Dicotyledon guide editing system based on promoter optimization and Csy4 processing and application thereof
Patent Information
- Application Number
- CN202611288637.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-08-24
- Publication Date
- 2026-11-03
AI Technical Summary
Existing guided editing systems are inefficient in dicotyledonous plants, mainly due to insufficient expression of PE protein, incomplete post-transcriptional processing of pegRNA, and easy degradation of pegRNA, resulting in low editing efficiency and limiting their research and breeding applications in dicotyledonous crops.
The expression cassette of PE fusion protein driven by the SlEF1α promoter and the expression cassette of pegRNA driven by the 35S-CmYLCV-U6 complex promoter are combined with the Csy4 nuclease recognition site and the evopreQ1 motif to optimize PE protein expression and pegRNA stability. Precise post-transcriptional processing is achieved through Csy4 endonuclease, thereby improving editing efficiency.
It significantly improves the efficiency of guided editing in dicotyledonous plants, enabling the high-frequency acquisition of homozygous edited plants in the T0 generation. It achieves various precise editing techniques such as base substitution and small fragment insertion, with fewer editing byproducts and a highly modular vector, making it suitable for Cucurbitaceae and other dicotyledonous crops.
Smart Images
Figure CN123027249A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a dicotyledonous plant guided editing system based on promoter optimization and Csy4 processing and its application. Background Technology
[0002] Prime editing (PE) is a CRISPR-based tool that enables all types of precise genome editing, including base substitutions, small fragment insertions and deletions, without the need for double-strand breaks or donor templates. The PE system consists of a nickase SpCas9 (nSpCas9-H840A) fused with reverse transcriptase (RT) and a pegRNA. The former cuts single-stranded DNA and initiates the reverse transcription reaction, while the latter specifies the target site and provides the template for the desired editing. Due to its unique structural and functional characteristics, PE has become an indispensable tool for plant functional genomics research and crop genetic improvement.
[0003] Significant progress has been made in optimizing PE efficiency and expanding its applicability in monocotyledonous crops (including rice, wheat, and maize). In recent years, plant PE systems have evolved into advanced versions such as DualPE and PE7, showing great potential for application in plant genome fragment manipulation. However, the PE efficiency in dicotyledonous plants remains very low. Existing guided editing systems applied to dicotyledonous crops generally suffer from problems such as insufficient PE protein expression, incomplete post-transcriptional processing of pegRNA, and easy degradation of pegRNA, resulting in low overall editing efficiency and hindering the research and breeding applications of guided editing technology in dicotyledonous crops. Current research often directly uses CaMV35S to drive the editing protein and relies on the plant's endogenous tRNA-ribozyme pathway to process pegRNA. This processing mode is limited by the activity of endogenous nucleases in the crop, resulting in limited pegRNA maturation efficiency. Although some reverse transcriptase mutants and mismatch repair inhibitory elements have been shown to have synergistic effects in other species, their editing effects in dicotyledonous cucurbitaceae plants are unpredictable, and a highly efficient guided editing system adapted to cucurbitaceae crops is still lacking. Summary of the Invention
[0004] In view of this, the present invention provides a guided editing system that significantly improves the guided editing efficiency of dicotyledonous plants such as Cucurbitaceae, and can obtain homozygous edited plants at high frequency in the T0 generation.
[0005] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a guided editing system, comprising a PE fusion protein expression cassette and a pegRNA expression cassette. The PE fusion protein expression cassette includes an SlEF1α promoter, an nSpCas9 nuclease, a reverse transcriptase or a reverse transcriptase mutant, and a Csy4 nuclease. The pegRNA expression cassette includes a Csy4 nuclease recognition site. The nucleotide sequence of the SlEF1α promoter is shown in SEQ ID NO:2; the nucleotide sequence of the Csy4 nuclease is shown in SEQ ID NO:4.
[0006] Preferably, the nucleotide sequence of the reverse transcriptase mutant is shown in SEQ ID NO:9.
[0007] Preferably, the nucleotide sequences of the PE fusion protein expression cassette are as shown in SEQ ID NO:5 or SEQ ID NO:10.
[0008] Preferably, the PE fusion protein expression cassette further includes an MLH1 small binding protein encoding gene; the nucleotide sequence of the MLH1 small binding protein encoding gene is shown in SEQ ID NO:6.
[0009] Preferably, the nucleotide sequence of the PE fusion protein expression cassette is shown in SEQ ID NO:10.
[0010] Preferably, the pegRNA expression cassette further includes the evopreQ1 motif.
[0011] This invention provides a guided editing expression carrier, including the guided editing system.
[0012] This invention provides a recombinant bacterium containing the guide editing expression vector.
[0013] This invention provides an application of the guided editing system, the guided editing expression vector, or the recombinant bacteria in at least one of the following: 1) gene editing of dicotyledonous plants; 2) preparation of gene editing products of dicotyledonous plants; 3) improving the gene editing efficiency of dicotyledonous plants.
[0014] Preferably, the dicotyledonous plant includes plants of the Cucurbitaceae family.
[0015] Compared with the prior art, the present invention has the following advantages: The guided editing system of this invention includes a PE fusion protein expression cassette and a pegRNA expression cassette. The PE fusion protein expression cassette is driven by the SlEF1α promoter to produce a fusion protein composed of Csy4, an nSpCas9 nickase variant, nucleocapsid protein NC, and reverse transcriptase. The pegRNA expression cassette is driven by the 35S-CmYLCV-U6 complex promoter, which replaces the traditional tRNA-HDV ribozyme with a Csy4 recognition site and introduces the evopreQ1 motif at the 3′ end of the pegRNA to enhance RNA stability. By employing the SlEF1α promoter to enhance the expression level of guided editing fusion proteins, combining it with the Csy4 endonuclease to achieve precise post-transcriptional processing of pegRNA, and using evopreQ1 to stabilize the motif and an optimized reverse transcriptase variant, the expression level of PE protein and the stability of pegRNA are increased, significantly improving the guided editing efficiency of dicotyledonous plants such as Cucurbitaceae. Homozygous edited plants can be obtained at high frequency in the T0 generation. It can perform various precise edits such as base substitution and small fragment insertion, with few editing byproducts and strong vector modularity. In addition to cucumber, it can also be applied to melon, pumpkin, and potato, providing an efficient genome editing tool for gene function research and molecular breeding in dicotyledonous crops. Attached Figure Description
[0016] Figure 1 This section compares the transcriptional activity and editing-driven efficiency of the CaMV35S and SlEF1α promoters. A shows a comparison of the transcriptional activity of the CaMV35S and SlEF1α promoters. B is a schematic diagram of the pegRNAs for CsACS2-T1 and CsACS2-T2, with red arrows indicating the expected editing sites. The PAM used for gRNA design is marked in orange. The regions corresponding to the protospacer region, PBS sequence, and RTT of the pegRNA are shown in parentheses; the desired editing location is calculated starting from the notch following the arrow. C is a statistical comparison of the editing efficiency of the guided editing system for PE proteins driven by the CaMV35S and SlEF1α promoters at the cucumber ACS2-T1 and ACS2-T2 target sites. p-values were calculated using a t-test. P<0.05, P<0.01, P<0.001, P<0.0001.
[0017] Figure 2This diagram illustrates the editing analysis of CsYUC4-T1 in cucumber using the ePE2-CK and ePE2 editing systems. A shows the vector structures of ePE2-CK and ePE2 in cucumber; B shows the pegRNA of CsYUC4-T1, with red arrows indicating the expected editing sites. The PAM used for gRNA design is marked in orange, and the regions corresponding to the protospacer region, PBS sequence, and RTT of the pegRNA are shown in parentheses. The required editing location is calculated from the notch following the arrow; C shows the efficiency of the two vectors in generating edited line types at generation T0; D shows the editing efficiency generated per plant through high-throughput sequencing.
[0018] Figure 3 This diagram illustrates the editing analysis of CsYUC4-T2, CsARF3-T1, and CsCCD1-T1 in cucumber using six editing systems. A shows schematic diagrams of the vector structures Csy4-ePE2, Csy4-ePE2-SB, Csy4-ePE2-MK, Csy4-PE6d, and Csy4-PE6c; B shows schematic diagrams of the pegRNAs for CsYUC4-T2, CsARF3-T1, and CsCCD1-T1, with red arrows indicating the expected editing sites, and PAMs used for gRNA design marked in orange. The regions corresponding to the protospacer region, PBS sequence, and RTT of the pegRNA are shown in parentheses. The desired editing location is calculated from the notch mark following the arrow; C shows the editing efficiency of each vector; D shows the average editing efficiency of each vector at each target site and the editing efficiency of byproduct production; E shows the proportion of T0 generation line types generated by each vector at each target site; F shows the first-generation sequencing peaks for each target site.
[0019] Figure 4 This diagram illustrates the pegRNAs for CsNLP-T, CsCCD1-T2, CsARF3-T2, and CsCals1-T. Red arrows indicate the intended editing sites. The PAM used for gRNA design is highlighted in orange. The regions corresponding to the protospacer region, PBS sequence, and RTT of the pegRNA are shown in parentheses. The desired editing location is calculated starting from the notch following the arrow.
[0020] Figure 5The results of editing and verifying crop vertices using the Csy4-PE6d editing system. A shows the proportion of different types of T0 generation lines generated by Csy4-PE6d in CsNLP-T, CsCCD1-T2, CsARF3-T2, and CsCals1-T; B shows a schematic diagram of pegRNAs in CsCals1-T, CmCals1-T, CmaCals1-T, and StCals1-T, with red arrows indicating the expected editing sites. PAMs used for gRNA design are marked in orange, and the regions corresponding to the prespacer region, PBS sequence, and RTT of the pegRNA are shown in parentheses. The required editing position is calculated from the notch after the arrow; C shows the proportion of different types of T0 generation lines generated by Csy4-PE6d in other crops using CsCals1-T, CmCals1-T, CmaCals1-T, and StCals1-T; D shows the first-generation sequencing peak diagram generated by Csy4-PE6d in CsCals1-T, CmCals1-T, CmaCals1-T, and StCals1-T. Detailed Implementation
[0021] This invention provides a guided editing system comprising a PE fusion protein expression cassette and a pegRNA expression cassette. The PE fusion protein expression cassette includes an SlEF1α promoter, an nSpCas9 nuclease, a reverse transcriptase or a reverse transcriptase mutant, and a Csy4 nuclease. The pegRNA expression cassette includes a Csy4 nuclease recognition site. The nucleotide sequence of the SlEF1α promoter is shown in SEQ ID NO:2. The nucleotide sequence of the Csy4 nuclease is shown in SEQ ID NO:4. The original backbone vector of the PE fusion protein expression cassette of this invention is pHUC411-pPE2.
[0022] In this invention, the SlEF1α promoter in the PE fusion protein expression cassette drives the transcription of the downstream fusion protein. The coding sequence of the fusion protein, from the 5′ end to the 3′ end, sequentially encodes a Csy4 endonuclease, a P2A self-cleaving peptide, an nSpCas9 cleavage enzyme variant, a nucleocapsid protein NC, a linker, and an M-MLV reverse transcriptase lacking the RNase-H domain. It can also selectively link a small binding protein at the 3′ end via the P2A peptide. The nSpCas9 cleavage enzyme variant has an H840A / R221K / N394K amino acid mutation. The M-MLV reverse transcriptase can selectively carry a T128N / N200C / V223Y mutation. Optimized nuclear localization signals (NLS) are set at both ends of the coding sequence of the fusion protein. The terminator is used to terminate transcription. The pegRNA expression cassette consists of a 35S-CmYLCV-U6 complex promoter, a 5′ Csy recognition site Csy4RS, an epigRNA coding sequence, and a 3′ Csy4 recognition site Csy4RS. The epigRNA coding sequence includes a spacer sequence, a PBS sequence, an RTT reverse transcription template sequence, and a 3′ evopreQ1 stable motif. The Csy4 recognition site Csy4RS can be specifically recognized and cleaved by the Csy4 endonuclease, releasing mature and complete epigRNA.
[0023] In this invention, the PE fusion protein expression cassette includes an SlEF1α promoter, an nSpCas9 nuclease, a reverse transcriptase mutant, and a Csy4 nuclease. The nucleotide sequence of the reverse transcriptase mutant is shown in SEQ ID NO:9, and the nucleotide sequence of the PE fusion protein expression cassette constructed therefrom is shown in SEQ ID NO:10. The PE fusion protein expression cassette of this invention includes an SlEF1α promoter, an nSpCas9 nuclease, a reverse transcriptase or a reverse transcriptase mutant, and a Csy4 nuclease. The nucleotide sequence of the PE fusion protein expression cassette constructed therefrom is shown in SEQ ID NO:5.
[0024] This invention involves digesting the ZmUbi promoter in pHUC411-pPE2 with PstI and HindIII and replacing it with the CaMV35S promoter to obtain ePE2-CK; then, digesting ePE2-CK with PstI to replace the CaMV35S promoter with the SlEF1α promoter to obtain ePE2; finally, integrating the Csy4 restriction enzyme system into ePE2 and fusing Csy4 to the N-terminus of the ePE2 protein via P2A peptide linker to obtain the Csy4-ePE2 plasmid. This invention amplifies the MMLV-T128N / N200C / V223Y fragment from the Csy4-ePE2, performs site-directed mutagenesis at the appropriate positions, and then assembles it using a HiFi DNA Assembly Kit to obtain the Csy4-PE6d plasmid.
[0025] In this invention, the PE fusion protein expression cassette further includes an MLH1 small binding protein encoding gene; the nucleotide sequence of the MLH1 small binding protein encoding gene is shown in SEQ ID NO:6. In this invention, the MLH-SB sequence is fused to the C-terminus of Csy4-ePE2 via the P2A sequence to obtain Csy4-ePE2-SB, wherein the nucleotide sequence of the PE fusion protein expression cassette is shown in SEQ ID NO:10.
[0026] In this invention, the pegRNA expression cassette further includes the evopreQ1 motif. The pegRNA expression cassette of this invention is driven by the 35S-CmYLCV-U6 complex promoter, uses the Csy4 recognition site to replace the traditional tRNA-HDV ribozyme, and introduces the evopreQ1 motif at the 3′ end of the pegRNA to enhance RNA stability.
[0027] This invention provides a guided editing expression vector, including the guided editing system. The invention involves annealing the pegRNA expression cassette and then inserting it into a BsaI-linearized PE fusion protein expression vector to obtain the guided editing expression vector.
[0028] This invention provides a recombinant bacterium containing the guide-edit expression vector. The guide-edit expression vector is transformed into Agrobacterium tumefaciens EHA105 competent cells to obtain the recombinant bacterium.
[0029] This invention provides the application of the guided editing system, the guided editing recombinant expression vector, or the recombinant bacteria in at least one of the following: 1) gene editing of dicotyledonous plants; 2) preparation of gene editing products of dicotyledonous plants; 3) improving the gene editing efficiency of dicotyledonous plants. The dicotyledonous plants mentioned in this invention include plants of the Cucurbitaceae family.
[0030] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0031] Unless otherwise specified, the following embodiments are all conventional methods.
[0032] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. The plant materials used in the following examples include cucumber germplasm 9930, melon germplasm M1, pumpkin germplasm n23195, and potato germplasm C65.
[0033] Example 1: Optimization of the Guided Editing System 1. Promoter optimization 1.1 Construction of ePE2-CK plasmid The PE vector pHUC411-pPE2 was disclosed in existing technology (Juan Li et al. (2022). Development of a highly efficient prime editor 2 system in plants. Genome Biology 23.) as a framework for constructing plant prime editors.
[0034] The ZmUbi promoter in pHUC411-ePE2 was removed by PstI and HindIII restriction enzymes and replaced with the CaMV35S promoter to obtain ePE2-CK. The nucleotide sequence of the CaMV35S promoter is shown in SEQ ID NO:1.
[0035] The ePE2-CK plasmid contains the following features: (1) It uses an nSpCas9 variant (H840A / R221K / N394K), removes the RNase H domain from the M-MLV RT, and fuses nucleocapsid protein (NC) RNA between the SpCas9 nickase and the M-MLV RT. The nuclear localization signal (NLS) and linker are optimized. All elements are driven by the CaMV35S promoter; (2) The transcription of pegRNA is driven by the 35S-CmYLCV-U6 promoter; (3) The evopreQ1 motif is introduced at the 3′ end of the pegRNA to enhance its structural stability (named epigRNA).
[0036] 1.2 Construction of ePE2 plasmid The activities of the CaMV35S promoter and the SlEF1α promoter in cucumber were compared using a dual-luciferase reporter system. Specifically, the CaMV35S promoter was inserted into pGreenII-0800-LUC via BamHI and SacII digestion to obtain the recombinant vector 0800-35S, and the SlEF1α promoter was inserted into pGreenII-0800-LUC to obtain the recombinant vector 0800-EF1α, which were then used for promoter activity analysis. The results showed that the activity of SlEF1α was slightly higher (…). Figure 1 A).
[0037] The CaMV35S promoter in ePE2-CK was replaced with the SlEF1α promoter (SEQ ID NO:2) by PstI digestion to obtain ePE2. The nucleotide sequence of the PE fusion protein expression cassette in ePE2 is shown in SEQ ID NO:3.
[0038] We also designed two additional targets, using the ePE2-CK and ePE2 editing systems prepared above to introduce a T→C substitution at position 54 and a C→T substitution at position 933 of the CsACS2 gene. The results confirmed that, compared with the control group driven by the CaMV35S promoter, the SlEF1α promoter consistently improved PE efficiency. Figure 1 (B and C in the middle).
[0039] 2. The Csy4-mediated guided editing system is illustrated in the following schematic diagram of its carrier structure. Figure 3 As shown in Figure A.
[0040] 2.1 Construction of Csy4-ePE2 plasmid The CRISPR-associated endonuclease Csy4 recognizes specific 28-nucleotide long RNA motifs and mediates precise cleavage, providing a modular tool for the processing and stabilization of pegRNA. To improve the stability and processing efficiency of pegRNA, the Csy4 endonuclease system was integrated into the ePE2 protein constructed above. Csy4 was fused to the N-terminus of the ePE2 protein via a P2A peptide linker, resulting in the Csy4-ePE2 plasmid.
[0041] Specifically, the Csy4 coding sequence (SEQ ID NO:4) was synthesized and fused to the N-terminus of ePE2 via a P2A self-cleaving peptide. Then, the tGly-SpR-sgRNA scaffold-HDV element in ePE2 was replaced with the Csy4RS-SpR-sgRNAscaffold-Csy4RS system to generate the Csy4-ePE2 plasmid, wherein the nucleotide sequence of the PE fusion protein expression cassette is shown in SEQ ID NO:5.
[0042] 2.2 Construction of Csy4-ePE2-SB plasmid MLH1-SB is a novel small-molecule binding protein that can inhibit mismatch repair.
[0043] The construction method is as follows: the MLH-SB sequence (SEQ ID NO:6) is synthesized and fused to the C-terminus of Csy4-ePE2 via the P2A sequence to obtain Csy4-ePE2-SB, wherein the nucleotide sequence of the PE fusion protein expression cassette is shown in SEQ ID NO:7.
[0044] 2.3 Construction of Csy4-ePE2-MK plasmid The reverse transcriptase of Csy4-ePE2-MK carries the V223M / L435K mutation, which enhances the activity and solubility of MMLV-RT.
[0045] The construction method is as follows: the MMLV-V223M / L435 fragment is amplified from Csy4-ePE2 and site-directed mutagenesis is performed at the corresponding position. Then, the plasmid is assembled using the HiFi DNA Assembly Kit to obtain Csy4-ePE2-MK plasmid, wherein the nucleotide sequence of the PE fusion protein expression cassette is shown in SEQ ID NO:8.
[0046] 2.4 Construction of Csy4-PE6d plasmid The RT variant of Csy4-PE6d carries the T128N / N200C / V223Y mutation, which can increase the insertion frequency of the target PE. The construction method is as follows: the MMLV-T128N / N200C / V223Y fragment is amplified from Csy4-ePE2 and site-directed mutagenesis is performed at the corresponding position. The mutant sequence is shown in SEQ ID NO:9. Subsequently, the plasmid Csy4-PE6d is assembled using the HiFi DNA Assembly Kit, and the nucleotide sequence of the PE fusion protein expression cassette is shown in SEQ ID NO:10.
[0047] 2.5 Construction of Csy4-PE6c plasmid In Csy4-PE6c, MMLV-RT was replaced with a Tf1 RT variant derived from fission yeast.
[0048] The construction method is as follows: Based on the Csy4-ePE2 plasmid, the MMLV RT and NC chaperone regions were replaced with a synthesized Tf1 fragment using the same assembly method to obtain the Csy4-PE6c plasmid, wherein the nucleotide sequence of the PE fusion protein expression cassette is shown in SEQ ID NO:11.
[0049] Example 2: Design of pegRNA When the pegRNA is ligated to the ePE2-CK plasmid or ePE2 plasmid sequence constructed in Example 1, the backbone sequence is: GCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAA (SEQ ID NO:12)-spacer-GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:13)-RTT-PBS- TTGACGCGGTTCTATCTAGTTACGCG TTAAACCAACTAGAAAGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGAC (SEQ ID NO: 14).
[0050] When the pegRNA is ligated to the Csy4-ePE2, Csy4-ePE2-SB, Csy4-ePE2-MK, Csy4-PE6d, or Csy4-PE6c plasmid sequences constructed in Example 1, the backbone sequence is: GTTCACTGCCGTATAGGCAG (SEQ ID NO:15)-spacer-GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:13)-RTT-PBS- TTGACGCGGTTCTATCTAGTTACGCGTTAAACCAAC TAGAAA GTTCACTGCCGTATAGGCAG (SEQ ID NO:16) is a sequence that differs from the above sequence only in the bolded Csy4 recognition site. The tRNA / HDV ribozyme structure in the pegRNA is replaced with the Csy4 recognition site (Csy4RS), which enables Csy4 to recognize and cleave the sequence, thereby releasing the independent pegRNA.
[0051] In the above sequences, the sequence between the spacer and PBS-RTT is the sgRNA scaffold, and the underlined sequence is the evopreQ1 motif. The evopreQ1 motif is introduced into the 3′ end of the pegRNA to enhance its structural stability. The spacer, PBS, and RTT template need to be designed according to the target gene, and the sequences are shown in Table 1.
[0052] PegRNAs targeting CsYUC4, CsARF3, CsCCD1, CsNLP, CsCals1, CmCals1, CmaCals1, and StCals1 were designed. The spacer, PBS, and RTT template sequences are shown in Table 1. Two sets of pegRNA sequences were synthesized based on the sequences in Table 1. One set was used for ligation with the constructed ePE2-CK or ePE2 plasmid sequences for subsequent transformation; the other set was used for ligation with the constructed Csy4-ePE2, Csy4-ePE2-SB, Csy4-ePE2-MK, Csy4-PE6d, or Csy4-PE6c sequences for subsequent transformation.
[0053] Table 1. Sequences of pegRNAs used to guide editing
[0054] Example 3: Genetic transformation and evaluation of Cucurbitaceae crops 1. Construction of vectors and recombinant bacteria The pegRNA vector constructed above was annealed and then inserted into the plasmid vector constructed above, which had been linearized with BsaI. All vectors were validated by Sanger sequencing (BGI, Beijing, China) to obtain expression vectors.
[0055] All vectors were transformed into Agrobacterium tumefaciens EHA105 competent cells. Subsequently, genetic transformation of cucurbitaceous crops was carried out through Agrobacterium-mediated transformation.
[0056] 2. Genetic transformation of Cucurbitaceae crops Based on the above methods, genetic transformation of cucurbit crops (including melon, squash, and cucumber) was optimized by adding 100 mg / L spectinomycin to SIM medium. Briefly, seeds were sterilized with ethanol and sodium hypochlorite solution. After germination at 28°C (24 hours for cucumber and melon, 42 hours for squash), cotyledons were removed, transversely cut in half with a sterile scalpel, and the hypocotyl was removed. The explants were gently scraped off with a microbrush and then subjected to ultrasonic treatment (cucumber: 100W, 30s; melon: 50W, 15s; squash: 50W, 5s) using an ultrasonic cleaner (KQ-100DV). After ultrasonic treatment, the explants were vacuum-permeated using a 20 mL syringe (cucumber: 90s twice; melon: 90s once; squash: 30s once). After co-culturing in the dark for 3 days, the explants were transferred to SIM medium supplemented with 100 mg / L spectinomycin. After about a month of regeneration and selection, the surviving regenerated plants were identified as candidate transgenic lines and transferred to rooting medium.
[0057] 3. Evaluation of key editing efficiency and frequency Genomic DNA was extracted from all T0 plants using the CTAB method. Editing was detected by next-generation sequencing (NGS). Raw sequencing reads underwent quality control and filtering, and were then aligned with reference sequences using SuperDecode software (Li et al., 2025a). Coverage depth was calculated. Editing efficiency was determined as: Editing efficiency (%) = (Number of edited reads / Total number of reads) × 100. To compare editing efficiency across different vectors, the average editing efficiency of all positive plants for each vector and target was calculated. Based on editing frequency, plants were classified into four categories: wild-type (WT), chimera (Chi, plants with at least two mutations and / or one wild-type allele), heterozygote (one allele of the intended edit appears at the target site), and homozygote (both alleles at the target site carry the desired edit). Genotypes of T0 mutants were identified by Sanger sequencing. Primer sequences used are shown in Table 2.
[0058] Table 2 Primer sequences
[0059] 4. Deviation from Target Effect Analysis To assess the edit specificity and target deviation risk of the optimized PE system, potential off-target sites for each target site were first predicted using the Cas-o finder online toolkit (http: / / www.rgenome.net / Cas-offinder / new). For each target, the top five candidate off-target sites with the highest predicted probability scores were prioritized for subsequent validation, resulting in a total of 40 off-target evaluation sites. High-throughput deep sequencing was then performed on the Hi-TOM platform to quantitatively detect unexpected indels and SNPs at these candidate sites. Primers used for Hi-TOM sequencing are listed in Table 2.
[0060] 5. Experimental Results The ePE2-CK constructed above and the corresponding guided editing system for ePE2 (see diagram below) Figure 2 A) Schematic diagram of CsYUC4-T1 (pegRNA) in cucumber (see diagram). Figure 2 The analysis by editor B yielded the following results: Figure 2 As shown in the CD, ePE2-CK, using an optimized stable gene transformation system, yielded 20 transgenic plants with an editing efficiency of 5.0%. Hi-TOM deep sequencing analysis indicated that the expected edited reads accounted for only 5.20% of the total sequencing reads. ePE2 targeting the same CsYUC4-T1 site yielded 18 transgenic plants, 10 of which carried the targeted edit (frequency 55.56%), including 2 homozygous lines and 8 heterozygous lines. No byproducts, including insertions or base substitutions from the pegRNA scaffold, were detected. Compared to ePE2-CK, the editing efficiency using ePE2 was significantly improved (5.40-fold), reaching a maximum of 28.12%.
[0061] Three target sites were selected in cucumber genes CsYUC4, auxin response factor 3 (CsARF3), and carotenoid cleavage dioxygenase 1 (CsCCD1) (see schematic diagram of pegRNA). Figure 3(Csy4-ePE2), used to introduce AT to TG, G to C, and a 4-base-pair TTTT insertion. More than ten independent T0 generation lines were obtained for each vector using a stable genetic transformation system. Hi-TOM deep sequencing analysis showed that the introduction of Csy4 significantly improved guided editing efficiency. The average expected edit reads as a percentage of total sequencing reads for Csy4-ePE2, Csy4-ePE2-SB, Csy4-ePE2-MK, Csy4-PE6d, and Csy4-PE6c were 47.23%, 56.20%, 34.40%, 59.93%, and 20.76%, respectively. Except for PE6c, the efficiency of all other vectors was significantly higher than the 19.82% produced by the control ePE2. Among them, Csy4-PE6d showed the best performance, with an efficiency 3.02 times that of ePE2, and slightly better than Csy4-ePE2-SB. At each target site, Csy4-PE6d consistently exhibited the highest precision editing efficiency, reaching up to 71.20% of total sequencing reads at the CsYUC4-T2 target site. In contrast, the editing efficiency of Csy4-ePE2-MK decreased to a level comparable to Csy4-ePE2, indicating that the V223M / L435K double mutation in MMLV-RT has a negative impact on guided editing in cucumber. The above experimental results are as follows... Figure 3 As shown in C.
[0062] In the obtained T0 generation, the average editing frequency increased from 42.38% for ePE2 to 62.55% for Csy4-ePE2, 83.27% for Csy4-ePE2-SB, 52.46% for Csy4-ePE2-MK, 80.83% for Csy4-PE6d, and 37.50% for Csy4-PE6c. Notably, Csy4-ePE2, Csy4-ePE2-SB, Csy4-ePE2-MK, Csy4-PE6d, and Csy4-PE6c produced homozygous lines in 33.44%, 21.57%, 15.44%, 36.44%, and 11.96% of the T0 generation plants, respectively, significantly better than ePE2 (9.52%). Csy4-PE6d achieved a high homozygous editing rate of 46.81% in the YUC4-T2 gene and produced homozygous mutant lines at all three target sites. Figure 3 (DF).
[0063] To evaluate the editing capabilities of the Csy4-PE6d system at different target sites, the editing efficiency of Csy4-PE6d on four other cucumber endogenous genes—CsNLP-T1, CsCCD1-T2, CsARF3-T2, and CsCals1-T—was compared. The expected editing results were TG to CC, CG to GC, a 6-base pair insertion, and AT to GC conversion. Figure 4 ).
[0064] As shown in Table 3 and Figure 5 Results showed that among the more than 23 positive seedlings produced at each target site, the average editing frequencies of Csy4-PE6d were 42.50% (CsNLP-T), 84.38% (CsCCD1-T2), 69.57% (CsARF3-T2), and 76.67% (Cals1-T). Furthermore, among all target genes, Csy4-PE6d produced an average homozygous editing frequency of 10.26%, with the highest editing frequency of 30.43% observed in CsARF3-T2.
[0065] Table 3. Number and proportion of mutants generated by the PE system in T0 transgenic plants.
[0066] To further evaluate the editing effect of Csy4-PE6d in other dicotyledonous crops, targeted and precise editing of the CmCals1 gene (CmCals1-T) in melon, the CmaCals1 gene (CmaCals1-T) in squash, and the StCals1 gene (StCals1-T) in potato was performed using stable transformation technology. A schematic diagram of the pegRNAs for CsCals1-T, CmCals1-T, CmaCals1-T, and StCals1-T is shown below. Figure 5 As shown in B.
[0067] Table 4. Number and proportion of mutants generated by Csy4-PE6d in T0 plants.
[0068] like Figure 5 As shown in Table 4, the expected PE frequency was 70.00% in the melon line, 78.26% in the squash line, and 18.75% in the potato line.
[0069] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. Other embodiments can be obtained based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A guided editing system, characterized in that, The device includes a PE fusion protein expression cassette and a pegRNA expression cassette. The PE fusion protein expression cassette includes an SlEF1α promoter, an nSpCas9 nuclease, a reverse transcriptase or a reverse transcriptase mutant, and a Csy4 nuclease. The pegRNA expression cassette includes a Csy4 nuclease recognition site. The nucleotide sequence of the SlEF1α promoter is shown in SEQ ID NO:2; the nucleotide sequence of the Csy4 nuclease is shown in SEQ ID NO:
4.
2. The guided editing system according to claim 1, characterized in that, The nucleotide sequence of the reverse transcriptase mutant is shown in SEQ ID NO:
9.
3. The guided editing system according to claim 1, characterized in that, The nucleotide sequences of the PE fusion protein expression cassette are shown in SEQ ID NO:5 or SEQ ID NO:
10.
4. The guided editing system according to claim 2, characterized in that, The PE fusion protein expression cassette also includes the MLH1 small binding protein encoding gene; the nucleotide sequence of the MLH1 small binding protein encoding gene is shown in SEQ ID NO:
6.
5. The guided editing system according to claim 4, characterized in that, The nucleotide sequence of the PE fusion protein expression cassette is shown in SEQ ID NO:
10.
6. The guided editing system according to claim 1, characterized in that, The pegRNA expression cassette also includes the evopreQ1 motif.
7. A guided editing expression carrier, characterized in that, Includes the guided editing system as described in any one of claims 1-6.
8. A recombinant bacterium, characterized in that, It includes the guided editing expression carrier as described in claim 7.
9. The use of the guided editing system according to any one of claims 1-6, the guided editing expression vector according to claim 7, or the recombinant bacteria according to claim 8 in at least one of the following: 1) Gene editing in dicotyledonous plants; 2) Preparation of gene-edited products from dicotyledonous plants; 3) Improve the efficiency of gene editing in dicotyledonous plants.
10. The application according to claim 9, characterized in that, The dicotyledonous plants include plants of the Cucurbitaceae family.