Application of citrus CsHAD1 gene in enhancing resistance of citrus to bacterial wilt

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to application of a citrus CsHAD1 gene in enhancing resistance of citrus to bacterial wilt. The application constructs a VIGS vector of a CsHAD1 coding sequence, transforms citrus by using an Agrobacterium tumefaciens mediation method, successfully reduces the transcription level of CsHAD1 in the transgenic citrus, and obtains a VIGS plant in which the citrus CsHAD1 gene is silenced. The application first clones the citrus CsHAD1 gene, and reduces the transcription level of the citrus CsHAD1 by using a VIGS technology, can significantly improve the resistance of the citrus to bacterial wilt, and does not affect the phenotype of the transgenic plant, has great application value in breeding of the citrus resistant to bacterial wilt, and can be used as a candidate gene to breed bacterial wilt resistance together with multiple bacterial wilt resistant and susceptible genes.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of the citrus CsHAD1 gene in enhancing the resistance of citrus to citrus canker. Background Technology

[0002] Citrus canker ( Citrus bacterial canker CBC is a strain of Xanthomonas citrus (Citrullus xanthomonas). Xanthomonas citri subsp. Citri Citrus canker is a bacterial disease caused by Xcc, which affects most of the currently cultivated citrus varieties. Therefore, strengthening research on the prevention and control of citrus canker is an urgent need for the development of the citrus industry.

[0003] Traditional control methods for citrus canker, such as burning diseased trees and using pesticides, require significant manpower and resources and cause substantial environmental damage. Therefore, the control of citrus canker relies more heavily on cultivating new resistant germplasm. Molecular breeding, due to its ability to selectively and efficiently cultivate new resistant germplasm, has seen rapid development and widespread application. In recent years, biotechnology has yielded some citrus resources resistant to canker, such as Jincheng, Xinhui, and navel orange lines transgenic with the antimicrobial peptide D gene from silkworms; late-maturing Jincheng orange lines overexpressing CsBZIP40; and plants with enhanced resistance to citrus canker obtained through site-specific editing of the CsLOB1 promoter, a citrus canker susceptibility gene. However, high-quality candidate genes remain scarce, and their functions and mechanisms of action are not well understood. Therefore, there is an urgent need to specifically identify more genes closely related to citrus canker, deeply analyze their functions and mechanisms, and use them for molecular breeding to combat canker.

[0004] The superfamily of halogenated dehalogenases and hydrolases ( Haloacid dehalogenase-like hydrolase, Plant phosphatase (HAD) proteins are widely distributed in various plants. They are a superfamily of highly differentiated phosphatases encoded by multiple genes. Their core catalytic domains possess conserved hydrolytic active sites, mediating key biochemical processes such as intracellular phosphate metabolism, organic acid transport, and endogenous hormone homeostasis remodeling. They are a crucial protein family connecting plant basal metabolism and stress-immune regulation. Based on conserved catalytic motifs, phylogenetic evolution, and gene structure characteristics, the plant HAD family can be divided into multiple evolutionary branches. Typical HAD proteins all contain a characteristic conserved phosphatase domain, which is a hallmark distinguishing this family from other hydrolases. Currently, HAD family genes have been identified genome-wide in various crops such as Arabidopsis thaliana, rice, maize, and soybean. These proteins participate extensively in multiple biological processes, including plant root development, cross-regulation of endogenous hormones, abiotic stress responses, and pathogen infection interactions, by regulating intracellular phosphate cycling and salicylic acid / auxin signaling balance. Existing studies have confirmed that pathogen infection can significantly disrupt the transcriptional level of host HAD family genes, thereby regulating the plant's basic resistance to fungal and bacterial diseases by reshaping defense hormone pathways, and altering the rate of lesion expansion and the severity of disease.

[0005] Although there has been some basic research on the auxin signaling pathway mediated by HAD in the regulation of plant disease resistance, there are no reports on the in vivo functional verification and breeding application of the CsHAD1 gene in the field of the interaction mechanism of citrus canker. Summary of the Invention

[0006] The purpose of this invention is to provide an application of the citrus CsHAD1 gene in enhancing the resistance of citrus to citrus canker, which significantly improves the resistance of citrus to citrus canker without affecting the citrus phenotype, thus laying the foundation for the breeding of citrus resistant to citrus canker.

[0007] To achieve the above objectives, the present invention provides the following technical solution: This invention provides the application of the citrus CsHAD1 gene in enhancing resistance to citrus canker by reducing the transcription level of the CsHAD1 gene in citrus. The nucleotide sequence of the citrus CsHAD1 gene is shown in SEQ ID NO.1.

[0008] Preferably, the transcription level of the CsHAD1 gene in citrus is reduced by using VIGS silencing; The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.2.

[0009] This invention provides a method for preventing and controlling citrus canker, including reducing the transcription level of the citrus CsHAD1 gene by using VIGS silencing, wherein the nucleotide sequence of the citrus CsHAD1 gene is shown in SEQ ID NO.1; The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.2.

[0010] This invention provides a method for enhancing citrus canker resistance using the CsHAD1 gene in citrus, comprising the following steps: S1, VIGS fragment of the cloned citrus CsHAD1 gene; S2. Construct the VIGS expression vector for CsHAD1; The VIGS expression vectors of S3 and CsHAD1 were transformed into citrus, resulting in VIGS plants in which the CsHAD1 gene of citrus was silenced. The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.2.

[0011] Preferably, in step S1, the cloning method of the VIGS fragment is as follows: extract total RNA from citrus, reverse transcribe it into cDNA, and use the cDNA as a template to amplify the VIGS fragment of the citrus CsHAD1 gene by high-fidelity enzyme PCR.

[0012] More preferably, the nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.2.

[0013] More preferably, the primers used for the PCR amplification are CsHAD1-VIGS-F and CsHAD1-VIGS-R; The nucleotide sequence of CsHAD1-VIGS-F is shown in SEQ ID NO.3; the nucleotide sequence of CsHAD1-VIGS-R is shown in SEQ ID NO.4.

[0014] Preferably, in step S2, the VIGS expression vector is constructed as follows: the VIGS fragment obtained in step S1 is digested with EcoRI and KpnI enzymes, recovered, ligated with the TRV2 vector digested with the same enzymes, and transformed into competent E. coli cells. The plasmid is then extracted to obtain the VIGS vector of the CsHAD1 gene.

[0015] Preferably, in step S3, the method for transforming citrus with the VIGS vector is as follows: the VIGS vector obtained in step S2 is transformed into Agrobacterium, an Agrobacterium bacterial solution containing the VIGS vector is prepared, and sterile citrus seedlings are infected. After verification by fluorescence observation, PCR and qRT-PCR, VIGS plants with the citrus CsHAD1 gene silenced are obtained.

[0016] This invention also provides the application of negative regulation of CsHAD1 gene expression in the breeding of citrus canker-resistant varieties, wherein the nucleotide sequence of the CsHAD1 gene is shown in SEQ ID NO.1.

[0017] The beneficial effects of this invention are: 1. This invention provides a citrus CsHAD1 gene and its application in enhancing citrus resistance to citrus canker. By constructing a VIGS vector of the citrus CsHAD1 gene and transforming citrus with Agrobacterium-mediated transformation, the resulting citrus plants showed significant resistance to citrus canker, with a reduction in lesion area of ​​35.46%~41.87% and a reduction in disease index of 30.89%~43.29%, significantly alleviating the severity of citrus canker. 2. This invention provides a citrus CsHAD1 gene and its application in enhancing citrus resistance to citrus canker. Silencing the citrus CsHAD1 gene VIGS can significantly reduce the severity of citrus canker, and silencing the citrus CsHAD1 gene VIGS does not affect the phenotype of citrus plants. 3. This invention provides a citrus CsHAD1 gene and its application in enhancing citrus resistance to citrus canker. The citrus CsHAD1 gene can also be used as a candidate gene to synergistically carry out citrus canker resistance breeding with multiple citrus canker resistance and susceptibility genes using VIGS silencing, RNA interference and gene editing technologies, which has significant application value in citrus ... Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 Bioinformatics features of citrus CsHAD1: A, Chromosomal location of citrus CsHAD1 gene; B, Gene structure of citrus CsHAD1; C, Conserved domains of citrus CsHAD1. Figure 2 Electrophoresis diagram of PCR amplification of the VIGS fragment of the CsHAD1 encoding gene: VIGS represents the RNAi fragment of the CsHAD1 encoding gene; M represents the DNA molecular weight standard, the same below; Figure 3 The structure diagram of the CsHAD1 VIGS vector: GFP, green fluorescent protein; RdRp, NA-dependent RNA polymerase; CP, coat protein; 35S, plant constitutive promoter derived from cauliflower mosaic virus; NOS, crown gall synthase gene terminator; LB, left homologous arm; RB, right homologous arm; Figure 4 Figure A shows the PCR identification of transgenic plants; Figure B shows the PCR detection of VIGS plants: +, positive control; -, negative control; M, molecular weight standard; TRV2, plants with empty vector; Figure C shows the 150 bp band amplified by primer pair CsHAD1-ID1-F / R in three silent plants: TRV2 (CK) and TRV2-CsHAD1; Figure C shows the 150 bp band amplified by primer pair CsHAD1-ID2-F / R in three silent plants: TRV2 (CK) and TRV2-CsHAD1; Figure C shows no amplification band in TRV2 (CK) plants, but a 493 bp band amplified in TRV2-CsHAD1 plants using primer pair CsHAD1-ID2-F / CsHAD1-VIGS-R. bp bands; TRV2-CsHAD1-1, TRV2-CsHAD1-2, and TRV2-CsHAD1-3 are three CsHAD1 silenced plants, the difference being that they are different lines that silence the same gene. Figure 5 qRT-PCR detection of CsHAD1 expression in VIGS plants: *, significant difference (P≤0.05) (the same below); TRV2, plants with empty vector (the same below); TRV2-CsHAD1, plants transformed with CsHAD1 VIGS vector (the same below). Figure 6 Phenotypic diagram of VIGS plants: TRV2, plants transgenic from TRV1 and TRV2 without grafts; Figure 7 Disease incidence 10 days after VIGS plants were inoculated with ulcer pathogens on their leaves; Figure 8 A statistical chart of lesion area on leaves of VIGS plants 10 days after inoculation with ulcer pathogen; Figure 9 A statistical chart of disease index of VIGS plant leaves 10 days after inoculation with ulcer pathogen. Detailed Implementation

[0020] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0021] The plant total RNA extraction kit used in this invention was purchased from Adley (CAT: RN09); the reverse transcription kit PrimeScript RT Master Mix was purchased from Takara Bio Inc. (CAT: RR036A); and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase was purchased from Takara Bio Inc. (CAT: R045Q).

[0022] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0023] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.

[0024] Example 1: Bioinformatics Analysis of CsHAD1 in Citrus The citrus CsHAD1 gene is located between 22121525 bp and 22123007 bp on chromosome 1 of the citrus plant. It contains 3 introns and 4 exons, encoding 283 amino acids. The nucleotide sequence of the citrus CsHAD1 gene is shown in SEQ ID NO.1, and its bioinformatics characteristics are as follows: Figure 1 As shown.

[0025] CsHAD1: ATGAGCATGGGAGGGGTGTCACTGCCATTATTCTTCTTTTTTCTGGCTACCATATCAGCAACATCCCATGGATTTAGCATGGACATCCGCCATCTTTTTCTGGCTACCATATCAGCAACATCCCATGGATTTAGCATGGACATCCCCCATCAGATTCATCTTCTCCGACCGAAAGCCGGTTCCCGGAACAACGATGTTCCCGGCTTGTCCTGCCTGAGTTGGCGACTCGGAGTGGAAACTAATAACGTTATAGGATGGGCGACTGTTCCCGAAAAATGTGCAGGCTACGTGGGGCATTACATGTTAGGCCAGCAGTACCGCATGGACTCTGAAGTGGTAGCTAATGAGGCCATTCTCTATGCGCAGAGCCTCAAGCTTGCTGGCGACGGCAAGAACATTTGGGTTTTCGACATAGATGAAACCTCGCTATCTAATTTGCCATATTATGCTAAGAATGGATTCGGGGTGAAGCCATACAACCCTACTTTGTTTAATGAATGGGTGAACACCGGAAAAGCACCACCGCTGCCAGAGAGCCTTAAGCTTTACAAAAAATTATTATTGCTTGGAATTAAGATTGTATTCCTCACGGGAAGACCAGAAGATCAGAGAAATGTTACAGAAGCTAATTTAAAGCATGCTGGATTCGACACCTGGGAGAAGCTCATCCTCAAGGGATCATCTCACTCAGGAGAAACAGCAGTGGTGTACAAATCAAGTGAAAGAAAGAAGCTTGAGATGAAAGGGTACAGAATTATTGGAAACATAGGTGATCAATGGAGCGATCTCCTGGGCACCAACGCCGGCAATCGGACGTTCAAGCTGCCTGACCCAATGTATTACATTGGC (SEQ ID NO.1).

[0026] Example 2 Cloning of VIGS Fragment 2.1 RNA Extraction and cDNA Synthesis Total RNA was extracted from leaves of *Citrus aurantiacus* using a plant total RNA extraction kit. RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a concentration meter. cDNA was synthesized using the PrimeScript RT Master Mix reverse transcription kit and stored at -20°C for later use.

[0027] 2.2 VIGS Fragment Amplification The VIGS fragment of the CsHAD1 encoding gene, with a length of 320 bp, was cloned from the cDNA of Late Orange using primers CsHAD1-VIGS-F and CsHAD1-VIGS-R and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase.

[0028] PCR amplification program: 98℃, 5 min; 98℃, 30 s, 56℃, 30 s, 72℃, 1.5 min, 35 cycles; extension at 72℃ for 10 min. Electrophoresis results of PCR amplification of the VIGS fragment of the CsHAD1 encoding gene are shown below. Figure 2 As shown.

[0029] The nucleotide sequence of primer CsHAD1-VIGS-F is shown in SEQ ID NO.3: GAATTCATGAGCATGGGAGGGGTGT (SEQ ID NO.3); the nucleotide sequence of primer CsHAD1-VIGS-R is shown in SEQ ID NO.4: GGTACCCGGTACTGCTGGCCTAACAT (SEQ ID NO.4).

[0030] The nucleotide sequence of the VIGS fragment of CsHAD1 is as SEQ ID Shown in NO.2: ATGAGCATGGGAGGGGTGTCACTGCCATTATTCTTCTTTTTTCTGGCTACCATATCAGCAACATCCCATGGATTTAGCATGGACATCCGCCATCTTTTTCTGGCTACCATATCAGCAACATCCCATGGATTTAGCATGGACATCCCCCATCAGATTCA TCTTCTCCGACCGAAAGCCGGTTCCCGGAACAACGATGTTCCCGGCTTGTCCTGCCTGAGTTGGCGACTCGGAGTGGAAACTAATAACGTTATAGGATGGGCGACTGTTCCCGAAAAATGTGCAGGCTACGTGGGGCATTACATGTTAGGCCAGCAGTACCG (SEQ IDNO.2).

[0031] Under UV light, use a clean blade to cut off the agarose gel block containing the target fragment, and use a kit (BioFlux, CAT: BSC02M1) to recover the DNA fragment.

[0032] Example 3: Construction of VIGS Carrier The VIGS fragments of the TRV2 and CsHAD1 genes in the VIGS vector were digested with EcoRI and KpnI, recovered via gel electrophoresis, and then the two fragments were ligated and transformed into competent E. coli cells. Plasmids were extracted to obtain the VIGS expression vector TRV2-CsHAD1. The structure of the TRV2-CsHAD1 vector is shown below. Figure 3 As shown. Among them, GFP: green fluorescent protein; RdRp: NA-dependent RNA polymerase; CP: coat protein; 35S: plant constitutive promoter derived from cauliflower mosaic virus; NOS: crown gall synthase gene terminator; LB: left homologous arm; RB: right homologous arm.

[0033] Agrobacterium was transformed with the vector TRV2-CsHAD1 by electroporation to prepare Agrobacterium bacterial culture containing the CsHAD1 gene VIGS expression vector.

[0034] Example 4: VIGS vector transformation of citrus 4.1 Activation of Agrobacterium tumefaciens 500 μL of each of the following Agrobacterium tumefaciens cultures were added to 50 mL of liquid LB medium (containing kanamycin: 50 mg / L) and cultured at 28 °C and 200 r / min until OD500. 600 =1; Collect bacterial cells, resuspend in MMA (10 mM MgCl2, 10 nM MES, 100 μM acetylsuccinone) solution, and adjust OD. 600 =1; Mix TRV1 with TRV2 and TRV2-HAD1 vectors at a volume ratio of 1:1 and incubate at room temperature for 3 h.

[0035] 4.2 Agrobacterium infection Sterile seedlings with radicles reaching 3 cm in length were immersed in Agrobacterium tumefaciens solution and vacuumed for 1 minute. They were then rinsed 3-5 times with sterile water and cultured in seed culture medium at room temperature in the dark for 2-3 days. If green fluorescence was observed, the seedlings were considered positive. They were then transferred to soil for cultivation at 25°C under 16 h light / 8 h dark conditions, with regular watering.

[0036] Example 5: Identification and Phenotypic Observation of VIGS Plants 5.1 PCR Identification Seedlings showing green fluorescence under ultraviolet light were considered positive and subsequently transferred to nutrient soil culture medium. One month later, tissue samples were collected for DNA and total RNA extraction. PCR verification was performed using two primer pairs: CsHAD1-ID1-F / CsHAD1-ID1-R, CsHAD1-ID2-F / CsHAD1-ID2-R, and CsHAD1-ID2-F / CsHAD1-VIGS-R. PCR reaction conditions: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min.

[0037] PCR identification results of transgenic plants are as follows Figure 4 As shown in Figures A and B, primer pair CsHAD1-ID1-F / R amplified a 150 bp band in both TRV2 and TRV2-CsHAD1 plants. Primer pair CsHAD1-ID2-F / R amplified a 150 bp band in both TRV2 and TRV2-CsHAD1 plants. Primer pair CsHAD1-ID2-F / CsHAD1-VIGS-R did not amplify a band in TRV2 plants, but amplified a 493 bp band in TRV2-CsHAD1 plants.

[0038] CsHAD1-ID1-F: GCTATTCGTATAGGGACAATCCG (SEQ ID NO.5); CsHAD1-ID1-R: GAGCAATCTGCTCATGAGTGAGG (SEQ ID NO.6); CsHAD1-ID2-F: ATTCACTGGGAGATGATACGCT (SEQ ID NO.7); CsHAD1-ID2-R:GAATCTAAGTCCACTCGTCCGT (SEQ ID NO. 8).

[0039] 5.2 qRT-PCR analysis 5.2 qRT-PCR analysis qRT-PCR was performed using primers CsHAD1-RT-F and CsHAD1-RT-R to verify whether CsHAD1 was successfully silenced. The gene expression level of plants transgenic with empty TRV1 and TRV2 vectors was set to 1. If the CsHAD1 gene expression level in plants containing the target fragment vector was less than 1, gene silencing had occurred. qRT-PCR detection of CsHAD1 expression in VIGS plants was performed as follows: Figure 5 As shown, CsHAD1 transcription levels decreased by 51.29%–65.96%.

[0040] Table 1. Raw data on relative HAD1 expression levels

[0041] qRT-PCR reaction conditions: 95℃, 3 min; 94℃, 10 s; 56℃, 10 s; 72℃, 10 s, 40 cycles; 72℃, 10 min.

[0042] CsHAD1-RT-F: CGCATGGACTCTGAAGTGGT (SEQ ID NO.9); CsHAD1-RT-R: CCAAATGTTCTTGCCGTCG (SEQ ID NO. 10).

[0043] 5.3 Phenotypic Observation Observe the phenotype of VIGS plants with the CsHAD1 gene, such as Figure 6 As shown, no obvious abnormalities were found in appearance or growth. This indicates that silencing CsHAD1 did not have a significant impact on the plant's phenotype and development.

[0044] Example 6: Resistance evaluation of VIGS plants Mature leaves of transgenic plants were washed, disinfected with 75% alcohol, and rinsed with sterile water before being placed in a clean bench. Acupuncture was performed around the leaf veins, and 1 μL (1×10⁻⁶) of ulcer bacteria solution was pipetted into each well. 5 CFU / mL); cultured in a constant temperature and light incubator at 28℃ (16 h light / 8 h dark); photographed leaves 10 days after inoculation, and the area of ​​lesions was counted using ImageJ software.

[0045] The disease is classified into grades 0-7 based on the area of ​​the lesions, with the letter R representing the lesion area, grade 0 (R ≤ 0.25 mm). 2 Level 1 (0.25 mm) 2 <R≤0.5 mm 2 Level 2 (0.5 mm) 2 <R≤0.75 mm 2 Level 3 (0.75 mm) 2 <R≤1 mm 2 Level 4 (1.0 mm) 2 <R≤1.25 mm 2 Level 5 (1.25 mm) 2 <R≤1.5 mm 2 Level 6 (1.5 mm) 2 <R≤1.75 mm 2 Level 7 (R > 1.75 mm) 2The disease index is calculated according to the formula: DI = 100 × Σ [number of lesions at each level × corresponding level value] / (total number of lesions × maximum level).

[0046] The results are as follows Figures 7-9 As shown, 10 days after inoculation with peptic ulcer bacteria, Figure 7 The symptoms of VIGS plants containing CsHAD1 were significantly reduced. Figure 8 The lesion area of ​​VIGS plants treated with CsHAD1 was reduced by 35.46% to 41.87%; Figure 9 The disease index of VIGS plants with CsHAD1 decreased by 30.89% to 43.29%. Therefore, silencing the CsHAD1 gene can enhance resistance to citrus canker.

[0047] Table 2 Dataset of Lesion Area

[0048] Table 3. Plant Disease Data Set

[0049] In summary, this invention can significantly reduce the lesion area and severity of citrus canker by silencing CsHAD1. The CsHAD1 gene provided by this invention can be used for molecular breeding of citrus canker resistance, or it can be used synergistically with other disease-resistant or susceptible genes for molecular breeding of citrus canker resistance, demonstrating significant application value in citrus canker resistance breeding.

[0050] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of the citrus CsHAD1 gene in enhancing resistance to citrus canker, characterized by, Enhance citrus canker resistance by reducing the transcription level of the CsHAD1 gene in citrus; The nucleotide sequence of the citrus CsHAD1 gene is shown in SEQ ID NO.

1.

2. The application of the citrus CsHAD1 gene according to claim 1 in enhancing resistance to citrus canker, characterized in that, The transcription level of the CsHAD1 gene in citrus was reduced by using VIGS silencing. The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.

2.

3. A method for preventing and controlling citrus canker, characterized in that, This includes using VIGS silencing to reduce the transcription level of the citrus CsHAD1 gene, the nucleotide sequence of which is shown in SEQ ID NO.1; The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.

2.

4. A method for enhancing citrus canker resistance using the CsHAD1 gene in citrus, characterized in that, Includes the following steps: S1, VIGS fragment of the cloned citrus CsHAD1 gene; S2. Construct the VIGS expression vector for CsHAD1; The VIGS expression vectors of S3 and CsHAD1 were transformed into citrus, resulting in VIGS plants in which the CsHAD1 gene of citrus was silenced. The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.

2.

5. The method for enhancing citrus canker resistance using the CsHAD1 gene according to claim 4, characterized in that, In step S1, the VIGS fragment is cloned as follows: total RNA is extracted from citrus, reverse transcribed into cDNA, and the VIGS fragment of the citrus CsHAD1 gene is amplified by high-fidelity enzyme PCR using cDNA as a template.

6. The method for enhancing citrus canker resistance using the CsHAD1 gene according to claim 5, characterized in that, The nucleotide sequence of the VIGS fragment is shown in SEQ ID NO.

2.

7. The method for enhancing citrus canker resistance using the CsHAD1 gene according to claim 5, characterized in that, The primers used for the PCR amplification were CsHAD1-VIGS-F and CsHAD1-VIGS-R; The nucleotide sequence of CsHAD1-VIGS-F is shown in SEQ ID NO.3; the nucleotide sequence of CsHAD1-VIGS-R is shown in SEQ ID NO.

4.

8. A method for enhancing citrus canker resistance using the CsHAD1 gene according to claim 4, characterized in that, In step S2, the VIGS expression vector is constructed as follows: the VIGS fragment obtained in step S1 is digested with EcoRI and KpnI enzymes, recovered, ligated with the TRV2 vector digested with the same enzymes, and transformed into competent E. coli cells. The plasmid is extracted to obtain the VIGS vector of the CsHAD1 gene.

9. A method for enhancing citrus canker resistance using the CsHAD1 gene according to claim 4, characterized in that, In step S3, the method for transforming citrus with the VIGS vector is as follows: the VIGS vector obtained in step S2 is transformed into Agrobacterium, an Agrobacterium bacterial suspension containing the VIGS vector is prepared, and sterile citrus seedlings are infected. After verification by fluorescence observation, PCR and qRT-PCR, VIGS plants with the citrus CsHAD1 gene silenced are obtained.

10. The application of negative regulation of CsHAD1 gene expression in the breeding of citrus varieties resistant to citrus canker, characterized in that, The nucleotide sequence of the CsHAD1 gene is shown in SEQ ID NO.1.

Images