Aux / iaa protein mutant and application thereof

Abstract

The application relates to the field of agricultural biotechnology, and particularly discloses an Aux / IAA protein mutant and application thereof. Δ9 , SoIAA2 Δ15‑1 , SoIAA2 Δ15‑2 , SoIAA2 Δ33 , SoIAA2 Δnd , SoIAA2 NW , AtIAA5 Δ27 or AtIAA16 KW . After the coding gene of the mutant is introduced into a receptor plant and expressed, the root elongation inhibition rate and the aboveground dry weight inhibition rate of the plant under the treatment of an auxin herbicide 2,4-D and dicamba can be significantly reduced, the plant can normally bolt and bloom, and a clear molecular target point for cultivating crop germplasm resistant to multiple auxin herbicides is provided.

Description

Technical Field

[0001] This invention relates to the field of agricultural biotechnology, specifically to an Aux / IAA protein mutant and its applications. Background Technology

[0002] Weeds are a significant biological stressor affecting global crop production, significantly reducing yields of staple crops such as wheat, barley, rice, and corn. Compared to time-consuming, labor-intensive, and energy-intensive mechanical weeding methods, chemical herbicides have become the core means of weed control in farmland due to their low cost and high efficiency. Among them, auxin-based herbicides, by mimicking the physiological functions of endogenous plant auxins, interfere with the homeostasis of weed auxins and induce abnormal development. They exhibit strong selectivity and are the third most widely used herbicide category globally, after acetolactate synthase inhibitors and glyphosate. Varieties such as 2,4-D and dicamba are widely used for broadleaf weed control due to the development of herbicide-resistant crops.

[0003] However, the long-term, high-volume application of herbicides and the intense selective pressure have driven weed populations to gradually evolve resistance, continuously weakening the control efficacy of existing herbicides and increasing the difficulty of weed management in farmland. While the evolutionary cases of resistance to auxin-based herbicides are relatively limited, 2,4-D or dicamba-resistant populations have been found in multiple weed species, and the potential risk of weed resistance evolution continues to rise, threatening the stability of existing weed control systems. Conventional methods for addressing weed resistance in production, such as increasing application rates and rotating herbicides with different mechanisms of action, have drawbacks such as increased planting costs and exacerbated environmental burdens. Therefore, cultivating crop varieties tolerant to auxin-based herbicides, thereby expanding the herbicide application window, optimizing field application strategies, and improving the control efficacy of resistant weeds, is an important technological direction for solving the weed resistance problem and ensuring stable crop yields.

[0004] Preliminary studies indicate that the resistance of some weeds to auxin-based herbicides is related to... Aux / IAA Mutations in the degradation regions of genes are associated with this type of mutation. However, the resistance effects conferred by these mutations are generally weak and insufficient to meet the needs of practical field applications. In some naturally resistant populations, the identified resistance... Aux / IAA The mutation can only alleviate growth inhibition under extremely low concentrations of herbicides (far below the recommended field dose). At conventional application concentrations, the mutant plants still show obvious symptoms of herbicide damage, such as inhibited root elongation, significantly reduced aboveground biomass, and abnormal reproductive development. Summary of the Invention

[0005] To address the problem of weak resistance to existing mutants, this invention provides an Aux / IAA protein mutant and its applications.

[0006] The present invention adopts the following technical solution: This invention provides an isolated Aux / IAA protein mutant, wherein the mutant is any one of the following: The SoIAA2S series of deletion mutants are obtained by in-frame deletion mutations in the degradation region and degradation tail of the wild-type SoIAA2S protein, including the gene sequence encoding SoIAA2 as shown in SEQ ID NO.1. Δ9 The encoding gene sequence is SoIAA2 as shown in SEQ ID NO.2. Δ15-1 The encoding gene sequence is SoIAA2 as shown in SEQ ID NO.3. Δ15-2 The encoding gene sequence is SoIAA2 as shown in SEQ ID NO.4. Δ33 And the encoding gene sequence SoIAA2 as shown in SEQ ID NO.5 Δnd ; SoIAA2S point mutant SoIAA2 NW It is obtained by replacing the glycine coding site in the conserved degradation region of the wild-type SoIAA2 protein with GG→AA nucleotides, and the coding gene sequence is shown in SEQ ID NO.6; AtIAA5 homologous deletion mutant AtIAA5 Δ27 It was obtained by in-frame deletion of the degradation tail of wild-type AtIAA5 protein, and the encoding gene sequence is shown in SEQ ID NO.7; AtIAA16 point mutant AtIAA16 KW It was obtained by replacing the glycine coding site in the conserved degradation region of the wild-type AtIAA16 protein with GG→AA nucleotides, and the coding gene sequence is shown in SEQ ID NO.8.

[0007] This invention, based on the conserved function of the Aux / IAA protein degradation region and its adjacent tail sequence, utilizes systematically designed in-frame deletions and point mutations of varying lengths and mutation types to verify the regulatory effect of structural variations in this region on auxin-based herbicide sensitivity in two species, Oriental mustard and Arabidopsis. Specifically, by locking the mutation region within the 9–33 bp range of the degradation tail and specific glycine sites within the degradation region, a quantitative relationship between mutation type and resistance level is established. This clarifies that structural perturbation in this region is a universal molecular mechanism for conferring herbicide resistance, and that the resistance effect is independent of specific species or a single mutation type, thus providing a transferable molecular design strategy for cross-species herbicide resistance breeding.

[0008] This invention also provides the application of the aforementioned Aux / IAA protein mutant in improving plant resistance to auxin-based herbicides.

[0009] Furthermore, the auxin-based herbicides are 2,4-D and dicamba.

[0010] Furthermore, the coding gene of the Aux / IAA protein mutant is introduced into the recipient plant, causing the recipient plant to express the Aux / IAA protein mutant.

[0011] Furthermore, the transgene is generated using an Agrobacterium-mediated genetic transformation method.

[0012] Furthermore, the coding gene is regulated by a constitutive promoter.

[0013] Furthermore, the Aux / IAA protein mutant can alleviate the root elongation inhibition and biomass reduction in recipient plants caused by auxin-based herbicides, and enable the plants to bolt and flower normally.

[0014] Furthermore, the recipient plant is Arabidopsis thaliana.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention designs and verifies Oriental mustard. SoIAA2 The series of in-frame deletion mutants (SoIAA2) Δ9 SoIAA2 Δ15-1 SoIAA2 Δ15-2 SoIAA2 Δ27 SoIAA2 Δ33 and SoIAA2 Δnd ), point mutant SoIAA2 NW And Arabidopsis thaliana homolog AtIAA5 Δ27 Deletion mutants and AtIAA16 KW Point mutants were identified, demonstrating that deletions of varying lengths (9 bp to 33 bp) in the degradation tail and point mutations replacing glycine with asparagine or lysine in the degradation region effectively conferred resistance to multiple auxin-based herbicides, including 2,4-D and dicamba. Quantitative correlations between different mutation types and resistance levels were also provided. These validation results fill the gap in existing technologies regarding systematic functional validation and clearly defined molecular design targets, providing directly applicable and precise molecular targets for herbicide-resistant crop breeding.

[0016] Regarding the relationship between resistance levels and mutation forms, this invention provides detailed quantitative data support through a soil spraying experimental system. For example, under the spraying condition of 62.5 g / ha 2,4-D, the dry weight inhibition rate of each mutant line reached 85%~95%, significantly higher than that of the wild type and the wild type overexpression control. Moreover, the mutants could still bolt and flower normally at a low dose of 31.25 g / ha, while the control lines could not complete reproductive growth. The above data indicate that both deletion mutations and point mutations can significantly improve the plant's tolerance to auxin-based herbicides, and the resistance intensity of different mutation forms varies. Among them, the deletion mutants are more stable under high concentrations of dicamba, while the point mutants show weakened resistance at high concentrations, providing a basis for selectively designing mutants based on herbicide type and application intensity.

[0017] This invention also achieved cross-species conserved function verification in Arabidopsis thaliana, demonstrating the broad species applicability and expansion potential of this mutation strategy. By constructing stable T3 generation homozygous transgenic lines, combined with rigorous molecular identification and phenotypic quantitative analysis, a reliable technical pathway for creating crop germplasm resistant to multiple auxin herbicides was established through the mutation of the Aux / IAA protein degradation region. This lays a solid experimental foundation and operational basis for subsequent breeding applications in staple crops such as wheat and maize. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This refers to information about mutation sites.

[0020] Figure 2 The growth phenotypes of each line after 21 days of 2,4-drop treatment are shown in the figure; in the figure, A is wild type, B is wild type overexpression control SoIAA2S, and C is SoIAA2 NW Strain D is AtIAA16 KW Strain, E is AtIAA5 Δ27 strain F is SoIAA2 Δ15-2 strain, G is SoIAA2 Δ33 strain, H is SoIAA2 Δnd Strain I is SoIAA2 Δ15-1 strain J is SoIAA2 Δ9 strain, K is SoIAA2 Δ27The strains and dosages from left to right were 0 g / ha, 31.25 g / ha, 62.5 g / ha, 125 g / ha, and 250 g / ha.

[0021] Figure 3 The growth phenotypes of each line after 21 days of dicamba treatment are shown in the figure; in the figure, A is the wild type, B is the wild type overexpression control SoIAA2S, and C is SoIAA2 NW Strain D is AtIAA16 KW Strain, E is AtIAA5 Δ27 strain F is SoIAA2 Δ15-2 strain, G is SoIAA2 Δ33 strain, H is SoIAA2 Δnd Strain I is SoIAA2 Δ15-1 strain J is SoIAA2 Δ9 strain, K is SoIAA2 Δ27 The strains and dosages from left to right were 0 g / ha, 31.25 g / ha, 62.5 g / ha, 125 g / ha, 250 g / ha, and 500 g / ha. Detailed Implementation

[0022] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0023] Example 1: Design of Aux / IAA mutant sequence and construction of plant expression vector.

[0024] 1. Mutant sequence design wild type Aux / IAA Based on gene sequences, different types of mutant cDNA sequences are artificially synthesized, as specifically designed below: SoIAA2 series deletion mutants: based on Oriental mustard ( Sisymbrium orientale ) wild type SoIAA2 Using the gene (SoIAA2S, accession number OK631624) as a template, various in-frame deletion mutations were designed in the protein degradation region and degradation tail, including: a 9 bp deletion of SoIAA2. Δ9 (SEQ ID NO.1), two different 15 bp deletions in SoIAA2 Δ15-1 (SEQ ID NO.2) and SoIAA2Δ15-2 (SEQ ID NO.3), SoIAA2 missing 27 bp Δ27 (Login ID OK631625), SoIAA2 missing 33 bp Δ33 (SEQ ID NO.4), and SoIAA2 lacking a complete degradation region. Δnd (SEQ ID NO.5).

[0025] SoIAA2 point mutant: A GG→AA nucleotide substitution was performed at the glycine coding site in the conserved degradation region, resulting in a mutation of glycine (G) to asparagine (N) in the degradation motif, thus obtaining the point mutant SoIAA2. NW (SEQ ID NO.6).

[0026] AtIAA5 homologous deletion mutant: Arabidopsis thaliana AtIAA5 Using the gene (accession number AT1G15580.19) as a template, its degradation tail was designed to resemble SoIAA2. Δ27 A 27 bp deletion within a sequence homologous frame yielded AtIAA5. Δ27 (SEQ ID NO.7).

[0027] AtIAA16 homologous site mutant: Arabidopsis thaliana AtIAA16 Using the gene (accession number AT3G04730.1) as a template, a GG→AA nucleotide substitution was performed at the glycine coding site in the conserved degradation region, resulting in a glycine (G) mutation to lysine (K), thus obtaining AtIAA16. KW (SEQ ID NO.8).

[0028] The target sequences mentioned above were all artificially synthesized by Thermo Fisher Scientific. Mutation site information can be found here. Figure 1 The sequence information for A and B is as follows: SEQ ID NO.1, ATGGCGTACGAGAAAGTCAATGAGCTTAACCTTAAGGACACAGAGCTTCGTCTTGGATTACCTGGAACAGAGCAAGTTAAAGAAGAACAAGAGGTTTCTTGCGTTAGAAGCAACAAGCGTCAATTCCAAATCGATAACGAGGAAAACCGTGAGGAAGAAGAATCTACACCTCCTACGAAAACTCAAATCGTTGGTTGGCCTCCGGTGAGATCTTACAACAACAGTGTGAGCTATGTGAAAGTGAGTATGGACG GAGCACCATACCTCCGCAAAATCGATCTCAAAACATACAAAAACTATCCAGAGCTTCTCAAGGCGTTAGAAAACATGTTCAAGTTCACGGTAGGTGAGTACTGTGAAAGAGAAGGATACAAAGGATCTGAAGTCGTACCAACGTACGAGGATAAAGATGGAGACTGGAGGTTGGTTGGTGATGTTCCATGGGATATGTTCTCATCCTCTTGTAAGAGACTCAGAATCATGAAAGGATCTGATGACTCTTCCTTATGA; SEQ ID NO.2, ATGGCGTACGAGAAAGTCAATGAGCTTAACCTTAAGGACACAGAGCTTCGTCTTGGATTACCTGGAACAGCAAGTTAAAGAAGAACAAGAGGTTTCTTGCGTTAGAAGCAACAAGCGTCAATTCCAAATCGATAACGAGGAAAACCGTGAGGAAGAAGAATCTACACCTCCTACGAAAACTCAAATCGTTGGTTGGCCTCCGGTGAGATCTTACAGTGTGAGCTATGTGAAAGTGAGTATGGACGGAG CACCATACCTCCGCAAAATCGATCTCAAAACATACAAAAACTATCCAGAGCTTCTCAAGGCGTTAGAAAACATGTTCAAGTTCACGGTAGGTGAGTACTGTGAAAGAGAAGGATACAAAGGATCTGAAGTCGTACCAACGTACGAGGATAAAGATGGAGACTGGAGACTGGATGTTGGTTGGTGATGTTCCATGGGATATGTTCTCATCCTCTTGTAAGAGACTCAGAATCATGAAAGGATCTGATGACTCTTCCTTATGA; SEQ ID NO.3, ATGGCGTACGAGAAAGTCAATGAGCTTAACCTTAAGGACACAGAGCTTCGTCTTGGATTACCTGGAACAGAGCAAGTTAAAGAAGAACAAGAGGTTTCTTGCGTTAGAAGCAACAAGCGTCAATTCCAAATCGATAACGAGGAAAACCGTGAGGAAGAAGAATCTACACCTCCTACGAAAACTCAAATCGTTGGTTGGCCTCCGGTGAGCAACAACAGTGTGAGCTATGTGAAAGTGAGTATGGACGGAG CACCATACCTCCGCAAAATCGATCTCAAAACATACAAAAACTATCCAGAGCTTCTCAAGGCGTTAGAAAACATGTTCAAGTTCACGGTAGGTGAGTACTGTGAAAGAGAAGGATACAAAGGATCTGAAGTCGTACCAACGTACGAGGATAAAGATGGAGACTGGAGACTGGATGTTGGTTGGTGATGTTCCATGGGATATGTTCTCATCCTCTTGTAAGAGACTCAGAATCATGAAAGGATCTGATGACTCTTCCTTATGA; SEQ ID NO.4, ATGGCGTACGAGAAAGTCAATGAGCTTAACCTTAAGGACACAGAGCTTCGTCTTGGATTACCTGGAACAGAGCAAGTTAAAGAAGAACAAGAGGTTTCTTGCGTTAGAAGCAACAAGCGTCAATTCCAAATCGATAACGAGGAAAACCGTGAGGAAGAAGAATCTACACCTCCTACGAAAACTCAAATCGTTGGTTGGCCTCCGGTGAGATCTTACGTGAGTATGGACGGAGCACCATACCTCCGCAAAATCGATCTCAAAACATACAAAAACTATCCAGAGCTTCTCAAGGCGTTAGAAAACATGTTCAAGTTCACGGTAGGTGAGTACTGTGAAAGAGAAGGATACAAAGGATCTGAAGTCGTACCAACGTACGAGGATAAAGATGGAGACTGGATGTTGGTTGGTGATGTTCCATGGGATATGTTCTCATCCTCTTGTAAGAGACTCGAAATCATGAAAGGATCTGATGACTCTTCCTTATGA; SEQ ID NO.5, ATGGCGTACGAGAAAGTCAATGAGCTTAACCTTAAGGACACAGAGCTTCGTCTTGGATTACCTGGAACAGAGCAAGTTAAAGAAGAACAAGAGGTTTCTTGCGTTAGAAGCAACAAGCGTCAATTCCAAATCGATAACGAGGAAAACCGTGAGGAAGAAGAATCTACACCTCCTACGAAAACTCAAATCGTTAAGAACAACAACAGTGTGAGCTATGTGAAAGTGAGTATGGACGGAGCACCATACCTCCGCAAAATCGATCTCAAAACATACAAAAACTATCCAGAGCTTCTCAAGGCGTTAGAAAACATGTTCAAGTTCACGGTAGGTGAGTACTGTGAAAGAGAAGGATACAAAGGATCTGAAGTCGTACCAACGTACGAGGATAAAGATGGAGACTGGATGTTGGTTGGTGATGTTCCATGGGATATGTTCTCATCCTCTTGTAAGAGACTCAGAAATCATGAAAGGATCTGATGACTCTTCCTTATGA; SEQ ID NO.6, ATGGCGTACGAGAAAGTCAATGAGCTTAACCTTAAGGACACAGAGCTTCGTCTTGGATTACCTGGAACAGCAAGTTAAAGAAGAACAAGAGGTTTCTTGCGTTAGAAGCAACAAGCGTCAATTCCAAATCGATAACGAGGAAAACCGTGAGGAAGAAGAATCTACACCTCCTACGAAAACTCAAATCGTTAATTGGCCTCCGGTGAGATCTTACCGTAAGAACAACAACAGTGTGAGCTATGTGAAAGTGAGTAT GGACGGAGCACCATACCTCCGCAAAATCGATCTCAAAACATACAAAAACTATCCAGAGCTTCTCAAGGCGTTAGAAAACATGTTCAAGTTCACGGTAGGTGAGTACTGTGAAAGAGAAGGATACAAAGGATCTGAAGTCGTACCAACGTACGAGGATAAAGATGGAGACTGGATGTTGGTTGGTGATGTTCCATGGGATATGTTCTCATCCTCTTGTAAGAGACTCAGAATCATGAAAGGATCTGATGACTCTTCCTTATGA; SEQ ID NO.7, ATGGCGAATGAGAGTAATAATCTTGGACTCGAAATCACCGAACTACGGCTAGGTCTTCCCGGAGATATCGTCGTCTCCGGTGAGTCCATCTCCGGGAAGAAGAGGGCTTCTCCGGAAGTAGAGATTGATTTGAAATGTGAACCGGCGAAAAAGAGTCAAGTTGTGGGTTGGCCACCGGTTTGTTCGTACAAAAGTTCGTACGTGAAAGTGAGTGTAGATGGAGCTGCATTTTTAAGGAAGATTGATTTGGAAATGTACAAATGTTACCAAGATCTTGCTTCCGCTCTGCAAATTCTGTTCGGATGCTATATCAATTTTGATGATACGTTGAAGGAAAGTGAATGTGTACCAATATATGAAGACAAAGATGGAGATTGGATGCTTGCTGGAGATGTTCCTTGGGAAATGTTCCTTGGATCGTGCAAGAGGTTAAGGATTATGAAGAGATCATGTAACAGAGGATGA; SEQ ID NO.8,

[0029] 2. Construction of plant expression vectors During the synthesis of the target sequence, the attB1 site sequence (ACAAGTTTGTACAAAAAAGCAGGCT, SEQ ID NO.9) is added upstream and the attB2 site sequence (ACCCAGCTTTCTTGTACAAAGTGGT, SEQ ID NO.10) is added downstream for BP recombination reaction.

[0030] The Gateway cloning system was used: the synthesized target sequence was recombinated into the pDONR221 vector via a BP recombination reaction; after the BP recombination product was sequenced to verify its correctness, it was then constructed into the pMDC32 target vector via an LR recombination reaction, allowing the target gene to be regulated by the CaMV 35S constitutive promoter. The verified expression vector was transformed into *E. coli* DH5α, and then transformed into *Agrobacterium tumefaciens* AGL0 strain via a freeze-thaw method for subsequent *Arabidopsis thaliana* genetic transformation.

[0031] According to the Gateway® Technology manual (Gateway® Technology, A universal technology to clone DNA sequences for functional analysis and expression in multiple systems, Revision 1.0), the specific reaction system and conditions are as follows: BP recombination reaction: BP Clonase TM The II enzyme mixture (Thermo Fisher Scientific, catalog number 11789020) was thawed on ice for 2 min after being removed from -20°C, followed by two brief vortexing cycles (2 s each). The following components were added to a 1.5 mL centrifuge tube at 25°C: 5 µL of the target sequence (10 ng / µL), 1 µL of the donor vector pDONR221 (150 ng / µL, Thermo Fisher Scientific, catalog number 12536017), and BP Clonase. TM 2 µL of enzyme II mixture was added to a final volume of 10 µL with TE buffer (Thermo Fisher Scientific, catalog number 12090015). The mixture was briefly vortexed twice (2 s each time) to mix, then briefly centrifuged and incubated at 25 °C for 1 h. The reaction was terminated by adding 2 µL of proteinase K solution (2 µg / µL, Thermo Fisher Scientific, catalog number AM2546). After a brief vortex of 2 s, the mixture was incubated at 37 °C for 10 min to obtain the BP recombinant reaction product.

[0032] LR recombination reaction: LR Clonase TM After removing the II enzyme mixture from -80°C, thaw it on ice for 2 min, followed by two brief vortexes (2 s each). Add the following components to a 1.5 mL centrifuge tube at 25°C: 5 µL (20 ng / µL) of the BP recombinant reaction product, 1 µL (150 ng / µL, Newp Biotechnology Co., Ltd., catalog number V013793) of the target vector pMDC32, and LRClonase. TMAdd 2 µL of enzyme II mixture to 10 µL with TE buffer (pH 8.0), briefly vortex twice (2 s each time) to mix, then briefly centrifuge and incubate at 25°C for 1 h. Add 1 µL of proteinase K solution (2 µg / µL) to terminate the reaction, briefly vortex for 2 s, and then incubate at 37°C for 10 min.

[0033] Example 2: Obtaining and molecularly identifying transgenic Arabidopsis thaliana.

[0034] 1. Genetic transformation and positive selection Genetic transformation was performed using *Arabidopsis thaliana* ecotype (Col-0) as the recipient via Agrobacterium-mediated flower maceration. After harvesting T0 generation seeds, they were sown on 1 / 2 MS medium supplemented with 50 mg / L hygromycin and incubated at 22°C under a 16 h light / 8 h dark (white light, 150 µM / cm²) environment. 2 / S 1 Under long-day conditions, T1 generation positive plants with hygromycin resistance were screened and transplanted to a soil-fertilizer mixture with a soil-fertilizer ratio of 1:1, a pH of 6.0, and an organic matter content of 1.5% to continue growth.

[0035] 2. Genotyping identification Leaves from T1 generation plants and wild-type plants were collected, and total RNA was extracted using an RNA extraction kit (Meridian Bioscience). cDNA templates were synthesized using a Tetro cDNA synthesis kit (Meridian Bioscience). PCR amplification was performed using the universal vector upstream primer LBF (GACGCACAATCCCACTATC) combined with gene-specific downstream primers. The PCR reaction mixture consisted of: 5 µL 5×MyFi mixture, 0.5 µL 10 µM upstream primer, 0.5 µL 10 µM downstream primer, 2 µL cDNA template, and 16 µL water. The reaction conditions were: 95℃ pre-denaturation for 1 min, followed by 35 cycles (95℃ for 30 s, 55℃ for 30 s, and 72℃ for 30 s). Sequencing of the PCR products confirmed that the target genes had been integrated into the Arabidopsis genome. Information on the gene-specific downstream primers is as follows:

[0036] SoIAA2R: CTTTCACAGTACTCACCTACC, SEQ ID NO.11; AtIAA5R: CACATTCACTTTCCTTCAACG, SEQ ID NO.12; AtIAA16R: CAGAAGTCTTATCGTTTCCTTC, SEQ ID NO. 13.

[0037] 3. Expression level detection and screening of homozygous lines q-PCR detection was performed on T1 generation plants and wild-type plants using the iTaq Universal SYBR Green Supermix kit (Bio-Rad Laboratories). The reaction mixture consisted of 10 µL Universal Green Supermix, 0.5 µL 10 µM F primers, 0.5 µL 10 µM R primers, 2 µL cDNA template, and 6 µL water. The reaction procedure was described in the kit instructions. Atactin (Login ID AT5G43500) and Attubulin (Accession number AT1G50010) is the internal reference gene, using 2 -ΔΔCT The relative expression level of the target gene was calculated using this method. The specific primer information for each gene is as follows:

[0038] SoIAA2-F:GGGCTTCTCCGGAAGTAGAG, SEQ ID NO.14; SoIAA2-R:ATCGATTTTGCGGAGGTATG, SEQ ID NO.15; AtIAA16-F: TCCAACGCCTTAAGCAAAAT, SEQ ID NO.16; AtIAA16-R: TCCCACGGTACGTCTCCTAC, SEQ ID NO.17; AtIAA5-F:GGGCTTCTCCGGAAGTAGAG, SEQ ID NO.18; AtIAA5-R: AGCATCCGAACAGAATTTGC, SEQ ID NO.19; Atactin-F:GAGTTCTTCACGCGATACCTCCA, SEQ ID NO.20; Atactin-R: GACCACCTTTTATTAACCCCATTTACCA, SEQ ID NO. 21; Attubulin-F: ATGTGGGTCAGGGTATGGAA, SEQ ID NO. 22; Attubulin-R: CCGACAACCTTCTTAGTCTCCTCT, SEQ ID NO. 23.

[0039] After multiple generations of resistance screening, the T3 generation homozygous transgenic line was obtained.

[0040] Example 3: Identification of resistance of transgenic Arabidopsis to auxin-based herbicides.

[0041] The resistance levels of each transgenic line were evaluated from three dimensions: root growth, aboveground dry weight, and heading phenotype, using root length experiments on culture media and soil spraying experiments. Wild-type Arabidopsis thaliana (WT) and the SoIAA2S transgenic line were used as controls. The herbicides used were auxin-based herbicides (2,4-D and dicamba).

[0042] 1. Effect of Arabidopsis mutants on 2,4-drop sensitivity test The experiment was conducted from December 2025 to June 2026 in the greenhouse of the Collaborative Innovation Center for Green Pesticides at Zhejiang Agriculture and Forestry University.

[0043] Test herbicide: 50% 2,4-D isooctyl ester (2,4-D, Delis, Jinan, Shandong).

[0044] The dosage settings for 2,4-drop are as follows: 0 g / ha, 31.25 g / ha, 62.5 g / ha, 125 g / ha, 250 g / ha, 500 g / ha and 1000 g / ha.

[0045] Prepare a soil-fertilizer mixture with a soil-to-fertilizer ratio of 1:1 (the test soil was collected from the topsoil of Zhejiang A&F University campus; the test fertilizer was Stanley Gold compound fertilizer with N-P2O5-K2O ratio of 15-15-15, conforming to standard GB / T 15063-2020). The soil mixture had a pH of 6.0, an organic matter content of 1.5%, and had never been treated with herbicides. Fill small plastic boxes (5×5×5 cm) with holes at the bottom with the soil mixture and add water to the bottom until the soil is saturated. Select plump Arabidopsis thaliana seeds and sow 10 seeds per small plastic box. After sowing, cover with a layer of fine soil and allow the bottom to absorb water until saturated. Place the boxes in a greenhouse for growth. Once the Arabidopsis thaliana seedlings emerge uniformly, thin them to 5 seedlings per pot. The day and night temperatures in the greenhouse were 22℃ and 20℃, respectively, with a photoperiod of 16 h:8 h (D:L). After seedling establishment, the plants continued cultivation until the Arabidopsis thaliana reached the 4-5 leaf stage, at which point a 2,4-D foliar spray treatment was applied. The spraying was performed using a 3WP-2000 mobile bioassay spray tower manufactured by the Nanjing Institute of Agricultural Mechanization, Ministry of Agriculture and Rural Affairs. The main shaft rotation speed was 96 mm / r, the spray height was 300 mm, the effective spray width was 350 mm, the flow rate was 390 mL / min, the travel distance was 1340 mm, and the liquid volume was 30 mL. After spraying, the plants continued to grow in a greenhouse. Twenty-one days after spraying, representative phenotypic images of each treatment group were obtained by taking top-down photographs at a fixed height and shooting distance using a digital camera. The aboveground parts of the Arabidopsis thaliana plants were cut, weighed, and the dry weight inhibition rate was calculated. The dry weight inhibition rate of the herbicide on Arabidopsis thaliana was analyzed using DPS software and the Duncan multiple range test for significance analysis (p=0.05).

[0046] Dry weight inhibition rate % = (control dry weight - treatment dry weight) / control dry weight × 100.

[0047] Table 1 shows that under the 2,4-D stem and leaf treatment conditions, the GR of wild-type Arabidopsis thaliana... 50 The value was 20.1 g / ha. Compared with the wild type, all transgenic Arabidopsis lines showed significantly improved 2,4-D tolerance, and different deletion mutants showed increased GR. 50 The values ​​were 165.7 g / ha, 153.6 g / ha, 148.1 g / ha, 165.7 g / ha, and 197.7 g / ha, respectively, which were 8.2 times, 7.6 times, 7.4 times, 8.2 times, and 9.8 times that of the wild type. The point mutant also showed a high level of 2,4-D resistance: SoIAA2 NW Mutants and AtIAA16 KW GR mutant 50 The values ​​were all 171.6 g / ha, approximately 8.5 times that of the wild type. SoIAA5 Δ27 GR mutant 50The value was 99.9 g / ha, approximately 5.0 times that of the wild type. When 2,4-D was sprayed onto the leaves at a concentration of 31.25 g / ha, the dry weight of both the wild-type and transgenic SoIAA2S Arabidopsis mutants decreased, with dry matter inhibition rates of 76% and 52%, respectively; in contrast, the Arabidopsis mutant SoIAA2... NW (10%), SoIAA2 Δ9 (11%), SoIAA2 Δ15-1 (6%), SoIAA2 Δ15-2 (5%), SoIAA2 Δnd (5%), SoIAA2 Δ33 (11%), AtIAA16 KW (10%) and AtIAA5 Δ27 The inhibition rate of (19%) was significantly lower. Based on the above results, all transgenic Arabidopsis lines carrying different Aux / IAA gene mutants acquired resistance to 2,4-drop.

[0048] Table 1 Effect of 2,4-drop on the sensitivity of Arabidopsis thaliana Arabidopsis <![CDATA[GR 50 (g / ha)]]> Inhibition rate of dry weight treated with 31.25 g / ha 2,4-drop wild-type Arabidopsis thaliana 20.1a 76% SoIAA2S mutant 61.1b 52% <![CDATA[SoIAA2 Δ9 Mutant 165.7c 11% <![CDATA[SoIAA2 Δ15-1 Mutant 153.6c 6% <![CDATA[SoIAA2 Δ15-2 Mutant 148.1c 5% <![CDATA[SoIAA2 Δ33 Mutant 165.7c 11% <![CDATA[SoIAA2 Δnd Mutant 197.7c 5% <![CDATA[SoIAA2 NW Mutant 171.6c 10% <![CDATA[AtIAA16 KW Mutant 171.6c 10% <![CDATA[SoIAA5 Δ27 Mutant 99.9c 19% Combination Figure 2 Phenotypic images of lines A through K can visually verify the above quantitative data: Under the 0 g / ha treatment, wild-type, wild-type overexpression control SoIAA2S, and all mutant transgenic lines showed fully expanded rosette leaves, normal elongation of the main stem, no deformities or phytotoxicity, and no significant differences in growth status among the lines; under the 31.25 g / ha and 62.5 g / ha 2,4-D treatment groups, wild-type rosette leaves were severely wrinkled and yellowed, with almost no bolting, and reproductive growth was completely inhibited; the wild-type overexpression control SoIAA2S showed obvious leaf deformities and very little bolting; while all deletion mutant lines ( Figure 2 F~K), point mutant lines ( Figure 2 In cases C and D), the leaves only curl slightly, the main stem elongates normally and completes flowering, with SoIAA2 being an example. Δnd SoIAA2 Δ15-2 The least phytotoxicity was observed, matching the quantitative result of 5% dry weight inhibition rate; AtIAA5 Δ27 The phytotoxicity was slightly higher than that of the *Vitex negundo* mutant, but significantly better than the two control groups. In the 125 g / ha and 250 g / ha 2,4-D treatment groups, wild-type and wild-type overexpression control SoIAA2S plants showed significant wilting and death. All Aux / IAA mutant lines could still maintain basal vegetative growth, with deletion mutant lines showing better growth than point mutation lines, particularly SoIAA2. Δnd The strongest tolerance, compared to GR 50 The result of 197.7 g / ha is completely consistent.

[0049] 2. Effects of Arabidopsis mutants on dicamba sensitivity test The experiment will be conducted from December 2025 to June 2026 in the greenhouse of the Collaborative Innovation Center for Green Pesticides at Zhejiang Agriculture and Forestry University.

[0050] The tested herbicide was 48% dicamba dimethylamine salt (Shandong Weifang Plant Protection Agricultural Materials).

[0051] The dosage settings for dicamba are as follows: 0 g / ha, 31.25 g / ha, 62.5 g / ha, 125 g / ha, 250 g / ha and 500 g / ha.

[0052] The remaining experimental procedures were the same as those in section 1, the experiment on the effect of Arabidopsis mutants on 2,4-drop sensitivity.

[0053] Table 2 shows that under the condition of dicamba stem and leaf treatment, the GR of wild-type Arabidopsis thaliana... 50 The value was 12.1 g / ha. Compared with the wild type, all transgenic Arabidopsis lines showed significantly improved tolerance to dicamba. GR of different deletion mutants... 50 The values ​​were 165.7 g / ha, 183.6 g / ha, 162.2 g / ha, 165.7 g / ha, and 196.7 g / ha, respectively, which were 13.7 times, 15.2 times, 13.4 times, 13.7 times, and 16.2 times that of the wild type. The point mutant also showed a high level of dicamba resistance: SoIAA2 NW mutant AtIAA16 KW GR mutant 50 The values ​​were all 190.7 g / ha, approximately 15.7 times that of the wild type. SoIAA5 Δ27 GR mutant 50 The value was 116.0 g / ha, approximately 9.6 times that of the wild type. When dicamba was sprayed on the leaves at a concentration of 62.5 g / ha, the dry weight of both the wild-type and transgenic SoIAA2S Arabidopsis mutants decreased, with dry matter inhibition rates of 75% and 51%, respectively; in contrast, the Arabidopsis mutant SoIAA2... NW (17%), SoIAA2 Δ9 (15%), SoIAA2 Δ15-1 (16%), SoIAA2 Δ15-2 (15%), SoIAA2 Δnd (15%), SoIAA2 Δ33 (16%), AtIAA16KW (20%) and AtIAA5 Δ27The inhibition rate of (29%) was significantly lower. Based on the above results, all transgenic Arabidopsis lines carrying different Aux / IAA gene mutants acquired resistance to dicamba.

[0054] Table 2 Effects of dicamba on the sensitivity of Arabidopsis thaliana Arabidopsis GR50 (g / ha) Dry weight inhibition rate under 62.5 g / ha dicamba treatment wild-type Arabidopsis thaliana 12.1a 75% SoIAA2S mutant 93.1b 51% <![CDATA[SoIAA2 Δ9 Mutant 165.7c 15% <![CDATA[SoIAA2 Δ15-1 Mutant 183.6c 16% <![CDATA[SoIAA2 Δ15-2 Mutant 162.2c 15% <![CDATA[SoIAA2 Δ33 Mutant 165.7c 16% <![CDATA[SoIAA2 Δnd Mutant 196.7c 15% <![CDATA[SoIAA2 NW Mutant 190.7c 17% <![CDATA[AtIAA16 KW Mutant 190.7c 20% <![CDATA[SoIAA5 Δ27 Mutant 116.0c 29% Figure 3 Phenotypic results for A-K dicamba treatments showed that under 0 g / ha dicamba treatment, all lines grew normally without developmental abnormalities; under 62.5 g / ha dicamba treatment, wild-type rosette leaves showed extensive necrosis and complete failure to bolt; the wild-type overexpression control SoIAA2S exhibited severely distorted leaves, short bolts, and no normal floral organs; all SoIAA2 deletion mutants (F-K) showed only minor leaf damage, complete bolt development, and normal flowering. The point mutation SoIAA2... NW (C) AtIAA16 KW (D) Mild leaf yellowing exists, and resistance is slightly weaker than that of the deletion mutation, AtIAA5 Δ27 (E) The most severe herbicide damage, but better than wild-type and wild-type overexpression control SoIAA2S; under dicamba treatments of 250 g / ha and 500 g / ha, wild-type and SoIAA2S plants almost completely died; the SoIAA2 series deletion mutant lines could still stably maintain vegetative and reproductive growth, among which SoIAA2 Δnd Optimal resistance (GR) 50 =196.7 g / ha), point mutant lines suffered more severe herbicide damage under ultra-high concentrations of dicamba, and their resistance stability was weaker than that of deletion mutants.

[0055] The above results indicate that glycine substitution mutations (G→N, G→K) in the conserved degradation region of the Aux / IAA protein, as well as in-frame deletion mutations of a certain length in the degradation tail, can confer resistance to 2,4-D and dicamba in plants. Among them, the shortest deletion of 9 bp and the longest deletion of 33 bp in SoIAA2 can produce resistance, and the homologous 27 bp deletion in AtIAA5 also has a resistance effect, which can provide clear molecular targets for the breeding of herbicide-resistant crops.

[0056] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0057] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. An isolated Aux / IAA protein mutant, characterized in that, The mutant is any one of the following: The SoIAA2S series of deletion mutants are obtained by in-frame deletion mutations in the degradation region and degradation tail of the wild-type SoIAA2S protein, including the SoIAA2 gene sequence shown in SEQ ID NO.

1. Δ9 The encoding gene sequence is SoIAA2 as shown in SEQ ID NO.

2. Δ15-1 The encoding gene sequence is SoIAA2 as shown in SEQ ID NO.

3. Δ15-2 The encoding gene sequence is shown in SEQ ID NO.4 as SoIAA2 Δ33 And the encoding gene sequence SoIAA2 as shown in SEQ ID NO.5 Δnd ; SoIAA2S point mutant SoIAA2 NW It is obtained by replacing the glycine coding site in the conserved degradation region of the wild-type SoIAA2 protein with GG→AA nucleotides, and the coding gene sequence is shown in SEQ ID NO.6; AtIAA5 homologous deletion mutant AtIAA5 Δ27 It was obtained by in-frame deletion of the degradation tail of wild-type AtIAA5 protein, and the encoding gene sequence is shown in SEQ ID NO.7; AtIAA16 point mutant AtIAA16 KW It was obtained by replacing the glycine coding site in the conserved degradation region of the wild-type AtIAA16 protein with GG→AA nucleotides, and the coding gene sequence is shown in SEQ ID NO.

8.

2. The application of the Aux / IAA protein mutant according to claim 1 in improving plant resistance to auxin-based herbicides.

3. The application according to claim 2, characterized in that, The auxin-based herbicides include 2,4-D and dicamba.

4. The application according to claim 2, characterized in that, The gene encoding the Aux / IAA protein mutant of claim 1 is transferred into a recipient plant, thereby causing the recipient plant to express the Aux / IAA protein mutant.

5. The application according to claim 4, characterized in that, The encoding gene was transferred using Agrobacterium-mediated genetic transformation.

6. The application according to claim 4, characterized in that, The coding gene is regulated by a constitutive promoter.

7. The application according to claim 4, characterized in that, The Aux / IAA protein mutant can alleviate the root elongation inhibition and biomass reduction in recipient plants caused by auxin-based herbicides, and enable the plants to bolt and flower normally.

8. The application according to claim 7, characterized in that, The recipient plant is Arabidopsis thaliana.

Images