DNA functionalized iron-based ZIF-8 material applied to tumor cell killing and preparation method thereof

Abstract

The application provides a kind of DNA functionalized iron-based ZIF-8 probe for application in tumor cell killing, including H1 chain, H2 chain, ZIF-8, iron ion, glucose oxidase (GOx), hyaluronic acid (HA);The ZIF-8 is formed by the reaction of Zn (NO3) 2·6H2O and 2-methylimidazole;The H1 chain and H2 chain are hairpin structures, and the sequences are shown in SEQ ID NO:1-2 respectively, and the DNAzyme active center targeting GPX4 and VEGFR-2 is embedded respectively;And H2 is modified with a fluorescent group and a quenching group;The nano reactor of the application has good performance, can make up for the defects and deficiencies of existing detection methods of tumor biomarkers, and provides a new idea for the design of precise nano diagnosis and treatment platform based on functional nucleic acids and MOFs cooperation.

Description

Technical Field

[0001] This invention belongs to the field of biomarker detection and tumor treatment technology, specifically relating to an AD@FeG@ZIF-8 nanoreactor for detecting miRNA-21 and APE1 and having tumor treatment function. Background Technology

[0002] Because tumor cells and tissue cells differ significantly in metabolic rate and biophysical environment, some common substances (such as microRNA (miRNA), mRNA, ATP, GSH, proteins / enzymes, etc.) exhibit abnormally high levels both inside and outside tumor cells; these substances are biomarkers. Imaging these biomarkers using DNA nanoparticle drug delivery systems enables early diagnosis and treatment of cancer cells. miRNAs are small, non-coding, single-stranded RNA molecules of 18-25 nucleotides in length, playing important regulatory roles in many life processes, including cell growth, proliferation, and differentiation, and are promising tumor biomarkers. Apurinol / pyrimidine endonuclease 1 (APE1) is a DNA repair enzyme involved in nucleotide damage repair and transcription factor regulation, possessing anti-apoptotic functions, and is one of the promising tumor biomarkers; its subcellular distribution is crucial for tumor detection. This suggests that APE1 activity can be used to assess disease progression and as a prognostic indicator to monitor tumor sensitivity or resistance to drug therapy or radiotherapy / chemotherapy. Some tumor markers are not expressed only on specific tumor cells. Most of the currently reported biosensing strategies only detect single tumor markers, which easily leads to false positive signals. This greatly hinders the early diagnosis and precision treatment of cancer.

[0003] Functional nucleic acids (FNAs), with their sequence designability, high specificity, and catalytic activity, can achieve a variety of functions such as targeted recognition, multi-marker logical judgment and signal amplification, and gene silencing. Metal-organic frameworks (MOFs), especially iron-doped zeolite imidazole ester framework-8 (Fe@ZIF-8), have high specific surface area, good biocompatibility, pH-responsive degradation characteristics, and chemokinetic therapeutic functions. Both provide an ideal platform for constructing intelligent nanomedical systems. Summary of the Invention

[0004] To achieve more sensitive and efficient simultaneous detection of two tumor biomarkers, miRNA and APE1, this invention proposes a highly sensitive iron-doped AD@FeG@ZIF-8 nanoreactor based on HCR reaction for the detection of miRNA and APE1 in tumor cell environmental factors and for cellular-level tumor synergistic therapy. This invention can overcome the deficiencies and shortcomings of existing tumor biomarker detection methods and provide new ideas for the design of precision nanodiagnostic and therapeutic platforms based on the synergy of functional nucleic acids and MOFs.

[0005] To achieve the above objectives, the present invention adopts the following technical solution.

[0006] A DNA-functionalized iron-based ZIF-8 nanomaterial, abbreviated as AD@FeG@ZIF-8, wherein the ZIF-8 surface is loaded with H1 chains, H2 chains and hyaluronic acid, and the interior is encapsulated with ferrous ions and glucose oxidase; the H1 chains and H2 chains have a hairpin structure. The nucleotide sequences of the H1 and H2 chains are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; and, the 16th position of the H1 chain is an AP site; the 31st nucleotide of the H2 chain is modified with a fluorescent group, and the 83rd nucleotide is modified with a quenching group. Preferably, the fluorescent group is FAM, and the quenching group is BHQ1.

[0007] A method for preparing the above-mentioned AD@FeG@ZIF-8 nanomaterial includes the following steps: (1) 2-methylimidazole, GOx, zinc nitrate and ferrous chloride were stirred and reacted in water, and the solid was separated and dried to obtain the intermediate product FeG@ZIF-8; (2) Mix the solution of H1, H2 and hyaluronic acid (HA) with the suspension of intermediate product FeG@ZIF-8, separate the solid and liquid and wash the solid to obtain nanomaterial AD@FeG@ZIF-8.

[0008] The molar ratio of zinc nitrate to 2-methylimidazole is 1:5-10. The mass ratio of zinc nitrate to GOx is 4:1, and the molar ratio of zinc nitrate to ferrous chloride is 5-10:1.

[0009] The molar ratio of FeG@ZIF-8 to H1 is 1:1000-1500; the molar ratio of FeG@ZIF-8 to H2 is 1:1000-1500; and the mass ratio of hyaluronic acid to FeG@ZIF-8 is (3-5):1.

[0010] A kit and drug for the above-mentioned AD@FeG@ZIF-8 nanomaterials.

[0011] The kit also includes standards for the target miRNA 21 and / or APE1.

[0012] The detection principle of this invention is as follows: Figure 1 As shown, the sequences are as follows: H1: 5'-CTAGCCAAATAGCTT / idSp / ATCAGACTGATGTTGTTTTTTTGCTCCTCGTT GAATTCGTGCA GGCTAGCTACAACGAGGAGCGCGCGCGCATCAACATCAGTCTGATAAGCTATTTGGCAAG-3'; H2: 5'-CGAGGACGAAAAAAAACAACATCAGTCTGAT(FAM) TGCTCTCCAGGCTAGCTACAACGACCT GCACCTAGCTAGCCAAATAGCTTAT(BHQ1)CAGACTGATGTTG-3'; The H1 chain contains the AP site ( / idSp / ), and the H2 chain is modified with both a fluorescent group and a quenching group. The underlined part in the H1 chain is the GPX4 DNAzyme sequence, and the underlined part in the H2 chain is the VEGFR-2 DNAzyme active site.

[0013] Tumor cells highly express hyaluronic acid receptors such as CD44 on their surface. AD@FeG@ZIF-8 cells, through their surface hyaluronic acid (HA), enter tumor cells more extensively under the mediation of CD44. In the more acidic environment of tumor cell lysosomes, the following reactions occur: 1. Acid-responsive degradation and release functional component After the nanoreactor enters the lysosomes of tumor cells, the ZIF-8 framework degrades and releases Fe under acidic conditions. 2+ The sample contains glucose oxidase (GOx) and two DNA hairpins H1 and H2 adsorbed on the surface. H1 has an AP site at its 5' end, and H2 is labeled with both the FAM fluorescent group and the BHQ1 quenching group. Initially, the two are close to each other, causing the fluorescence to be quenched.

[0014] 2. Dual-target "AND" logic gate recognition After H1 and H2 are released into the cytoplasm, the reaction is activated only when both target molecules miR-21 and APE1 are present in the tumor cells: APE1 specifically cleaves the AP site on H1 to release the hairpin spatial lock, while miR-21 acts as the initiating chain to hybridize with H1, and the two work together to trigger the hybridization chain reaction (HCR).

[0015] 3. HCR initiation and fluorescence signal recovery After the HCR reaction is initiated, H1 and H2 alternately hybridize to form long-chain DNA, causing the FAM fluorescent group and the BHQ1 quenching group to separate and move away from each other due to spatial separation. This relieves the quenching effect of BHQ1 on FAM, allowing the FAM fluorescence signal to be restored and enabling in situ specific imaging of tumor cells.

[0016] 4. HCR exposure of DNAzyme active site initiates gene silencing While restoring the fluorescence signal, the HCR reaction also exposes the active centers of the GPX4 DNAzyme and VEGFR-2 DNAzyme, which were originally locked by the hairpin structure. These two DNAzymes target and silence the GPX4 and VEGFR-2 genes, respectively, thereby blocking the antioxidant defense mechanism of tumor cells and inhibiting tumor angiogenesis.

[0017] In summary, regarding diagnostic specificity, the introduction of a DNA logic gate with APE1 and miR-21 as dual input signals allows HCR to be triggered and fluorescence signals to be restored only when both tumor markers are present simultaneously, effectively reducing the risk of false positives and significantly improving diagnostic accuracy. Regarding therapeutic synergy, a portion of the functional nucleic acid hairpin is designed as a DNAzyme active domain targeting GPX4 and VEGFR-2, enabling it to inhibit the expression of antioxidant-related genes and block tumor angiogenesis, respectively, during the response process, thereby achieving precise and synergistic treatment of breast cancer.

[0018] The present invention has the following advantages: The material of this invention introduces a DNA logic gate with APE1 and miR-21 as dual input signals, which can only trigger HCR and restore fluorescence signal when both tumor markers are present simultaneously, effectively reducing the risk of false positives and significantly improving diagnostic accuracy. At the therapeutic synergy level, a portion of the functional nucleic acid hairpin is designed as a DNAzyme active domain targeting GPX4 and VEGFR-2, which inhibits the expression of antioxidant-related genes and blocks tumor angiogenesis during the response process, thereby achieving efficient induction of tumor apoptosis. This design provides a new approach for constructing an intelligent nanoplatform integrating visualized diagnosis and multimodal synergistic therapy. Attached Figure Description

[0019] Figure 1 This is a schematic diagram illustrating the principle of a nanoreactor; Figure 2 These are the XRD patterns of ZIF-8 and FeG@ZIF-8; Figure 3 These are microstructure analysis images of ZIF-8 and AD@FeG@ZIF-8; where a is a TEM image of ZIF-8, b is a TEM image of AD@FeG@ZIF-8, c is a SEM image of AD@FeG@ZIF-8, the inset is a normal distribution map of the size obtained from simulation calculation, and d is an EDS diagram of the elemental distribution of zinc (Zn), carbon (C), nitrogen (N), oxygen (O), phosphorus (P), sulfur (S), and iron (Fe) in AD@FeG@ZIF-8.

[0020] Figure 4These are material characterization diagrams of ZIF-8 and its functionalized modifications; where a is the zeta potential diagram and b is the FT-IR spectrum of AD@FeG@ZIF-8.

[0021] Figure 5 This is a graph showing the catalytic activity of the AD@FeG@ZIF-8 nanozyme; where a is the pH change of the reaction system over time, and b is the peroxidase-like activity assay.

[0022] Figure 6 The graphs show the successful loading and loading rate characterization of each functional component; where a is the fluorescence curve of free GOx and GOx encapsulated in ZIF-8; b is the normalized fluorescence of a. Figure 7 The graph shows the successful loading and loading rate characterization of each functional component; where a is the fluorescence curve of free fluorescent hairpin (Y-DNA) and Y-DNA adsorbed in ZIF-8; b is the normalized fluorescence of a.

[0023] Figure 8 This is a diagram showing the successful loading of each component as verified by ultraviolet light; Figure 9 This is a diagram illustrating the principle and verification of the HCR-DNAzyme signal amplification system; where a is a schematic diagram of dual-target triggering of HCR and activation of DNAzyme cleavage, b is a PAGE diagram verifying dual-target induced HCR, and c is a PAGE diagram verifying DNAzyme cleavage activity.

[0024] Figure 10 This is a feasibility verification diagram of AD@FeG@ZIF-8 initiated by miR-21 / APE1; where a is a schematic diagram of the "AND" logic circuit, b is the fluorescence spectrum of different treatments, and c is a quantitative comparison diagram of the fluorescence peak intensity at 525 nm obtained from the data in (b).

[0025] Figure 11 This is an analytical performance evaluation chart of the AD@FeG@ZIF-8 system; where a is the fluorescence response of the AD@FeG@ZIF-8 system to different concentrations of miR-21, b is the relationship curve between the fluorescence peak intensity at 525 nm and the miR-21 concentration, and c is the standard curve of the fluorescence peak intensity versus the logarithm of the miR-21 concentration.

[0026] Figure 12 This is an analytical performance evaluation graph of the AD@FeG@ZIF-8 system; where a is the fluorescence response of the AD@FeG@ZIF-8 system to different concentrations of APE1, b is the relationship curve between the fluorescence peak intensity at 525 nm and the APE1 concentration, and c is the standard curve of the fluorescence peak intensity versus the logarithm of the APE1 concentration.

[0027] Figure 13Figure 1 shows the analytical performance evaluation of the AD@FeG@ZIF-8 system. Figure 2a evaluates the specificity of the target miR-21 relative to the mutant sequence (Mut) and other non-target miRNAs, and verifies the anti-interference ability when the mixed interfering agent coexists with the target. Figure 3b evaluates the specificity of the AD@FeG@ZIF-8 system for the target APE1 relative to other interfering enzymes, and verifies the anti-interference ability when the mixed interfering agent coexists with the target.

[0028] Figure 14 The graph shows the cytotoxicity analysis under different treatment groups; where a is the MDA-MB-231 cytotoxicity analysis of ZIF-8, FeG@ZIF-8, AD@ZIF-8 and AD@FeG@ZIF-8, and b is the cell survival rate of AD@FeG@ZIF-8 co-incubated with different cells.

[0029] Figure 15 This is a graph assessing gene silencing and redox homeostasis of AD@FeG@ZIF-8 in MDA-MB-231 cells; where a is Western blot analysis of GPX4 and VEGFR-2 protein expression in MDA-MB-231 cells, b is an assessment of GSH production capacity in MDA-MB-231 cells, and c is an assessment of MDA production capacity in MDA-MB-231 cells. Detailed Implementation

[0030] The present invention will be further described below with reference to the embodiments and accompanying drawings, but the present invention is not limited to the following embodiments.

[0031] Example 1: Construction and Characterization of Nanomaterials 1. Construction of Nanomaterials (1) The modified H1 and H2 chains were commercially synthesized according to the sequence SEQ ID NO:1-2, and then the hairpin structures H1 and H2 were prepared according to the following steps: Oligonucleotides H1 and H2 were prepared as stock solutions and diluted to 20 μM with HEPES buffer (10 mM HEPES, 1 M NaCl, 50 mM MgCl2, pH=7.2). The solutions were then incubated in a 95°C water bath for 5 min and an ice bath for at least 15 min to obtain hairpin structures H1 and H2.

[0032] (2) Prepare AD@FeG@ZIF-8 according to the following steps: a. Preparation of FeG@ZIF-8 4.1 g of 2-methylimidazole was added to 20 mL of deionized water and stirred vigorously in a 38°C water bath until dissolved. Then, 50 mg of GOx (total enzyme activity: 7500 U) was slowly added, and the mixture was stirred continuously for 5 min. Then, 1.4 mL of 0.5 M Zn(NO3)2·6H2O aqueous solution was added, followed by 1.4 mL of 0.05 M FeCl2 aqueous solution. Finally, the product was collected by centrifugation, washed three times with pure water, and freeze-dried to obtain FeG@ZIF-8 nanoparticles.

[0033] ZIF-8 was prepared using the same method without the addition of GOx and FeCl2.

[0034] The freeze-dried ZIF-8 and FeG@ZIF-8 nanoparticles were ground into fine powders and pressed into uniform thin sheets using a tablet press. These sheets were then placed on the XRD stage of an XRD instrument, with the scanning angle set to 5°–50° and the scanning speed at 5° / min. XRD patterns were recorded, and the crystal structure and purity of the nanoparticles were verified by comparison with standard cards. The results are as follows: Figure 2 As shown, the XRD diffraction pattern of the synthesized material is in high agreement with the simulated pattern of single-crystal ZIF-8, indicating that the obtained product is pure-phase ZIF-8 and that doping did not change the crystal structure of ZIF-8.

[0035] b. Synthesis of AD@FeG@ZIF-8 Take 100 μL of the prepared H1 and H2 hairpin solution (20 μM), 100 μL of FeG@ZIF-8 nanoparticle dispersion (6 mg / mL), 200 μL of HA solution (10 mg / mL) and 500 μL of HEPES buffer, add them to a centrifuge tube, and magnetically stir at 300 r / min for 24 h at room temperature to allow H1, H2 and HA to fully bind to the FeG@ZIF-8 surface through electrostatic adsorption. Collect the product by centrifugation, wash it three times with pure water, and freeze-dry to obtain the nanoparticles AD@FeG@ZIF-8.

[0036] 2. Characterization of Nanomaterials The microstructure of the nanomaterials was characterized by scanning electron microscopy (SEM): 25 μL of clear nanomaterial dispersion was uniformly dropped onto the surface of a clean silicon wafer. After drying at room temperature, gold sputtering was performed to enhance the conductivity of the sample. The silicon wafer was then placed on the SEM sample stage, and the working voltage was set to 5 kV. The surface morphology and particle size distribution of the nanomaterials were observed and recorded.

[0037] High-resolution transmission electron microscopy (TEM) and its accompanying energy dispersive spectroscopy (EDS) were used to analyze the microstructure and elemental composition of the nanomaterials: 5 μL of clear nanomaterial dispersion was dropped onto the surface of a copper mesh, allowed to dry naturally, and then placed in the TEM sample chamber. The accelerating voltage was set to 0-200 kV to observe the internal structure and particle size of the nanomaterials. Elemental scanning of the nanomaterials was performed using the EDS system to determine their main elemental composition and distribution.

[0038] SEM and TEM images show that after GOx and Fe doping, AD@FeG@ZIF-8 exhibits a well-defined rhombic dodecahedral morphology with a smooth surface and a diameter of approximately 196.51 nm. Figure 3 c). No significant morphological differences were observed compared to undoped ZIF-8. X-ray energy dispersive spectroscopy showed that elements such as P, S, and Fe were uniformly dispersed in the nanosheets of AD@FeG@ZIF-8. Figure 3 (d) indicates DNA, GOx and Fe 2+ Successful loading.

[0039] The surface charge of nanomaterials was analyzed using a nanoparticle size and ZETA potential analyzer: ultrapure aqueous dispersions of nanomaterials were taken, placed in a ZETA potential sample cell, and then analyzed in the analyzer. Each sample was analyzed in parallel three times, and the average value was taken as the final ZETA potential value to analyze the changes in the surface charge of the nanomaterials.

[0040] Zeta potential analysis showed that the ZIF-8 surface was positively charged (+22.0 mV). After incorporation of GOx and Fe²⁺, the potential decreased to +6.0 mV. Further adsorption of negatively charged DNA hairpins and HA resulted in a potential reversal to -5.0 mV. Figure 4 (a)

[0041] The functional group structure of AD@FeG@ZIF-8 nanomaterials was analyzed using Fourier transform infrared spectroscopy (FT-IR). Small amounts of AD@FeG@ZIF-8 nanomaterial powder samples were mixed with dry potassium bromide (KBr) in a specific ratio, thoroughly ground in an agate mortar, and then pressed into transparent thin sheets. These sheets were then placed in the sample chamber of the FT-IR spectrometer for scanning, with a scanning range of 4000–400 cm⁻¹. -1 The resolution is 4 cm. -1 Record its infrared absorption spectrum and analyze the functional group composition and chemical bond changes of the nanomaterial.

[0042] The synthesis of AD@FeG@ZIF-8 was further confirmed by Fourier transform infrared spectroscopy (FT-IR). Figure 4 (b) FT-IR spectrum at 424 cm⁻¹-1 The presence of a distinct characteristic peak at 1650 cm⁻¹ indicates the presence of Zn-S bonds in AD@FeG@ZIF-8; -1 and 1580 cm -1 The appearance of two characteristic peaks at the point is mainly attributed to the stretching vibrations of amide I and amide II in GOx, further proving the successful loading of GOx.

[0043] The above results confirm that GOx and Fe 2+ It has been successfully encapsulated inside the ZIF-8 backbone, and the change in potential from positive to negative indicates that the DNA hairpin and HA are effectively adsorbed, laying the foundation for subsequent cellular uptake and targeted delivery.

[0044] 3. Catalytic activity of GOx (1) Real-time monitoring of the reaction process of GOx catalyzing glucose to gluconic acid using a pH meter: Prepare 5 mL of 17.6 mM glucose solution in a beaker, place it on a magnetic stirrer, insert a calibrated pH electrode, and add 5 mL of 600 μg / mL FeG@ZIF-8 solution after the reading stabilizes. Record the pH value change of the reaction solution continuously under magnetic stirring.

[0045] like Figure 5 As shown in Figure a, the pH of the reaction system decreases in the presence of GOx, while the pH remains essentially unchanged after treatment with ZIF-8 alone. This indicates that ZIF-8 alone cannot consume glucose to produce gluconic acid, but FeG@ZIF-8 carrying GOx can catalyze the decomposition of Glu, leading to a significant decrease in pH.

[0046] (2) Construct the detection system according to the following method: a) Mix 200 μL of 60 μg / mL FeG@ZIF-8 nanozyme dispersion, 100 μL of glucose solution (30 mM), and 100 μL of TMB solution (5 mM), then add 1.6 mL of NaAc-HAc buffer (0.1 M, pH 4), vortex to mix, and incubate at room temperature. Measure the absorbance at 452 nm using a UV-Vis spectrophotometer; this is FeG@ZIF-8+TMB+Glu. b) Following the method in a), replace FeG@ZIF-8 with ZIF-8 to construct the detection system, denoted as ZIF-8+TMB+Glu; c) Following the method in a), replace FeG@ZIF-8 with Fe@ZIF-8 to construct the detection system, denoted as Fe@ZIF-8+TMB+Glu; d) Following the method in a), replace FeG@ZIF-8 with G@ZIF-8 to construct the detection system, denoted as G@ZIF-8+TMB+Glu; e) Mix 100 μL of 60 μg / mL FeG@ZIF-8 nanozyme dispersion, 100 μL of H2O2 solution (0.5 mM), 100 μL of glucose solution (30 mM), and 100 μL of TMB solution (5 mM), then add 1.6 mL of NaAc-HAc buffer (0.1 M, pH 4), vortex to mix, and incubate at room temperature. Measure the absorbance at 452 nm using a UV-Vis spectrophotometer. This is the FeG@ZIF-8+H2O2+TMB+Glu solution. Depend on Figure 5 As can be seen from b, the addition of Fe at the same time 2+ The system with H2O2 exhibits the strongest absorption peak; Fe 2+ The system coexisting with glucose also showed a significant increase in absorbance, but the peak value was slightly lower than that of the group with added H2O2; while the Fe group lacking H2O2... 2+ Group, Fe-free 2+ The curves for both the control group and the blank control group were close to baseline, with no significant colorimetric changes. These results indicate that the colorimetric reaction on the AD@FeG@ZIF-8 platform is strictly dependent on Fe. 2+ Synergistic effect between the catalytic center and the H2O2 oxidation substrate.

[0047] 4. GOx Encapsulation Ratio Utilizing the characteristic fluorescence emission of glucose oxidase (GOx) at 350 nm under 280 nm excitation light, the encapsulation efficiency of GOx in a nanoreactor was determined by fluorescence spectroscopy: ZIF-8 and FeG@ZIF-8 nanoparticles were prepared, and unencapsulated free GOx was separated by centrifugation (12000 rpm, 10 min), and the supernatant was collected. The fluorescence intensity of the supernatant at 350 nm was measured using a fluorescence spectrophotometer at an excitation wavelength of 280 nm. Using the fluorescence intensity of an equal volume of GOx solution not incubated with the nanomaterials as a 100% reference, the encapsulation efficiency was calculated using the following formula: Encapsulation efficiency (%) = Among them, FL supernatant is the fluorescence intensity of the supernatant of the experimental group, and FL control is the fluorescence intensity of an equal volume of GOx solution in the control group.

[0048] like Figure 6 As shown in Figure a, the AD@FeG@ZIF-8 group exhibits a distinct characteristic fluorescence signal at 350 nm, while the blank ZIF-8 group shows no obvious emission peak at this wavelength, indicating that GOx has been successfully encapsulated within the nanocomposite material. Based on quantitative fluorescence intensity analysis... Figure 6 (b) GOx's loading efficiency reached 46.56%.

[0049] 5. Hairpin DNA Loading Rate The loading rate of hairpin DNA in a nanoreactor was determined by fluorescence spectroscopy, utilizing the quenching effect of ZIF-8 on the FAM fluorescent group: FAM-labeled hairpin H2 (Y-DNA) was co-incubated with FeG@ZIF-8 nanomaterials to ensure sufficient DNA loading in the nanocarrier. After incubation, unloaded free DNA was separated by centrifugation (12000 rpm, 10 min), and the supernatant was collected. The fluorescence emission spectrum of the supernatant in the 500-650 nm range was measured using a fluorescence spectrophotometer at an excitation wavelength of 488 nm, and the fluorescence intensity at 520 nm was recorded. Using the fluorescence intensity of an equal volume of FAM-labeled hairpin DNA solution not incubated with the nanomaterials as a 100% reference, the loading rate was calculated using the following formula: Load factor (%) = Among them, FL supernatant is the fluorescence intensity of the supernatant of the experimental group, and FL control is the fluorescence intensity of an equal volume of γ-DNA solution of the control group.

[0050] The results are as follows Figure 7 As shown in Figure a, the free FAM-DNA group exhibited strong fluorescence, while the AD@FeG@ZIF-8 group showed significantly reduced fluorescence, with only extremely weak fluorescence detected in the centrifugation supernatant. This indicates that the FAM-labeled hairpin DNA had been effectively assembled onto the ZIF-8 surface, and its fluorescence was effectively quenched by ZIF-8. The extremely low fluorescence signal in the supernatant further demonstrates that the vast majority of DNA had been successfully loaded, with very little residual free DNA. The fluorescence intensity difference between the free group and the AD@FeG@ZIF-8 group was used to calculate (…). Figure 7 (b) The DNA loading efficiency on the AD@FeG@ZIF-8 surface reached 57.89%.

[0051] 6. Fe 2+ load Take an appropriate amount of the AD@FeG@ZIF-8 mixed system, and use a blank solvent as a reference to record its ultraviolet-visible absorption spectrum in the wavelength range of 300-600 nm. The loading of Fe²⁺ is evaluated by analyzing the change of the characteristic absorption peak of Fe²⁺ at 260 nm.

[0052] like Figure 8 As shown, the ultraviolet absorption spectra of different experimental groups exhibit significant differences. Free Fe 2+ The solution exhibited a significant characteristic absorption at 260 nm; the fully assembled AD@FeG@ZIF-8 system also showed a characteristic absorption signal at this wavelength; while the blank ZIF-8 group did not show a significant absorption peak in this wavelength range. The characteristic absorption peak at 260 nm in the AD@FeG@ZIF-8 group originates from the Fe it supports. 2+ This confirms that Fe 2+The sample has been successfully encapsulated within the nanocomposite material; the absence of this absorption peak in the blank ZIF-8 support group eliminates the interference of the support itself on the detection results. Furthermore, Fe in the AD@FeG@ZIF-8 group... 2+ The position of the characteristic absorption peak and free Fe 2+ The groups are basically consistent, indicating that the in-situ encapsulation process did not affect Fe. 2+ The structural integrity was significantly affected.

[0053] In summary, the experimental results confirm that GOx, Fe²⁺, and functional DNA hairpins have been successfully assembled into ZIF-8 nanomaterials, and the AD@FeG@ZIF-8 multifunctional nanoreactor has been successfully constructed.

[0054] Example 2: In vitro feasibility verification of AD@FeG@ZIF-8 1. Controllable activation of HCR response system To verify the controllable activation mechanism of this HCR response system ( Figure 9 (a) The formation of HCR and Zn were verified using 12% non-denaturing polyacrylamide gel electrophoresis. 2+ The process by which GPX4 DNAzyme and VEGFR-2 DNAzyme cleave substrate sequences: 5 μL of 1 μM samples of miR-21, hairpin H1, hairpin H2, GPX4 mRNA, VEGFR-2 mRNA, miR-21+H1+H2, APE1+H1+H2, miR-21+APE1+H1+H2; miR-21+APE1+H1+H2+GPX4 mRNA and miR-21+APE1+H1+H2+VEGFR-2 mRNA were mixed with 1 μL of 6×Loading Buffer and incubated in Zn-containing buffer for 1.5 h. The mixture was then slowly added to the sample wells and electrophoresed at a constant voltage of 120 V for 50 min in 1×TBE buffer. After the bands in the gel were completely separated, the gel was removed and stained with Gel Red nucleic acid dye for 20 min. Finally, the gel was imaged using a gel imaging system.

[0055] Depend on Figure 9 The results in the middle b show that when miR-21, H1, H2 alone, or a single target (miR-21 or APE1) is incubated with H1 or H2, only monomeric bands are observed; when both targets are present simultaneously, high molecular weight bands appear and their positions shift upwards.

[0056] Figure 9As shown in Figure c, after introducing the target mRNAs of GPX4 and VEGFR-2 into the complete HCR system, in addition to retaining some high molecular weight polymer bands, small molecular weight fragments began to appear on the gel, and the bands became significantly lighter compared to lanes 2-3.

[0057] The above results confirm that the designed HCR response system has good controllability, initiating cascade assembly only when both APE1 and miR-21 dual targets are present. This exposes and restores the activity of the DNAzyme sequence originally enclosed in the hairpin structure, cleaving the GPX4 mRNA and VEGFR-2 mRNA substrates embedded in the polymer and releasing small molecule cleavage products. This logic-gated gene regulation strategy provides a reliable molecular basis for subsequent research on inhibiting GPX4 and VEGFR-2 expression and regulating redox homeostasis at the cellular level.

[0058] 2. AND logic gating for dual-signatures This invention relates to a programmable "AND" logic gate circuit with miR-21 and APE1 as dual input signals, the principle of which is as follows: Figure 10 As shown in Figure a. To verify the response performance of this logic gate, the following reaction system was constructed to measure the fluorescence response signal of the AD@FeG@ZIF-8 system under different input conditions: PBS group (APE1: 0 U / mL; miR-21: 0 nM); APE1 group (APE1: 10 U / mL; miR-21: 0 nM); miR-21 group (APE1: 0 U / mL; miR-21: 100 nM); APE1+miR-21 group (APE1: 10 U / mL; miR-21: 100 nM); All reaction systems were incubated at 37°C for 2 h, followed by detection using a fluorescence spectrophotometer: excitation wavelength 488 nm, emission scan range 500-650 nm, excitation / emission slit width 5 nm / 5 nm, scan rate 600 nm / min, PMT voltage 800 V, and response time 0.1 s. Each treatment was measured in triplicate, and the average value was taken.

[0059] The results are as follows Figure 10 As shown in Figures b and c, the system exhibits a significantly enhanced fluorescence signal only when miR-21 and APE1 are present simultaneously; however, when only miR-21 or only APE1 is added, only negligible weak fluorescence signals are detected. These results demonstrate that the constructed AD@FeG@ZIF-8 system possesses high selectivity and robust dual-input logic recognition capability, effectively distinguishing between the simultaneous presence of two targets and the presence of a single target.

[0060] Example 3: Detection limit and specificity of AD@FeG@ZIF-8 1. Detection limit for miR-21 AD@FeG@ZIF-8 was prepared using the method described in Example 1. Suspensions were prepared to achieve a final concentration of 1 nM for both H1 and H2. APE1 solution was added to this system to achieve a final concentration of 10 U / mL. Then, different concentrations of miR-21 were added to final concentrations of 10, 50, 100, 500, 1000, 5000, 10000, and 100000 pM, respectively. The mixture was incubated at 37°C for 2 h to initiate HCR. Subsequently, a fluorescence spectrophotometer was used for detection: excitation wavelength 488 nm, emission scan range 500–650 nm, excitation / emission slit width 5 nm / 5 nm, scan rate 600 nm / min, PMT voltage 800 V, and response time 0.1 s. Each concentration point was measured in triplicate, and the average value was taken.

[0061] The results are as follows Figure 11 As shown in Figure ac, the fluorescence intensity of the system increases with the gradual increase of miR-21 concentration. A plot of the fluorescence peak intensity at 525 nm against the logarithm of miR-21 concentration shows a good linear relationship in the range of 0.01-100 nM, with the linear regression equation being I0. 525 = 193.590 lg C miR-21 - 115.486 ( R 2 = 0.996), with a detection limit (LOD) as low as 0.145 pM (calculated on 3σ).

[0062] 2. Detection limit for APE1 Using the same method, the final concentration of miR-21 was fixed at 100 nM, and then different concentrations of APE1 were added to final concentrations of 0.001, 0.01, 0.05, 0.1, 0.5, 1, 5, and 10 U / mL. Fluorescence was measured after incubation.

[0063] The results are as follows Figure 12 As shown in Figure ac, the fluorescence intensity of the system increased significantly when the APE1 concentration increased from 0 to 100 U / mL. A non-linear curve was obtained by fitting the fluorescence intensity at 525 nm against the APE1 concentration, while a good linear relationship was shown by plotting the fluorescence intensity at 525 nm against the logarithm of the APE1 concentration. The linear regression equation is I... 525 = 182.211 lg C APE1 - 8.662 ( R 2=0.994), LOD is 2.4 × 10 -4 U / mL.

[0064] 3. Specificity to miR-21 or APE1 AD@FeG@ZIF-8 was prepared using the method described in Example 1. A suspension was prepared to a final concentration of 1 nM for both H1 and H2. APE1 solution was added to the above system to a final concentration of 10 U / mL. Then, miR-21 and its analogues / interferants were added to a final concentration of 100 nM. miR-375: 5'-UUGUUCGUUCGGCUCGCGUGA-3' miR-221: 5'-AGCUACAUUGUCUGCUGGGUUUC-3' miR-210: 5'-CUGUGCGUGUGACAGCGGCUGA-3' miR-155: 5'-UUAAUGCUAAUCGUGAUAGGGGU-3' miR-122: 5'-UGGAGUGUGACAAUGGUGUUUG-3' miR-20A: 5'-UAAAGUGCUUAUAGUGCAGGUAG-3' miR-21 Mut-3: 5'-UAGCUUAUCTCTCUGAUGUUGA-3' miR-21 Mut-2: 5'-UAGCUUAUCTCACUGAUGUUGA-3' miR-21 Mut-1: 5'-UAGCUUAUCTGACUGAUGUUGA-3' Mixture: A mixture of miR-21 and its analogues / interference agents Similarly, AD@FeG@ZIF-8 was prepared using the method in Example 1. The suspension was prepared so that the final concentrations of H1 and H2 were both 1 nM. miR-21 was added to the above system to a final concentration of 100 nM. Then, APE1 and interfering agents were added: IgG (immunoglobulin G), KF (E. coli DNA polymerase I Klenow fragment), FEN1 (valve endonuclease 1), UDG (uracil-DNA glycosylase), and Mixture (a mixture of APE1 and all interfering agents).

[0065] The results are as follows Figure 13 As shown, only miR-21 and APE1 can induce strong fluorescence signals, while other interfering substances and mixed samples have no obvious response, indicating that the system has excellent selectivity for dual targets.

[0066] Example 4 Cytotoxicity analysis of AD@FeG@ZIF-8 Cytotoxicity was determined using the CCK-8 assay: cells were spaced at 1 × 10⁶ cells per well. 4 Cells were seeded at a density of [number] cells / well in 96-well plates and incubated at 37°C for 24 hours until fully adhered. The original culture medium was removed, and the appropriate reaction sample (100 μL) was added according to the experimental purpose. After co-incubating with the cells for 24 hours, 10 μL of CCK8 reagent was added to each well, and the cells were incubated at 37°C in the dark for 2 hours. The absorbance at 450 nm was measured using a microplate reader. Three replicates were set up for each treatment group to minimize error.

[0067] The experimental groups are as follows: Experiment (1): ZIF-8, FeG@ZIF-8, AD@ZIF-8 and AD@FeG@ZIF-8 at concentrations of 10, 20, 40, 60 and 80 μg / mL; Experiment (2): AD@FeG@ZIF-8 at concentrations of 10, 20, 40 and 60 μg / mL were co-incubated with MCF-10A, HeLa, MCF-7 and MDA-MB-231 cells; Experiment (3): HEPES, 60 μg / mL ZIF-8, 60 μg / mL FeG@ZIF-8, 200 nM DNA, 60 μg / mL AD@ZIF-8 and 60 μg / mL AD@FeG@ZIF-8 were co-incubated with MDA-MB-231 cells.

[0068] The specific formula for calculating cell viability is as follows: Cell viability (%) = Among them, A 加药 A represents a well containing cells, CCK8 solution, and drug solution. 450 A 细胞 A represents a well containing cells and CCK8 solution but without added drug. 450 A 空白 A represents a pore containing culture medium and CCK8 solution but without cells. 450 .

[0069] like Figure 14As shown in Figure a, the cell viability of MDA-MB-231 cells treated with different nanomaterials showed significant differences. Under the same concentration conditions, the ZIF-8 group had the highest cell viability, followed by the AD@ZIF-8 group, with the FeG@ZIF-8 group showing a further decrease, and the AD@FeG@ZIF-8 group exhibiting the lowest cell viability. Taking a 40 μg / mL treatment as an example, the cell viability of the ZIF-8 group was 92%, the AD@ZIF-8 group was 71%, the FeG@ZIF-8 group was 77%, while the AD@FeG@ZIF-8 group only had 48%.

[0070] The above results indicate that the empty ZIF-8 vector itself has good biocompatibility and low cytotoxicity; the functional DNA modified on the surface of the AD@ZIF-8 group may have a slight effect on cells; the FeG@ZIF-8 group showed good performance in Fe... 2+ The chemical kinetic therapeutic effect imparted by the loaded material led to a decrease in cell viability; while the DNA hairpins assembled on the surface of the AD@FeG@ZIF-8 group and the internally loaded Fe 2+ The combination of GOx and GOx created a synergistic killing effect, significantly enhancing antitumor activity and fully demonstrating the antitumor advantages of the multi-component synergistic strategy.

[0071] The results are as follows Figure 14 As shown in Figure b, the survival rate of each non-target cell decreased with increasing concentration of the nanomedicines, but all maintained high cell survival rates. For MCF-10A cells, the cell survival rate of MDA-MB-231 remained above 85% at a concentration of 60 μg / mL. This demonstrates that the synthesized AD@FeG@ZIF-8 exhibits good tumor cell targeting, meets the requirements for biomarker stimulation activation by the drug delivery system, and demonstrates good biocompatibility.

[0072] Example 5: Gene silencing and redox homeostasis assessment of AD@FeG@ZIF-8 Take 5×10 5 MDA-MB-231 cells were co-incubated for 24 h with 40 μg / mL ZIF-8, FeG@ZIF-8, AD@FeG@ZIF-8 and 200 nM H1 and H2 hairpin solutions, respectively. After washing with PBS, the cells were digested with trypsin, and the digestion was terminated by adding an equal volume of PBS. The collected MDA-MB-231 cells were directly lysed in 1× lysis buffer (1 mL RIPA I + 10 μL phosphatase inhibitor + 10 μL protease inhibitor). 40 μg of protein was taken, reduced with 2.5% β-mercaptoethanol, separated by SDS-PAGE, and transferred to a 0.45 μm PVDF membrane according to standard blotting procedures for further processing.

[0073] The antibodies used are: Primary antibody: recombinant Anti-GPX4 (DF6701), VEGF Receptor 2 Antibody (J9N19) (1:1000).

[0074] Secondary antibody: Goat anti-rabbit antibody IgG H&L (HRP) (ab97051) (1:8000).

[0075] The results are as follows Figure 15 As shown in Figure a, the gray-scale quantitative analysis results (with the blank control group as 1.00) showed that, compared with the blank control group, the expression levels of VEGFR-2 (0.98) and GPX4 (0.97) in the ZIF-8 group did not change significantly; in the DNA group, VEGFR-2 expression was downregulated to 0.69-fold and GPX4 expression was downregulated to 0.89-fold, indicating limited inhibitory effect. However, the AD@FeG@ZIF-8 treatment group significantly reduced the expression levels of both proteins, with VEGFR-2 decreasing to 0.34-fold and GPX4 decreasing to 0.62-fold compared with the blank control group. These results indicate that AD@FeG@ZIF-8 can effectively deliver and activate DNAzymes targeting VEGFR-2 and GPX4, achieving efficient dual-gene silencing at the cellular level.

[0076] To evaluate the system's ability to induce oxidative stress, the effects of different nanomaterial treatments on GSH consumption and MDA (lipid peroxidation product) generation in MDA-MB-231 cells were measured. The specific steps are as follows: (1) Glutathione content determination: MDA-MB-231 cells were prepared at 5 × 10⁶ cells per well. 5 Cells were seeded at a density of [number] cells / well in six-well plates and cultured at 37°C in a 5% CO2 incubator for 24 h. The old culture medium was discarded, and DMEM medium containing different treatment groups (HEPES, ZIF-8, FeG@ZIF-8, 200 nM DNA, AD@ZIF-8, AD@FeG@ZIF-8, 40 μg / mL) was added, and the cells were cultured for another 24 h. The supernatant was discarded, cells were washed with PBS, and cells were collected by trypsin digestion. 1 mL of cell suspension was centrifuged at 1000 rpm for 5 min, the supernatant was discarded, 200 μL of reagent one (precipitant) was added, vortexed, and incubated at 4°C for 10 min. Then, the cells were centrifuged at 4000 rpm for 10 min, and the supernatant was collected for analysis. Prepare the standard and chromogenic working solution according to the kit instructions. Add 100 μL each of blank control, standard and supernatant to be tested to a 96-well plate, then add 100 μL of chromogenic working solution, mix well and let stand at room temperature in the dark for 10 min. Measure the absorbance at 420 nm.

[0077] (2) Determination of malondialdehyde (MDA) production: MDA-MB-231 cells were prepared at a density of 5 × 10⁻⁶ cells per well.5 Cells were seeded at a density of [number] cells / well in six-well plates and cultured at 37°C in a 5% CO2 incubator for 24 h. The old culture medium was discarded, and DMEM medium containing different treatment groups (HEPES, ZIF-8, FeG@ZIF-8, 200 nM DNA, AD@ZIF-8, AD@FeG@ZIF-8, 40 μg / mL) was added, and the cells were cultured for another 24 h. The supernatant was discarded, cells were washed with PBS, digested with trypsin, and the cells were collected and counted. Approximately 5 million cells were collected, centrifuged, and the supernatant was discarded. 1 mL of extraction buffer was added, and the cells were sonicated to disrupt the cell structure. The cells were centrifuged at 4°C (8000g, 10 min), and the supernatant was collected for analysis. Following the kit instructions, the cells were incubated at 95°C for 30 min, cooled, and centrifuged at 10000g, 25°C, 10 min. 200 μL of the supernatant was transferred to a 96-well plate, and the absorbance at 532 nm and 600 nm was measured. The absorbance difference was calculated using the formula: ΔA = A 532 - A 600 .

[0078] like Figure 15 As shown in b and c, compared with the control group treated with HEPES buffer, the intracellular GSH levels and MDA contents of different nanomaterial treatment groups showed significant differences. Regarding GSH consumption, the ZIF-8 group showed virtually no GSH consumption, while the FeG@ZIF-8 group showed a more significant decrease. The DNA-only treatment groups did not show particularly significant GSH changes, but the AD@FeG@ZIF-8 group had the lowest GSH residue, only 49% of the control group. Regarding MDA generation, the ZIF-8 group showed a relatively low increase in MDA level, approximately 30% of the positive group, while the FeG@ZIF-8 group further increased to 81%, and the DNA group to 55%. The AD@FeG@ZIF-8 group had the highest MDA level, exhibiting the most significant lipid peroxidation accumulation. Empty ZIF-8 did not induce significant oxidative stress. AD@FeG@ZIF-8, however, induced MDA through Fe... 2+ The synergistic effect of consuming GSH, GOx catalyzing H2O2 production, and silencing GPX4 leads to a large accumulation of lipid peroxides.

Claims

1. A DNA-functionalized iron-based ZIF-8 nanomaterial, characterized in that, The ZIF-8 surface is loaded with H1 chains, H2 chains, and hyaluronic acid, and internally encapsulates ferrous ions and glucose oxidase; the H1 chains and H2 chains have a hairpin structure. The nucleotide sequences of the H1 and H2 chains are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; and the 16th position of the H1 chain is an AP site; the 31st nucleotide of the H2 chain is modified with a fluorescent group, and the 83rd nucleotide is modified with a quenching group.

2. The DNA-functionalized iron-based ZIF-8 nanomaterial according to claim 1, characterized in that, The fluorescent group is FAM, and the quenching group is BHQ1.

3. A method for preparing DNA-functionalized iron-based ZIF-8 nanomaterials as described in claim 1, characterized in that, Includes the following steps: (1) 2-methylimidazole, GOx, zinc nitrate and ferrous chloride were stirred and reacted in water, and the solid was separated and dried to obtain the intermediate product FeG@ZIF-8; (2) Mix the solution of H1, H2 and hyaluronic acid with the suspension of intermediate product FeG@ZIF-8, separate the solid and liquid and wash the solid to obtain nanomaterial AD@FeG@ZIF-8.

4. The preparation method according to claim 3, characterized in that, The molar ratio of zinc nitrate to 2-methylimidazole is 1:5-10; the mass ratio of zinc nitrate to GOx is 4:1; and the molar ratio of zinc nitrate to ferrous chloride is 5-10:

1. The molar ratio of FeG@ZIF-8 to H1 is 1:1000-1500; the molar ratio of FeG@ZIF-8 to H2 is 1:1000-1500; and the mass ratio of hyaluronic acid to FeG@ZIF-8 is (3-5):

1.

5. A kit and drug for DNA-functionalized iron-based ZIF-8 nanomaterials as described in claim 1.

6. The reagent kit according to claim 5, characterized in that, It also includes standards for the target miRNA 21 and / or APE1.

Images