Rhizobium 2Y15 and application thereof

Abstract

The application discloses a rhizobium 2Y15. The application also discloses a bacterial agent prepared from the rhizobium 2Y15. The application further discloses applications of the rhizobium 2Y15 and the bacterial agent prepared from the rhizobium 2Y15 in preventing and treating sweet potato root rot, promoting growth of sweet potato plants and increasing sweet potato yield. The rhizobium 2Y15 has a significant antagonistic effect on the pathogenic fungus of sweet potato root rot, i.e. fusarium solani, and has multiple growth-promoting functions such as phosphorus solubilization (inorganic phosphorus and organic phosphorus), nitrogen fixation, potassium solubilization and production of auxin (IAA). Field test results show that the rhizobium 2Y15 has a good field prevention and control effect on the sweet potato root rot and has a significant growth-promoting and yield-increasing effect on the sweet potato. The rhizobium 2Y15 provided by the application provides an efficient and safe microbial solution for green prevention and control and efficient cultivation of the sweet potato continuous cropping obstacle.

Description

Technical Field

[0001] This invention relates to the field of agricultural microbial technology, specifically to a rhizobium strain 2Y15 and its applications. Background Technology

[0002] Sweet potato, as an important food and cash crop in agricultural production, is often affected by continuous cropping obstacles, leading to soil microbial imbalance, decreased nutrient utilization efficiency, and exacerbation of soil-borne diseases such as root rot and black spot, severely restricting sweet potato yield and quality. Among these, sweet potato root rot, caused by pathogenic fungi such as Fusarium solani, has become one of the major diseases in continuously cropped fields. While traditional chemical control has some effect, it still has many limitations. Therefore, exploring environmentally friendly and sustainable biological control and growth-promoting methods has become an important research direction for healthy sweet potato cultivation. Utilizing functional strains to regulate the rhizosphere microenvironment, inhibit pathogen growth, and promote crop growth is considered a promising green biological control strategy. However, the screening, identification, and disease resistance and growth-promoting effects of highly effective functional strains under field conditions still require systematic verification.

[0003] Therefore, this invention starts from the rhizosphere soil of sweet potato continuous cropping, and isolates and screens functional bacterial strains that have antagonistic effects on the pathogen of sweet potato root rot and also have growth-promoting potential, in order to provide theoretical and technical basis for the microbial control of sweet potato continuous cropping obstacles. Summary of the Invention

[0004] The purpose of this invention is to provide a rhizobium strain 2Y15 and its applications to address the shortcomings of existing technologies.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] The first aspect of this invention provides a rhizobium strain 2Y15, which is classified and named as follows: Rhizobium sp. 2Y15, Latin name For Rhizobium sp., deposited at the China Center for Type Culture Collection (CCTCC) on February 4, 2026, with accession number CCTCC NO: M 2026341.

[0007] A second aspect of the present invention provides a microbial agent prepared from the aforementioned Rhizobium 2Y15, wherein the viable bacteria concentration of the microbial agent is 1×10⁻⁶. 5 CFU / mL or higher. The live bacteria concentration can be adjusted as needed during application.

[0008] Further, the inoculant is prepared by the following method: Rhizobium 2Y15 is inoculated into a liquid culture medium for liquid fermentation to obtain 2Y15 fermentation stock solution, and the viable cell concentration of 2Y15 fermentation stock solution is adjusted to 1×10⁻⁶ using sterile water. 5The bacterial agent is obtained when the concentration of CFU / mL is above a certain level.

[0009] Furthermore, the liquid culture medium is LB liquid culture medium.

[0010] Furthermore, the liquid fermentation conditions are: temperature of 28-30℃, rotation speed of 170-190 rpm, and time of 2-3 days.

[0011] A third aspect of this invention provides the application of the aforementioned rhizobium 2Y15 in controlling sweet potato root rot, promoting sweet potato plant growth, and increasing sweet potato yield, wherein the sweet potato root rot is caused by Fusarium solani. Fusarium solani (Mart.)Sacc. f. sp. batatas McClure caused this; the promotion of sweet potato plant growth is to increase the height of sweet potato plants and promote tuber enlargement.

[0012] The fourth aspect of this invention provides the application of the above-mentioned inoculant in controlling sweet potato root rot, promoting sweet potato plant growth, and increasing sweet potato yield, wherein the sweet potato root rot is caused by Fusarium solani. Fusarium solani (Mart.) Sacc. f.sp. batatas McClure caused this; the promotion of sweet potato plant growth is to increase the height of sweet potato plants and promote tuber enlargement.

[0013] Furthermore, the agent is applied twice: once on the day of sweet potato seedling cutting and once on the 10th-15th day after cutting. It is applied by root irrigation, with 100-150 mL of the agent applied to each sweet potato seedling each time.

[0014] The beneficial effects of this invention are:

[0015] This invention screened a rhizobium strain, 2Y15, which exhibits significant antagonistic activity against *Fusarium solani*, the pathogen causing sweet potato root rot. This strain also possesses multiple growth-promoting functions, including phosphorus solubilization (both inorganic and organic phosphorus), nitrogen fixation, potassium solubilization, and the production of growth regulators (IAA). Field trials showed that application of 2Y15 effectively reduced the disease index of sweet potato root rot, demonstrating excellent field control of the disease. Simultaneously, it significantly increased sweet potato plant height, promoted tuber enlargement, and improved the average weight of individual tubers and the average weight of all tubers per plant, resulting in a significant growth-promoting and yield-increasing effect. The rhizobium 2Y15 provided by this invention offers an efficient and safe microbial solution for the green control and high-efficiency cultivation of sweet potato continuous cropping obstacles. Attached Figure Description

[0016] Figure 1 Photographs showing the plate confrontation effect of strain 2Y15 and Fusarium solani.

[0017] Figure 2This is a photograph of the colony morphology of strain 2Y15.

[0018] Figure 3 Phylogenetic tree of strain 2Y15 constructed based on the 16S rRNA gene sequence.

[0019] Figure 4 Photographs of plates used to test the inorganic phosphorus solubility of strain 2Y15.

[0020] Figure 5 Photographs of plate tests for the organophosphate solubility of strain 2Y15.

[0021] Figure 6 This is a plate image showing the nitrogen fixation capacity of strain 2Y15.

[0022] Figure 7 Photographs of plate tests for potassium solubilization ability of strain 2Y15.

[0023] Figure 8 A bar graph showing the ability of strain 2Y15 to produce auxin.

[0024] Figure 9 These are photos comparing the size of sweet potato tubers treated differently in Example 3.

[0025] Figure 10 Example 3 is a bar chart comparing the plant height of sweet potato plants under different treatments.

[0026] Figure 11 Example 3 is a bar chart comparing the average weight of a single tuber from a single plant under different treatments.

[0027] Figure 12 Example 3 is a bar chart comparing the average weight of all tubers from a single plant under different treatments.

[0028] Figure 13 Example 3 is a bar chart comparing the disease index of sweet potato root rot under different treatments.

[0029] Note: **** in the figure indicates P < 0.0001.

[0030] Information on the preservation of biological materials

[0031] 2Y15, categorized and named Rhizobium sp. 2Y15, Latin name Rhizobium sp., deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, on February 4, 2026, with accession number CCTCC NO: M 2026341. Detailed Implementation

[0032] The following embodiments and accompanying drawings are provided to better understand the present invention, but should not be construed as limiting the invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.

[0033] The culture medium formulations involved in the following examples are as follows:

[0034] R2A liquid culture medium: purchased from Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd., product number HB0167-2. R2A solid culture medium: 15 g / L of agar powder was added to the R2A liquid culture medium.

[0035] LB liquid medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L. LB solid medium: LB liquid medium with 15 g / L agar powder added.

[0036] YMB culture medium: purchased from Beijing Coolaber Technology Co., Ltd., brand name Coolaber. ® The product number is MM5010.

[0037] YMA culture medium: purchased from Beijing Coolaber Technology Co., Ltd., brand name Coolaber. ® The product number is MM5011.

[0038] PDA culture medium: purchased from Beijing Solarbio Technology Co., Ltd., brand name Solarbio. ® The product number is P8931.

[0039] Organophosphate bacteria culture medium: purchased from Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd., product number HB8549-1.

[0040] Inorganic phosphorus bacteria culture medium: purchased from Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd., product number HB8549-2.

[0041] Ashube's nitrogen-free medium: purchased from Alashan (Guangzhou) Biotechnology Co., Ltd., brand name CHINOOK. ® The product number is CN250399.

[0042] Potassium-solubilizing medium: purchased from Alashan (Guangzhou) Biotechnology Co., Ltd., brand name CHINOOK ® The product number is CN250037.

[0043] YN liquid culture medium: sucrose 10.0 g / L, yeast extract 0.5 g / L, NaCl 0.1 g / L, (NH4)2SO4 1.0 g / L, K2HPO4 1.0 g / L, MgSO4·7H2O 0.5 g / L, pH 7.2.

[0044] Unless otherwise specified, the plates (petition dishes) used in the following examples are all 90 mm in diameter.

[0045] Example 1: Isolation, screening and identification of functional strains

[0046] 1.1 Isolation of functional strains (bacteria)

[0047] Rhizosphere soil samples were collected from sweet potato plants with mild root rot in Xiangfu District, Kaifeng City, Henan Province (34°45′29.3″N, 114°26′5.5″E) that had been continuously planted for three years. 10 g of rhizosphere soil was placed in a sterile Erlenmeyer flask containing 100 mL of sterile water, with three replicates. The flasks were incubated at 30°C and 180 rpm for 6 h to prepare a soil suspension. The soil suspension was diluted using a serial dilution method: 100 μL of the soil suspension was added to 900 μL of sterile water and vortexed for 10 s to obtain a dilution of 10-10. -1 Soil suspension; serially diluted to obtain a dilution of 10. -8 Soil suspension. Take 100 μL of each diluted to 10... -5 10 -6 10 -7 10 -8 Soil suspensions were evenly spread onto R2A, LB, and YMA solid agar plates. Using three different media allows for the isolation of more strains due to varying nutritional requirements of soil microorganisms. Plates were incubated at 30°C for 2-3 days, and colony growth was observed. If the number of colonies on the plate was too low, the incubation time was appropriately extended. Single colonies with different morphologies were picked, purified, and then transferred to test tubes containing the corresponding liquid media (R2A, LB, and YMB media), labeled, and incubated at 30°C with shaking at 180 rpm for 1-2 days. 750 μL of the bacterial suspension was thoroughly mixed with 750 μL of 30% (v / v) sterile glycerol, pre-frozen at -20°C for approximately 12 hours, and then transferred to -80°C for storage. The mixture can be revived and used as needed for subsequent experiments.

[0048] 1.2 Screening of functional strains

[0049] The pathogen tested in this experiment was *Fusarium solani*, a pathogen causing sweet potato root rot. Fusarium solani (Mart.)Sacc. f. sp. batatas McClure.

[0050] Preparation of cryopreservation solution: Add 10 g of glucose, 1 g of yeast extract, 0.5 g of enzymatically hydrolyzed casein (purchased from Beijing Solarbio Technology Co., Ltd., brand name Solarbio®, catalog number C8210), and 0.5 g of acid-hydrolyzed casein (purchased from Beijing Solarbio Technology Co., Ltd., brand name Solarbio®, catalog number C8221) to deionized water in sequence, and stir until completely dissolved; then add 180 mL of glycerol, and bring the volume to 1000 mL with deionized water. Autoclave at 121℃ for 20 min for later use.

[0051] Fusarium solani was inoculated onto PDA agar plates and incubated at 26°C. After the mycelium had fully colonized the plates, 5 mm diameter Fusarium solani mycelial cakes were punched out using a sterile punch. Five cakes were placed in 1.6 mL of sterile cryopreservation solution and subjected to gradient cooling: 4°C for 2 h, -20°C for 2 h, and finally transferred to -80°C for long-term storage. The mycelial cakes can be revived and used as needed in subsequent experiments.

[0052] Preparation of functional bacterial suspensions: Single colonies of each functional strain isolated and purified in Section 1.1 were picked and inoculated into 50 mL Erlenmeyer flasks containing 20 mL of the corresponding liquid culture medium (R2A liquid medium, LB liquid medium, and YMB medium), respectively. The flasks were incubated at 30℃ and 180 rpm with shaking for 12 h, centrifuged at 6000 rpm for 10 min, and the bacterial cells were collected. The cells were washed twice with sterile physiological saline (0.85% (wt) NaCl), resuspended in sterile water, and the OD of the bacterial suspension was adjusted with sterile water. 600 =1.0 (for backup)

[0053] Take *Fusarium solani* mycelium cakes stored at -80℃ and transfer them to PDA medium plates for activation at 26℃. Once the mycelium has fully colonized the plate, use a sterile punch to create 5 mm diameter *Fusarium solani* mycelium cakes and inoculate them into the center of a new PDA medium plate. Select four directional sites on the circumference 2 cm from the edge of the *Fusarium solani* mycelium cake, and add 5 μL of OD to each site. 600 =1 functional strain bacterial suspension, with 3 replicates for each functional strain; an equal volume of sterile water droplets were added as a control (CK). All plates were incubated at 26℃. The growth status of Fusarium solani was observed daily and the colony diameter was measured. The inhibition rate of each functional strain against Fusarium solani was calculated using the following formula:

[0054] Inhibition rate = (Coronavirus diameter of control group - Coronavirus diameter of experimental group) ÷ Coronavirus diameter of control group × 100%.

[0055] Seven functional bacterial strains (bacteria) exhibiting antagonistic effects against *Fusarium solani* were obtained through plate confrontation screening. The inhibition rates are shown in Table 1. Strain 2Y15 showed the best antagonistic effect and was selected as the target strain for subsequent experiments. The plate confrontation effect of this strain against *Fusarium solani* is shown in Table 1. Figure 1 .

[0056] Table 1

[0057] functional strains 2Y15 1Y18 5L14 2L34 4L7 1Y12 4R3 Antibacterial rate (%) 38.90 17.14 33.36 18.53 24.67 15.32 31.35

[0058] 1.3 Identification of Functional Strains

[0059] The bacterial suspension of strain 2Y15, stored at -80℃, was taken out and inoculated onto LB agar plates using a four-zone streak method. Activation was achieved by incubation at 30℃ for 24 hours. After activation, the colonies of strain 2Y15 were round, discretely distributed, pale yellow, hemispherical, smooth and glossy, with regular edges and uniform texture. Figure 2 ).

[0060] Genomic DNA of strain 2Y15 was amplified by PCR using universal primers 27F / 1492R for the bacterial 16S rRNA gene. The primer sequences were: 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1); 1492R: TACGGCTACCTTGTTACGACTT (SEQ ID NO.2).

[0061] PCR amplification reaction system (25 μL): 12.5 μL of 2×Taq PCR Master Mix, 1 μL of upstream primer (10 μmol / L), 1 μL of downstream primer (10 μmol / L), 1.5 μL of template DNA, and sterile ultrapure water to a final volume of 25 μL.

[0062] PCR amplification reaction conditions: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 90 s, for a total of 35 cycles; 72℃ final extension for 10 min, and storage at 4℃ for later use.

[0063] After the PCR products passed the agarose gel electrophoresis test, they were sent to Beijing Qingke Biotechnology Co., Ltd. for bidirectional sequencing to obtain the 16S rRNA gene sequence of strain 2Y15, as shown in SEQ ID NO.3.

[0064] The 16S rRNA gene sequence of strain 2Y15 was BLAST-aligned with the NCBI GenBank database, and the results showed that the sequence was consistent with... Rhizobium The genus of strains showed the highest sequence similarity, reaching 99%. A phylogenetic tree was constructed using representative closely related reference sequences (see [link to phylogenetic tree]). Figure 3 Phylogenetic tree analysis showed that strain 2Y15 and Rhizobium nepotum NJ004、 Rhizobium rubi The LMG 156 cluster is within the evolutionary branch with a break value of 88; Rhizobium nepotum NJ004 and Rhizobium rubi LMG 156 forms a subbranch with a development value of 98, and strain 2Y15 forms an independent clade within this major branch. Based on the colony morphology characteristics, BLAST alignment of the 16S rRNA gene sequence, and phylogenetic analysis, strain 2Y15 is identified as belonging to the genus *Rhizobium*. Rhizobium strain 2Y15 was deposited at the China Center for Type Culture Collection (CCTCC) on February 4, 2026, with accession number CCTCC NO: M 2026341.

[0065] Example 2: Test of growth-promoting ability of functional strains

[0066] Preparation of 2Y15 bacterial culture: The strain 2Y15, which was stored at -80℃, was activated by streaking on LB solid medium and cultured at 30℃ for 24 h. Single colonies were picked and cultured in LB liquid medium at 30℃ and 180 rpm until the logarithmic growth phase to obtain 2Y15 bacterial culture.

[0067] 2.1 Phosphorus solubility test

[0068] This experiment used two sets of culture media for detecting inorganic phosphorus and organic phosphorus: inorganic phosphorus was detected using inorganic phosphorus bacteria medium, and organic phosphorus was detected using organic phosphorus bacteria medium. 5 μL of 2Y15 bacterial suspension was spotted onto the center of each type of medium plate and incubated at 30℃ for 3 days. The presence of a clear zone around the 2Y15 colony was observed. The formation of a clear zone indicates that the strain has a certain phosphorus-solubilizing ability; the larger the clear zone, the stronger the phosphorus-solubilizing ability of the strain.

[0069] The results of the inorganic phosphorus bacteria culture medium are shown in the figure. Figure 4 This confirmed that strain 2Y15 can dissolve inorganic phosphorus. Results of organic phosphorus bacteria culture are shown below. Figure 5 This confirmed that strain 2Y15 can also dissolve organophosphates.

[0070] 2.2 Nitrogen fixation capacity test

[0071] 5 μL of 2Y15 bacterial culture was inoculated onto the center of an Assumption nitrogen-free medium plate and incubated at 30℃ for 3 days. The presence of a clear zone around the 2Y15 colony was observed. The formation of a clear zone indicates that the strain can fix nitrogen using atmospheric nitrogen, and the diameter of the clear zone is positively correlated with nitrogen fixation capacity. The culture results are shown below. Figure 6A clear hydrolysis zone was visible around the colony, proving that strain 2Y15 has nitrogen-fixing ability.

[0072] 2.3 Potassium solubilization capacity test

[0073] 5 μL of 2Y15 bacterial culture was inoculated onto the center of a potassium-solubilizing medium plate and incubated at 30℃ for 3 days. The growth of strain 2Y15 was then observed. This potassium-solubilizing medium contains insoluble potassium; normal growth of the strain indicates its ability to decompose insoluble potassium and thus possess potassium-solubilizing function. The culture results are shown below. Figure 7 Strain 2Y15 can grow normally on potassium-solubilizing medium, proving that the strain has the ability to decompose insoluble potassium minerals.

[0074] 2.4 Test of ability to produce longin (IAA)

[0075] Prepare a 2.5 mg / mL tryptophan solution and store it in the dark. Before use, filter it through a 0.22 µm sterile filter membrane for sterilization. Take a 10 mL centrifuge tube and dispense 4 mL of YN liquid culture medium. Add 1 mL of the filtered and sterilized tryptophan solution under dark conditions to obtain YN liquid culture medium with a tryptophan concentration of 0.5 mg / mL.

[0076] Take OD 600 =1.0 of 2Y15 bacterial suspension (prepared as in Section 1.2 of Example 1) was inoculated into YN liquid medium with tryptophan concentration of 0.5 mg / mL at an inoculation ratio of 1% (v / v). The culture was incubated at 30°C and 200 rpm for 3 days with shaking. 2 mL of the culture was transferred to a sterile 2 mL centrifuge tube and centrifuged at 6000 rpm for 10 min. The supernatant was collected. An equal volume of sterile water was used as a control.

[0077] Take 500 µL of supernatant and add 25 µL of 10 mM phosphoric acid and 1 mL of Sackowki's colorimetric reagent (preparation of Sackowki's colorimetric reagent: slowly add 150 mL of concentrated sulfuric acid along the wall of the beaker to 250 mL of deionized water, cool, and then add 7.5 mL of 0.5 mol / L FeCl3 solution). Mix thoroughly and react in the dark at room temperature for 30 min.

[0078] After the reaction in the dark is complete, the absorbance of the reaction solution is measured at 530 nm using a spectrophotometer. The zeroing point is set using a control reaction solution.

[0079] IAA standard curve plotting: Prepare a series of IAA standard solutions with concentrations of 0, 5, 10, 20, 40, 60, and 80 mg / L, and use the same colorimetric treatment. Measure the absorbance at 530 nm. Plot the IAA standard solution concentration (mg / L) on the x-axis and the OD curve on the y-axis.530 The absorbance value is used as the ordinate to plot the IAA standard curve. The IAA content in the supernatant is calculated based on the absorbance value of the sample. The higher the calculated value, the stronger the ability of the strain to produce auxin.

[0080] Quantitative detection results as follows Figure 8 As shown, strain 2Y15 can produce auxin IAA.

[0081] Example 3: Field trial of the effect of inoculating functional strains on the growth promotion and root rot resistance of sweet potato.

[0082] 3.1 Preparation of working solutions for functional strains

[0083] The strain 2Y15, stored at -80℃, was activated by streaking on LB solid medium and cultured at 30℃ for 24 h. A single colony was picked and inoculated into 3 mL of LB liquid medium and cultured with shaking at 30℃ and 180 rpm until the logarithmic growth phase to obtain the primary seed culture of strain 2Y15.

[0084] The above-mentioned 2Y15 primary seed culture was inoculated into 300 mL of LB liquid medium at an inoculation ratio of 1% (v / v), and fermented at 30℃ and 180 rpm for 48 h with shaking to obtain the 2Y15 fermentation stock broth; the viable cell concentration of the 2Y15 fermentation stock broth was 1×10⁻⁶. 7 -1×10 8 CFU / mL. Dilute 300 mL of the 2Y15 fermentation stock solution with sterile water and bring the volume to 30-300 L. Mix thoroughly to obtain a viable cell concentration of 1×10⁻⁶. 5 2Y15 root irrigation working solution (CFU / mL).

[0085] 3.2 Field Trial Design and Field Management

[0086] The experimental plot was a sweet potato field in Xiangfu District, Kaifeng City, Henan Province, which had been continuously planted with sweet potatoes for three consecutive years. During the previous sweet potato harvest, large-scale root rot and a significant decrease in yield were observed, indicating that the field was severely affected by continuous cropping and root rot. The soil naturally carried the pathogen of sweet potato root rot, Fusarium solani. Fusarium solani (Mart.) Sacc. f. sp. batatas McClure.

[0087] The tested sweet potato variety was Pushu 32. The experiment was set up with 2 treatments, and each treatment had 3 biological replicate plots. The area of ​​a single plot was about 100 m², and each plot had 10 rows, with a row length of 10 m.

[0088] Treatment 1 (FS+2Y15 group): Root drenching was performed using 2Y15 root drenching solution: root drenching was performed once on the day of sweet potato seedling cutting and once on the 14th day after cutting, with 100 mL of 2Y15 root drenching solution per sweet potato seedling each time.

[0089] Treatment 2 (FS group, control): Root drenching was performed using sterile water (containing an equal volume of LB liquid medium to the 2Y15 root drenching working solution): root drenching was performed once on the day of sweet potato seedling cutting and once on the 14th day after cutting. Each sweet potato seedling was drenched with 100 mL of sterile water (containing an equal volume of LB liquid medium to the 2Y15 root drenching working solution) each time.

[0090] Field cultivation and management conditions were kept consistent across all plots. No chemical fertilizers, fungicides, insecticides, or other biological agents were applied throughout the entire experimental period to eliminate interference from exogenous fertilizers and pesticides on the experimental results. Water management was uniform across all treatments: water was supplemented according to soil moisture during the early growth stage; no additional irrigation was needed when soil water holding capacity was sufficient; and water was promptly supplemented in case of drought to ensure balanced water conditions across all plots until the sweet potatoes matured and were harvested. A total of three irrigations were actually conducted throughout the entire growth period of this experiment.

[0091] 3.3 Determination of indicators related to sweet potato growth promotion and yield increase, and investigation of the effect of sweet potato on resistance to root rot.

[0092] Determination of growth-promoting indicators during sweet potato maturity and harvest: Twelve sweet potato plants were randomly selected from each treatment. The entire plant was carefully dug up with a shovel, the roots were cleaned of soil, and the indicators were measured. The measured indicators included: ① Plant height: The vertical distance from the soil surface (i.e., the junction of the stem base and the ground) to the tip of the longest vine; ② Tuber weight and morphology: The fresh weight of all tubers on a single plant was measured (only mature tubers were counted) to obtain the average weight of all tubers on the plant. The average weight of a single tuber on the plant was also calculated. Tuber enlargement and growth morphology were observed and photographed. A disease grading survey was conducted on sweet potato root rot (caused by Fusarium solani), and a 5-level grading standard (0-4 levels) was used to evaluate the degree of root damage in sweet potato plants:

[0093] Grade 0: No root rot or browning symptoms;

[0094] Grade 1: Slight browning of the vascular bundles in the roots, with the browned cross-sectional area accounting for ≤25% of the total cross-sectional area of ​​the roots;

[0095] Grade 2: Obvious browning of the vascular bundles in the roots, with 25% < browning area accounting for ≤50% of the total cross-sectional area of ​​the roots;

[0096] Grade 3: Severe browning of the vascular bundles in the roots, with 50% < browning area accounting for ≤75% of the total cross-sectional area of ​​the roots, and localized rot in the main root;

[0097] Grade 4: The vascular bundles of the root are completely necrotic and brown, with the browned cross-sectional area accounting for more than 75% of the total cross-sectional area of ​​the root. The main root is rotten and a large number of lateral roots die.

[0098] The root rot disease severity index is calculated using the following formula:

[0099] Root rot disease severity index = Σ (number of diseased plants at each level × corresponding level) ÷ (total number of plants surveyed × highest disease level) × 100%

[0100] Productivity-related results such as Figure 9-12 As shown, the application of 2Y15 root irrigation solution can significantly increase the height of sweet potato plants, promote tuber enlargement, increase the average weight of a single tuber per plant and the average weight of all tubers per plant, confirming that strain 2Y15 has a significant growth-promoting and yield-increasing effect on sweet potatoes.

[0101] Sweet potato root rot disease severity index results as follows Figure 13 As shown, the application of 2Y15 root irrigation solution can significantly reduce the disease index of sweet potato root rot, indicating that strain 2Y15 has a good field control effect on sweet potato root rot.

Claims

1. A rhizobium strain 2Y15, characterized in that, Its classification is named Rhizobium sp. 2Y15, Latin name Rhizobium sp., deposited at the China Center for Type Culture Collection (CCTCC) on February 4, 2026, with accession number CCTCC NO: M 2026341.

2. The inoculum prepared from Rhizobium 2Y15 according to claim 1, characterized in that, The viable bacteria concentration of the bacterial agent is 1×10⁻⁶. 5 CFU / mL or higher.

3. The inoculum prepared from Rhizobium 2Y15 according to claim 2, characterized in that, The microbial agent was prepared by the following method: Rhizobium 2Y15 was inoculated into a liquid culture medium for liquid fermentation to obtain 2Y15 fermentation stock solution, and the viable bacteria concentration of 2Y15 fermentation stock solution was adjusted to 1×10⁻⁶ with sterile water. 5 The bacterial agent is obtained when the concentration of CFU / mL is above a certain level.

4. The microbial agent according to claim 3, characterized in that, The liquid culture medium is LB liquid culture medium.

5. The microbial agent according to claim 3, characterized in that, The liquid fermentation conditions are: temperature 28-30℃, rotation speed 170-190 rpm, and time 2-3 days.

6. The application of the rhizobium 2Y15 described in claim 1 in controlling sweet potato root rot, promoting sweet potato plant growth, and increasing sweet potato yield, characterized in that, The sweet potato root rot is caused by Fusarium solani. Fusarium solani (Mart.) Sacc.f. sp. batatas McClure caused this; the promotion of sweet potato plant growth is to increase the height of sweet potato plants and promote tuber enlargement.

7. The application of the microbial agent according to any one of claims 2-5 in controlling sweet potato root rot, promoting sweet potato plant growth, and increasing sweet potato yield, characterized in that, The sweet potato root rot is caused by Fusarium solani. Fusarium solani (Mart.)Sacc. f. sp. batatas McClure caused this; the promotion of sweet potato plant growth is to increase the height of sweet potato plants and promote tuber enlargement.

8. The application according to claim 7, characterized in that, Apply the fungicide twice, once on the day of sweet potato seedling cutting and once on the 10th-15th day after cutting. Apply by root irrigation, using 100-150 mL of the fungicide per sweet potato seedling each time.

Images