A genetic transformation method for areca nut callus mediated by Fe3O4@PEI magnetic nanocarriers

Abstract

The application discloses a Fe3O4@PEI magnetic nano-carrier mediated genetic transformation method of Areca catechu L. callus and belongs to the field of genetic transformation of palm family plants. The Fe3O4@PEI magnetic nano-carrier with nano-enzyme activity is applied to the genetic transformation of the Areca catechu L. callus for the first time, so that tissue damage caused by excessive proliferation of Agrobacterium tumefaciens can be avoided, browning and cell death in the transformation process can be reduced, and the positive callus acquisition rate is improved, thereby providing a low-damage and high-applicability genetic transformation technical system for Areca catechu L. functional gene research and genetic improvement.

Description

Technical Field

[0001] This invention belongs to the field of genetic transformation of palm plants, and in particular relates to a method for genetic transformation of areca nut callus mediated by Fe3O4@PEI (polyethyleneimine-modified iron tetroxide) magnetic nanocarrier. Background Technology

[0002] Areca nut (scientific name: Areca catechu L. Areca palm (Areca catechu) is an evergreen tree belonging to the genus Areca in the family Arecaceae, and is a widely cultivated tropical crop in tropical and subtropical regions. Plant genetic transformation technology is a key tool in modern crop breeding and gene function research. However, traditional genetic transformation methods (such as Agrobacterium-mediated transformation and gene gun methods) generally suffer from problems such as species dependence, low transformation efficiency, long operation cycles, and easy induction of tissue browning or tissue damage. Especially for perennial woody palms like Areca catechu, which have long breeding cycles and are difficult to genetically transform, there is still a lack of efficient, stable, and low-damage callus genetic transformation techniques.

[0003] Gene delivery technology based on magnetic nanocarriers has made progress in animals, protoplasts without cell walls, and pollen cells with germination pores, such as obtaining transgenic mice and transgenic cotton seeds. However, for palm trees, their callus cells have intact cell walls, a dense structure, and low porosity. This dense cell wall constitutes a physical barrier that nanoparticles cannot overcome. Currently, there is no technology to apply magnetic nanotechnology to callus tissue of woody monocotyledonous plants with intact cell walls. In addition, areca nut callus tissue is prone to oxidative stress and tissue browning during genetic transformation, screening, and long-term culture, which seriously affects the acquisition of positive materials.

[0004] Therefore, developing a genetic transformation method that can efficiently deliver exogenous genes and mitigate oxidative damage and browning during the transformation process is of great significance for the study of functional genes and genetic improvement of areca nut. Summary of the Invention

[0005] The inventors discovered that areca nut callus tissue possesses a loose cell cluster structure and local intercellular spaces. The Fe3O4@PEI-DNA complex can efficiently accumulate on the callus surface under an applied magnetic field, promoting the delivery of exogenous genes to callus cells. Furthermore, the inventors found that the Fe3O4@PEI magnetic nanocarrier not only possesses excellent DNA loading capacity and magnetic field response performance, but also exhibits peroxidase-like nanozyme activity, capable of scavenging reactive oxygen species (ROS) within cells and alleviating oxidative stress damage. Utilizing this property, the material can significantly reduce the browning rate of callus tissue during transformation and decrease ROS (reactive oxygen species, mainly including superoxide anion radicals (•O2)). -), hydroxyl radical (•OH), singlet oxygen ( 1 Accumulation of substances such as oxygen (O2) and hydrogen peroxide (H2O2) effectively increases the yield of positive callus. Based on the above findings, this invention provides a Fe3O4@PEI magnetic nanocarrier-mediated genetic transformation method for areca nut callus. This method uses areca nut callus as the recipient and Fe3O4@PEI magnetic nanocarrier as the exogenous gene delivery carrier. By optimizing the nanoparticle size, surface charge, and magnetic field parameters, and combining pretreatment methods such as acupuncture, a low-browning, low-oxidative-stress, highly efficient, and stable magnetic nano-mediated genetic transformation system suitable for areca nut callus is established.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A method for genetic transformation of areca nut callus mediated by Fe3O4@PEI magnetic nanocarriers includes:

[0008] (1) Fe3O4@PEI magnetic nanoparticles and the target gene expression vector were mixed and incubated at room temperature for 10-30 min to prepare Fe3O4@PEI-DNA complex;

[0009] (2) The areca nut callus that has been pretreated by acupuncture and the Fe3O4@PEI-DNA complex obtained in step (1) are co-cultured in liquid culture medium and placed in a magnetic field of 10000~12000 Gs (Gauss) for magnetic transfection. After transfection, the areca nut callus is taken out and dried under sterile conditions to remove excess water.

[0010] (3) The dried areca nut callus from step (2) is transferred to a screening medium for culture to obtain positive regenerated callus.

[0011] Preferably, in step (1), the mass ratio of the Fe3O4@PEI magnetic nanoparticles to the target gene expression vector is 25~40:1.

[0012] Preferably, in step (2), the liquid culture medium is formulated as follows: sodium dihydrogen phosphate 3 g / L; calcium chloride 2.9 g / L; magnesium sulfate heptahydrate 2.47 g / L; ferrous sulfate heptahydrate 1.39 g / L; inositol 0.1 g / L; activated carbon 1 g / L; sucrose 40 g / L.

[0013] Preferably, in step (2), the acupuncture pretreatment includes using a sterile needle with a 1 mL syringe to puncture the areca nut callus tissue to form a mechanical wound.

[0014] More preferably, the sterile needle has a specification of 0.45 mm × 15 mm (nominal outer diameter × needle length).

[0015] Preferably, in step (2), co-culture is carried out in a petri dish, and the petri dish is placed on a 10000~12000 Gs magnetic plate for magnetic transfection for 2 h.

[0016] More preferably, during magnetic transfection, the culture dish is picked up and gently shaken every 30 minutes, and then placed back on the magnetic plate; after transfection, the extracted areca nut callus tissue is dried on sterile filter paper for 20-30 minutes to remove excess moisture.

[0017] Preferably, in step (3), the formulation of the screening culture medium is as follows: sodium dihydrogen phosphate 3 g / L; calcium chloride 2.9 g / L; magnesium sulfate heptahydrate 2.47 g / L; ferrous sulfate heptahydrate 1.39 g / L; inositol 0.1 g / L; activated carbon 1 g / L; sucrose 40 g / L; cysteine ​​100 mg / L; agar 5 g / L; glufosinate 2.5 mg / L.

[0018] Preferably, in step (3), the tissue is cultured in the dark at 28°C for 3-4 months in the screening medium, and positive regenerated callus tissue is obtained after 3-4 rounds of resistance screening.

[0019] Preferably, the above method further includes: selecting areca nut positive regenerated callus tissue, extracting genomic DNA using a plant genome extraction kit, and performing PCR detection on the glufosinate resistance marker gene bar in the areca nut positive regenerated callus tissue to obtain transgenic areca nut resistant callus tissue.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] In Agrobacterium-mediated transformation, Agrobacterium easily proliferates on the surface of callus tissue, inhibiting its normal regeneration and making it impossible to obtain positive regenerated callus tissue from Areca catechu. However, this invention uses Areca catechu callus tissue as the transformation recipient and Fe3O4@PEI magnetic nanoparticles as the gene delivery tool, combined with acupuncture pretreatment, to directly deliver genes into callus tissue cells under the action of a magnetic field. This eliminates the problem of bacterial growth, not only bypassing the specific requirements of Agrobacterium for host recognition but also avoiding the obstacle of plant defense response triggered by it. In particular, the Fe3O4@PEI magnetic nanocarrier can significantly reduce the browning rate of callus tissue during transformation and reduce ROS accumulation, thereby effectively improving the yield of positive callus tissue.

[0022] This invention is the first to apply Fe3O4@PEI magnetic nanocarriers with nanozyme activity to callus tissue of woody monocotyledonous plants with intact cell walls, establishing a genetic transformation system suitable for areca nut callus tissue. This system successfully overcomes the dual technical obstacles of difficult cell wall penetration and severe tissue browning in existing technologies, providing an efficient technical platform for gene function research and genetic improvement of areca nut. Attached Figure Description

[0023] Figure 1 SEM analysis of the surface pores of areca nut callus cells in Example 1: (a) Field of view at a scale of 10µm, (b) Field of view at a scale of 2µm.

[0024] Figure 2 For the characterization analysis of the magnetic nanocarrier in Example 2, (a) FT-IR Fourier transform infrared spectrum; (b) X-ray powder diffraction (XRD) pattern; (c) Zeta potential histogram; (d) DLS dynamic light scattering particle size of Fe3O4; (e) DLS dynamic light scattering particle size of Fe3O4@PEI; (f) hysteresis loop (VSM) plot.

[0025] Figure 3 The electrophoretic analysis of the Fe3O4@PEI-DNA complex in Example 3 is shown. M is GL DNA Marker 15000 (catalog number: AG11908, Aikerui Biotechnology), DNA is pNC-Cam3304-ANRSV-CP-RNAi, and the remaining lanes are Fe3O4@PEI:DNA samples obtained by mixing Fe3O4@PEI and DNA at mass ratios of 0.06:1, 1:1, 5:1, 15:1, 20:1, 25:1, 30:1, 35:1, and 40:1.

[0026] Figure 4 For the electrophoretic analysis of the Fe3O4@PEI-DNA complex double-digested in Example 3, M is GL DNAMarker 15000 (catalog number: AG11908, Aikerui Biotechnology), DNA is pNC-Cam3304-ANRSV-CP-RNAi, the digested DNA is the double-digested pNC-Cam3304-ANRSV-CP-RNAi, and the remaining lanes are the double-digested Fe3O4@PEI-DNA complex samples.

[0027] Figure 5 The particle size distribution and zeta potential of Fe3O4@PEI and Fe3O4@PEI-DNA complex in Example 3 were analyzed.

[0028] Figure 6The images show TEM images of the Fe3O4@PEI and Fe3O4@PEI-DNA complexes in Example 3: (a) Fe3O4@PEI, field of view at a scale of 10 nm; (b) Fe3O4@PEI-DNA, field of view at a scale of 10 nm; and (c) Fe3O4@PEI-DNA, field of view at a scale of 5 nm.

[0029] Figure 7 This is a diagram of the positive regenerated callus tissue from Areca catechu in Example 4.

[0030] Figure 8 This is a PCR electrophoresis image of the glufosinate resistance gene in transgenic areca callus from Example 4. M is GL DNAMarker 2000 (catalog number: AG11904, Aikerui Biotechnology), WT is untransfected areca callus, and the DNA is pure pNC-Cam3304-ANRSV-CP-RNAi plasmid. Lanes 1, 2, and 3 are DNA samples from three areca positive regenerated callus tissues.

[0031] Figure 9 This refers to the peroxidase-like activity of Fe3O4@PEI in Example 5.

[0032] Figure 10 The browning of areca nut callus tissue after transformation in the wild-type group, Fe3O4@PEI group, and Agrobacterium group in Example 5 is shown.

[0033] Figure 11 This is a line graph showing the hydrogen peroxide (H2O2) content in Example 5.

[0034] Figure 12 This is a diagram of areca nut callus transformed by Agrobacterium-mediated transformation in Example 5. Detailed Implementation

[0035] The present invention will now be described in detail with reference to specific embodiments. The following specific embodiments and accompanying drawings will help those skilled in the art to further understand the present invention, but do not limit the present invention in any way.

[0036] The culture medium formula used in the areca nut callus culture of this application is as follows: per 1L of liquid culture medium formula: 3 g sodium dihydrogen phosphate; 2.9 g calcium chloride; 2.47 g magnesium sulfate heptahydrate; 1.39 g ferrous sulfate heptahydrate; 0.1 g inositol; 1 g activated carbon; 40 g sucrose.

[0037] The formula for each 1L of screening medium is as follows: 100 mg of cysteine, 5 g of agar, and 2.5 mg of glufosinate are added to 1L of liquid medium.

[0038] In the following examples, the “DNA” corresponding to “Fe3O4@PEI-DNA complex” refers to the target gene expression vector. For example, the DNA in Examples 3 and 4 refers to pNC-Cam3304-ANRSV-CP-RNAi.

[0039] Example 1: SEM analysis of areca nut callus cells

[0040] Fresh areca nut callus tissue, 2–3 mm thick and 5–6 mm in length and width, was collected. After rinsing with PBS to remove residual culture medium, the tissue was fixed in 2.5% glutaraldehyde fixative at 4°C for 12 h. The tissue was then thoroughly dehydrated using a gradient of ethanol solutions (30%, 50%, 70%, 80%, 90%, 95%, 100%), followed by critical point drying. Finally, the dried sample was mounted on a stage and sputtered with a 3–10 nm metal film (e.g., gold / platinum) for scanning electron microscopy (SEM) observation. Results are as follows: Figure 1 As shown, micron-sized pores of about 4 μm are visible on the surface of areca nut callus cells, which provide a structural basis for the enrichment and further delivery of exogenous genes on the callus surface by the Fe3O4@PEI-DNA complex under the action of an external magnetic field.

[0041] Example 2: Modification and Characterization of Magnetic Nanoparticles

[0042] Weigh 100 mg of Fe3O4 nanoparticles (catalog number: I992751, Macklin) and place them in an Erlenmeyer flask. Add 40 mL of deionized water to disperse them, and then add 300 mg of trisodium citrate (catalog number: 10019418, Sinopharm Group). Place the Erlenmeyer flask in a 70°C heated stirrer and stir at 300-400 rpm for 3 hours (under nitrogen atmosphere). Cool to room temperature, magnetically separate and discard the supernatant, and add 40 mL of deionized water to prepare a resuspension with a concentration of 2.5 mg / mL. Take 10 mL of the resuspended solution and add 75 mg EDC·HCl (1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride, catalog number: E106172, Aladdin) and 50 mg Sulfo-NHS (N-hydroxysulfosuccinimide, catalog number: H109337, Aladdin). Add 1 mL of PEI (polyethyleneimine, catalog number: E107078, Aladdin) at a concentration of 20 mg / mL dropwise. Stir magnetically at room temperature for 4 hours. After the reaction is complete, magnetically separate and discard the supernatant. Add 10 mL of 0.1 M glycine solution (pH 8.0, catalog number: G8200, Solarbio) to terminate the reaction. Stir at room temperature for 15 min, magnetically separate and discard the supernatant. Wash three times with deionized water to obtain Fe3O4@PEI. The particles were characterized using Fourier transform infrared spectroscopy (FTIR), X-ray diffraction (XRD), nanoparticle size analysis, and a Zetasizer Nano ZSE.

[0043] Characterization data: In FTIR, both Fe3O4 and Fe3O4@PEI are in the low wavenumber region (< 1000 cm⁻¹). -1 Both exhibited strong absorption and a significant decrease in transmittance, characteristic of ferrite frameworks. Fe3O4@PEI showed a peak at 2929.34 cm⁻¹. -1 (CH stretching vibration) New absorption peaks appear, such as Figure 2 As shown in Figure (a), the PEI modification was successful; XRD analysis revealed that the six significant diffraction peaks of Fe3O4@PEI were consistent with the standard spectrum of Fe3O4 (#19-0629), as shown in Figure (a). Figure 2 As shown in Figure (b); Dynamic Light Scattering (DLS) display, and Figure 2 Compared to the particle size distribution of Fe3O4 shown in Figure (d), the particle size distribution range of Fe3O4@PEI changes from 106~342 nm to 142~342 nm, and the main peak position shifts to the right from 146 nm to around 220 nm. Figure 2 As shown in Figure (e), the hydrodynamic diameter of the particles was physically increased; the Zeta potential increased from -22 mV for Fe3O4 to +27.5 mV, as... Figure 2As shown in Figure (c). The above results demonstrate that PEI successfully modified Fe3O4. This Fe3O4@PEI complex retains the crystal structure of the Fe3O4 core, with increased positive charge, which is beneficial for DNA electrostatic adsorption. The hysteresis loop shows that the Fe3O4@PEI curve exhibits a single S-shape with no obvious hysteresis, remanence Mr≈0, and coercivity Hc≈0, as shown in Figure (c). Figure 2 As shown in Figure (f), Fe3O4@PEI exhibits superparamagnetism.

[0044] Example 3: Analysis of the loading speciation and protective ability of the Fe3O4@PEI-DNA complex

[0045] 1. The vector pNC-Cam3304-ANRSV-CP-RNAi was constructed using the NC cloning system. The conserved CP fragment of ANRSV (836 bp, as shown in SEQ ID NO.3) was amplified, and NC cloning adapters were added to both ends of the primers. The vector was cloned into the empty pNC-Cam3304-RNAi vector (Addgene #193401) in one step to construct an hpRNA hairpin RNAi vector driven by CaMV 35S and separated by PDK introns. This vector carries the bar gene and is used for glufosinate screening after plant transformation. For the specific steps of vector construction, please refer to the following: Yan P, et al. A Nimble Cloning-compatible vector system for high-throughput gene functional analysis in plants[J]. Plant Communications, 2023, 4(2): 100471. DOI: 10.1016 / j.xplc.2022.100471.

[0046] The primer sequences used are:

[0047] AVRNI-F:

[0048] 5′-AGTGGTCTCTGTCCAGTCCTATATTGGGGAAGAGAGGC-3′ (SEQ ID NO. 1),

[0049] AVRNI-R:

[0050] 5′-GGTCTCAGCAGTACCACAAGTCATGATCATAGCATGGCCAGT-3′ (SEQ ID NO. 2),

[0051] The gene sequence of the ANRSV CP target fragment is as follows:

[0052] atattggggaagagaggcgtttgcaatcaagtgaggaaatgggtgcaatagcagacccaccaacagggccagtttcaaggacaccaccaggttcaaacattataggaccaactgcagcaggcgaagctaccacatggaacctgggtactttgagcacagaacagatagaattggcaatgataccaagtttatctggaacgcctgttattgatgaatcaacactaaaatcaataccctatcaccagatgcattttgataacacaacagcaacagaggatcaagtgaaagcctgggaaactttttgcaaacagaaatatggaggcaccgggcaagcactttctgacagtcacttcaataaattaaaagttgcttttatttactggtgtgcagacaatggaacaagtgaaaaccatgatttcgatgcaaaaacaaagattccaacagggccaaatacaagtatggaactgccattgaggccatttctagaaggatctaagtcggttggattgaggaagattatgcgattttactcagacctgactgtcttactattgaaaaagagaggaacactcacgaggtgggcaattaaaaggggtattcgtcagaaagagatgataccatttgcctttgattttctcaaatttgaccacaaagttactgcagttgtaagagagatcctaactcaagcaaaagcaggggcgcttggttcaggaacgaaaagagcaatgcttacggatggcaatgtatcacagggaacaagttatgagagacataccacaagagatgttagtgagtatgaacatggtcctagtggcactggccatgctatgatcatg(SEQ ID NO.3)。

[0053] 2. Fe3O4@PEI: DNA (i.e., pNC-Cam3304-ANRSV-CP-RNAi prepared in step 1) was mixed at mass ratios of 0.06:1, 1:1, 5:1, 15:1, 20:1, 25:1, 30:1, 35:1, and 40:1, with the DNA amount fixed at 4 μg. The mixture was incubated at room temperature for 30 min, and then ligated to prepare the Fe3O4@PEI-DNA complex.

[0054] 3. Add 1 μL of 6× DNA loading buffer (catalog number: BL532A, Lanjieke) to the Fe3O4@PEI-DNA complex sample prepared in step 2, mix well, and then spot the sample onto a 1.2% agarose gel. Electrophoresis is performed in TAE buffer at 120V for 25 min. After electrophoresis, the DNA loading capacity of Fe3O4@PEI is analyzed using a blue light gel cutter (BL-15). The results are as follows: Figure 3 As shown in the figure, when the Fe3O4@PEI:DNA mass ratio is 25:1, 30:1, 35:1, and 40:1, there is basically no free DNA in the lane, indicating that the plasmid is fully loaded.

[0055] 4. Take 2 μL each of the pNC-Cam3304-ANRSV-CP-RNAi prepared in step 1 and the Fe3O4@PEI-DNA complex samples prepared in step 2 (Fe3O4@PEI:DNA mass ratios of 5:1, 15:1, 20:1, 25:1, 30:1, 35:1, and 40:1), and digest them with BamHI and SacI double enzyme digestion systems (see Table 1) at 37 ℃ for 30 min, followed by inactivation at 80 ℃ for 5 min. Analyze the DNA protection ability of Fe3O4@PEI by agarose gel electrophoresis of the digestion products. The results are as follows: Figure 4 As shown in the figure, after double enzyme digestion, the excess DNA is digested, while the fully bound Fe3O4@PEI-DNA complex remains in the sample well. Fe3O4@PEI has a certain spatial protection effect on DNA.

[0056] Table 1. Double enzyme digestion system

[0057]

[0058] Note: 10×FastDigest green buffer solution is included with BamHI and SacI products.

[0059] The above results indicate that, with a complex ratio of 25:1 or higher, Fe3O4@PEI can fully load DNA and effectively resist restriction endonuclease degradation.

[0060] 5. Fe3O4@PEI-DNA complexes prepared at Fe3O4@PEI:DNA mass ratios of 20:1, 25:1, 30:1, 35:1, and 40:1 were diluted with ultrapure water to 100 μg / mL. Particle size distribution and zeta potential were analyzed using a nanoparticle size and zeta potential analyzer (Zetasizer NanoZSE). The results are as follows: Figure 5 As shown, Fe3O4@PEI binds to DNA, resulting in an increase in particle size and a decrease in zeta potential.

[0061] 6. Take magnetic nanoparticles Fe3O4@PEI and Fe3O4@PEI-DNA complex (mass ratio 25:1), and dilute with ultrapure water to a concentration of 10 μg / mL. Centrifuge the Fe3O4@PEI-DNA complex at 5000 rpm for 10 min to remove unbound DNA. Take 10 μL of each sample and evenly add it to a clean copper grid covered with a carbon film. Blot off excess liquid with filter paper, allow to air dry for 30 min, negatively stain with 2% (m / v) phosphotungstic acid (2 g phosphotungstic acid dissolved in 100 mL deionized water) for 1 min, place in a clean petri dish to air dry, and then observe and image the morphology under a transmission electron microscope (TEM). The results are as follows: Figure 6 As shown, the TEM image reveals that the plasmid is adsorbed and coated on the surface of the nanoparticles.

[0062] Depend on Figure 5 and Figure 6 It can be seen that Fe3O4@PEI has tightly bound DNA. As the amount of bound DNA increases, the particle size of the Fe3O4@PEI-DNA complex increases and the Zeta potential decreases.

[0063] Example 4: Magnetic transfection of areca nut callus tissue

[0064] The DNA in the Fe3O4@PEI-DNA complex was prepared using the recombinant plasmid pNC-Cam3304-ANRSV-CP-RNAi prepared in Example 3.

[0065] Take healthy areca nut callus tissue and use a 0.45mm×15mm sterile needle (item number: KC15002014, Wuhan Wangguan Medical Instruments) to prick each callus tissue 3-4 times to create mechanical trauma. Then, add 30mL of liquid culture medium containing Fe3O4@PEI-DNA complex (Fe3O4@PEI:DNA mass ratio of 25:1, total DNA amount of 100 μg) to a culture dish and co-culture with the areca nut callus tissue. Place the culture dish on a 10000 Gs magnetic plate (10000~12000 Gs is acceptable) for magnetic transfection for 2 h. During transfection, pick up the culture dish and shake it slightly every 30 min, and then put it back on the magnetic plate.

[0066] After magnetic transfection, the areca nut callus tissue was removed and placed on sterile filter paper to dry for 20-30 minutes.

[0067] Magnetically transfected areca nut callus was inoculated into selection medium containing 2.5 mg / L glufosinate and cultured in the dark at 28°C for approximately 3 months. Areca nut-positive regenerated callus was observed as follows: Figure 7 As indicated by the arrows, three pieces of areca nut-positive regenerated callus were selected. Genomic DNA was extracted using the Novizan Plant DNA Extraction Kit (FastPure® Plant DNA Isolation Mini Kit, catalog number: DC104-01). Primers Bar-F and Bar-R were designed to detect the glufosinate resistance marker gene 'bar' in areca nut-positive regenerated callus by PCR. The primer sequences are as follows:

[0068] Bar-F: 5′-ATCTCGGTGACGGGCAGGAC-3′ (SEQ ID NO.4),

[0069] Bar-R: 5′-TGCACCATCGTCAACCACTACA-3′ (SEQ ID NO. 5).

[0070] The PCR reaction system is shown in Table 2, and the PCR reaction procedure is shown in Table 3.

[0071] Table 2. PCR reaction system

[0072]

[0073] Table 3. PCR reaction procedure

[0074]

[0075] The results are as follows Figure 8As shown, all three areca nut positive regenerated callus samples obtained through resistance screening showed a specific band of the bar resistance marker gene. These results indicate that this method can introduce exogenous expression vectors containing the target fragment into areca nut callus tissue, obtaining transgenic areca nut resistant callus tissue, thus achieving genetic transformation of areca nut callus tissue.

[0076] Example 5: Fe3O4@PEI-like peroxidase (POD-like) scavenging ROS in areca nut callus tissue

[0077] 1. The reagents used in the kinetic analysis of the peroxidase-like activity of Fe3O4@PEI were as follows: 3,3',5,5'-tetramethylbenzidine (TMB), 30% H2O2, and sodium acetate buffer were all purchased from Aladdin. Fe3O4@PEI was added to a final concentration of 20 μg / mL with 100 mM 30% H2O2, followed by different final concentrations of TMB substrate (concentration gradients of 0.1 mM, 0.2 mM, 0.4 mM, 0.8 mM, 1.0 mM, 1.2 mM, 1.5 mM, and 2.0 mM). Finally, 0.2 M sodium acetate buffer (pH 3.5) was added to a final volume of 200 μL. The absorbance was monitored at 652 nm using a microplate reader, with readings every 30 s. The total measurement time was 10 min, and the reaction temperature was kept constant at 28 ℃. The substrate concentration [S] and reaction rate V during the initial linear phase (1–3.5 min) were measured (as shown in Table 4, with two measurements taken to obtain V1 and V2). The Michaelis-Menten model in GraphPad Prism was used for fitting, and the enzyme kinetic results are as follows: Figure 9 As shown, the fitted Michaelis constant K m The maximum reaction rate V is 0.6951 mM. max The concentration was 0.05011 μM / s, with the Fe3O4@PEI nanozyme concentration [E] being 6.28 × 10⁻⁶. -12 M, Transformation number K cat =V max / [E]=7.98×10 3 s -1 Catalytic efficiency K cat / K m 1.15×10 7 M -1 ·s -1 The above results demonstrate that this Fe3O4@PEI nanozyme maintains high catalytic efficiency while possessing stability and recyclability that are difficult for natural enzymes to match.

[0078] Table 4. Substrate concentration and reaction rate

[0079]

[0080] 2. Agrobacterium infection of areca nut callus tissue includes the following steps:

[0081] (1) Preparation of infection medium: Centrifuge the Agrobacterium EHA105 bacterial culture loaded with pNC-Cam3304-ANRSV-CP-RNAi vector, discard the supernatant, add liquid medium (the formula of liquid medium per 1L is: sodium dihydrogen phosphate 3 g; calcium chloride 2.9 g; magnesium sulfate heptahydrate 2.47 g; ferrous sulfate heptahydrate 1.39 g; inositol 0.1 g; activated carbon 1 g; sucrose 40 g; acetylsuccinone 200 μM) to resuspend the bacterial cells, and culture at 28℃ with shaking at 200 rpm for 30 min and adjust to OD 600 =0.5~0.6, to obtain the infection culture medium;

[0082] (2) Select the same batch of areca callus tissue as in Example 4 as the recipient, remove the residual culture medium, soak it in the infection culture medium for 30 min, and shake it manually once every 10 min.

[0083] (3) After the infection is completed, the areca callus tissue is dried on sterile filter paper for 30-60 min, then transferred to co-culture medium (acetylsalicylic acid 200 μM, cysteine ​​100 mg / L, agar 5 g / L) and cultured at 19℃ for 2-3 days.

[0084] (4) Wash the areca callus tissue from step (3) with sterile water several times (3-5 times) until the sterile water is clear; transfer the areca callus tissue to a liquid culture medium containing 500 mg / L termethin (the formula of each 1L liquid culture medium is: 3 g sodium dihydrogen phosphate; 2.9 g calcium chloride; 2.47 g magnesium sulfate heptahydrate; 1.39 g ferrous sulfate heptahydrate; 0.1 g inositol; 1 g activated carbon; 40 g sucrose; 0.5 g termethin), shake at 28℃ and 140 rpm for 30 min;

[0085] (5) After emptying the liquid culture medium in step (4), spread the areca callus tissue on sterile filter paper and dry it for 1-2 hours. Then transfer it to the screening medium (cysteine ​​100 mg / L, agar 5 g / L, glufosinate 2.5 mg / L) and incubate it in the dark at a constant temperature of 28℃.

[0086] 3. Using untransformed areca nut callus as a control (referred to as wild type), areca nut callus transformed with Fe3O4@PEI in Example 4 (referred to as Fe3O4@PEI), and areca nut callus infected with Agrobacterium in Step 2 (referred to as Agrobacterium), samples were taken at 12 h, 24 h, 36 h, 48 h, 3 d, 4 d, 5 d, 6 d, and 7 d after the start of culture, and the changes in browning degree were continuously observed over 7 days. The results are as follows: Figure 10 As shown, the wild-type group showed natural browning on day 5; no obvious browning was observed in the Fe3O4@PEI group within 7 days; and browning began to appear in the Agrobacterium group at 36 h, with the degree of browning further intensifying on day 4.

[0087] The H2O2 content of areca nut callus samples taken at different time points was determined using the Solarbio Hydrogen Peroxide (H2O2) Content Detection Kit (catalog number: BC3595). Results are as follows: Figure 11 As shown, the H2O2 level in the Fe3O4@PEI group was lower than that in the Agrobacterium group in the middle and late stages, consistent with its phenotype of milder browning. The results indicate that the Fe3O4@PEI magnetic nanocarrier-mediated transformation system can reduce H2O2 accumulation and alleviate oxidative damage during the transformation of Areca catechu callus, thereby significantly inhibiting callus browning.

[0088] Furthermore, following the method of infecting areca nut callus with Agrobacterium in step 2, after 3 months of dark culture at 28°C, no areca nut-positive regenerated callus was obtained, as shown in the following results. Figure 12 As shown.

[0089] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for genetic transformation of areca nut callus mediated by Fe3O4@PEI magnetic nanocarrier, characterized in that, include: (1) Fe3O4@PEI magnetic nanoparticles and the target gene expression vector were mixed and incubated at room temperature for 10-30 min to prepare Fe3O4@PEI-DNA complex; (2) The areca callus tissue pretreated by acupuncture and the Fe3O4@PEI-DNA complex obtained in step (1) were co-cultured in liquid culture medium and placed in a magnetic field of 10000~12000 Gs for magnetic transfection. After transfection, the areca callus tissue was taken out and dried under sterile conditions to remove excess water. (3) The dried areca nut callus from step (2) is transferred to a screening medium for culture to obtain positive regenerated callus.

2. The method for genetic transformation of areca nut callus mediated by Fe3O4@PEI magnetic nanocarrier according to claim 1, characterized in that, In step (1), the mass ratio of the Fe3O4@PEI magnetic nanoparticles to the target gene expression vector is 25~40:

1.

3. The method for genetic transformation of areca nut callus mediated by Fe3O4@PEI magnetic nanocarrier according to claim 1, characterized in that, In step (2), the liquid culture medium is formulated as follows: sodium dihydrogen phosphate 3 g / L; calcium chloride 2.9 g / L; magnesium sulfate heptahydrate 2.47 g / L; ferrous sulfate heptahydrate 1.39 g / L; inositol 0.1 g / L; activated carbon 1 g / L; sucrose 40 g / L.

4. The method for genetic transformation of areca nut callus mediated by Fe3O4@PEI magnetic nanocarrier according to claim 1, characterized in that, In step (2), the acupuncture pretreatment includes using a sterile needle with a 1 mL syringe to puncture the areca nut callus tissue to form mechanical trauma.

5. The method for genetic transformation of areca nut callus mediated by Fe3O4@PEI magnetic nanocarrier according to claim 1, characterized in that, In step (2), co-culture is carried out in a petri dish, and the petri dish is placed on a magnetic plate of 10000~12000 Gs for magnetic transfection for 2 h.

6. The method for genetic transformation of areca nut callus mediated by Fe3O4@PEI magnetic nanocarrier according to claim 5, characterized in that, In step (2), during the magnetic transfection process, the culture dish is picked up and gently shaken every 30 minutes, and then placed back on the magnetic plate; after transfection, the extracted areca callus tissue is dried on sterile filter paper for 20-30 minutes to remove excess moisture.

7. The method for genetic transformation of areca nut callus mediated by Fe3O4@PEI magnetic nanocarrier according to claim 1, characterized in that, In step (3), the formulation of the screening medium is as follows: sodium dihydrogen phosphate 3 g / L; calcium chloride 2.9 g / L; magnesium sulfate heptahydrate 2.47 g / L; ferrous sulfate heptahydrate 1.39 g / L; inositol 0.1 g / L; activated carbon 1 g / L; sucrose 40 g / L; cysteine ​​100 mg / L; agar 5 g / L; glufosinate 2.5 mg / L.

8. The method for genetic transformation of areca nut callus mediated by Fe3O4@PEI magnetic nanocarrier according to claim 1, characterized in that, In step (3), the tissue is cultured in the dark at 28°C for 3-4 months in the screening medium, and positive regenerated callus tissue is obtained after 3-4 rounds of resistance screening.

9. The method for genetic transformation of areca nut callus mediated by Fe3O4@PEI magnetic nanocarrier according to claim 1, characterized in that, Also includes: Areca nut positive regenerated callus was selected, and genomic DNA was extracted using a plant genome extraction kit. The glufosinate resistance marker gene bar in the areca nut positive regenerated callus was then detected by PCR to obtain transgenic areca nut resistant callus.

Images