Nzz gene for creating parthenocarpic citrus and application thereof

Abstract

The application discloses an NZZ gene for creating parthenocarpic citrus and application of the NZZ gene, and the sequence of the NZZ gene is shown as SEQ ID NO. 1. The application finds that the NZZ gene can be used for regulating the parthenocarpic shape of the citrus, and through CRISPR / Cas9 editing, the NZZ gene is mutated, and especially after a hybrid mutant plant line with a gene editing efficiency of not higher than 90% is obtained, seedless fruits can be obtained without taking isolation pollination measures, new materials are provided for citrus variety breeding, and the application has a good application prospect in the parthenocarpic breeding of the citrus.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to an NZZ gene for creating parthenocarpy citrus and its application. Background Technology

[0002] Citrus is one of the most widely cultivated and economically valuable fruit crops in the world. With the development of the consumer market, seedless fruits are widely welcomed by consumers due to their convenience and high commercial value. Therefore, seedless breeding has become one of the important goals of citrus genetic improvement.

[0003] Currently, the seedless trait in citrus mainly originates from embryo abortion, polyploidy, male sterility, and some varieties with parthenocarpic ability in natural germplasm resources. Among these, polyploid breeding has a long cycle and low breeding efficiency; male sterile materials usually need to be used in conjunction with other breeding strategies; and the number of natural seedless germplasm resources is limited and their genetic background is complex. Therefore, existing seedless breeding technologies generally suffer from long breeding cycles, complex genetic mechanisms, and limited application. On the other hand, most commercially cultivated citrus varieties can still complete the fertilization process and form seeds normally after pollination. To reduce the number of seeds in the fruit, production usually requires management measures such as isolated planting, control of pollinating insects, and artificial flower thinning, but these measures increase production costs and cannot fundamentally solve the seed formation problem.

[0004] Parthenocarpy refers to the phenomenon where the ovary forms a seedless fruit without pollination or fertilization. This eliminates the need for fertilization and allows for the production of seedless fruit. For producers, this eliminates the need for artificial or insect pollination and the application of exogenous growth regulators, ensuring yield while reducing production costs. For consumers, seedless fruit is also more appealing. Therefore, citrus breeding aimed at parthenocarpy is of great significance.

[0005] In recent years, with the development of plant molecular biology and gene editing technology, the targeted improvement of important agronomic traits using key developmental regulatory genes has become an important direction in fruit tree breeding. The inventors (in their previous study, "Functional and Molecular Mechanism Analysis of Csi-miR159a-DU01 Module Regulating Citrus Pollen Sterility") previously discovered through research on the miR159a-DU01 regulatory module that overexpression of miR159a or knockout of FhDUO1 significantly reduced pollen viability and germination rate, identifying DUO1 as a key target gene of csi-miR159a regulating citrus pollen fertility. This laid a foundation for establishing male sterility and parthenocarpy in citrus. However, the molecular regulatory mechanism of parthenocarpy formation in citrus has not been fully elucidated, particularly lacking effective molecular breeding techniques that can stably induce parthenocarpy and maintain seedless characteristics under pollination conditions. Therefore, developing a breeding method that can stably obtain parthenocarpy ability, achieve completely seedless production, and is applicable to citrus genetic improvement is of great significance for promoting the breeding of new seedless citrus varieties. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides an NZZ gene for creating parthenocarpy citrus and its application. By performing site-specific editing on the gene provided by this invention, stable parthenocarpy citrus can be obtained, providing technical support for the breeding of parthenocarpy citrus varieties.

[0007] To achieve the objectives of this invention, the following technical solutions are provided: On one hand, the present invention provides an NZZ gene for creating parthenocarpy citrus fruits, the nucleotide sequence of which is shown in SEQ ID NO.1: ATGGAAAAATACAAAGCAACAATGTCCTGTACTGTATGTGATCATCATCATGAAGCTGCTGCCGCTGCTGCTGCTTCAGGAGTTAATATTGTGAAGAGTGGCAGAGGAAGAAAGCCAAGCAACAAAGCGAATGCTCAGAAGAAGCAGAAGAAGACACCGCAGAGAGGAATGGGAGTGGCTCAACTTGAGCGTTTAAGGCAACAAGAAATGCCCCCACCCACACCCAGTATTCAAAATGGTCACTTGCAGTCCCACATGCCCTTTCCAGAGCCGATTCCGAGTGTTCCGGTGCTGCACGGTGCTGGGCACTACGGTATGCCGTCCGTTGTTGTTGCAAATGGATTGTTGGGTTCTCTGGAAGAGAGCCGAGTCTTGCATAGTGGTGGCGGTGGCGGGTCGGGTCAAGTTTTGATGAGTAAAAATCTTGTTGGGCTTGGGACCTCGAAAGAGCTCTCTTCAATGCCAAAGAACATGCATGTGCATCATCACCAGCAGCCATGGGGAGTTTTGCCTCAACAGCATTGTGATATTTGCCTAAAGAAGAAGCGCTTCCATGGGGAGAATATGGGATTTCCTGGATTAATCAATCCAACAAACACCTTTAACTTCTATGAAGGGATGAATGTTTATGGTGCTAGAGCTGCAAGAAGTGCTTTTTATGCTGGCCAATGTCATGACAATAATTTTCAGAACCAGGGCACACAAGCGGTGTTGATTCACAGAAACGGTAACTCAATGGGCAGAAATGTTCCAAGGGAGTATGAATTTTTCCCAGGAAAAGGTGGCAAAAGCACTTCTTCCAAGGACTTGGAATTTCCATTGGAAGAAGCTTCAGTTGCAGTGCATGGTGAAGCTTCTTGGTTCACACCTACTGCTTATTACAGTGATAATAATGCATGTGGACCTTCTAATTCTATTGATTTGTCCCTCAAACTTTCAGTATAG Further, the primer pair for amplifying the NZZ gene is: NZZ-F (as shown in SEQ ID NO.2): ATGGAAAAATACAAAGCAACAATGTCC NZZ-R (as shown in SEQ ID NO.3): CTATACTGAAAGTTTGAGGGACAAATCAA On the other hand, the present invention provides a gene knockout vector CRISPR-NZZ for regulating the NZZ gene in citrus.

[0008] Furthermore, the gene knockout vector CRISPR-NZZ is constructed by designing an SgRNA that recognizes the target site, digesting it with enzymes and ligating it into the CRISPR-NZZ vector, and then transforming it to obtain the gene knockout vector CRISPR-NZZ.

[0009] Furthermore, the SgRNA at the target site includes target site 1 and target site 2, wherein the sequence of target site 1 is CAGAGAGGAATGGGAGTGGC and the sequence of target site 2 is TGGGGAGTCTTGCCTCAACA.

[0010] The application of the NZZ gene or the vector that knocks out the NZZ gene described in this invention in the creation of parthenocarpy in citrus.

[0011] Furthermore, the primer pairs used to detect NZZ gene mutations or knockout vectors are: FhNZZ-TGC-F (as shown in SEQ ID NO.4): TGTGAAGAGTGGCAGAGGAAG; FhNZZ-TGC-R (as shown in SEQ ID NO.5): CAAGAAAAAAAAACAACAGAAAAGACGC Furthermore, the NZZ gene of citrus was edited using CRISPR / Cas9, and gene-edited plants were obtained through Agrobacterium-mediated genetic transformation. The genomes of the gene-edited plants were then sequenced. After obtaining transformed plants through CRISPR gene editing, the gene editing efficiency was statistically analyzed based on the sequencing and genotyping results: plants with an editing efficiency greater than 95% were identified as homozygous mutant plants of the target gene, and plants with an editing efficiency not higher than 95% were identified as heterozygous mutant plants of the target gene; wherein, the heterozygous mutant plants were able to stably exhibit parthenocarpic traits.

[0012] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention identified an NZZ gene that can be used to regulate parthenocarpy in citrus, providing a new gene resource for the molecular genetic improvement of parthenocarpy in citrus. Furthermore, this invention utilized the CRISPR-Cas9 method to perform site-specific knockout of the NZZ gene in citrus, obtaining heterozygous and homozygous citrus lines, achieving successful editing of the NZZ gene in the citrus genome. Results showed that the heterozygous lines obtained through gene editing possessed good parthenocarpy ability, producing seedless fruits without the need for isolated pollination, providing new materials for citrus variety breeding and showing great application potential in citrus parthenocarpy breeding. Attached Figure Description

[0013] The disclosure of this invention will become more readily understood with reference to the accompanying drawings. It will be readily understood by those skilled in the art that these drawings are merely illustrative of the technical solutions of this invention and are not intended to limit the scope of protection of this invention.

[0014] Figure 1 A schematic diagram of the mutant DNA sequence obtained by knocking out the NZZ gene target sequence in CRISPR / Cas9.

[0015] Figure 2 Paraffin sections of the ovary at different stages of wild-type, NZZ heterozygous edited plants, and NZZ homozygous edited plants.

[0016] Figure 3 This represents the parthenocarpic phenotype of plants lacking NZZ functional components.

[0017] Figure 4 A comparison of the phenotypes of pollinated fruits from wild-type and NZZ hybrid edited plants. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. All other embodiments obtained by those skilled in the art based on the embodiments in this application without inventive effort are within the scope of protection of this application. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.

[0019] Example 1: Cloning and Detection of the Citrus NZZ Gene The cloning method for the FhNZZ gene includes the following steps: (1) Citrus tissue cDNA synthesis: RNA was extracted from the ovary tissue of citrus at day 0 and reverse transcribed to obtain the first-strand cDNA; or RNA from the ovary tissue of citrus transformation recipient material QL at day 0 was reverse transcribed to obtain the first-strand cDNA. (2) PCR amplification of the FhNZZ gene and its CDS sequence, using primer pairs designed as follows: FhNZZ-F (shown in SEQ ID NO.2): 5'-ATGGAAAAATACAAAGCAACAATGTCC-3'; FhNZZ -R (shown in SEQ ID NO.3):5' - CTATACTGAAAGTTTGAGGGACAAATCAA -3', Using cDNA from citrus ovary tissue at day 0 as a template, PCR amplification was performed, and the PCR amplification products were recovered, purified, and sequenced.

[0020] Example 2: Construction of a CRISPR / Cas9 vector using the citrus NZZ gene Construction of the FhNZZ gene knockout vector: Two target gene primer sequences for FhNZZ, sgRNA1 and sgRNA2, were designed. The designed gene sequences are as follows: sgRNA1: 5'-CAGAGAGGAATGGGAGTGGC-3'; sgRNA2: 5'-TGGGGAGTCTTGCCTCAACA-3'; The first step is the annealing of single-stranded oligonucleotides. The reaction system is as follows: 19 μL forward (10 μM), 19 μL reverse (10 μM), 2 μL Buffer G (Thermo Scientific), and the reaction is precisely annealed at 55°C for 25 min.

[0021] The second step involves cloning the annealed oligonucleotide pairs into the sgRNA entry vector using the Golden Gate reaction. The Golden Gate reaction mixture consists of: 1 μL of Esp3 I (Thermo Scientific), 1 μL of T4 DNA ligase (400 U / μL, NEB), 2 μL of ATP (10 mM), 2 μL of Buffer G (Thermo Scientific), 0.7 μL of pYPQ131A-ccdB or pYPQ132A-ccdB (100 ng / μL), 1 μL of the annealed oligonucleotide product, and sterile distilled water to a final volume of 20 μL. The Golden Gate reaction program is performed in a thermal cycler: three cycles of 40°C for 10 min and 16°C for 10 min, followed by 10 min at 50°C, 20 min at 80°C, and a hold at 10°C. The ligation product was transformed into 50 μL of DH5α competent cells, plated on LB agar plates containing tetracycline (5 ng / μL), and incubated overnight at 37°C. Single colonies were selected for polymerase chain reaction (PCR) validation, and positive colonies were then subjected to Sanger sequencing.

[0022] The third step involves assembling the two sgRNA expression cassettes into the pYPQ142 vector using a Golden Gate reaction. The following reagents were added to an ice-cold centrifuge tube: 1 μL 10×T4 DNA ligase buffer (NEB), 0.6 μL pYPQ142 (100 ng / μL), 1.4 μL pYPQ131A-gRNA1 (100 ng / μL), 1.4 μL pYPQ132A-gRNA2 (100 ng / μL), 1 μL BsaI (Thermo Scientific), 1 μL T4 DNA ligase (400 U / μL, NEB), and 12.3 μL sterile distilled water. The mixture was cycled three times: 40°C for 10 min and 16°C for 10 min, followed by 50°C for 10 min, 80°C for 20 min, and then held at 10°C. The ligation product was transformed into chemically active *E. coli* DH5α cells and plated on LB agar plates containing spectinomycin (100 μg / mL), then incubated overnight at 37°C. Since the sgRNA expression cassette replaced the lacZ gene in the pYPQ142 receptor vector, blue-white screening was possible. Two clones were selected and validated by PCR using the gene-gRNA-oligo-1F and gene-gRNA-oligo-2R primer pairs, respectively. Sanger sequencing was then performed on the positive clones.

[0023] In the fourth step, the Cas9 gene and two sgRNA expression cassettes were assembled into the T-DNA binary vectors pK7WG2D or pMDC32 via Gateway recombination. The 10 μL LR reaction mixture was prepared as follows: 1.4 μL pYPQ150 (100 ng / μL), 0.8 μL pYPQ142-gRNA1-gRNA2 (100 ng / μL), 2.4 μL T-DNA binary plasmid (100 ng / μL), 0.5 μL LR cloning enzyme II (Invitrogen), and 4.9 μL sterile distilled water. The reaction was incubated overnight at 25°C in a dry incubator. Without terminating the reaction, all ligation mixtures were directly transformed into chemically active E. coli DH5α cells, plated on LB agar plates containing spectinomycin (100 μg / mL), and then incubated overnight at 37°C. Ten clones were screened and verified by PCR amplification using two primer pairs: gRNA-oligo-1F and gRNA-oligo-2R, and Cas9-F and Cas9-R. The amplified fragments of sgRNAs and Cas9 were then sequenced by Sanger sequencing.

[0024] The nucleotide sequence of the gRNA-oligo-1F is: GATTGTGTTGAGGCAAGACTCCCCA. The nucleotide sequence of the gRNA-oligo-2R is: AAACCAGAGAGGAATGGGAGTGGCC. The nucleotide sequence of the Cas9-F is: CCGAGGGAATGAGAAAGC. The nucleotide sequence of the Cas9-R is: CGGTGATAGACTGGTGGATAAG.

[0025] Example 3: Obtaining CRISPR-NZZ transgenic plants and positive detection Transgenic plants were obtained using Agrobacterium-mediated genetic transformation, with the recipient material being the kumquat "QL". The basic method is as follows: 1. Prepare MT sowing medium: 4.43 g / L MT + 30 g / L sucrose, adjust pH to 5.8-6.0 with KOH, add 6 g / L agar, boil, dispense into sowing tubes, seal and sterilize at 121℃ for 15 min.

[0026] 2. Sowing: Remove the seeds from fresh kumquat fruits and rinse them with tap water to remove the pulp. Let the washed seeds dry slightly, then soak them in a 2 mol / L NaOH solution (8g NaOH, 100mL sterile water) in an Erlenmeyer flask for 15-20 minutes to remove the pectin. Discard the NaOH solution and rinse the seeds 4-5 times with clean water. Disinfect the washed seeds with 75% alcohol for 30 seconds and discard the alcohol. In a clean bench, dilute the antifomin solution (containing 5% NaClO) 4-5 times, i.e., 20ml NaClO + 60-80ml sterile water + 2 drops Triton X-100. Pour the seeds into the Erlenmeyer flask and soak for 15-20 minutes, shaking several times during the process. Discard the NaClO solution and rinse the seeds 4-5 times with sterile water until the water is no longer yellowish. Sow the seeds in glass test tubes containing MT sowing medium, seal and culture in a dark room at 25°C for 5-6 weeks. Beforehand, move the seedlings from the dark to a 16-hour light / 8-hour dark environment and let them grow for 8-10 days to allow their stems to turn green.

[0027] 3. Agrobacterium infection: When the entire tissue culture seedling turns light green (generally 7-8 days), Agrobacterium activation begins. Inoculate the detected Agrobacterium monoclonal suspension carrying the target gene onto solid LB medium at 28℃. After 2 days in an incubator, pick 3-4 monoclonal strains and transfer them to a 50ml centrifuge tube containing 5ml LB + Km / Spec (50mg / L) + Rif (25mg / L). Shake at 220r / min for at least 16 hours at 28℃ until the suspension becomes turbid. In a clean bench, take 1mL of Agrobacterium suspension and add it to an Erlenmeyer flask containing 30ml LB + Km / Spec (50mg / L) + Rif (25mg / L) + 31μl AS (20mg / L). Seal the flask and place it in an incubator at 28℃ at 220r / min for about 5-6 hours until the OD600 reaches 0.3-0.4. Meanwhile, the kumquat seedlings that had already undergone greening treatment under light were cut into stem segments of about 1 cm on sterile filter paper in sterile glass dishes using a sterile blade. These cut stem segments were then placed in 30 ml of MT suspension medium (MT-SM). In a clean bench, the shaken Agrobacterium was poured into a sterile 50 ml centrifuge tube and centrifuged at 4000 rpm / min for 15 min. The supernatant was discarded, and 1 ml of suspension medium (MT-SM) was used to resuspend the bacterial solution. This suspension was then added to an Erlenmeyer flask containing the stem segments, and 32 μl of AS (20 mg / L) was added. The flask was sealed and incubated at 200 rpm / min for 15 min. The bacterial solution was then discarded, ensuring it was as clean as possible.

[0028] 4. Co-culture and selection culture: Place stem segments on co-culture medium (MT-CCM) and co-culture in the dark at 23℃~25℃ for 48~72h. Continue until a straw imprint appears around the stem segment. Then transfer the stem segments to MT-RM selection medium and incubate in the dark at 26℃±2℃. Subculture every 20 days or so, waiting for positive buds to emerge. When the stem segment (excluding leaves) of the positive bud grows to >0.5cm and is completely green, cut the bud from the base and graft it onto the trifoliate orange rootstock seedling. Transplant after the graft has taken.

[0029] CRISPR-NZZ transgenic positive plants were screened by PCR, and the gene editing type of the knockout plants was further determined by sequencing.

[0030] Design specific primers near the FhNZZ target gene sequence to detect the gene knockout fragment sequence: FhNZZ-TGC-F (as shown in SEQ ID NO.4): TGTGAAGAGTGGCAGAGGAAG; FhNZZ-TGC-R (as shown in SEQ ID NO.5): CAAGAAAAAAAAACAACAGAAAAGACGC; Using CRISPR-FhNZZ transgenic plant leaf DNA as a template, PCR amplification and sequencing were performed using Phanta Max Super high-fidelity enzyme to obtain the editing sites. The reaction system was 50 μL, containing 25 μL of 2× Phanta Max Buffer, 1 μL of dNTPMix, 1.25 μL of F-terminal primer, 1.25 μL of R-terminal primer, 18 μL of ddH2O, 2.5 μL of DNA template, and 1 μL of PrimerSTAR high-fidelity enzyme. The reaction program was 95℃ for 3 min; 35 cycles of 95℃ for 15 sec, 57℃ for 15 sec, and 72℃ for 15 sec; 72℃ for 5 min. The amplified products were recovered from the gel, ligated into the TA cloning vector, transformed into E. coli, and sequenced using a single-clone sequencing method. The results are shown below. Figure 1 Four types of positive plants were obtained, as shown.

[0031] Figure 1 A schematic diagram of the mutant DNA sequence obtained by knocking out the NZZ gene target sequence in CRISPR / Cas9. Compared with the wild-type plant (WT), the transgenic plant FhSPLN... CR#1 、FhSPLN CR#2 、FhSPLN CR#3 and FhSPLN CR#4 Different degrees of base deletions or insertions occurred. Specifically, this was observed in the transgenic plant FhSPLN. CR#1 24 clones were sequenced, FhSPLNCR#2 Sequencing of 26 clones, FhSPLN CR#3 29 clones were sequenced and FhSPLN was obtained. CR#4 Sequencing of 18 clones revealed gene editing efficiencies of 100%, 100%, 89.7%, and 44.4%, respectively. Based on the gene editing efficiency evaluation criteria, plants with an editing efficiency greater than 95% were classified as homozygous mutants of the target gene, while those with an editing efficiency not exceeding 95% were classified as heterozygous mutants of the target gene. Therefore, the transgenic plant FhSPLN was identified as... CR#1 and FhSPLN CR#2 It belongs to the homozygous edited plant, the transgenic plant FhSPLN CR#3 and FhSPLN CR#4 It belongs to the heterozygous edited plant.

[0032] Example 4: Phenotypic observation of CRISPR-NZZ transgenic plants To confirm the effect of the NZZ gene on parthenocarpy in citrus, CRISPR-NZZ transgenic plants were compared with wild-type plants (WT). After removing the stigma one day before flowering, the fruit set rate of both CRISPR-NZZ transgenic plants and wild-type plants (WT) was calculated as parthenocarpy capacity. Ovaries were harvested at 0, 3, 7, 14, and 21 days after flowering for paraffin sectioning. The results of ovary paraffin sections at different stages from wild-type (WT), NZZ heterozygous edited plants (NZZ-CR#4), and NZZ homozygous edited plants (NZZ-CR#1) are shown in [link to table]. Figure 2 As shown in the figure, the wild-type plant (WT) does not have the ability to produce parthenocarpic fruit, and its embryo sac is fully developed by day 0 after flowering; the NZZ homozygous knockout plant also does not have the ability to produce parthenocarpic fruit, and its embryo sac fails to develop, and it is still not fully developed by day 21 after flowering; the NZZ heterozygous knockout plant has the ability to produce parthenocarpic fruit, and it can still set fruit and cut the fruit completely seedless even without pollination and fertilization, but its embryo sac development is delayed, and it is only fully developed about day 7 after flowering.

[0033] Figure 3 This represents the parthenocarpic phenotype of plants lacking NZZ function. Figure 4 A comparison of the phenotypes of pollinated fruits from wild-type and NZZ hybrid edited plants. Figure 4 In the middle, the left image (QL-WT x QL-WT) represents the fruit phenotype of a wild-type plant after pollination with wild-type pollen, and the right image (NZZ-CR#4 x QL-WT) represents the heterozygous edited plant FhSPLN. CR#4 The fruit phenotype after pollination with wild-type pollen shows that the pollinated fruits of NZZ heterozygous edited plants also exhibit good parthenocarpy, and seedless fruits can be obtained without the need for isolation pollination measures.

[0034] The above description, in conjunction with specific / preferred embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, various substitutions or modifications can be made to these described embodiments without departing from the inventive concept, and all such substitutions or modifications should be considered within the scope of protection of the present invention.

Claims

1. An NZZ gene for creating parthenocarpic citrus fruits, characterized in that, The nucleotide sequence of the NZZ gene is shown in SEQ ID NO.

1.

2. The NZZ gene for creating parthenocarpic citrus fruits according to claim 1, characterized in that, The primer pairs used to amplify the NZZ gene are shown in SEQ ID NO.2 and SEQ ID NO.

3.

3. A gene knockout vector CRISPR-NZZ for creating parthenocarpic citrus fruits based on the NZZ gene described in claim 1.

4. The gene knockout vector CRISPR-NZZ according to claim 3, characterized in that, The gene knockout vector CRISPR-NZZ is constructed by designing an SgRNA that recognizes the target site, digesting it with enzymes and ligating it into the CRISPR-NZZ vector, and then transforming it to obtain the gene knockout vector CRISPR-NZZ.

5. The gene knockout vector CRISPR-NZZ according to claim 4, characterized in that, The SgRNA at the target site includes target site 1 and target site 2. The sequence of target site 1 is CAGAGAGGAATGGGAGTGGC, and the sequence of target site 2 is TGGGGAGTCTTGCCTCAACA.

6. The application of the NZZ gene for creating parthenocarpy citrus fruits according to claims 1-2 or the gene knockout vector CRISPR-NZZ according to claims 3-5 in creating parthenocarpy citrus fruits.

7. The application according to claim 6, characterized in that, After editing the NZZ gene of citrus with CRISPR / Cas9 and obtaining gene-edited plants, plants with an editing efficiency of no more than 95% are identified as heterozygous mutant plants of the target gene, and the heterozygous mutant plants of the target gene can stably exhibit parthenocarpy traits.

8. The application as described in claim 6 or 7, characterized in that, Primer pairs used to detect NZZ gene mutations or knockout vectors are shown in SEQ ID NO.4 and SEQ ID NO.5.

Images