or consisting of a polynucleotide polymer sequence having at least 95% identity with a sequence selected from the group consisting of: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 10; SEQ ID NO: 11; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 25; SEQ ID NO: 26; SEQ ID NO: 28; SEQ ID NO: 29; SEQ ID NO: 31; SEQ ID NO: 32; SEQ ID NO: 34; SEQ ID NO: 35; SEQ ID NO: 37; SEQ ID NO: 38; SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 43; and SEQ ID NO: 44 or combinations thereof; and optionally wherein uracil nucleotides are replaced by thymine nucleotides.

[0335] 27. A polynucleotide polymer comprising or consisting of a polynucleotide polymer sequence having at least 95% identity with a sequence selected from the group consisting of any one of SEQ ID NO: 47 to 434 or combinations thereof; and optionally wherein uracil nucleotides are replaced by thymine nucleotides.

[0336] 28. The polynucleic acid polymer according to any one of items 23 to 27, wherein the polynucleic acid polymer is conjugated or combined with a delivery vector suitable for delivering the polynucleic acid polymer to cells.

[0337] 29. A carrier comprising any one of items 23 to 27 of the polynucleic acid polymer.

[0338] 30. A delivery vector comprising or incorporating any one of items 23 to 27 of a polynucleic acid polymer.

[0339] 31. A composition comprising any one of items 23 to 28, a polynucleic acid polymer, or a carrier according to item 29, or a delivery carrier according to item 30.

[0340] 32. The composition according to item 31 further comprises additional bioactive molecules.

[0341] 33. A method for selecting a subject for treatment, comprising determining whether the subject has a disease induced by defective protein expression caused by intron retention in a gene transcript, wherein, upon positive confirmation, the subject is selected for treatment with a polynucleic acid polymer according to any one of items 23 to 28, or a vector according to item 29, or a delivery vector according to item 30, or a composition according to item 31 or 32; and optionally, the subject is treated.

[0342] 34. The use of antisense polynucleotide polymers to normalize gene expression by correcting intron retention in cancer cells.

[0343] 35. The method according to any one of the preceding items, wherein the gene transcript is an intron splicing regulatory element.

[0344] 36. The method according to any one of the preceding items, wherein the intron splicing adjustment element is located between two G quadrupoles.

[0345] 37. The method according to any one of the preceding items, wherein the intron splicing adjustment element comprises a first CCC motif.

[0346] 38. The method of item 37, wherein the intron splicing modulator further comprises a second CCC motif.

[0347] 39. The method according to any one of the preceding items, wherein the intron splicing adjustment element further comprises the CCCAG or AGGCC motif.

[0348] 40. The method according to any one of the preceding items, wherein the intron splicing modulator does not form a G-quadruplex.

[0349] 41. The method according to any one of the preceding items, wherein the polynucleotide polymer specifically hybridizes with the gene transcript.

[0350] 42. A pharmaceutical composition comprising: A polynucleotide polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the target sequence is located between two G quadruplexes, and wherein the polynucleotide polymer is capable of inducing the cleavage of the retained introns from the partially processed mRNA transcript; and Pharmaceutically acceptable excipients and / or delivery carriers.

[0351] 43. The pharmaceutical composition of item

[0014] , wherein the polynucleic acid polymer hybridizes with the retained intron of the partially processed mRNA transcript.

[0352] 44. A pharmaceutical composition comprising: A polynucleotide polymer hybridizes with a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the polynucleotide polymer hybridizes with an intron splicing regulatory element of the partially processed mRNA transcript, wherein the intron splicing regulatory element contains a first CCC motif, and wherein the polynucleotide polymer is capable of inducing the retained introns to be cleaved from the partially processed mRNA transcript; and Pharmaceutically acceptable excipients and / or delivery carriers.

[0353] 45. The pharmaceutical composition of item

[0014] , wherein the intron splicing regulation element further comprises a second CCC motif.

[0354] 46. ​​The pharmaceutical composition of item

[0015] , wherein the first CCC motif is about 3 or more nucleotide bases away from the second CCC motif.

[0355] 47. The pharmaceutical composition of any one of items

[0014] -

[0016] , wherein the polynucleic acid polymer hybridizes with an intron splicing regulatory element comprising a CCCAG or AGGCC motif.

[0356] 48. A pharmaceutical composition comprising: A polynucleotide polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the polynucleotide polymer hybridizes to a binding motif of the partially processed mRNA transcript, wherein the binding motif does not form a G-quadruplex, and wherein the polynucleotide polymer is capable of inducing the retained introns to be cleaved from the partially processed mRNA transcript; and Pharmaceutically acceptable excipients and / or delivery carriers.

[0357] 49. The pharmaceutical composition of any one of items

[0014] -

[0016] , wherein the polynucleic acid polymer comprises pyridine nucleotides at the 3' end and / or at the 5' end.

[0358] 50. The pharmaceutical composition of any one of items

[0014] -

[0017] , wherein the polynucleotide polymer comprises two consecutive pyridine residues at the 3' end position and / or at the 5' end position.

[0359] 51. A pharmaceutical composition comprising: A polynucleotide polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the polynucleotide polymer hybridizes to a binding motif of the partially processed mRNA transcript, and wherein the binding motif forms a hairpin structure, wherein the polynucleotide polymer is capable of inducing the retained introns to be cleaved from the partially processed mRNA transcript; and Pharmaceutically acceptable excipients and / or delivery carriers.

[0360] 52. A pharmaceutical composition comprising: A polynucleotide polymer that hybridizes to a target sequence of a partially processed mRNA transcript encoding a protein and containing retained introns, wherein the polynucleotide polymer induces the retained introns to be cleaved from the partially processed mRNA transcript; and Pharmaceutically acceptable excipients and / or delivery carriers.

[0361] 53. The pharmaceutical composition of item

[0018] , wherein the polynucleic acid polymer is also capable of destabilizing the hairpin structure.

[0362] 54. The pharmaceutical composition according to any one of items

[0014] -53, wherein the delivery carrier comprises a cell-penetrating peptide or peptide-based nanoparticles.

[0363] 55. The pharmaceutical composition of any one of items

[0014] -

[0020] , wherein the delivery carrier is compounded with the polynucleic acid polymer by ion bonding.

[0364] 56. The pharmaceutical composition of any one of items

[0014] -

[0020] , wherein the polynucleotide polymer has a length of about 10 to about 50, about 10 to about 45, about 10 to about 40, about 10 to about 30, about 10 to about 25, or about 10 to about 20 nucleotides.

[0365] 57. The pharmaceutical composition of any one of items

[0014] -

[0020] , wherein the sequence of the polynucleic acid polymer is at least 60%, 70%, 80%, 90% or 95% complementary or 100% complementary to the target sequence of the partially processed mRNA transcript.

[0366] 58. The pharmaceutical composition of any one of items

[0014] -

[0021] , wherein the sequence of the polynucleotide polymer has four or fewer, three or fewer, two or fewer, or one or fewer mismatches with the target sequence of the partially processed mRNA transcript.

[0367] 59. The pharmaceutical composition of any one of items

[0014] -

[0021] , wherein the polynucleic acid polymer is modified at the nucleoside moiety or at the phosphate moiety.

[0368] 60. The pharmaceutical composition of any one of items

[0014] -

[0021] , wherein the polynucleic acid polymer comprises one or more artificial nucleotide bases.

[0369] 61. The pharmaceutical composition of item

[0021] or

[0022] , wherein the one or more artificial nucleotide bases comprise locked nucleic acids (LNA), ethylene nucleic acids (ENA), peptide nucleic acids (PNA), 1',5'-dehydrated hexadiol nucleic acids (HNA), morpholine nucleotides, methylphosphonate nucleotides, mercaptophosphonate nucleotides, or 2'-fluoroN3-P5'-phosphamide.

[0370] 62. The pharmaceutical composition of item

[0022] , wherein the polynucleotide polymer is modified at the 2' hydroxyl group of the ribose portion of the nucleoside moiety of the polynucleotide polymer.

[0371] 63. The pharmaceutical composition of item

[0022] , wherein the modification at the 2' hydroxyl group is by means of a 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T0-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA) moiety.

[0372] 64. The pharmaceutical composition of item

[0022] , wherein a methyl group is added to the 2' hydroxyl group of the ribose moiety to produce a 2'-O-methylribose moiety.

[0373] 65. The pharmaceutical composition of item

[0022] , wherein a methoxyethyl group is added to the 2' hydroxyl group of the ribose moiety to produce a 2'-O-methoxyethyl ribose moiety.

[0374] 66. The pharmaceutical composition of item

[0022] , wherein the modification at the 2' hydroxyl group is linked to the 4' carbon via a methylene group.

[0375] 67. The pharmaceutical composition of any one of items

[0021] -

[0022] , wherein the ribose ring is replaced by a six-membered morpholine ring to produce a morpholine artificial nucleotide analog.

[0376] 68. The pharmaceutical composition of any one of items

[0021] -

[0022] , wherein the phosphate backbone is partially replaced by oligoglycine-like components to produce peptide nucleic acid (PNA).

[0377] 69. The pharmaceutical composition of any one of items

[0021] -

[0022] , wherein the phosphate backbone is modified by a mercapto or methyl group.

[0378] 70. The pharmaceutical composition of any one of items

[0021] -

[0022] , wherein the 5' end, the 3' end, or a combination thereof is modified.

[0379] 71. The pharmaceutical composition of any one of items

[0021] -

[0022] , wherein the modification protects the polynucleic acid polymer from endogenous nucleases in the subject.

[0380] 72. The pharmaceutical composition of any one of items

[0021] -

[0022] , wherein the modified polynucleic acid polymer does not induce RNase H to cleave RNA or its ability to induce RNase H to cleave RNA is reduced.

[0381] 73. The composition of any one of items

[0021] -

[0022] , wherein the polynucleic acid polymer is modified to improve its stability.

[0382] 74. The pharmaceutical composition of any one of items

[0014] -

[0022] , wherein the polynucleotide polymer hybridizes with an mRNA transcript, the mRNA transcript having at least 80%, 85%, 90% or 95% or 100% sequence identity with at least 13 consecutive bases of SEQ ID NO: 46.

[0383] 75. The pharmaceutical composition of any one of items

[0014] -

[0022] , wherein the polynucleic acid polymer hybridizes with an mRNA transcript comprising at least 10 consecutive bases of SEQ ID NO: 46.

[0384] 76. A pharmaceutical composition of any one of items

[0014] -

[0022] , wherein the polynucleotide polymer hybridizes with an mRNA transcript, the mRNA transcript having at least 63%, 70%, 80%, 90% or 95% sequence identity with a sequence selected from SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42, SEQ ID NO: 45 or combinations thereof.

[0385] 77. The pharmaceutical composition of any one of items

[0014] -

[0022] , wherein the polynucleotide polymer hybridizes with an mRNA transcript, the mRNA transcript having at least 55%, 60%, 70%, 80%, 90% or 95% sequence identity with SEQ ID NO: 3.

[0386] 78. The pharmaceutical composition of any one of items

[0014] -

[0022] , wherein the polynucleic acid polymer is combined with a polymer selected from SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 43, and SEQ ID NO: 44 or combinations thereof have a sequence identity of at least 63%, 70%, 80%, 90%, 95%, or 100%, and optionally wherein uracil nucleotides are replaced by thymine nucleotides.

[0387] 79. The pharmaceutical composition of any one of items

[0014] -

[0022] , wherein the polynucleotide polymer has at least 55%, 60%, 70%, 80%, 90% or 95% or 100% sequence identity with a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2 or a combination thereof, and optionally wherein uracil nucleotides are replaced by thymine nucleotides.

[0388] 80. The pharmaceutical composition of any one of items

[0014] -

[0022] , wherein the polynucleotide polymer hybridizes with an mRNA transcript having at least 80%, 85%, 90% or 95% sequence identity with at least 13 consecutive bases of a sequence selected from SEQ ID NO: 47-434 or a combination thereof.

[0389] 81. The pharmaceutical composition of any one of items

[0014] -

[0023] , wherein the hybridization is specific hybridization.

[0390] 82. The pharmaceutical composition of any one of items

[0014] -

[0022] , wherein the polynucleic acid polymer is a synthetic polynucleic acid polymer.

[0391] 83. The pharmaceutical composition of any one of items

[0014] -

[0023] , wherein the pharmaceutical composition comprising the polynucleic acid polymer is administered intravenously or subcutaneously.

[0392] 84. A composition for treating a disease or condition in a patient in need, comprising administering the pharmaceutical composition described in items

[0014] -

[0024] to the patient.

[0393] 85. A composition for use as described in item

[0025] , wherein the disease or condition is associated with or is characterized by defective splicing of proteins.

[0394] 86. A composition for use as described in item

[0025] or

[0026] , wherein the disease or condition is a hereditary disease.

[0395] ...

Claims

1. A pharmaceutical composition comprising: A therapeutic agent comprising a polynucleotide polymer that hybridizes to a target region of a retained intron of a partially processed mRNA transcript of a gene, the partially processed mRNA transcript encoding the full-length functional form of a protein and comprising the retained intron, an exon flanking the 5' splice site of the retained intron, and an exon flanking the 3' splice site of the retained intron. The hybridization of the polynucleotide polymer with the target region enhances the cleavage of the retained introns from the partially processed mRNA transcript. The target region mentioned above: (a) is the internal region of the retained intron. (b) Does not contain the 5' splice site of the reserved intron. (c) Does not contain the 3' splice site of the reserved intron; and (d) A distance of at least 10 nucleotides from the 5' splice site of the retained intron; or a distance of at least 30 nucleotides from the 3' splice site of the retained intron; The fully processed mRNA transcript is translated into a copy expressing the full-length functional form of the protein, and the full-length functional form of the protein has the same length as the wild-type protein. as well as Pharmaceutically acceptable excipients and / or delivery carriers.

2. The pharmaceutical composition according to claim 1, wherein the target sequence is a binding motif that forms a hairpin structure.

3. The pharmaceutical composition of claim 1, wherein the target sequence is between two G quadrupoles of the partially processed mRNA transcript.

4. The pharmaceutical composition according to claim 1, wherein the target sequence does not form a G-quadruplex.

5. The pharmaceutical composition of claim 1, wherein the target sequence is an intron splicing regulatory element of the partially processed mRNA transcript.

6. The pharmaceutical composition of claim 1, wherein the intron splicing modulator comprises a first CCC motif or a second CCC motif.

7. The pharmaceutical composition of claim 6, wherein the intron splicing regulatory element comprises a first CCC motif and a second CCC motif, and wherein the first CCC motif is about 3 or more nucleotide bases away from the second CCC motif.

8. The pharmaceutical composition of claim 1, wherein the intron splicing regulatory element comprises a CCCAG or AGGCC motif.

9. The pharmaceutical composition of claim 1, wherein the delivery carrier comprises a cell-penetrating peptide or peptide-based nanoparticles.

10. The pharmaceutical composition of claim 1, wherein the length of the polynucleotide polymer is about 10 to about 50 nucleotides.

11. The pharmaceutical composition of claim 1, wherein the length of the polynucleotide polymer is about 10 to about 30 nucleotides.

12. The pharmaceutical composition of claim 1, wherein the polynucleotide polymer comprises a sequence complementary to at least 5 consecutive nucleotides or at least 10 consecutive nucleotides of the target sequence.

13. The pharmaceutical composition of claim 1, wherein the polynucleic acid polymer is modified at the nucleoside moiety, the phosphate moiety, the 5' end, the 3' end, or a combination thereof.

14. The pharmaceutical composition of claim 13, wherein the polynucleic acid polymer comprises one or more artificial nucleotide bases.

15. The pharmaceutical composition of claim 14, wherein the one or more artificial nucleotide bases comprise 2'-O-methyl modified nucleotides, 2'-O-methoxyethyl (2'-O-MOE) modified nucleotides, 2'-O-aminopropyl modified nucleotides, 2'-deoxy, T-deoxy-2'-fluoro modified nucleotides, 2'-O-aminopropyl (2'-O-AP) modified nucleotides, 2'-O-dimethylaminoethyl (2'-O-DMAOE) modified nucleotides, 2'- Nucleotides modified with O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethoxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamide (2'-O-NMA), locked nucleic acids (LNA), ethylene nucleic acids (ENA), peptide nucleic acids (PNA), 1',5'-dehydrated hexadiol nucleic acids (HNA), morpholine nucleotides, methylphosphonate nucleotides, mercaptophosphonate nucleotides, or 2'-fluoroN3-P5'-phosphamide.

16. The pharmaceutical composition of claim 1, wherein the target region is at a distance of about 10 nucleotides from the 5' splice site of the retained intron and about 30 nucleotides from the 3' splice site of the retained intron.

17. Use of polynucleic acid polymers in the preparation of pharmaceuticals for treating diseases or conditions associated with defects in the full-length functional form of proteins, including: Administering a pharmaceutical composition comprising the polynucleic acid polymer and a pharmaceutically acceptable excipient and / or delivery carrier to the subject. The polynucleotide polymer hybridizes with the target region of a retained intron of a partially processed mRNA transcript of the gene, the partially processed mRNA transcript encoding the full-length functional form of the protein and containing the retained intron, exons flanking the 5' splice site of the retained intron, and exons flanking the 3' splice site of the retained intron. The hybridization of the polynucleotide polymer with the target region enhances the cleavage of the retained intron from the partially processed mRNA transcript to produce a fully processed mRNA transcript, wherein the fully processed mRNA transcript is translated into a copy expressing the full-length functional form of the protein, thereby increasing the expression of the full-length functional form of the protein; and The target region mentioned above: (a) is the internal region of the retained intron. (b) Does not contain the 5' splice site of the reserved intron. (c) Does not contain the 3' splice site of the reserved intron; and (d) a distance of at least 10 nucleotides from the 5' splice site of the retained intron; or a distance of at least 30 nucleotides from the 3' splice site of the retained intron; and The full-length functional form of the protein has the same length as the wild-type form.

18. The use according to claim 17, wherein the subject has a genome containing a defective copy of the gene that cannot produce a wild-type version of the functional form of the protein.

19. The use according to claim 17, wherein the partially processed mRNA transcript comprises a partially processed mRNA transcript containing two or more retained introns.

20. The use according to claim 17, wherein the defect in the full-length functional form of the protein includes a defective form that produces the full-length functional form of the protein.

21. The use according to claim 17, wherein the polynucleotide polymer increases the expression of the full-length functional form of the protein by reducing the rate of intron retention in the partially processed mRNA transcript.

22. The use according to claim 17, wherein the subject has: (A) A disease or condition characterized by impaired production of the full-length functional form of the protein; and (B) The genome, which contains (I) A copy of a gene containing an exon set that encodes the full-length functional form of the protein when properly transcribed into fully processed mRNA, and (II) A defective copy of the gene that cannot produce the full-length functional form of the protein.

23. The use according to claim 22, wherein the disease or condition is selected from tuberous sclerosis, cystic fibrosis, retinoblastoma, sickle cell disease, and osteogenesis imperfecta.

24. The use according to claim 22, wherein the disease or condition is diabetes and the reserved intron is intron 1 of the INS gene.

25. The use according to claim 24, wherein the target region: (a) The 5' splice site relative to the retained intron is (+59), and (b) The distance from the 3' splice site of the retained intron is (-106).

Images