CRISPR-cas9 double-plasmid gene editing system for xanthomonas campestris, construction method and application thereof

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a CRISPR-Cas9 double-plasmid gene editing system for Xanthomonas campestris, a construction method and application. The CRISPR-Cas9 double-plasmid gene editing system comprises a SpCas9 protein expression vector and an sgRNA expression vector. The SpCas9 protein expression vector comprises a SpCas9 expression cassette and a resistance marker, and the sgRNA expression vector comprises a lambda Red expression cassette, a target gene homologous recombination arm and an sgRNA expression cassette. The gene knockout efficiency of the system for Xanthomonas campestris reaches 95%, the glycolaldehyde acid transferase gene GumL for acetone modification of xanthan gum is successfully knocked out, a xanthan gum production strain with acetone modification removed is obtained, the modification demand of Xanthomonas campestris in multiple fields such as food, medicine and cosmetics is met, and the system has a very high application prospect.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a CRISPR-Cas9 dual-plasmid gene editing system for Xanthomonas oryzae, its construction method, and its application. Background Technology

[0002] Xanthan gum (XG), also known as xanthan gum, is a high-viscosity, water-soluble anionic extracellular polysaccharide. It was first isolated in the 1950s by the USDA Northern Research Laboratory from the fermentation broth of *Xanthomonas oryzae*, and its average molecular weight is 2 × 10⁻⁶. 6 ~2×10 7 Between Da and D, there are excellent rheological properties and a unique molecular structure.

[0003] The basic structure of XG consists of repeating pentasaccharide units composed of D-glucose, D-mannose, and D-glucuronic acid in a molar ratio of 2:2:1. Its main chain is composed of D-glucose units linked by β-1,4 glycosidic bonds, and each glucose unit in the main chain has a trisaccharide side chain connected at the C3 position via an α-1,3 glycosidic bond. The side chain consists of β-D-mannose, β-D-glucuronic acid, and α-D-mannose sequentially linked by α-1,3 glycosidic bonds, forming a trisaccharide unit structure of β-D-mannose-(1,4)-β-D-glucuronic acid-(1,2)-α-D-mannose. The most significant and structurally characteristic modification is the pyruvyl modification: approximately 30–40% of the terminal α-D-mannose (i.e., the third sugar unit of the trisaccharide side chain) forms a 4,6-cyclic pyruvate acetal structure at C4 and C6. This modification is catalyzed by pyruvate transferase GumL using PEP as a donor, imparting an additional negative charge and rigid cyclic constraint to the side chain terminal. Furthermore, the first β-D-mannose directly connected to the main chain in the side chain has an acetyl modification at C6, with a modification rate of approximately 60–70%. It is worth noting that the modification ratio of pyruvyl and acetyl groups exhibits an inverse regulatory relationship, with both constituting a detailed chemical modification profile of xanthan gum side chains. Among them, pyruvyl modification is widely recognized as one of the most critical structural factors determining the rheological properties, gel behavior, and environmental adaptability of xanthan gum due to its profound influence on molecular conformation, charge distribution, and thermodynamic stability.

[0004] Currently, Xanthomonas campestris ( Xanthomonas campestris*Xanthan gum* pv. campestris (Xcc) efficiently secretes the extracellular polysaccharide xanthan gum. Due to its excellent thickening, suspending, emulsifying, and stabilizing properties, it is widely used in food, oil extraction, and pharmaceutical fields. In recent years, with the continuous expansion of the global xanthan gum market, my country has become a major producer, accounting for over 70% of the global market capacity. However, the inherent pyruvyl and acetyl groups in natural xanthan gum limit its physiological activity, targeting, and functional controllability, restricting its further application in high-end biomedical and functional materials fields. Furthermore, systematic analysis of functional genes and metabolic network modification of this strain have long been hampered by a lack of efficient, precise, and universal gene manipulation tools. Traditional gene knockout methods (such as homologous recombination and suicide plasmid systems) suffer from low efficiency and lengthy operation cycles, failing to meet the needs of rapid mutant construction and parallel multi-gene editing, severely restricting in-depth research on key issues such as its pathogenic mechanism, stress resistance regulation, and xanthan gum synthesis pathway.

[0005] In recent years, the rise of emerging gene editing technologies such as CRISPR Cas9 has brought revolutionary breakthroughs to bacterial genetic manipulation. The CRISPR Cas9 system and its derivative tools (such as CRISPRi and CRISPRa) have achieved efficient gene editing and regulation in various model bacteria, including *Escherichia coli* and *Pseudomonas aeruginosa*. However, *Xanthomonas spp.* exhibits significant cytotoxicity to the Cas9 protein, and overexpression can lead to a sharp decline in editing efficiency. Furthermore, the recombinase activity of this bacterium is insufficient to support efficient template integration, making it difficult to effectively utilize homology-directed repair pathways. In addition, its genome has a high GC content of 65%, which not only makes the DNA secondary structure more stable but also severely interferes with the transcription and translation efficiency of exogenous CRISPR components, greatly increasing the difficulty of genetic manipulation. The aforementioned three inherent obstacles constitute a "hard bottleneck" for the application of CRISPR tools in this bacterium, resulting in poor adaptability and low editing efficiency in existing reported systems. Consequently, the development of CRISPR systems specifically for this strain is still in its early stages. Furthermore, existing reported editing systems generally suffer from poor adaptability and low editing efficiency, and systematic screening and validation of promoters, RBS, and other basic expression elements suitable for this strain are lacking. Therefore, there is an urgent need to develop a highly efficient, stable, and universal CRISPR Cas9 gene editing tool specifically for *Xanthomonas brasiliensis* to achieve rapid and precise gene knockout and metabolic engineering, thereby promoting the in-depth application of this bacterium in the field of industrial microbiology. Summary of the Invention

[0006] In view of the limitations of existing technologies for Xanthomonas brasiliensis, which lack efficient and precise gene editing tools, the purpose of this invention is to provide a CRISPR Cas9 dual-plasmid gene editing system for Xanthomonas brasiliensis, its construction method, and its application.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A CRISPR Cas9 dual-plasmid gene editing system for Xanthomonas campestris includes an SpCas9 protein expression vector and an sgRNA expression vector. The SpCas9 protein expression vector contains an SpCas9 expression cassette and an resistance marker, while the sgRNA expression vector consists of a λRed expression cassette, a target gene homologous recombination arm, and an sgRNA expression cassette.

[0008] The SpCas9 expression cassette is composed of P AB It consists of an inducible promoter, an RBS sequence, and the SpCas9 protein-coding gene, among which P AB The inducible promoter initiates expression during the host's logarithmic growth phase. The amino acid sequence of the SpCas9 protein is shown in SEQ ID NO. 1.

[0009] The host is Xanthomonas campestris.

[0010] The sgRNA expression vector comprises a λRed expression cassette, a target gene homologous recombination arm, and an sgRNA expression cassette, wherein the λRed expression cassette is composed of P 11 The constitutive promoter, RBS sequence, and λRed combinatorial protein-coding gene constitute the sgRNA expression cassette, which is composed of P Te It consists of a constitutive promoter, crRNA, and tracrRNA.

[0011] The homologous recombination arm of the target gene is composed of the following sequence: crRNA - upstream homologous arm of the knockout gene - downstream homologous arm of the knockout gene - crRNA.

[0012] The SpCas9 protein expression vector uses the commercially available pBBR1MCS-2 plasmid as its backbone, and the sgRNA expression vector uses the commercially available pKD46 plasmid.

[0013] An application of the dual-plasmid gene editing system, specifically its application in genome editing of Xanthomonas campestris.

[0014] A recombinant strain for producing xanthan gum (shown in Formula 1) with side-chain pyruvyl modification removed is obtained by constructing the recombinant strain using the dual plasmid gene editing system, wherein the target gene in the dual plasmid gene editing system is the pyruvyltransferase encoding gene GumL.

[0015] Formula 1 One application of the recombinant strain is to ferment the strain in NYGB medium to obtain xanthan gum with deacetylated acyl groups.

[0016] Advantages of this invention: This invention provides a CRISPR Cas9 dual-plasmid gene editing system, employing P with low basal expression levels and well-defined induction effects. AB An inducible promoter drives SpCas9 gene expression, effectively avoiding cytotoxicity caused by excessive accumulation of Cas9 protein; simultaneously, P is used in conjunction with it. 11 Constitutive promoters drive the expression of the λRed homologous recombination system, providing a sufficient supply of recombinase for efficient integration of the editing template. The synergistic effect of these two mechanisms overcomes the dual obstacles of Cas9 toxicity and low recombination efficiency at the source. Furthermore, this system achieves a 95% gene knockout efficiency in *Xanthomonas brasiliensis*. Using the constructed CRISPR Cas9 dual-plasmid gene editing system, efficient and precise knockout or expression regulation of the pyruvyltransferase encoding gene *GumL* can be achieved. This system provides an efficient and reliable genetic manipulation platform for industrial strains of *Xanthomonas brasiliensis*, freeing them from the limitations of low efficiency and long processing times inherent in traditional gene editing tools. Furthermore, this invention successfully knocked out the pyruvate transferase gene GumL, which modifies xanthan gum with pyruvate, in Xanthan Bacillus thuringiensis using the aforementioned dual-plasmid gene editing system, thereby obtaining a xanthan gum production strain containing pyruvate modification. Further fermentation culture of the obtained strain yields xanthan gum containing pyruvate modification, which has broad market prospects and industrialization value in applications such as food texture improvement, drug sustained-release carriers, oilfield displacement agents, and personal care products. Attached Figure Description

[0017] Figure 1 pBBR1MCS-2-P provided for embodiments of the present invention AB -Schematic diagram of SpCas9 plasmid.

[0018] Figure 2 A schematic diagram of the pKD46-sgRNA plasmid provided in an embodiment of the present invention. Figure 3 This is an electrophoresis diagram of colony PCR identification of the GumL gene knockout mutant strain provided in this embodiment of the invention; wherein: lane M is the marker, and lanes 1-20 are templates of whole genome from a single colony on a plate.

[0019] Figure 4 The sequencing and alignment results of the GumL gene knockout colony PCR samples provided in this embodiment of the invention.

[0020] Figure 5 The graph shows the determination of pyruvate content in xanthan gum from different sources, as provided in the embodiments of the present invention.

[0021] Figure 6 Fourier transform infrared spectra and pyruvate characteristic peak spectra of xanthan gum from different sources provided in embodiments of the present invention. Detailed Implementation

[0022] The following non-limiting embodiments are intended to enable those skilled in the art to gain a more comprehensive understanding of the present invention, but are not intended to limit the invention in any way.

[0023] Example 1: SpCas9 protein expression vector, specifically pBBR1MCS-2-P AB Construction of the SpCas9 expression vector, plasmid schematic diagram as shown below. Figure 1 As shown.

[0024] a. According to SpCas9, P AB Primers were designed upstream and downstream of the inducible promoter and the vector plasmid pBBR1MCS-2, respectively. Specific primer information is shown in Table 1. Table 1 Constructing pBBR1MCS-2-P AB - Primers required for the SpCas9 expression vector and their specific information

[0025] Primer pairs SpCas9-F and SpCas9-R were used to amplify the SpCas9 fragment.

[0026] Primer pair P AB -F and P AB -R is used to amplify P AB Excerpt.

[0027] Primer pairs MCS2-F and MCS2-R were used to amplify the pBBR1MCS-2 vector fragment.

[0028] b. Using seamless DNA cloning, plasmid pBBR1MCS-2-P AB -SpCas9 is used for building (1) Seamless clone fragment amplification: ①The SpCas9 fragment amplification reaction system was as follows: 25 μl of 2×SuperNova PCR Mix (Dye) (purchased from GenStar), 2.5 μl of forward primer, 2.5 μl of reverse primer, template DNA, 200 ng, and sterile water to a final volume of 50 μl.

[0029] The PCR reaction program for fragment amplification was as follows: pre-denaturation at 98℃ for 5 min; followed by denaturation at 98℃ for 15 s, annealing for 15 s (annealing temperature and extension time are shown in Table 1), for 35 cycles, and finally incubation at 72℃ for 10 min. The amplified fragment bands were recovered.

[0030] ②P AB The fragment amplification reaction system was as follows: 25 μl of 2×SuperNova PCR Mix (Dye) (purchased from GenStar), 2.5 μl of forward primer, 2.5 μl of reverse primer, template DNA, 200 ng, and sterile water to a final volume of 50 μl.

[0031] The PCR reaction program for fragment amplification was as follows: pre-denaturation at 98℃ for 5 min; followed by denaturation at 98℃ for 15 s, annealing for 15 s (annealing temperature and extension time are shown in Table 1), for 35 cycles, and finally incubation at 72℃ for 10 min. The amplified fragment bands were recovered.

[0032] ③ The amplification reaction system for the pBBR1MCS-2 vector fragment was as follows: 25 μl of 2×SuperNova PCR Mix (Dye) (purchased from GenStar), 2.5 μl of forward primer, 2.5 μl of reverse primer, 200 ng of template DNA plasmid (pBBR1MCS-2), and 50 μl of sterile water.

[0033] The PCR reaction program for fragment amplification was as follows: pre-denaturation at 98℃ for 5 min; followed by denaturation at 98℃ for 15 s, annealing for 15 s (annealing temperature and extension time are shown in Table 1), for 35 cycles, and finally incubation at 72℃ for 10 min. The amplified fragment bands were recovered.

[0034] (2) Seamless cloning and plasmid construction: The gel-recovered fragment samples obtained in steps ①, ② and ③ were used to determine their concentration using a NanoVuePlus micro spectrophotometer. The volume of different fragment samples added to the seamless reaction system was calculated according to the following formula.

[0035] Formula: V = segment length × 0.02 / C V: Volume (unit: μl) C: Concentration (unit: ng / μl) Assuming the volume of the SpCas9 fragment sample added to the reaction system is X μl according to the above formula, P AB The volume of the fragment sample added to the reaction system was Y μl, and the volume of the pBBR1MCS-2 vector fragment sample added to the reaction system was Z μl.

[0036] Seamless connection system: 5 μl 2 × CE Mix V3 (purchased from Vazyme), X μl SpCas9 fragment sample, Y μl P AB Fragment sample: Z μl pBBR1MCS-2 vector fragment sample, sterile water to a final volume of 10 μl. Mix well and react in a 50℃ water bath for 30 min.

[0037] c. Introduce the plasmid into E. coli (1) Add the above seamless connection system to the heat-transformed Escherichia coli DH5α competent cells, gently tap and mix with a pipette, place on ice for 30 min, heat shock in a 42℃ water bath for 60 s, quickly transfer to ice bath for 2 min, then add 1 ml of LB liquid medium (mass concentration in water: 1% NaCl, 1% peptone, 0.5% yeast extract), and culture in a shaker at 37℃ and 200 rpm for 1 h. After the culture is completed, centrifuge at 4000 rpm for 2 min, aspirate 900 μl of supernatant, resuspend the bacterial precipitate with the remaining supernatant, aspirate all of it and spread it on the surface of LB solid medium containing a final concentration of 50 μg / mL Chl resistance, and culture in an incubator at 37℃ for 12 h.

[0038] (2) Inoculate the single colony grown on the solid medium in step (1) into 10 mL of LB liquid medium containing Apra resistance at a final concentration of 50 μg / mL, and incubate at 37°C and 200 rpm for 12 h.

[0039] Plasmid extraction: ① At room temperature, take 8 mL of overnight cultured bacterial solution and centrifuge at 8,000 g × 2 min, discarding the supernatant; ② Add 250 μL of Buffer P1 (from Sangon Biotech (Shanghai) Co., Ltd. Plasmid Extraction Kit, B518191, 100 times) to the precipitate to suspend the bacterial cells; ③ Add 250 μL of Buffer P2 (from Sangon Biotech (Shanghai) Co., Ltd. Plasmid Extraction Kit, 100 times), immediately and gently invert the centrifuge tube to mix, and incubate at room temperature for 2 min to allow complete cell lysis; ④ Add 350 μL of Buffer P2. P3 (from Sangon Biotech (Shanghai) Co., Ltd. Plasmid Extraction Kit, B518191, 100 times), gently invert to mix until the liquid becomes white and flocculent, centrifuge at 12,000g for 10 min; ⑤ Pipette the supernatant into the plasmid extraction column (from Sangon Biotech (Shanghai) Co., Ltd. Plasmid Extraction Kit, B518191, 100 times), centrifuge at 8,000g for 30 s, and discard the collected liquid; ⑥ Add 500 μL Wash buffer (from Sangon Biotech (Shanghai) Co., Ltd. Plasmid Extraction Kit, B518191, 100 times) to the plasmid extraction column, centrifuge at 9,000g for 30 s, and discard the collected liquid; ⑦ Add another 500 μL Wash buffer to the plasmid extraction column, centrifuge at 9,000g for 30 s, and discard the collected liquid; ⑧ Transfer the plasmid extraction column from step ⑦ to a clean 1.5 mL centrifuge tube, centrifuge at 9... Centrifuge at 9000g for 1 min; ⑨ Open the cap of the centrifuge tube at room temperature and let it stand for 10 min to allow the ethanol on the adsorption column to evaporate completely; ⑩ Add 80 μL of Elution Buffer (from Sangon Biotech (Shanghai) Co., Ltd. plasmid extraction kit, B518191, 100 times) evenly to the adsorption column membrane, incubate at 55℃ for 5 min, centrifuge at 9000g for 1 min, collect the liquid plasmid, and identify the plasmid by 1.0% agarose gel electrophoresis. Select the plasmid with the correct band size, pBBR1MCS-2-P. AB SpCas9 was commissioned to Jilin Kumei Company for sequencing verification, and the correctly verified pBBR1MCS-2-P was preserved. AB -SpCas9 plasmid.

[0040] Example 2 Using the pyruvyltransferase encoding gene GumL as the target gene, an sgRNA expression vector was constructed, specifically the pKD46-sgRNA expression vector. A schematic diagram of the plasmid is shown below. Figure 2 As shown: a. Primers were designed upstream and downstream of the GumL homologous recombination arm expression cassette, the sgRNA expression cassette, and the vector plasmid pKD46, respectively. Specific primer information is shown in Table 2.

[0041] Table 2. Primers and their specific information required for constructing the pKD46-sgRNA expression vector.

[0042] Primer pairs homologous-F and homologous-R were used to amplify the homologous recombination arm expression cassette fragment, namely, the GumL base sequence.

[0043] Primer pairs SgRNA-F and SgRNA-R are used to amplify the sgRNA expression cassette fragment, i.e., the SgRNA base sequence: TTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO. 3).

[0044] Primer pairs pKD46-F and pKD46-R were used to amplify the pKD46 vector fragment.

[0045] b. The plasmid pKD46-sgRNA was constructed using seamless DNA cloning.

[0046] (1) Seamless clone fragment amplification: ① The homologous recombination arm expression cassette fragment amplification reaction system was as follows: 25 μl of 2×SuperNova PCR Mix (Dye) (purchased from GenStar), 2.5 μl of forward primer, 2.5 μl of reverse primer, template DNA, 200 ng, and sterile water to a final volume of 50 μl.

[0047] The PCR reaction program for fragment amplification was as follows: pre-denaturation at 98℃ for 5 min; followed by denaturation at 98℃ for 15 s, annealing for 15 s (annealing temperature and extension time are shown in Table 2), for 35 cycles, and finally incubation at 72℃ for 10 min. The amplified fragment bands were recovered.

[0048] ②The sgRNA expression cassette fragment amplification reaction system was as follows: 25 μl of 2×SuperNova PCR Mix (Dye) (purchased from GenStar), 2.5 μl of forward primer, 2.5 μl of reverse primer, template DNA, 200 ng, and sterile water to a final volume of 50 μl.

[0049] The PCR reaction program for fragment amplification was as follows: pre-denaturation at 98℃ for 5 min; followed by denaturation at 98℃ for 15 s, annealing for 15 s (annealing temperature and extension time are shown in Table 2), for 35 cycles, and finally incubation at 72℃ for 10 min. The amplified fragment bands were recovered.

[0050] ③ The pKD46 vector fragment amplification reaction system was as follows: 25 μl of 2×SuperNova PCR Mix (Dye) (purchased from GenStar), 2.5 μl of forward primer, 2.5 μl of reverse primer, 200 ng of template DNA plasmid (pBBR1MCS-2), and Sterile Water to a final volume of 50 μl.

[0051] The PCR reaction program for fragment amplification was as follows: pre-denaturation at 98℃ for 5 min; followed by denaturation at 98℃ for 15 s, annealing for 15 s (annealing temperature and extension time are shown in Table 2), for 35 cycles, and finally incubation at 72℃ for 10 min. The amplified fragment bands were recovered.

[0052] (2) Seamless cloning and plasmid construction: The gel-recovered fragment samples obtained in steps ①, ② and ③ were used to determine their concentration using a NanoVuePlus micro spectrophotometer. The volume of different fragment samples added to the seamless reaction system was calculated according to the following formula.

[0053] Formula: V = segment length × 0.02 / C V: Volume (unit: μl) C: Concentration (unit: ng / μl) Let the volume of the homologous recombination arm expression cassette fragment sample added to the reaction system be X μl, the volume of the sgRNA expression cassette fragment sample added to the reaction system be Y μl, and the volume of the pKD46 vector fragment sample added to the reaction system be Z μl, calculated according to the above formula.

[0054] Seamless fusion system: 5 μl 2 × CE Mix V3 (purchased from Vazyme), X μl homologous recombination arm expression cassette fragment sample, Y μl sgRNA expression cassette fragment sample, Z μl pKD46 vector fragment sample, and sterile water to a final volume of 10 μl. After mixing, incubate in a 50°C water bath for 30 min.

[0055] c. Introduce the recombinant plasmid into E. coli (1) Add the above seamless connection system to the heat-transformed Escherichia coli DH5α competent cells, gently tap and mix with a pipette, place on ice for 30 min, heat shock in a 42℃ water bath for 60 s, quickly transfer to ice bath for 2 min, then add 1 ml of LB liquid medium (mass concentration in water: 1% NaCl, 1% peptone, 0.5% yeast extract), and culture in a shaker at 30℃ and 200 rpm for 2 h. After the culture is completed, centrifuge at 4000 rpm for 2 min, aspirate 900 μl of supernatant, resuspend the bacterial precipitate with the remaining supernatant, aspirate all of it and spread it on the surface of LB solid medium containing a final concentration of 30 μg / mL Gent resistance, and culture in an incubator at 30℃ for 24 h.

[0056] (2) Inoculate the single colony grown on the solid culture medium in step (1) into 10 mL of LB liquid medium containing a final concentration of 30 μg / mL Gent resistance, and culture at 30°C and 200 rpm for 24 h.

[0057] Plasmid extraction: ① At room temperature, take 8 mL of overnight cultured bacterial solution and centrifuge at 8,000 g × 2 min, discarding the supernatant; ② Add 250 μL of Buffer P1 (from Sangon Biotech (Shanghai) Co., Ltd. Plasmid Extraction Kit, B518191, 100 times) to the precipitate to suspend the bacterial cells; ③ Add 250 μL of Buffer P2 (from Sangon Biotech (Shanghai) Co., Ltd. Plasmid Extraction Kit, 100 times), immediately and gently invert the centrifuge tube to mix, and incubate at room temperature for 2 min to allow complete cell lysis; ④ Add 350 μL of Buffer P2. P3 (from Sangon Biotech (Shanghai) Co., Ltd. Plasmid Extraction Kit, B518191, 100 times), gently invert to mix until the liquid becomes white and flocculent, centrifuge at 12,000g for 10 min; ⑤ Pipette the supernatant into the plasmid extraction column (from Sangon Biotech (Shanghai) Co., Ltd. Plasmid Extraction Kit, B518191, 100 times), centrifuge at 8,000g for 30 s, and discard the collected liquid; ⑥ Add 500 μL Wash buffer (from Sangon Biotech (Shanghai) Co., Ltd. Plasmid Extraction Kit, B518191, 100 times) to the plasmid extraction column, centrifuge at 9,000g for 30 s, and discard the collected liquid; ⑦ Add another 500 μL Wash buffer to the plasmid extraction column, centrifuge at 9,000g for 30 s, and discard the collected liquid; ⑧ Transfer the plasmid extraction column from step ⑦ to a clean 1.5 mL centrifuge tube, centrifuge at 9... Centrifuge at 9000g for 1 min; ⑨ Open the cap of the centrifuge tube at room temperature and let it stand for 10 min to allow the ethanol on the adsorption column to evaporate completely; ⑩ Add 80 μL of Elution Buffer (from Sangon Biotech (Shanghai) Co., Ltd. plasmid extraction kit, B518191, 100 times) evenly to the adsorption column membrane, incubate at 55℃ for 5 min, centrifuge at 9000g for 1 min, collect the liquid plasmid, and identify the plasmid by 1.0% agarose gel electrophoresis. The pKD46-sgRNA plasmid with the correct band size was sent to Jilin Kumei Company for sequencing verification, and the verified pKD46-sgRNA plasmid was saved.

[0058] Example 3: Plasmid transfection a. Preparation of Xanthomonas oryzae electroporation competent cells: (1) Streaking of Xanthomonas oryzae (obtained commercially) frozen tube culture plates onto NYGB solid medium (mass concentration in water: 2% glycerol, 0.3% yeast extract, 0.5% tryptone, 1.5% agar) and incubating at 30℃ for 36h.

[0059] (2) Pick a single colony from the plate and inoculate it into 10 mL of NYGB liquid medium (concentration in water: 2% glycerol, 0.3% yeast extract, 0.5% tryptone), and incubate at 30°C and 200 rpm in a shaker until OD. 600 =0.6.

[0060] (3) Expand the seed culture to 50 mL of NYGB liquid medium at a ratio of 1:50 (v / v) and culture at 30°C and 200 rpm in a shaker until OD. 600 =0.6.

[0061] (4) Place the bacterial solution on ice to pre-cool for 30 minutes.

[0062] (5) Place the bacterial culture in a 250mL centrifuge cup and centrifuge at 1200 g × 3 min 4 ℃ using a Xiangyi GL21-M centrifuge.

[0063] (6) Discard the supernatant, resuspend the bacterial precipitate with 100 mL of pre-cooled 300 mM sucrose, and centrifuge at 1200 g × 3 min 4 ℃ using a Xiangyi GL21-M centrifuge.

[0064] (7) Discard the supernatant, resuspend the bacterial precipitate with 50 mL of pre-cooled 300 mM sucrose, and centrifuge at 1200 g × 3 min 4 ℃ using a Xiangyi GL21-M centrifuge.

[0065] (8) Discard the supernatant, resuspend the bacterial precipitate with 1 mL of pre-cooled 300 mM sucrose, aliquot 100 μL into sterile 1.5 mL EP tubes, and store at -80 °C for later use.

[0066] b. Plasmid transfection: (1) Turn on the electrofusion apparatus and preheat for 20 minutes, and place the electrofusion cup in a -20℃ refrigerator for 20 minutes to pre-cool.

[0067] (2) The prepared Xanthomonas oryzae were electroporated to become competent, taken out of the -80℃ freezer and placed on ice to thaw. 200 ng of the expression vector obtained in Example 1 and Example 2 above was added, gently tapped to mix, and placed on ice to incubate for 10 min.

[0068] (3) Aspirate the competent cells and place them in the slit of the electroporation cup. Place the electroporation cup in the electroporation fusion apparatus and electroporate at 2500V for 5ms. After the electroporation is completed, remove the electroporation cup and add 1mL of SOC liquid culture medium (2% trypsin, 0.5% yeast extract, 0.05% NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM D-glucose, pH 7.5) to the electroporation cup. Resuspend the cells, aspirate them, and place them in a 1.5mL EP tube. Incubate at 30℃ and 200rpm for 2h on a shaker.

[0069] (4) After the culture is completed, centrifuge at 4000 rpm for 2 min, aspirate 900 μl of supernatant, resuspend the bacterial precipitate with the remaining supernatant, aspirate all of it and spread it on the surface of NYGB solid medium with the corresponding plasmid resistance, and incubate in a 30℃ incubator for 48 h.

[0070] (5) Inoculate the single colony grown on the solid culture medium in step (4) into 10 mL of NYGB liquid culture medium containing the corresponding resistance, and culture at 30°C and 200 rpm for 36 h.

[0071] (6) After the culture is completed, plasmids are extracted and identified by agarose gel electrophoresis to ensure successful plasmid transfection.

[0072] (7) Preserve the successfully transfected bacterial strain: Mix 700 μL of bacterial solution and 300 μL of 60% glycerol in a sterile frozen tube and store in a -80°C freezer.

[0073] As can be seen from the above, specifically: a. First, prepare Xanthomonas oryzae electroporation-transformed competent cells according to the procedure described in Example 3a. Then, use the successfully constructed plasmid pBBR1MCS-2-P AB SpCas9 electroporation into the above competent cells yielded the recombinant strain Xcc-pBBR1MCS-2-P AB -SpCas9.

[0074] b. Following the procedure described in Example 3a, the recombinant strain Xcc-pBBR1MCS-2-P was prepared. AB - Electroporation transformation of SpCas9 into competent cells. The successfully constructed plasmid pKD46-sgRNA was electroporated into these competent cells to obtain the recombinant strain Xcc-SpCas9-sgRNA.

[0075] c. Pick a single colony of Xcc-SpCas9-sgRNA and inoculate it into 10 mL of NYGB liquid medium (composed of 2% glycerol, 0.3% yeast extract, and 0.5% trypsin per liter of water), and incubate at 30 ℃ with shaking at 200 r / min until OD reaches 100%. 600 =0.6, add 20 μL L-arabinose inducer (final concentration 0.2%), and continue induction culture at 30 ℃ and 200 rpm for 1 h.

[0076] d. Take 10 μL of the induced bacterial culture, dilute it 10 times with sterile water, take 100 μL of the diluted solution and spread it on NYGB solid plates, and incubate at 30 ℃ until obvious single colonies grow.

[0077] e. Select single colonies for colony PCR identification to verify the GumL gene knockout status: ① Take 20 PCR tubes and add 10 μL of sterile water to each tube. Randomly pick 20 single colonies from the plate and add them to each tube respectively. Shake to mix and prepare the bacterial solution.

[0078] ② Using each tube of bacterial culture as a template, PCR amplification was performed using the GumL gene knockout identification primers L-knockout-F and L-knockout-R (sequences are shown in Table 3).

[0079] ③ The colony PCR reaction system (total volume 15 μL) is as follows: 7.5 μL of 2×SuperNova PCR Mix (containing dye, purchased from GenStar), 0.6 μL of forward primer L-knockout-F, 0.6 μL of reverse primer L-knockout-R, 1 μL of single colony culture, and sterile water to a final volume of 15 μL.

[0080] The PCR reaction program was as follows: pre-denaturation at 98 °C for 10 min; then 30 cycles, each cycle consisting of denaturation at 98 °C for 15 s, annealing for 15 s (annealing temperatures are shown in Table 2), extension at 72 °C (extension times are shown in Table 2); and finally incubation at 72 °C for 10 min.

[0081] ④ Identify the PCR samples after the reaction by 1.0% agarose gel electrophoresis (see [link]). Figure 3 ), Figure 3 Electrophoresis results showed that among 20 randomly selected single colonies, 19 colonies exhibited PCR bands consistent with the expected target band size after knockout. Specifically, 19 colonies (lanes 1–19) showed amplification products consistent with the expected target band after knockout, while only one colony (lane 20) did not show this band. Fragment length comparison confirmed that the amplified fragment before GumL gene knockout was 3056 bp, while the target band after knockout was 2261 bp; the difference was significant and easily distinguishable.

[0082] Preliminary results indicate a gene knockout rate of up to 95%. To further verify the accuracy of the knockout, two randomly selected PCR samples were sent to Jilin Kumei Company for sequencing verification (see [link to sample sample]). Figure 4 Sequencing results are as follows Figure 4 As shown, sequencing results confirmed that the GumL gene had been successfully knocked out, thus obtaining a strain with the GumL gene knocked out, named Xcc-ΔGumL.

[0083] Table 3 Primers required for GumL gene knockout and their specific information.

[0084] Example 4: Fermentation and xanthan gum extraction of wild-type Xcc and Xcc-ΔGumL strains: a. Inoculate the frozen strain Xcc-ΔGumL obtained above into 10 mL of NYGB liquid medium and incubate at 30°C and 200 rpm in a shaker until OD. 600 =0.6.

[0085] c. Expand the seed culture to 500 mL NYGB liquid medium at a ratio of 1:100 (v / v) and culture at 30°C and 200 rpm for 96 h.

[0086] d. Remove the cultured fermentation broth from the incubator, pour it into a 250mL centrifuge cup, and place it in a GL-21M centrifuge at 10000 g for 30 min to remove the bacterial cells from the fermentation broth.

[0087] e. After centrifugation, pour the supernatant into a beaker, add three times the volume of anhydrous ethanol to the beaker, and let it stand for 5-10 minutes to allow the low molecular weight xanthan gum to precipitate and float to the surface.

[0088] f. After the low molecular weight xanthan gum has completely floated and aggregated, use a glass rod to pick it out and place it in a clean 50mL centrifuge tube. Open the centrifuge tube cap and place it at room temperature to allow the residual ethanol to evaporate. After evaporation, place it in an 80℃ oven to dry the extracted xanthan gum. Xanthomonas brasiliensis (wild-type Xcc) was used as a control.

[0089] The pyruvyl content of xanthan gum in the fermentation products obtained from the above-mentioned wild-type Xcc and Xcc-ΔGumL strains was determined as follows: 1. Plotting the standard curve Accurately weigh 0.75 g of sodium pyruvate standard and dissolve it in 25 ml of water. Dilute 10 times to obtain a 0.3 mg / ml pyruvate standard solution. Take 0, 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, and 0.45 ml of the pyruvate standard solution and place them in test tubes respectively. Add water to 1.0 ml, add 0.5 ml of 0.1% (w / v) 2,4-dinitrophenylhydrazine solution, shake well, then add 2.5 ml of 1.5 mol / L NaOH solution, shake well, and react at room temperature for 10 min. Measure the absorbance at 520 nm. Plot the standard solution concentration against the corresponding absorbance to obtain the standard curve and linear regression equation.

[0090] 2. Determination of pyruvic acid content Weigh 0.01 g of the xanthan gum sample to be tested and dissolve it in 5 ml of 1 M HCl. Hydrolyze at 100 °C for 3 h. Take 1 ml of the hydrolysate, add 0.5 ml of 0.1% 2,4-dinitrophenylhydrazine solution, shake well, then add 2.5 ml of 1.5 mol / L NaOH solution, shake well, and react at room temperature for 10 min. Use the same hydrolyzed 1 M HCl solution without xanthan gum as a control group for simultaneous experiments. Measure the absorbance at 520 nm, and calculate the pyruvate group content from the corresponding standard curve.

[0091] The measurement results are as follows Figure 5 As can be seen, the pyruvyl group content of xanthan gum obtained by the Xcc-ΔGumL strain was significantly lower than that obtained by the control strain, indicating that the pyruvyltransferase gene GumL was successfully knocked out. Furthermore, Fourier transform infrared spectroscopy was used to analyze the pyruvyl group characteristics of xanthan gum in the fermentation products of wild-type Xcc and Xcc-ΔGumL strains, specifically... The chemical structure of xanthan gum samples was analyzed using Fourier transform infrared spectroscopy. Sample pretreatment employed the potassium bromide pelleting method: dried xanthan gum powders of wild-type Xcc and Xcc-ΔGumL were respectively mixed with pre-dried potassium bromide in an agate mortar at appropriate ratios, thoroughly ground and mixed, then transferred to a pelleting mold and pressed into transparent sheets under appropriate pressure.

[0092] The test was conducted using a Spectrum Two Fourier Transform Infrared Spectrometer, in conjunction with IRsolution workstation software, with the scan wavenumber range set to 4000–500 cm⁻¹. -1 The resolution is 0.8 cm. -1The scanning was performed in transmission mode. The prepared sample slices were placed in the sample chamber, and scanning was initiated, with each sample scanned a total of 32 times to improve the signal-to-noise ratio. After acquiring the infrared spectra, baseline correction and spectral normalization were performed using workstation software. The changes in the position and intensity of characteristic absorption peaks were analyzed to resolve the differences in functional groups and chemical bonds among different xanthan gum samples.

[0093] Analysis results as follows Figure 6 As shown. Xanthan gum at 1400–1450 cm⁻¹ -1 The characteristic absorption peak of pyruvyl group appeared in the region. Compared with the original xanthan gum (XG), the characteristic peak of pyruvyl group in the XG-ΔGumL sample completely disappeared in this region, indicating that its pyruvyl group content was significantly reduced or even missing, confirming that the pyruvyl transferase gene GumL was successfully knocked out.

[0094] In summary, this invention successfully constructed a highly efficient, precise, and universal CRISPR-Cas9 dual-plasmid gene editing system in *Xanthomonas campestris*. This system, through the synergistic effect of the SpCas9 protein expression vector and the sgRNA expression vector, combined with the λRed homologous recombination mechanism, achieved highly efficient knockout of the target gene *GumL*, with an editing efficiency exceeding 95%, significantly superior to traditional homologous recombination methods. The *Xcc-ΔGumL* strain obtained using this system showed a significant reduction in pyruvyl content in its fermentation products. Fourier transform infrared spectroscopy analysis confirmed the near disappearance of the pyruvyl characteristic peak, indicating that the pyruvyl modification of the xanthan gum side chain was effectively eliminated.

[0095] This invention not only overcomes the long-standing technical bottleneck of lacking efficient genetic manipulation tools for Xanthomonas brassicae, but also provides a reliable editing platform for the targeted modification of xanthan gum side chains. This strategy allows for precise control of modification levels such as pyruvyl and acetyl groups, thereby obtaining a series of structurally customized modified xanthan gum-producing strains. This invention has broad industrial application prospects in food texture improvement, drug sustained-release carriers, oilfield displacement agents, and personal care products, and also provides a valuable reference example for the development of gene editing systems for other industrial Gram-negative bacteria.

[0096]

Claims

1. A CRISPR Cas9 dual-plasmid gene editing system for Xanthomonas campestris, characterized in that: The CRISPRCas9 dual-plasmid gene editing system includes an SpCas9 protein expression vector and an sgRNA expression vector. The SpCas9 protein expression vector contains an SpCas9 expression cassette and an antibiotic resistance marker, while the sgRNA expression vector consists of a λRed expression cassette, a target gene homologous recombination arm, and an sgRNA expression cassette.

2. The CRISPR Cas9 dual-plasmid gene editing system according to claim 1, characterized in that: The SpCas9 expression cassette is composed of P AB It consists of an inducible promoter, an RBS sequence, and the SpCas9 protein-coding gene, among which P AB The inducible promoter initiates expression during the host's logarithmic growth phase. The amino acid sequence of the SpCas9 protein is shown in SEQ ID NO.

1.

3. The CRISPR-Cas9 dual-plasmid gene editing system according to claim 2, characterized in that: The host is Xanthomonas campestris.

4. The CRISPR-Cas9 dual-plasmid gene editing system according to claim 1, characterized in that: The sgRNA expression vector comprises a λRed expression cassette, a target gene homologous recombination arm, and an sgRNA expression cassette, wherein the λRed expression cassette is composed of P 11 The constitutive promoter, RBS sequence, and λRed combinatorial protein-coding gene constitute the sgRNA expression cassette, which is composed of P Te It consists of a constitutive promoter, crRNA, and tracrRNA.

5. The CRISPR-Cas9 dual-plasmid gene editing system according to claim 4, characterized in that: The homologous recombination arm of the target gene is composed of the following sequence: crRNA - upstream homologous arm of the knockout gene - downstream homologous arm of the knockout gene - crRNA.

6. The CRISPR-Cas9 dual-plasmid gene editing system according to claim 1, characterized in that: The SpCas9 protein expression vector uses the commercially available pBBR1MCS-2 plasmid as its backbone, and the sgRNA expression vector uses the commercially available pKD46 plasmid.

7. An application of the dual plasmid gene editing system according to claim 1, characterized in that: Application of the dual-plasmid gene editing system in genome editing of Xanthomonas brassicae.

8. A recombinant bacterial strain for producing xanthan gum with side-chain pyruvyl modification removed, characterized in that: Recombinant strains were constructed using the dual plasmid gene editing system of claim 1, wherein the target gene in the dual plasmid gene editing system is the pyruvyltransferase encoding gene GumL.

9. The application of the recombinant strain according to claim 1, characterized in that: Fermenting the strain described in claim 8 in NYGB medium yields xanthan gum with deacetylated acyl groups.

Images