Method for quickly creating new lycium barbarum transgenic and gene edited germplasm from root sprouts

Abstract

The application discloses a method for rapidly creating a root-bud of a wolfberry transgenic and gene editing new germplasm, and the method comprises the following steps: (1) constructing a plant expression vector carrying a RUBY marker gene and transferring the plant expression vector into Agrobacterium rhizogenes; (2) selecting a hypocotyl of the wolfberry as an explant and using the Agrobacterium rhizogenes to infect the explant, so as to induce the root to obtain red hairy adventitious roots carrying the RUBY marker gene; (3) inoculating the red hairy adventitious roots into a root-bud induction culture medium, so as to induce the adventitious roots to differentiate red adventitious buds carrying the RUBY marker gene; and (4) cutting the differentiated red adventitious buds and transferring the red adventitious buds into a rooting culture medium, so as to culture the red adventitious buds to obtain wolfberry seedlings carrying the RUBY marker gene. The wolfberry red hairy roots carrying the RUBY marker gene are obtained through the transgenic technology, the hairy roots are directly differentiated into adventitious buds after being cultured, the callus process is omitted, the overall breeding cycle is greatly shortened, and the screening efficiency is improved.

Description

Technical Field

[0001] This invention relates to a method for in vitro culture of wolfberry, and more particularly to a method for rapidly creating transgenic and gene-edited new germplasm of wolfberry through root sprouting. Background Technology

[0002] Goji berries are a distinctive economic crop in Northwest my country that is both a food and a medicine. Using Agrobacterium rhizogenes to induce hairy roots to bind to the RUBY red visual marker is the mainstream method for constructing receptor materials for transgenic and gene-edited goji berries.

[0003] The existing publicly available technology CN120989131A discloses a genetic transformation method for Ningxia wolfberry based on adventitious bud induction. This method also uses Agrobacterium rhizogenes carrying the RUBY gene to infect wolfberry stem segments to obtain red hairy roots, but this method has a fundamental technical defect:

[0004] (1) The regeneration pathway is indirect organogenesis: Red hairy root segments must be inoculated into callus induction medium to induce a large amount of purplish-red callus tissue. Then, the callus can be repeatedly cultured in alternating medium to differentiate into adventitious shoots. The entire regeneration process depends on callus tissue as an intermediate carrier.

[0005] (2) There are multiple drawbacks in the callus induction process: the dedifferentiation of root cells of Lycium barbarum to form callus takes a long time, with a single callus culture cycle of up to 28 days. Multiple subcultures are required, and the overall regeneration cycle is more than 4 months. Browning, vitrification, and somatic chromosome variation are very likely to occur during the callus proliferation process, resulting in a high proportion of chimerism in the regenerated plants. High concentrations of screening antibiotics are required in both the callus induction and callus differentiation culture media, resulting in high material costs and complicated operation steps.

[0006] Meanwhile, other existing wolfberry root transformation systems generally have common problems: hairy roots can only proliferate continuously and cannot directly differentiate into adventitious buds. They must rely on callus tissue for transition. There is no integrated regeneration process that does not require callus and can directly differentiate red adventitious buds from RUBY red hairy roots, which seriously restricts high-throughput gene editing and transgenic breeding experiments of wolfberry. Summary of the Invention

[0007] Purpose of the invention: The purpose of this invention is to provide a method for rapidly creating new transgenic and gene-edited germplasm of wolfberry by directly differentiating red transgenic adventitious buds from the hairy adventitious roots of wolfberry carrying the RUBY visual marker gene without callus induction.

[0008] Technical solution: The method for rapidly creating transgenic and gene-edited new germplasm of wolfberry using root sprouts according to the present invention includes the following steps:

[0009] (1) Construct a plant expression vector carrying the RUBY marker gene and transfer it into Agrobacterium rhizogenes; when creating new transgenic germplasm of Lycium barbarum, the vector is a binary vector; when creating new gene-edited germplasm of Lycium barbarum, the vector is a gene knockout vector;

[0010] (2) The hypocotyl of Lycium barbarum was selected as the explant and infected with Agrobacterium rhizogenes to induce rooting and obtain red hairy adventitious roots carrying the RUBY marker gene;

[0011] (3) Red hairy adventitious roots were inoculated into root shoot induction medium to induce the adventitious roots to differentiate into red adventitious shoots carrying the RUBY marker gene. The root shoot induction medium was MS medium containing 0.3 mg / L 6-BA and 0.05 mg / L NAA to promote the growth of dormant shoots in the roots and promote the differentiation of adventitious shoots.

[0012] (4) Cut off the differentiated red adventitious buds, transfer them to the rooting medium, and culture to obtain wolfberry seedlings carrying the RUBY marker gene.

[0013] In step (1), the Agrobacterium rhizogenes is Ar.1193. After the strain is activated, it is plated and cultured on a culture medium containing antibiotics, the antibiotics being one of kanamycin and streptomycin.

[0014] In step (2), the conditions for inducing root growth are: after co-culturing in the dark for 3 days, transfer to a solid culture medium containing antibacterial antibiotics for 7-14 days. Infection is achieved by cutting off the base of the hypocotyl of a sterile Lycium barbarum tissue culture seedling and then scooping colonies from the culture medium in step (1) onto the wound. After root induction, bright red, hairy adventitious roots grow from the wound, while unconverted negative roots are white. The antibacterial antibiotic is termethin.

[0015] In step (3), the red hairy adventitious roots are red hairy adventitious roots of 2.0-3.0 cm in length with no other colors that are picked out by the naked eye.

[0016] In step (3), the root sprout induction medium contains 30 g / L sucrose and 7 g / L agar, and the pH of the medium is 5.8-6.0.

[0017] In step (3), the conditions for inducing adventitious root differentiation are: culture for 14-21 days at 23-27℃, light intensity of 2000-3000 lx, and light duration of 12-14 h / day. After the induction of adventitious root differentiation is completed, adventitious buds carrying the RUBY red phenotype are directly differentiated from the epidermis of the red root segments.

[0018] In step (4), the differentiated red adventitious buds grow to 2-3 cm and have 2-3 complete true leaves.

[0019] In step (4), the rooting medium includes 1 / 2MS medium, 30 g / L sucrose and 7 g / L agar, and the pH of the medium is 5.8-6.0.

[0020] In step (4), the culture conditions are constant temperature and light culture for 7-14 days, specifically 16 hours of light / 8 hours of darkness, light intensity of 2500 lx, temperature of 25±1℃, and relative humidity of 70% or more.

[0021] The applications described in this invention include large-scale transgenic seedling cultivation of superior wolfberry varieties, creation of wolfberry CRISPR / Cas9 gene-editing materials, and long-term in vitro preservation of rare transgenic wolfberry germplasm resources.

[0022] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) For the first time, the organogenesis pathway of direct bud development from root explants of wolfberry is realized, completely eliminating the two core steps of callus induction and callus alternation in traditional wolfberry in vitro culture, fundamentally avoiding the genomic instability and somatic cell asexual variation caused by callus induction, greatly shortening the regeneration cycle, and significantly inhibiting the occurrence rate of chimeras, ensuring the genetic authenticity and germplasm purity of the regenerated plants; (2) The present invention obtains red hairy roots of wolfberry carrying the RUBY marker gene through transgenic technology. The epidermal cells of the obtained red hairy roots directly differentiate into bud primordia, without going through the stage of dedifferentiation to form a large number of calluses. The genetic background of the regenerated plants is stable, and there is no need for multiple PCR screenings of chimeras. The direct organogenesis pathway is adopted, completely avoiding the somatic cell variation, browning, and vitrification problems caused by callus tissue; (3) The present invention shows a stable red color from root development, direct differentiation of adventitious buds to complete regenerated seedlings. The seedlings can show a bright purple-red, ruby ​​red or deep wine red phenotype in the seedling stage, forming a strong color difference with the control green seedlings. Breeders do not need to perform any molecular detection such as DNA extraction, PCR, electrophoresis or sequencing. They can select the target single plant in seconds without damage and with precision by naked eye observation, completely eliminating the tedious laboratory identification steps; (4) All red hairy roots obtained by infection can be used directly for sprouting, without material loss caused by callus induction failure; The whole set of culture parameters is stable and reproducible, without complicated operation, and is suitable for small-scale gene editing in the laboratory and large-scale transgenic seedling production in factories; The synergy between direct root sprouting and visual screening in the seedling stage greatly advances the identification window of positive edited plants to the seedling stage, greatly simplifies the germplasm screening and identification link, and significantly reduces detection costs and labor input; (5) The culture medium formula of the present invention is simplified, no herbicide is added, only a small amount of antibacterial antibiotics are used in the early sterilization stage, the amount of reagents and consumables is reduced, and the risk of experimental pollution and detection costs are reduced. Attached Figure Description

[0023] Figure 1This is a complete process flow diagram of the direct sprouting process of wolfberry RUBY red roots in Embodiment 1 of the present invention;

[0024] Figure 2 This is a morphological diagram of the hairy adventitious roots of RUBY red wolfberry obtained by Agrobacterium rhizogenes infection and induction in Example 1 of the present invention;

[0025] Figure 3 This is a diagram showing the growth status of RUBY red adventitious buds generated from the differentiation of red adventitious roots in Example 1 of the present invention.

[0026] Figure 4 This is a transgenic, sterile wolfberry seedling that is entirely red during the rooting stage of the positive seedlings in Example 1 of this invention;

[0027] Figure 5 This is the sequencing result after gene editing in Example 2 of the present invention. Detailed Implementation

[0028] The technical solution of the present invention will be further described below with reference to the embodiments and comparative examples. Unless otherwise stated, all reagents used are commercially available and are used directly without purification.

[0029] Example 1: Obtaining complete positive seedlings from wolfberry plants transfected with the RUBY reporter gene.

[0030] 1. Preparation of engineered bacteria: The binary vector pIB2-RUBY-Cas9 carrying the RUBY gene (purchased from Chongqing Baoguang Biotechnology Co., Ltd.) was transformed into Agrobacterium rhizogenes Ar.1193 (purchased from Weidi Biotechnology Co., Ltd.), and the bacteria were cultured in TY liquid medium until OD was reached. 600 After reaching a concentration of 0.6, the solution was spread onto TY solid medium; the transformation procedure was as follows:

[0031] (1) Transformation of Agrobacterium competent cells by freeze-thaw method: Ar.1193 Agrobacterium rhizogenes competent cells stored at -80℃ were placed at room temperature or in the palm of the hand for a moment until they partially thawed and were in an ice-water mixture state, and then inserted into ice;

[0032] (2) Add 0.01-1 μg of plasmid DNA (purchased from Chongqing Baoguang Biotechnology Co., Ltd.) to each 100 μl competent cells, mix quickly and vigorously by hand or by pipetting, and place in ice for 5 minutes, liquid nitrogen for 5 minutes, water bath at 37℃ for 5 minutes, and ice bath for 5 minutes.

[0033] (3) Remove from the ice bath and bring to room temperature. Add 700 μl of antibiotic-free TY liquid culture medium and incubate at 28°C with shaking for 2 hours.

[0034] (4) Centrifuge at 6000 rpm for one minute to collect the bacteria, take about 100 μl of supernatant and gently blow it to resuspend the bacterial block and spread it on a TY plate containing kanamycin or streptomycin. Invert the plate and incubate it in a 28℃ incubator for 2-3 days.

[0035] (5) Randomly select single colonies for colony PCR identification, and verify the amplification products by sequencing; save positive strains for later use, and activate them by plating and culturing for 2 days before infection.

[0036] 2. Induction of Red Roots: Hypocotyls of sterile wolfberry seedlings (from the Academician Workstation of Yancheng Forestry Farm, Yancheng City, Jiangsu Province) were selected. After dipping the seedlings in a medium containing Ar.1193 colonies, they were inserted into MS solid medium (30 g / L sucrose + 7.0 g / L agar) and cultured in the dark for 3 days. Then, they were transferred to a medium containing termethin for 7 days of culture. Bright red hairy roots grew from the wounds. White, negative-negative roots were manually removed, and 2.0-3.0 cm intact red root segments were cut. Figure 2 As shown.

[0037] 3. Adventitious bud induction culture: Red root segments were directly inoculated into root shoot induction medium. The root shoot medium formula was MS + 0.3 mg / L 6-BA + 0.05 mg / L NAA + 30 g / L sucrose + 7.0 g / L agar, pH 5.8; the culture temperature was 25 ℃, the light intensity was 2500 lx, the light intensity was 13 h / day, and the culture was continued for 14 days to obtain red adventitious buds, such as... Figure 3 As shown.

[0038] 4. Rooting culture of positive seedlings: Cut 2-3 cm red adventitious buds onto 1 / 2 MS medium + 30 g / L sucrose + 7.0 g / L agar and culture for 14 days (16 h light / 8 h dark, light intensity 2500 lx, temperature 25 ± 1℃, relative humidity above 70%) to obtain robust red sterile seedlings. Figure 4 As shown.

[0039] The experimental results show that, in the adventitious bud induction culture stage of wolfberry, this application directly achieves the organogenesis pathway of root explants developing directly into buds through a specially formulated culture medium, completely eliminating the callus induction stage that is necessary in traditional wolfberry in vitro culture. Positive seedlings obtained from direct root regeneration, due to successful integration of the RUBY reporter gene, exhibit a typical and striking anthocyanin / betalain deposition phenotype throughout the seedling stage—displaying a bright purplish-red, ruby ​​red, or deep wine red (i.e., the RUBY phenotype), forming an extremely strong color contrast with the conventional green seedlings of the untransformed control and non-edited plants.

[0040] Example 2: Obtaining complete positive seedlings of wolfberry by transfecting it with CDPK gene-editing vector

[0041] The target editing gene CDPK27 for wolfberry was obtained by homology comparison with the tomato sugar brake gene CDPK27 (calcium-dependent protein kinase). A gene knockout vector pIB2-RUBY-LcCDPK27-Cas9 was constructed based on the wolfberry CDPK27 gene sequence. Specifically, using the tomato CDPK27 amino acid sequence as a reference, homology comparison was performed in the wolfberry genome database to screen for the homologous gene LcCDPK27 (SEQ ID NO: 1). Total RNA was extracted from the roots of one-year-old seedlings using an RNA kit, and cDNA was synthesized by reverse transcription. The complete LcCDPK27 coding sequence was amplified using gene cloning, and the amplification product was detected by 1% agarose gel electrophoresis. CRISPR / Cas9 gene editing targets were designed using the online tool Chopchop: sgRNA1: ACAGGGCATAATATTCAAGA (SEQ ID NO: 2); sgRNA2: CTTGGTCGAGAACTCGGTAG (SEQ ID NO: 3). The sgRNA expression cassette was inserted into the CRISPR backbone containing the RUBY reporter gene via homologous recombination to construct the recombinant vector pIB2-RUBY-LcCDPK27-Cas9. After verification by sequencing, the recombinant plasmid was transformed into *Agrobacterium rhizogenes* Ar.1193. All RNA kits, reverse transcription kits, and homologous recombinases used were purchased from Nanjing Novizan Biotechnology Co., Ltd. The remaining procedures and culture medium formulations were identical to those in Example 1.

[0042] The experimental results showed that positive seedlings with the RUBY phenotype were obtained through the above method. Furthermore, by identifying the gene editing site, mutants of the CDPK gene in wolfberry were obtained, verifying the application of this invention in gene editing of wolfberry. By introducing the RUBY reporter gene, naked-eye visual screening of positively edited plants was achieved. This feature enables non-destructive, immediate, and large-scale visual screening of gene-edited positive wolfberry seedlings using the naked eye: breeders and germplasm creators do not need to perform any molecular testing; they can accurately identify and directly select target plants carrying the target mutation within seconds simply by directly observing the seedling color in a greenhouse or tissue culture room. This completely bypasses the complex and time-consuming laboratory procedures in traditional genotyping, such as DNA extraction, PCR amplification, product electrophoresis, enzyme digestion, or sequencing.

[0043] Based on this, target site sequencing analysis was performed on the selected RUBY phenotype-positive seedlings, confirming that all of them produced the expected gene-editing mutations, and stable genetic mutant materials were obtained. Furthermore, in this application, the non-callus regeneration method of direct root sprouting in wolfberry fundamentally avoids the genomic instability and somatic cell variation risks caused by callus induction, significantly shortens the regeneration cycle, and significantly reduces the incidence of chimerism. Coupled with a direct observation and selection strategy based on the naked-eye visual phenotype of seedlings, the identification window for positive edited plants is significantly advanced to the seedling stage, greatly simplifying the germplasm screening and identification workflow and significantly reducing detection costs and labor input. This breakthrough opens a fast track for the efficient and high-throughput creation of new gene-edited germplasm, powerfully promoting the transformation from laboratory gene-editing events to practically usable breeding materials, providing abundant germplasm reserves and technical support for precise genetic improvement of crops and new variety breeding, and truly realizing a new germplasm creation model of "direct root sprouting, selection upon seedling appearance, and immediate results upon selection."

Claims

1. A method for rapid creation of Lycium barbarum transgenic and gene edited new germplasm of root sprouts, characterized in that, Includes the following steps: (1) Construct a plant expression vector carrying the RUBY marker gene and transfer it into Agrobacterium rhizogenes; when creating new transgenic germplasm of Lycium barbarum, the vector is a binary vector; when creating new gene-edited germplasm of Lycium barbarum, the vector is a gene knockout vector; (2) The hypocotyl of Lycium barbarum was selected as the explant and infected with Agrobacterium rhizogenes to induce rooting and obtain red hairy adventitious roots carrying the RUBY marker gene; (3) Red hairy adventitious roots were inoculated into root shoot induction medium to induce the adventitious roots to differentiate into red adventitious shoots carrying the RUBY marker gene. The root shoot induction medium was MS medium containing 0.3 mg / L 6-BA and 0.05 mg / L NAA. (4) Cut off the differentiated red adventitious buds, transfer them to the rooting medium, and culture to obtain wolfberry seedlings carrying the RUBY marker gene.

2. The method of claim 1, wherein, In step (1), the Agrobacterium rhizogenes is Ar.1193.

3. The method of claim 1, wherein, In step (2), the conditions for inducing root growth are: after co-culturing in the dark for 3 days, the culture is transferred to a solid culture medium containing antibacterial antibiotics for 7-14 days.

4. The method of claim 1, wherein, In step (3), the red hairy adventitious roots are red hairy adventitious roots of 2.0-3.0 cm in length with no other colors that are picked out by the naked eye.

5. The method of claim 1, wherein, In step (3), the root sprout induction medium contains 30 g / L sucrose and 7 g / L agar, and the pH of the medium is 5.8-6.

0.

6. The method of claim 1, wherein, In step (3), the conditions for inducing adventitious root differentiation are to culture for 14-21 days at 23-27℃, light intensity of 2000-3000lx, and light duration of 12-14 h / day.

7. The method of claim 1, wherein, In step (4), the differentiated red adventitious buds grow to 2-3 cm and have 2-3 complete true leaves.

8. The method of claim 1, wherein, In step (4), the rooting medium includes 1 / 2MS medium, 30 g / L sucrose and 7 g / L agar, and the pH of the medium is 5.8-6.

0.

9. The method of claim 1, wherein, In step (4), the culture conditions are constant temperature and light culture for 7-14 days.

10. The application of the method as described in any one of claims 1-9 in the large-scale transgenic seedling production of superior wolfberry varieties, the creation of wolfberry CRISPR / Cas9 gene-editing materials, and the long-term in vitro preservation of rare transgenic germplasm resources of wolfberry.

Images