Identification of drought-inducible GmFATB3A promoter in soybean and development and application of molecular marker

Abstract

The application discloses identification of a soybean drought-inducible GmFATB3A promoter and development and application of a molecular marker, and belongs to the technical field of plant genetic engineering. The application carries out drought phenotype identification on a whole growth period by using 400 soybean core germplasms, locates a fatty acyl carrier protein thioesterase gene GmFATB3A on a fourth chromosome of the soybean, and finds that a key SNP variation site Chr04:46953292 (G / A) exists in a promoter region of the GmFATB3A, forms two promoter haplotypes proGmFATB3A HapG and proGmFATB3A HapA , and the proGmFATB3A HapA is an excellent promoter haplotype with stronger drought-inducible activity. A high-throughput KASP functional molecular marker is developed based on the effective SNP, the two promoter haplotypes can be quickly distinguished, and the KASP functional molecular marker is used for soybean drought-resistant germplasm screening and molecular marker assisted breeding.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the identification of the drought-inducible GmFATB3A promoter in soybean and the development and application of molecular markers. Background Technology

[0002] The promoter, located upstream of the coding region of a gene, is known as the "gene switch," and its main function is to regulate the transcriptional activity of the gene. The specific cis-acting elements contained in the promoter are important targets for protein binding during transcription initiation and regulation, and to a certain extent determine the timing and intensity of target gene expression. Promoters typically contain a core promoter region, structurally divided into a core region, a proximal region, and a distal region. The proximal and distal regions contain various regulatory sequences, such as enhancers, silencers, insulators, and other cis-elements, which together achieve fine-grained regulation of gene expression at the transcriptional level.

[0003] Higher plant gene promoters can be mainly classified into three types: constitutive promoters, tissue-specific promoters, and inducible promoters. Plant inducible promoters are regulatory sequences that can respond to specific external signals (including physical factors such as low temperature and drought, or chemical factors such as hormones) and significantly upregulate the transcriptional activity of downstream genes. Under conditions without inducible signals, genes driven by these promoters typically maintain basal expression levels or remain silent; however, when stress signals arrive, they can achieve rapid and efficient transcription of the target gene. This "on-demand expression" regulatory model helps plants optimize energy allocation under adverse conditions and enhance their perception and adaptive response to external stress. Summary of the Invention

[0004] To improve crop stress resistance and cope with increasingly severe agricultural production environments, researchers have isolated and identified a large number of stress-inducible promoters from different species. This invention relates to a drought-inducible promoter, proGmFATB3A, isolated from soybean. Functional analysis shows that this promoter is strongly induced by drought stress, exhibiting a significant transcriptional response to all drought stress treatments, and possesses potential value for genetic improvement of crop stress resistance. Furthermore, based on the differentially expressed proGmFATB3A sequences in different soybean varieties, the KASP marker designed and developed in this invention can be used for molecular detection of drought tolerance in soybean germplasm resources, providing a reliable molecular functional marker for breeding drought-resistant soybean varieties.

[0005] The first aspect of this invention aims to provide a soybean drought-inducible GmFATB3A promoter, wherein the nucleotide sequence of the promoter proGmFATB3A is shown in SEQ ID NO.1; or, a nucleotide sequence having ≥90% sequence homology with the nucleotide sequence shown in SEQ ID NO.1 and retaining drought-inducible transcriptional activation activity; or, a derived nucleotide sequence that, based on the sequence of SEQ ID NO.1, has been substituted, deleted, or added with one or more nucleotides, and still possesses drought-inducible promoter activity.

[0006] Preferably, the promoter is derived from soybean variety Jihei 4; the promoter proGmFATB3A contains the key SNP variant site Chr04:46953292, whose genomic version number is G.max Wm82.a2.v1, and the haplotype proGmFATB3A is formed when the base at this site is G. HapG When the base at this site is A, it forms the superior haplotype proGmFATB3A. HapA .

[0007] Population phenotyping confirmed that the proGmFATB3A HapA The induction activity of downstream gene transcription under drought stress was significantly higher than that of proGmFATB3A. HapG .

[0008] Preferably, the KASP molecular marker primer set for detecting the SNP variant sites includes two allele-specific reverse primers and one universal forward primer: FAM-labeled allele-specific primer proGmFATB3A-F1c: GAAGGTGACCAAGTTCATGCTTACAATAAAAAAATAGAGTCTATGTGACCc; HEX-labeled allele-specific primer proGmFATB3A-F1t: GAAGGTCGGAGTCAACGGATTTACAATAAAAAAATAGAGTCTATGTGACCt; and universal forward primer proGmFATB3A-R1: AATGAGCAAATCCAATTCAATTAAAGTT.

[0009] This primer set can distinguish proGmFATB3A HapG (G isotropic homozygous), proGmFATB3A HapA (A allelic homozygous) and G / A heterozygous genotypes can be used for high-throughput typing of soybean promoter haplotypes.

[0010] The second aspect of this invention aims to provide the application of the aforementioned KASP molecular marker primer set in marker-assisted breeding of soybean, including at least one of the following uses: a) high-throughput identification of haplotypes of the GmFATB3A promoter in soybean germplasm resources; b) screening for haplotypes carrying the superior proGmFATB3A. HapA c) Conduct molecular marker-assisted selection in the segregating populations of soybean hybrid and backcross progeny to breed new soybean lines with strong drought-induced expression ability and improved drought resistance.

[0011] A third aspect of the present invention aims to provide a complementary nucleic acid sequence, or its reverse complementary sequence, of the soybean drought-inducible promoter proGmFATB3A.

[0012] The fourth aspect of this invention aims to provide a recombinant expression vector containing the drought-inducible promoter proGmFATB3A; the promoter proGmFATB3A is operatively linked to a downstream target gene to drive the target gene to be expressed under drought stress conditions; the downstream target gene is a stress-resistance gene.

[0013] In some embodiments, the recombinant expression vector may be a cloning vector, a plant overexpression vector, or a gene editing vector. Furthermore, those skilled in the art will recognize that other commercially available or modified vector frameworks can also be used to construct overexpression, knockout, or gene editing vectors for the genes of this invention, all of which fall within the scope of protection of this invention.

[0014] A fifth aspect of the present invention aims to provide a transformant containing the recombinant expression vector described above; the transformant is a host bacterium or a plant cell.

[0015] In some embodiments, the host bacterium may be Escherichia coli or Agrobacterium; the plant cells may be soybean callus cells or soybean hairy root cells.

[0016] The sixth aspect of this invention aims to provide the application of the drought-inducible promoter proGmFATB3A, the recombinant expression vector, and the transformant in the genetic improvement of plant stress resistance. The promoter proGmFATB3A is operatively linked to the stress resistance target gene to induce the expression of downstream genes under drought stress conditions, thereby enhancing the drought tolerance of transgenic plants. The plants include dicotyledonous plants and monocotyledonous plants, preferably soybeans.

[0017] The seventh aspect of this invention aims to provide a molecular marker-assisted selection method for breeding drought-resistant soybeans, comprising the following steps: extracting genomic DNA from soybean materials to be tested; performing genotyping using the aforementioned KASP molecular marker primer set; and screening for SNP sites Chr04:46953292 that are homozygous for A and carry proGmFATB3A. HapA Soybean individuals with superior promoter haplotypes were selected; these individuals were used as breeding materials, and the proGmFATB3A promoter was introduced through hybridization and backcrossing. HapA Allelic variations were introduced into the target soybean backbone genetic background to obtain a new drought-resistant soybean line; the genome version number of the SNP site Chr04:46953292 is G.max Wm82.a2.v1.

[0018] Compared with the prior art, the beneficial effects of the present invention are:

[0019] 1. This invention is the first to confirm that the GmFATB3A gene is a positive regulatory gene for the drought stress response of soybean; overexpression lines show enhanced drought resistance, while knockout lines show significantly reduced drought resistance, providing conclusive evidence of transgenic phenotype; further, its upstream drought-inducible promoter proGmFATB3A is isolated and identified, enriching the resources of inducible promoter elements available for plant stress resistance gene engineering.

[0020] 2. This invention identifies the naturally occurring SNP variant Chr04:46953292 (G / A) in the promoter region, yielding two promoter haplotypes with significant functional differences; among them, proGmFATB3A HapA Drought-induced transcriptional activity is stronger, representing superior natural allelic variation and providing a natural regulatory element for drought-resistant soybean breeding.

[0021] 3. This invention develops KAS functional molecular markers based on promoter region-responsive SNPs. The markers directly target functional variant sites rather than linkage markers. The genotyping results are consistent with the resequencing results, enabling low-cost, high-throughput genotyping of large batches of soybean materials. This solves the problems of long phenotypic identification cycles and significant environmental interference in traditional drought-resistant breeding.

[0022] 4. On the one hand, the proGmFATB3A promoter of this invention can be used as a regulatory element to construct drought-induced expression vectors and carry out transgenic stress-resistant breeding; on the other hand, the KASP marker can be directly used for natural germplasm screening and molecular marker-assisted selection of hybrid offspring to breed new drought-resistant soybean lines carrying superior promoter haplotypes. Attached Figure Description

[0023] Figure 1This invention provides the following examples for identifying the drought-resistant phenotype of GmFATB3A transgenic plants: A shows photos of the drought-stressed and normal control phenotypes of wild-type WT, GmFATB3A overexpressing lines (OE1, OE2), and GmFATB3A knockout lines (KO1, KO2); B shows the statistical results of the chlorophyll fluorescence parameter Fv / Fm measured in the leaves of each line; and C shows chlorophyll fluorescence imaging images of the leaves in each group.

[0024] Figure 2 The results of haplotype analysis of the GmFATB3A gene promoter in this embodiment of the invention; box plot showing proGmFATB3A HapG With proGmFATB3A HapA Population statistical results of drought resistance coefficients for single-plant grain weight and plant height of two haplotype soybean germplasms.

[0025] Figure 3 This is an analysis of the relative expression levels of the GmFATB3A gene in soybean varieties carrying two different promoter haplotypes under drought stress conditions in this embodiment of the invention; green represents the normal control, and orange represents the PEG-6000 drought stress treatment.

[0026] Figure 4 This is a scatter plot of KASP molecular marker typing of the effective SNP in the GmFATB3A promoter region in this embodiment of the invention; the horizontal axis is the FAM fluorescence signal, and the vertical axis is the HEX fluorescence signal; red dots represent G allelic homozygosity (HapG), blue dots represent A allelic homozygosity (HapA), and yellow dots represent negative samples without amplification.

[0027] Figure 5 This is a schematic diagram of GUS staining results of transgenic Arabidopsis thaliana with different haplotypes GmFATB3A promoters under drought stress in an embodiment of the present invention. Detailed Implementation

[0028] To make the technical means, creative features, objectives, and effects of this invention easier to understand, the invention is further illustrated below with specific embodiments. These embodiments are only for explaining the invention and are not intended to limit the scope of protection of the invention. Unless otherwise specified, all molecular biology operations in the embodiments employ conventional experimental methods in the art; all reagents used are commercially available; and soybean materials, strains, and vectors are commercially available or publicly deposited.

[0029] Those skilled in the art should understand that this invention is not limited to the soybean varieties Jihei 4 and Williams 82 in the embodiments, nor is it limited to binary vectors, Agrobacterium-mediated transformation methods; it involves conserved modification of the promoter sequence, replacement of downstream stress-resistance genes, and the use of gene editing techniques to transform proGmFATB3A. HapA The importation of soybean genome data falls within the scope of protection of this invention.

[0030] Example 1: Identification of drought-resistant phenotype in GmFATB3A transgenic plants

[0031] 1.1. Preliminary GWAS gene mapping: Using 400 core soybean germplasms as experimental materials, we conducted multi-year, multi-location field drought stress phenotypic identification throughout the entire growth period, measured yield-related traits, and calculated drought resistance coefficients. We conducted GWAS analysis based on whole-genome resequencing genotypes, and combined with transcriptome data from extremely drought-resistant / sensitive materials, we located the acyl-carrier protein thioesterase gene GmFATB3A on soybean chromosome 4. This locus was significantly associated with soybean yield and drought resistance traits.

[0032] 1.2. Preparation of transgenic materials: Construct GmFATB3A gene overexpression vector and CRISPR-Cas knockout vector; use Agrobacterium-mediated soybean genetic transformation, with Williams 82 (WT) as recipient, to obtain GmFATB3A overexpression transgenic lines OE1 and OE2; obtain GmFATB3A gene knockout lines KO1 and KO2; molecular detection confirms the transgenic lines are positive.

[0033] 1.3. Drought Stress and Rehydration Experiment in Artificial Climate Chamber: Wild-type WT, overexpression lines OE1 / OE2, and knockout lines KO1 / KO2 soybean seeds with uniform seed size and viability were selected and cultured in an artificial climate chamber under the following conditions: 25℃, 16h light, 8h dark. A control group and a drought treatment group were set up: the control group received normal watering throughout the treatment; the drought group was subjected to natural controlled drought stress after emergence, with watering stopped; at 23 days of growth, the drought group's leaves showed obvious wilting, and rehydration was initiated; on the 13th day after rehydration, photographs were taken to record the recovery of growth phenotypes in each line. The maximum photochemical efficiency (Fv / Fm) of the leaf photosystem was measured using a chlorophyll fluorometer, and chlorophyll fluorescence images were collected simultaneously.

[0034] 1.4. Experimental Results (Refer to) Figure 1 (Normal irrigation control group: WT, OE1, OE2, KO1, KO2 lines showed no significant differences in growth status and Fv / Fm.) After drought stress and rehydration: GmFATB3A overexpressing lines OE1 and OE2 showed significantly better recovery than wild-type WT, with significantly higher Fv / Fm and stronger drought tolerance; GmFATB3A knockout lines KO1 and KO2 showed severe wilting, poor recovery ability, and significantly lower Fv / Fm than WT, indicating significantly reduced drought tolerance. This experiment demonstrates that GmFATB3A is a positive regulatory gene for soybean drought stress response and is an excellent candidate gene for genetic improvement of soybean drought tolerance.

[0035] Example 2: Haplotype Analysis of GmFATB3A Promoter Region

[0036] Based on resequencing data from 400 soybean core germplasm accessions, the upstream promoter region sequence of the GmFATB3A gene was extracted, and haplotype analysis was performed. The key SNP site Chr04:46953292 (G / A) in the promoter region was identified, with the genome version number G.max Wm82.a2.v1. Two promoter haplotypes were determined: proGmFATB3A. HapG (G isotropic), proGmFATB3A HapA (A allele). Population phenotypic statistics are shown below. Figure 2 Carrying proGmFATB3A HapA Haploid soybean materials showed significantly higher drought tolerance coefficients for single-plant grain weight and plant height than proGmFATB3A. HapG Materials, specifications for proGmFATB3A HapA It is a haplotype of an excellent promoter related to drought resistance.

[0037] Example 3: Analysis of GmFATB3A expression patterns in soybean materials with different promoter haplotypes under drought stress

[0038] 3.1. Experimental Materials and Treatment: Materials carrying proGmFATB3A were selected respectively. HapG proGmFATB3A HapA Seven haplotype soybean varieties were selected; seeds were germinated in vermiculite, and seedlings with uniform growth were selected for hydroponic culture; during the V1 stage, drought stress was simulated using a 6% PEG-6000 aqueous solution; soybean leaf samples were collected at 0h and 6h of stress for RNA extraction.

[0039] 3.2. Total RNA Extraction: Total RNA was extracted from the leaves using RNAiso Plus reagent. The specific steps were as follows:

[0040] A: Pre-cool the mortar with liquid nitrogen, wear multiple layers of gloves, put the leaf sample into the mortar, and grind the sample thoroughly with liquid nitrogen repeatedly until the liquid nitrogen evaporates completely. Repeat this process three times.

[0041] B: Add 1 mL RNAiso Plus, homogenize thoroughly, and let stand at room temperature for 5 min; centrifuge at 12000 g, 4℃ for 5 min;

[0042] C: Transfer the supernatant to a new 1.5ml centrifuge tube, add 200μL of chloroform, invert to mix, and let stand at room temperature for 5min; centrifuge at 12000g, 4℃ for 15min;

[0043] D: Transfer the upper aqueous phase to a new centrifuge tube, add an equal volume of isopropanol, invert to mix, and let stand at room temperature for 10 min; centrifuge at 12000g, 4℃ for 10 min to precipitate RNA.

[0044] E: Discard the supernatant, add 1 mL of 75% ethanol to wash the RNA precipitate; centrifuge at 12000g, 4℃ for 5 min, and discard the supernatant;

[0045] F: Open the lid, dry the precipitate, add an appropriate amount of DEPC water to dissolve the RNA, and detect the concentration;

[0046] G: Dilute the RNA concentration to 300-600 ng / ul and run electrophoresis. Store the RNA at -80°C.

[0047] 3.3. Reverse transcription and qRT-PCR quantitative expression analysis: The GmFATB3A gene sequence was obtained using the phytozome 13 website, and quantitative primers qPCR-GmFATB3A-F: CATTATTCCCACTTGCCGA (SEQ ID No.2) and qPCR-GmFATB3A-R: ACCGATGTTGCTGATTGCC (SEQ ID No.3) were designed.

[0048] RNA was extracted from various plant tissues using RNAiso Plus reagent at a uniform concentration of 500 ng / μL. The qualified RNA was reverse transcribed into cDNA using the "Chiliu" rapid reverse transcription kit from Polymerex. Soybean GmEF1a was used as an internal reference gene. The primer sequences were F: GCTCTTCTTGCTTTCACCCTT (SEQ ID No. 4) and R: TTCCTTCACAATTTCATCATACC (SEQ ID No. 5).

[0049] The qPCR reaction system (20 μL) is as follows:

[0050]

[0051] qPCR amplification program: 95℃ pre-denaturation for 3 min; 95℃ for 5 s, 60℃ for 30 s, 40 cycles; melting curve: 95℃ for 20 s; 60℃ for 30 s; 95℃ for 20 s.

[0052] Use 2 —△△Ct The method calculates the relative gene expression levels, and uses GraphPad Prism8 software for plotting and statistics.

[0053] 3.4. qRT-PCR results (refer to...) Figure 3 After 6 hours of PEG-6000 simulated drought stress treatment, the GmFATB3A gene in all tested materials was upregulated in response to drought; proGmFATB3A was also observed in these materials. HapA In superior haplotype materials, GmFATB3A-induced expression levels were significantly higher than those induced by proGmFATB3A. HapGMaterials. This demonstrates that the promoter SNP variation directly alters the promoter transcriptional activation capacity under drought stress. (proGmFATB3A) HapA It exhibits stronger drought-induced activity.

[0054] Example 4: Development and Validation of KASP Functional Molecular Markers for GmFATB3A Promoter-Affected SNPs

[0055] 4.1. Soybean germplasm genomic DNA extraction: Thirty representative soybean germplasms were selected; young leaves were collected during the seedling stage; genomic DNA was extracted using the Tiangen DP305 plant genomic DNA extraction kit; DNA integrity was detected by 1% agarose gel electrophoresis; purity and concentration were detected using a NanoDrop 2000 micro-volume spectrophotometer; all DNA samples were uniformly diluted to a working concentration of 20-50 ng / uL and stored at -20℃ for later use.

[0056] 4.2. KASP Primer Design and Synthesis: KASP allele-specific primers and universal forward primers were designed using the Primer3 online tool for the effective SNP site Chr04:46953292 (G / A) in the promoter region. The primer sequences are as follows:

[0057]

[0058] Prepare the primer mixture by mixing the three primers according to the standard KASP ratio.

[0059] 4.3. KASP genotyping reaction instrument: ABI QuantStudio 7 Pro real-time fluorescence PCR instrument; total reaction volume (10μL) is as follows:

[0060]

[0061] The 2×KASP Master Mix contains dNTPs, Taq DNA polymerase, MgCl2, and ROX reference fluorescent dye.

[0062] 4.4. PCR amplification program: 95℃ pre-denaturation for 10 min; cycles 1-10: 95℃ denaturation for 20 s; annealing at 61℃, decreasing to 55℃ by 0.6℃ per cycle, annealing extension for 40 s; cycles 11-45: 95℃ denaturation for 20 s; 55℃ annealing extension for 40 s; store at 4℃.

[0063] 4.5. Fluorescence Reading and Genotyping: After amplification, read the reference fluorescence signals for FAM (excitation wavelength 495nm, emission wavelength 520nm), HEX (excitation wavelength 535nm, emission wavelength 556nm), and ROX (excitation wavelength 585nm, emission wavelength 610nm); the software outputs a genotyping scatter plot. Interpretation criteria: ① High FAM signal, low HEX signal: G homozygous, haplotype GmFATB3A HapG ② High HEX signal, low FAM signal: A homozygous, excellent haplotype GmFATB3A HapA ③ Both FAM and HEX show high signal intensity: G / A heterozygous genotype; ④ No fluorescence signal near the origin: negative control NTC.

[0064] KASP scatter plot results are as follows Figure 4 As shown, this primer set can clearly distinguish between two homozygous and heterozygous genotypes, with stable and reliable genotyping results. This marker can be used for high-throughput marker-assisted selection of large quantities of soybean germplasm resources and hybrid progeny populations.

[0065] Example 5: proGmFATB3A under drought stress HapA With proGmFATB3A HapG Promoter activity analysis

[0066] 5.1. Drought stress treatment of transgenic Arabidopsis: transgenic Arabidopsis carrying proGmFATB3A HapA and proGmFATB3A HapG Transgenic Arabidopsis thaliana with two promoters germinated on 1 / 2 MS medium. After growing to the two-pair leaf stage, they were transferred to drought stress medium containing 300 mM mannitol. Seedlings were collected at 0 h, 6 h, 12 h, 24 h and 48 h after treatment for GUS staining analysis. Three biological replicates were set at each time point.

[0067] 5.2. Seedling sample staining and incubation: Take an appropriate amount of seedling tissue to be stained and immerse it in GUS staining solution, ensuring that the staining solution completely submerges the tissue sample; incubate at 37°C in the dark for 12 hours. As the incubation time increases, GUS positive sites gradually turn blue. When the expression level is high, the GUS active site appears blue or blue spots.

[0068] 5.3. Observation of GUS expression sites: The chlorophyll in the sample was removed with 70% ethanol. The decolorized sample was stored in 70% ethanol and observed under a stereomicroscope. The blue color that appeared on the white background was the GUS expression site.

[0069] The results are as follows Figure 5 As shown, when not under drought stress (0 h), proGmFATB3A HapAIt exhibits some basal GUS activity in the roots and hypocotyls, while proGmFATB3A HapG No visible GUS staining signal was observed in the hypocotyl. However, with increasing stress duration, the GUS signal in the hypocotyl of both haplotypes changed to varying degrees. These results indicate that both haplotype promoters of proGmFATB3A are induced by drought stress, but their temporal response characteristics differ. HapA The haplotype exhibits strong basal expression and a faster induced response in the early stages of drought stress, while proGmFATB3A... HapG The induction of the haplotype is relatively slow. It can be seen that the natural variation in the proGmFATB3A promoter region mainly affects the drought-induced response speed and thus the drought resistance of plants. Both haplotypes can be used as drought-induced promoter resources.

[0070] The above are merely embodiments of the present invention and do not limit the patent scope of the present invention. Any equivalent structures made using the content of the present invention specification, whether directly or indirectly applied to other related technical fields, are similarly within the patent protection scope of the present invention.

Claims

1. A soybean drought-inducible promoter proGmFATB3A, characterized in that, The nucleotide sequence of the promoter proGmFATB3A is shown in SEQ ID NO.1; the promoter proGmFATB3A contains a key SNP variant site Chr04:46953292, whose genomic version number is G.max Wm82.a2.v1. When the base at this site is G, it constitutes the haplotype proGmFATB3A. HapG When the base at this site is A, it forms the superior haplotype proGmFATB3A. HapA .

2. The soybean drought-inducible promoter proGmFATB3A according to claim 1, characterized in that, The KASP molecular marker primer set for detecting the SNP variant sites includes two allele-specific reverse primers and one universal forward primer: FAM-labeled allele-specific primer proGmFATB3A-F1c: GAAGGTGACCAAGTTCATGCTTACAATAAAAAAATAGAGTCTATGTGACCc; HEX-labeled allele-specific primer proGmFATB3A-F1t: GAAGGTCGGAGTCAACGGATTTACAATAAAAAAATAGAGTCTATGTGACCt; and universal forward primer proGmFATB3A-R1: AATGAGCAAATCCAATTCAATTAAAGTT.

3. The application of the KASP molecular marker primer set according to claim 2 in marker-assisted breeding of soybean, characterized in that, Including at least one of the following uses: a) high-throughput identification of haplotypes of the GmFATB3A promoter in soybean germplasm resources; b) screening for those carrying the superior haplotype proGmFATB3A. HapA c) Conduct molecular marker-assisted selection in the segregating populations of soybean hybrid and backcross progeny to breed new soybean lines with strong drought-induced expression ability and improved drought resistance.

4. A recombinant expression vector, characterized in that, The recombinant expression vector contains the drought-inducible promoter proGmFATB3A as described in claim 1 or 2; the promoter proGmFATB3A is operatively linked to a downstream target gene to drive the target gene to be induced to express under drought stress; the downstream target gene is a stress-resistance gene.

5. A transformant, characterized in that, The transformant contains the recombinant expression vector of claim 4; the transformant is a host bacterium or plant cell.

6. The application of the drought-inducible promoter proGmFATB3A according to claim 1 or 2, the recombinant expression vector according to claim 4, and the transformant according to claim 5 in the genetic improvement of plant stress resistance, characterized in that, The promoter proGmFATB3A is operatively linked to the target gene for stress resistance, inducing downstream gene expression under drought stress conditions to enhance the drought tolerance of transgenic plants; the plant includes soybean.

7. A molecular marker-assisted selection method for cultivating drought-resistant soybeans, characterized in that, The process includes the following steps: extracting genomic DNA from the soybean material to be tested; performing genotyping using the KASP molecular marker primer set described in claim 3; and screening for SNP locus Chr04:46953292 as homozygous for A and carrying proGmFATB3A. HapA Soybean individuals with superior promoter haplotypes were selected; these individuals were used as breeding materials, and the proGmFATB3A promoter was introduced through hybridization and backcrossing. HapA Allelic variations were introduced into the target soybean backbone genetic background to obtain a new drought-resistant soybean line; the genome version number of the SNP site Chr04:46953292 is G.max Wm82.a2.v1.

Images