A lfd-lamp primer pair probe combination for detecting exserohilum turcicum, a kit, a detection method and application

Abstract

The present application relates to the field of agricultural science and technology, plant protection technology, and relates to a LAMP-LFD primer pair probe combination for detecting corn large spot fungus, a kit, a detection method and application. The primer pair probe combination comprises four primers and one probe. The primers and the probe realize visual rapid detection of corn large spot fungus through the following steps: extracting corn large spot fungus genomic DNA, configuring a LAMP reaction system, amplification reaction, probe hybridization with amplification products, and LFD test strip detection. The present application has the advantages of rapid and accurate detection, strong specificity, high sensitivity, simple and fast operation, low cost, intuitive and easy-to-observe detection results, and the like. The present application has simple requirements for instruments and equipment, and only one simple constant temperature water bath is needed to complete the detection, which is suitable for rapid detection of corn large spot fungus in primary institutions and corn planting sites with simple experimental equipment, and has high application and promotion value in early diagnosis and timely prevention and control of corn large spot.

Description

Technical Field

[0001] This invention relates to the field of agricultural science and technology and plant protection technology, and in particular to a LAMP-LFD primer-probe combination, kit, detection method and application for detecting maize leaf spot pathogen. Background Technology

[0002] Maize (Zea mays) is not only an important food for humans and one of China's three major grain crops, but also an important livestock feed and industrial raw material. Northern Corn Leaf Blight (NCLB), caused by *Exserohilum turcicum* (sexual stage: *Setosphaeria turcia*), is a major foliar disease affecting maize worldwide. First discovered in Italy in 1876 and in my country in 1899, this disease is now widespread in maize-producing regions globally, particularly severe in Asia, Africa, and the Americas. In my country, NCLB is mainly distributed in cool maize-producing areas such as northern and southern mountainous regions, causing severe economic losses to maize yields, typically 20%-30%, and in severe cases, up to 50% or more. In recent years, the widespread application and large-scale planting of some susceptible varieties, as well as the variation of the pathogen's physiological races, have led to the continuous occurrence and spread of the disease, gradually increasing its threat to maize production.

[0003] Establishing a rapid and accurate detection method for maize leaf spot pathogens is of great significance for the timely and efficient control of maize leaf spot disease. Currently, the commonly used identification methods for maize leaf spot pathogens mainly include traditional morphological identification methods and molecular identification methods based on specific targets. Traditional morphological identification methods mainly distinguish and identify pathogens based on colony morphology, conidia, conidiophores, and conidiomata. This method is not only time-consuming and labor-intensive, but also requires practitioners to have solid theoretical knowledge of plant pathology and rich experience in pathogen morphology identification. The identification cycle is long, the operation is cumbersome, and it is very easy to cause diagnostic errors due to different varieties, different tissues, different growth stages of disease symptoms, or subjective perception. Therefore, it is not applicable to field testing and production practice. With the development of molecular biology detection technologies, conventional PCR, nested PCR, real-time quantitative PCR, Bio-PCR, and digital titration PCR, among other molecular nucleic acid detection techniques, have been widely used for the rapid and accurate detection and identification of pathogenic microorganisms. These methods offer advantages such as high sensitivity and short detection time. However, they still suffer from drawbacks, including reliance on sophisticated and expensive instruments like PCR machines and the need for specialized operators. These limitations fail to meet the needs of grassroots agricultural departments with limited experimental equipment for rapid on-site detection of pathogenic samples. Therefore, there is a need for a detection method that combines sensitivity, specificity, and convenience, and is an efficient field detection technology that does not rely on any instruments.

[0004] Loop-mediated isothermal amplification (LAMP) is a relatively new in vitro isothermal amplification technique for nucleic acids. Compared with PCR-related detection techniques, it has advantages such as faster detection, more convenient operation, higher specificity, higher sensitivity, and less dependence on instruments. However, LAMP amplification products need to be judged by agarose gel electrophoresis, observation by adding nucleic acid dyes, or turbidity measurement. This method has disadvantages such as easy contamination during operation and easy false positives.

[0005] LAMP-LFD technology, which combines LAMP with a lateral flow dipstick (LDD), is a novel detection method. It utilizes the specific hybridization of a fluorescein isothiocyanate (FITC)-labeled probe with a biotin-labeled LAMP product. This not only reduces false positives caused by nonspecific amplification but also eliminates the need for additional nucleic acid dye colorimetric reactions, agarose gel electrophoresis, or turbidity observation. The process is simplified; the operator only needs to immerse the LFD test strip in the hybridization solution and visually observe the control and test lines on the LFD test strip to determine the results. The method is simple, fast, efficient, highly specific, and safe.

[0006] Currently, LAMP-LFD technology has been successfully applied to the detection of plant pathogens, but there are no reports of its application in the diagnosis and detection of maize leaf spot pathogen. Summary of the Invention

[0007] To address the aforementioned problems, this invention provides a LAMP-LFD primer-probe combination, kit, detection method, and application for detecting maize leaf spot pathogen. This invention designs specific primers and probes for LAMP-LFD detection of maize leaf spot pathogen and establishes a LAMP-LFD detection system based on these primers and probes. This provides important guidance for the early diagnosis and timely control of maize leaf spot disease. The detection method established in this invention is suitable for use in grassroots agricultural departments with limited experimental equipment, overcoming dependence on expensive equipment, reducing detection costs, simplifying operation steps, shortening detection time, and improving detection accuracy.

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] This invention provides a LAMP-LFD primer-probe combination for detecting maize leaf spot pathogen, comprising an external primer pair, an internal primer pair, and a probe ET-HP. The external primer pair consists of an external upstream primer F3 and an external downstream primer B3, and the internal primer pair consists of an internal upstream primer FIP and an internal downstream primer BIP.

[0010] The nucleotide sequence of the external upstream primer F3 is shown in SEQ ID No. 1;

[0011] The nucleotide sequence of the external downstream primer B3 is shown in SEQ ID No. 2;

[0012] The nucleotide sequence of the internal upstream primer FIP is shown in SEQ ID No. 3;

[0013] The nucleotide sequence of the external downstream primer BIP is shown in SEQ ID No. 4;

[0014] The nucleotide sequence of the probe ET-HP is shown in SEQ ID No. 5.

[0015] Preferably, the 5' end of the internal upstream primer FIP is biotin-labeled, and the 5' end of the probe ET-HP is 6-carboxyfluorescein-labeled.

[0016] The present invention also provides a kit for detecting maize leaf spot pathogen, comprising the LAMP-LFD primer-probe combination described in the above technical solution.

[0017] This invention also provides the application of the LAMP-LFD primer-probe combination or the kit described in the above technical solutions in the detection of maize leaf spot pathogen.

[0018] The present invention also provides a method for detecting maize leaf spot pathogen, comprising the following steps:

[0019] 1) Extract genomic DNA from the sample to be tested;

[0020] 2) Using the genomic DNA described in step 1) as a template, LAMP amplification is performed using the outer primer pair and the inner primer pair in the LAMP-LFD primer-probe combination described in the above technical solution to obtain the amplification product;

[0021] 3) Mix the amplification product described in step 2) with probe ET-HP from the LAMP-LFD primer-probe combination described in the above technical solution to obtain the hybridization solution;

[0022] The solution to be hybridized is subjected to a hybridization reaction to obtain a hybridization solution;

[0023] 4) Mix the hybridization solution described in step 3) with the buffer solution to obtain a mixture. Immerse the detection end of the LFD test strip vertically into the mixture. When a purple-red band appears simultaneously in the control area and the detection area, the sample to be tested contains corn leaf blight.

[0024] Preferably, the LAMP amplification system in step 2) is as follows: 1.0 μL of 5 μM external upstream primer F3, 1.0 μL of 5 μM external downstream primer B3, 1.0 μL of 40 μM internal downstream primer FIP, 1.0 μL of 40 μM internal downstream primer BIP, 12.5 μL of LAMP reaction mixture, 1.0 μL of 8 U Bst polymerase, 1.0 μL of genomic DNA, and made up to 25 μL with sterile ultrapure water;

[0025] The LAMP reaction mixture comprises: 40 mM Tris-HCl, 20 mM (NH4)2SO4, 20 mM KCl, 16 mM MgSO4, 1.6 mol / L betaine, 2.0 mM dNTPs, and 0.2 wt.% Trion X-100.

[0026] Preferably, the LAMP amplification conditions in step 2) are: incubation at 63°C for 60 min.

[0027] Preferably, in step 3), the probe ET-HP is mixed in the form of a probe ET-HP solution, wherein the concentration of probe ET-HP in the probe ET-HP solution is 20 pmol;

[0028] The volume ratio of the probe ET-HP solution to the amplification product is 4:5;

[0029] The conditions for the hybridization reaction include hybridization at 63.5°C for 5 minutes.

[0030] Preferably, the volume ratio of the hybridization solution to the buffer solution in step 4) is 1:9;

[0031] The buffer solution is HybriDetect Assay Buffer.

[0032] Preferably, the immersion time in the mixture in step 4) is 5 minutes.

[0033] The beneficial effects of this invention are:

[0034] 1. High specificity: The specific primers and probes used are designed based on 7 different regions of the beta-tubulin (TUB2) gene sequence of maize leaf spot pathogen. Only when 4 primers and 1 probe are completely matched in different regions of the target gene can amplification be performed, which has high specificity.

[0035] 2. High sensitivity: The detection sensitivity for maize leaf spot pathogen can reach 10 fg / μL at the DNA level, which is very high.

[0036] 3. Rapid and efficient detection: The amplification reaction only takes 60 minutes. From the extraction of genomic DNA from the sample to the determination of the results, the entire detection can be completed within 90 minutes, which is more than 1.5 hours shorter than conventional PCR detection technology, greatly improving the detection speed.

[0037] 4. Low cost and wide applicability: No expensive and sophisticated experimental instruments such as PCR machines are required; only a constant temperature water bath or other temperature-controlled equipment is needed. Furthermore, all reagents used in the experiment are common and inexpensive, making it suitable for use in grassroots agricultural departments with limited experimental equipment. This overcomes dependence on expensive equipment, reduces testing costs, simplifies operation procedures, shortens testing time, and improves testing accuracy.

[0038] 5. Simple operation and easy-to-observe results: The entire detection process does not involve complex instruments and equipment, and can be completed by personnel with a basic understanding of molecular biology; the detection results are clear and obvious, and can be judged by the naked eye through LFD test strips.

[0039] In summary, the LAMP-LFD method for detecting maize leaf spot pathogens using the primers and probes of this invention has advantages such as speed, efficiency, high specificity, high sensitivity, simple operation, high accuracy, and low cost. It can meet the needs of grassroots testing institutions with limited experimental equipment and has practical application value. Attached Figure Description

[0040] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0041] Figure 1 A schematic diagram of primers and probes designed for LAMP-LFD detection based on a specific site in the beta-tubulin (TUB2) gene sequence of Exserohilum turcicum, the causal agent of maize leaf spot disease.

[0042] Figure 2Optimization of LAMP-LFD detection reaction temperature; a: Detection results under normal (natural) light; b: Detection results under 365nm UV light; c: 2% agarose gel electrophoresis results; d: LFD test strip results; C: Control line; T: Detection line. 1-8: 61.0℃, 61.5℃, 62.0℃, 62.5℃, 63.0℃, 63.5℃, 64.0℃ and 64.5℃ respectively; M: DL 2000 DNA marker;

[0043] Figure 3 Optimization of LAMP-LFD detection reaction time; a: Detection results under normal (natural) light; b: Detection results under 365nm UV light; c: 2% agarose gel electrophoresis results; d: LFD test strip results; C: Control line; T: Detection line. 1-7: 20 min, 30 min, 40 min, 50 min, 60 min, 70 min, 80 min respectively; 8: ddH2O; M: DL 2000 DNA marker.

[0044] Figure 4 To establish the LMP-LFD detection method; a is the detection result under normal (natural) light, b is the detection result under 365nm ultraviolet light, c is the detection result of 2% agarose gel electrophoresis, d is the detection result of LAMP-LFD test strip, C is the control line, T is the test line; 1-2: genomic DNA of maize leaf spot pathogen, 3: ddH2O, M: DL 2000 DNA marker;

[0045] Figure 5 For LAMP-LFD detection specificity determination; a is the detection result under normal (natural) light, b is the detection result under 365nm ultraviolet light, c is the detection result of 2% agarose gel electrophoresis, d is the detection result of LAMP-LFD test strip, C is the quality control line, and T is the test line. 1-4: Exserohilum turcicum, the causal agent of maize large leaf spot; 5-10: Bipolaris maydis, B. zeicola, B. oryzae, B. zeae, B. sorokiniana, Cercospora zeae-maydis, the causal agent of maize gray leaf spot; 8: negative control; M: DL 2000 DNA marker.

[0046] Figure 6For LAMP-LFD sensitivity testing; a) Detection results under normal (natural) light, b) Detection results under 365nm UV light, c) 2% agarose gel electrophoresis results, d) LAMP-LFD test strip results, C) Control line, T) Detection line. 1-8: 100 pg.μL -1 10 pg.μL -1 1 pg.μL -1 100 fg.μL -1 10 fg.μL -1 1 fg. μL -1 100 ag.μL -1 10 ag.μL -1 9: Negative control; M: DL 2000 DNA marker;

[0047] Figure 7 To simulate LAMP-LFD detection of bacteria-carrying samples; a is the detection result under normal (natural) light, b is the detection result under 365nm ultraviolet light, c is the detection result of 2% agarose gel electrophoresis, d is the detection result of LAMP-LFD test strip, C is the quality control line, and T is the test line. 1: Positive control; 2, 4, 7, 9, 11: Asymptomatic corn leaves; 3, 5, 6, 8, 10: Diseased leaf tissue; 12: Negative control; M: DL 2000 DNA marker. Detailed Implementation

[0048] This invention provides a LAMP-LFD primer-probe combination for detecting maize leaf spot pathogen, comprising an external primer pair, an internal primer pair, and a probe ET-HP. The external primer pair consists of an external upstream primer F3 and an external downstream primer B3, and the internal primer pair consists of an internal upstream primer FIP and an internal downstream primer BIP.

[0049] The nucleotide sequence of the external upstream primer F3 is shown in SEQ ID No. 1; the nucleotide sequence of the external downstream primer B3 is shown in SEQ ID No. 2; the nucleotide sequence of the internal upstream primer FIP is shown in SEQ ID No. 3; the nucleotide sequence of the external downstream primer BIP is shown in SEQ ID No. 4; and the nucleotide sequence of the probe ET-HP is shown in SEQ ID No. 5. In this invention, the 5' end of the internal upstream primer FIP is preferably biotin-labeled, and the 5' end of the probe ET-HP is preferably 6-carboxyfluorescein-labeled.

[0050] SEQ ID No. 1:

[0051] 5'-CCGTCTCCACTTCTTCATGG-3';

[0052] SEQ ID No. 2:

[0053] 5'-GTCCTCAACCTCCTTCATGG-3';

[0054] SEQ ID No. 3:

[0055] 5'-GTGAGCTCGGGGACGGTAACATTTGCTCCTCTTACCAGCC -3';

[0056] SEQ ID No.4:

[0057] 5'- CCAGCAGATGTTCGACCCCAATAGGCAGAGCAGGTCAGG -3';

[0058] SEQ ID No. 5:

[0059] 5'-GATGGCTGCTTCTGACTTCC-3'.

[0060] The present invention also provides a kit for detecting maize leaf spot pathogen, comprising the LAMP-LFD primer-probe combination described in the above technical solution.

[0061] This invention also provides the application of the LAMP-LFD primer-probe combination or the kit described in the above technical solutions in the detection of maize leaf spot pathogen.

[0062] The present invention also provides a method for detecting maize leaf spot pathogen, comprising the following steps:

[0063] 1) Extract genomic DNA from the sample to be tested;

[0064] 2) Using the genomic DNA described in step 1) as a template, LAMP amplification is performed using the outer primer pair and the inner primer pair in the LAMP-LFD primer-probe combination described in claim 1 or 2 to obtain the amplification product;

[0065] 3) Mix the amplification product described in step 2) with probe ET-HP from the LAMP-LFD primer-probe combination described in claim 1 or 2 to obtain the hybridization solution;

[0066] The solution to be hybridized is subjected to a hybridization reaction to obtain a hybridization solution;

[0067] 4) Mix the hybridization solution described in step 3) with the buffer solution to obtain a mixture. Immerse the detection end of the LFD test strip vertically into the mixture. When a purple-red band appears simultaneously in the control area and the detection area, the sample to be tested contains corn leaf blight.

[0068] This invention extracts genomic DNA from samples to be tested. In this invention, the sample to be tested preferably includes a pure culture of pathogenic bacteria or diseased plant tissue. This invention does not specifically limit the method for extracting genomic DNA from the sample to be tested; those skilled in the art can use conventional methods. For example, when using a pure culture of pathogenic bacteria for testing, the CTAB method is used to extract genomic DNA. The specific method is as follows: Take a small amount of mycelial powder into a 1.5 mL centrifuge tube (the mycelial powder should just cover the bottom of the semi-circle), add 900 µL of 2% CTAB (hexadecyltrimethylammonium bromide) extraction solution (2% CTAB; 100 mmol / L Tris-HCl, pH 8.0; 20 mmol / L EDTA, pH 8.0; 1.4 mol / L NaCl) and 90 µL of SDS (sodium dodecylbenzenesulfonate) [Note: CTAB and SDS need to be preheated to 60℃]. Mix well using a shaker, incubate at 60℃ for 1 h (DNA is released into the buffer), at 12000 rpm. -1 Centrifuge for 15 min; take 700 µL of the supernatant, add an equal volume of phenol, chloroform, and isoamyl alcohol (25:24:1), gently vortex to mix, and centrifuge at 12000 r·min. -1 Centrifuge for 9 min; take 500 µL of the supernatant, add an equal volume of chloroform, and extract again at 12000 r·min. -1 Centrifuge for 5 min; take 350 µL of the supernatant and add 1 / 10 volume of 3 mol·L⁻¹ -1 NaAc was reacted with 2 volumes of anhydrous ethanol and precipitated at -20°C for 30 min at 12000 r·min. -1 Centrifuge for 5 min; discard the supernatant, add 700 µL of ice-cold 70% ethanol for washing (centrifuge briefly; discard the supernatant), air dry on a clean bench until there is no alcohol odor, add 30~60 µL of TE (10 mmol / L Tris-HCl, 0.1 mmol / L EDTA, pH 8.0) solution to dissolve, and obtain DNA solution. Detect the DNA concentration with a UV spectrophotometer and dilute to 100 ng / µL for later use.

[0069] When detecting the presence of maize leaf spot pathogen in diseased plant tissues, DNA was extracted using the NaOH rapid lysis method. The specific procedure is as follows: 10 µL of 0.5 mol / L NaOH was added to each milligram of plant tissue. The tissue was thoroughly ground into a paste in a mortar and transferred to a 1.5 mL centrifuge tube. The mixture was centrifuged at 12,000 rpm for 6 min. 5 µL of the supernatant was taken and 495 µL of 0.1 mol / L Tris-HCl (pH=8.0) was added and mixed thoroughly. 1.0 µL of this mixture was used as a PCR template for amplification.

[0070] This invention uses the genomic DNA as a template and performs LAMP amplification using the outer and inner primer pairs in the LAMP-LFD primer-probe combination described in the above technical solution to obtain amplification products. In this invention, the preferred LAMP amplification system is as follows: 1.0 μL of 5 μM external upstream primer F3, 1.0 μL of 5 μM external downstream primer B3, 1.0 μL of 40 μM internal downstream primer FIP, 1.0 μL of 40 μM internal downstream primer BIP, 12.5 μL of LAMP reaction mixture, 1.0 μL of 8 U Bst polymerase, 1.0 μL of genomic DNA, and brings the volume to 25 μL with sterile ultrapure water. In this invention, the LAMP reaction mixture preferably comprises: 40 mM Tris-HCl, 20 mM (NH4)2SO4, 20 mM KCl, 16 mM MgSO4, 1.6 mol / L betaine, 2.0 mM dNTPs, and 0.2 wt.% Trion X-100. In this invention, the preferred conditions for LAMP amplification are: incubation at 63°C for 60 min.

[0071] In this invention, the amplification product is mixed with probe ET-HP from the LAMP-LFD primer-probe combination described in the above technical solution to obtain a hybridization solution; the hybridization solution is then subjected to a hybridization reaction to obtain a hybridization solution. In this invention, the probe ET-HP is mixed in the form of a probe ET-HP solution, and the concentration of probe ET-HP in the probe ET-HP solution is 20 pmol; the volume ratio of the probe ET-HP solution to the amplification product is 4:5. In this invention, the hybridization reaction conditions preferably include hybridization at 63.5°C for 5 min.

[0072] In this invention, the volume ratio of the hybridization solution to the buffer solution is preferably 1:9. In this invention, the buffer solution is preferably HybriDetect Assay Buffer. In this invention, the immersion time in the mixture is preferably 5 minutes.

[0073] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0074] Example 1

[0075] Design of specific primers and probes for LAMP-LFD detection of Exserohilum turcicum, the maize leaf spot pathogen.

[0076] The beta-tubulin (TUB2) gene sequence of *Exserohilum turcicum* and other closely related species of maize was determined, and the sequences were compared and analyzed using the online LAMP primer design software Primer Explorer V5. https: / / primerexplorer.jp / lampv5 / index.html Eiken Chemical Co., Japan designed a LAMP primer set specific to *Exserohilum turcicum*, consisting of primers F3, B3, FIP, and BIP. FIP is composed of F2 and F1c, and BIP is composed of B2 and B1c. Simultaneously, a probe, ET-HP, specifically hybridizing with the LAMP product was designed using Primer Premier 6.0 software for LFD detection. The specific sites and sequences of the primers and probe are detailed in Table 1. Figure 1 The primer FIP was biotin-labeled at the 5' end, and the probe HP was 6-carboxyfluorescein (6-FAM)-labeled at the 5' end. The primers and probe were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0077] Table 1 Primer and probe sequences used for LAMP-LFD detection of Exserohilum turcicum, the causal agent of maize leaf spot.

[0078] Primer / Probe Length (bp) Sequence (5'~3') Purpose F3 20 CCGTCTCCACTTCTTCATGG LAMP B3 20 GTCCTCAACCTCCTTCATGG LAMP FIP 40 Biotin- GTGAGCTCGGGGACGGTAACATTTGCTCCTCTTACCAGCC LAMP BIP 39 6-FAM- CCAGCAGATGTTCGACCCCAATAGGCAGAGCAGGTCAGG LAMP ET-HP 20 GATGGCTGCTTCTGACTTCC LAMP-LFD

[0079] Example 2

[0080] Establishment of LAMP-LFD detection method for Exserohilum turcicum, the causal agent of maize leaf spot.

[0081] LAMP amplification conditions optimization: Genomic DNA of the tested strain of *Cephalotaxus fortunei* was extracted using conventional nucleic acid extraction methods or commercial kits (such as the Plant Genomic DNA Extraction Kit from Tiangen Biotech) as a template for LAMP amplification. The LAMP reaction system was prepared in a sterile 200 μL Eppendorf tube. The final concentrations of various reagents in the 25 μL reaction system were as follows: 0.2 μmol / L each of outer primers F3 and B3, 1.6 μmol / L each of inner primers FIP and BIP, 0.96 mmol / L dNTPs, 20 mmol / L Tris-HCl (pH 8.8), 10 mmol / L KCl, 1 mmol / L MgSO4, 10 mmol / L (NH4)2SO4, 0.1% Triton X-100, 8 U Best DNA polymerase fragment, and 1 μL of sample template. Double-distilled water was added to bring the total reaction volume to 25 μL.

[0082] To obtain a reaction system with optimal amplification efficiency and detection specificity, the reaction temperature and amplification time of LAMP amplification were optimized. First, the LAMP amplification reaction temperature was optimized, as excessively high or low temperatures are detrimental to the LAMP reaction. 25 μL of the prepared reaction system was placed at different temperatures (61.5℃, 62.0℃, 62.5℃, 63.0℃, 63.5℃, 64.0℃, 64.5℃, 65.0℃, and 65.5℃) for 60 min to evaluate the effect of different temperatures on the LAMP reaction and screen out the optimal reaction temperature. After determining the optimal reaction temperature, the LAMP reaction system was placed at the optimal reaction temperature (63.0℃) for 5 min, 15 min, 25 min, 35 min, 45 min, 55 min, and 65 min to optimize the optimal reaction time. The optimal reaction conditions (temperature and time) were finally optimized through multiple repeated experiments.

[0083] LAMP amplification product detection: Three methods were used to detect LAMP amplification results: visual observation with color development, 2% agarose gel electrophoresis, and horizontal flow detection (LFD) strips. Visual observation with color development: SYBR Green I nucleic acid dye was added to the LAMP amplification product. If the amplification product turned yellow-green, the result was positive; if it turned orange-yellow, the result was negative. Alternatively, the LAMP amplification product was observed under a 263 nm UV lamp. If a turbid white precipitate appeared, the result was positive; if it was clear and colorless, the result was negative. Agarose gel electrophoresis: 5.0 μL of LAMP amplification product was subjected to 2% agarose gel electrophoresis. If ladder-like bands appeared in the gel, the result was positive; if no ladder-like bands appeared, the result was negative. LFD test strip detection method: After LAMP amplification, without stopping the reaction, add 25 μL of 20 pmol HP probe to the reaction solution and incubate at 63.0 ℃ for 5 min. Mix 10 μL of hybridization solution with 90 μL of buffer, immerse the LFD test strip (Milenia Biotec, Germany) in the mixture, and observe whether the test band develops color to determine the LAMP amplification result. If both the control band and the test band develop color, the result is positive. If the control band develops color but the test band does not, the result is negative. If no band appears at either the control line or the test line, the result is invalid.

[0084] Establishment of the LAMP-LFD detection method: Optimization results of the LAMP reaction temperature showed that the electrophoretic bands and the detection line on the test strip were brightest at 63.0℃, indicating that the optimal reaction temperature for LAMP-LFD was 63.0℃. Figure 2 );

[0085] Analysis of results from different reaction times at the optimal reaction temperature showed that the optimized LAMP-LFD method for treating maize leaf spot pathogens exhibited (…). Figure 3 Positive reactions were observed in LAMP amplification reactions from 45 min to 105 min. The DNA electrophoresis bands and LFD test strip detection lines were most obvious at 60 min, 70 min, and 80 min. Considering that the shorter the detection time, the better, 60 min was selected as the optimal reaction time.

[0086] Based on the optimized reaction temperature and time, the final LAMP-LFD detection system for maize large leaf spot pathogen was determined to be 25 μL, containing 12.5 μL of 2× reaction buffer (RM), 1.0 μL each of 0.2 μM outer primers (F3, B3) and 1.6 μM inner primers (FIP, BIP), and 8 U. μL of Bst DNA polymerase. −11.0 μL of nucleic acid fluorescent dye, 1.0 μL of genomic DNA template, and ddH2O were added to a final volume of 25 μL. The reaction conditions were 63.0 °C for 60 min. Figure 4 ).

[0087] Example 3

[0088] Specificity validation of the LAMP-LFD detection method for Exserohilum turcicum, the maize leaf spot pathogen.

[0089] 1. Extraction of genomic DNA from the tested strain

[0090] The tested bacterial strains (Bipolaris maydis, B. zeicola, B. oryzae, B. zeae, B. sorokinina, Exserohilum turcicum, Curvulariaeragrostidis, Alternaria tenuissima, Fusarium verticillioides, F. graminearum, F. proliferatum, Rhizoctonia solani, Cercospora zeae-maydis, Pythium arrhenomanes, P. ultimum, and Colletotrichum) were extracted using the CTAB method. Genomic DNA of *Truncatum* was extracted using the following method: A small amount of mycelial powder was placed in a 1.5 mL centrifuge tube (the powder should just cover the bottom of the tube). 900 µL of 2% CTAB (hexadecyltrimethylammonium bromide) extraction buffer (2% CTAB; 100 mmol / L Tris-HCl, pH 8.0; 20 mmol / L EDTA, pH 8.0; 1.4 mol / L NaCl) and 90 µL of SDS (sodium dodecylbenzenesulfonate) [Note: CTAB and SDS need to be preheated to 60°C]. The mixture was shaken to mix thoroughly and incubated in a 60°C water bath for 1 hour (to release the DNA into the buffer). The temperature was 12000 rpm. -1 Centrifuge for 15 min; take 700 µL of the supernatant, add an equal volume of phenol, chloroform, and isoamyl alcohol (25:24:1), gently vortex to mix, and centrifuge at 12000 r·min. -1Centrifuge for 9 min; take 500 µL of the supernatant, add an equal volume of chloroform, and extract again at 12000 r·min. -1 Centrifuge for 5 min; take 350 µL of the supernatant and add 1 / 10 volume of 3 mol·L⁻¹ -1 NaAc was reacted with 2 volumes of anhydrous ethanol and precipitated at -20°C for 30 min at 12000 r·min. -1 Centrifuge for 5 min; discard the supernatant, add 700 µL of ice-cold 70% ethanol for washing (centrifuge briefly; discard the supernatant), air dry on a clean bench until there is no alcohol odor, add 30~60 µL of TE (10 mmol / L Tris-HCl, 0.1 mmol / L EDTA, pH 8.0) solution to dissolve, and obtain DNA solution. Detect the DNA concentration with a UV spectrophotometer and dilute to 100 ng / µL for later use.

[0091] 2. Specificity determination of LAMP-LFD detection: The genomic DNA of the tested strains was amplified using the established LAMP-LFD detection system to evaluate its specificity. Genomic DNA of *Heliotropium indicum* was used as a positive control, and sterile double-distilled water was used as a negative control. The amplified products were detected using direct visual observation, 2% agarose gel electrophoresis, and LFD test strips, as described in Example 2.

[0092] 3. Specificity verification results:

[0093] Genomic DNA was extracted from the test strains listed in Table 2 and used for specific detection using the established LAMP-LFD method. LAMP-LFD detection results ( Figure 5 The results showed that only *Cephalotaxus fortunei* tested positive, while the other tested strains tested negative. This indicates that the established *Cephalotaxus fortunei* LAMP-LFD can distinguish FOC4 physiological race from other pathogens, demonstrating specificity and making it suitable for rapid and reliable detection and identification of *Cephalotaxus fortunei*.

[0094] Example 4

[0095] Sensitivity determination of LAMP-LFD detection for Exserohilum turcicum, the causal agent of maize leaf spot.

[0096] 1. Preparation of genomic DNA at different concentrations

[0097] The genomic DNA of corn leaf blight pathogen was diluted with sterile ultrapure water to prepare a series of concentrations on a 10-fold scale for later use.

[0098] 2. Sensitivity determination and result observation of LAMP detection method

[0099] Using genomic DNA of different concentrations of *Cephalotaxus fortunei* as templates, LAMP amplification was performed using primers F3 / B3 and FIP / BIP. The LAMP reaction system consisted of 25 μL, including 1.0 μL each of 5 μM primers F3 and B3, 1.0 μL each of 40 μM primers FIP and BIP, 12.5 μL of LAMP reaction mixture [40 mM Tris-HCl, 20 mM (NH4)2SO4, 20 mM KCl, 16 mM MgSO4, 1.6 mol / L betaine, 2.0 mM dNTPs, 0.2% Trion X-100], 1.0 μL of 8 U Bst polymerase, and 1.0 μL of DNA templates of different concentrations. The volume was then brought to 25 μL with sterile ultrapure water. The LAMP reaction conditions were: incubation at 63℃ for 60 min. The amplified products were detected by direct visual observation, 2% agarose gel electrophoresis, and LFD test strip method.

[0100] 3. LAMP amplification sensitivity detection results

[0101] Using genomic DNA of *Heliotropium indicum* at different concentrations as templates, the established LAMP-LFD detection system was used for sensitivity testing. The amplified products were detected using direct visual observation, 2% agarose gel electrophoresis, and LFD test strips, as described in Example 2.

[0102] The results of sensitivity detection of genomic DNA concentration showed that ( Figure 6 ), 100pg, 10 pg, 1 pg, 100 fg, fg.μL -1 and 10 fg.μL -1 All concentrations of *Maize leaf spot pathogen* genomic DNA were positive, while other concentrations and the negative control were negative, indicating that the detection sensitivity of the established LAMP-LFD is 10 fg / μL. -1 .

[0103] Example 5

[0104] Leaf bacterial testing

[0105] 1. Preparation of infected leaves: Prepare a suspension of conidia of the maize leaf spot pathogen (10... 6 .mL -1 Mix with ground corn leaf tissue, so that the leaf tissue carries 10 spores. 5 .g -1 .

[0106] 2. Genomic DNA from infected leaf tissue: Total DNA was extracted from the sample according to the instructions of the genomic DNA extraction kit from Tiangen Company. The DNA from the infected leaf tissue was used as a template for LAMP-LFD amplification and detection.

[0107] 3. Leaf-borne pathogen LAMP-LFD detection results: 1.0 μL of extracted leaf genomic DNA was used as a template for LAMP-LFD amplification and detection. The LAMP-LFD amplification system was as described in Example 2, with maize leaf spot pathogen genomic DNA as a positive control and sterile double-distilled water as a negative control. The leaf-borne pathogen LAMP-LFD detection results showed that all simulated infected leaves were positive, while unaffected healthy leaves were negative. Figure 7 This indicates that the LAMP-LFD detection system established in this study can provide a simple, rapid, and sensitive on-site detection method for maize leaf spot pathogens.

[0108] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A LAMP-LFD primer-probe combination for detecting maize leaf spot pathogen, characterized in that, It includes an external primer pair, an internal primer pair, and a probe ET-HP. The external primer pair consists of an external upstream primer F3 and an external downstream primer B3, and the internal primers consist of an internal upstream primer FIP and an internal downstream primer BIP. The nucleotide sequence of the external upstream primer F3 is shown in SEQ ID No. 1; The nucleotide sequence of the external downstream primer B3 is shown in SEQ ID No. 2; The nucleotide sequence of the internal upstream primer FIP is shown in SEQ ID No. 3; The nucleotide sequence of the external downstream primer BIP is shown in SEQ ID No. 4; The nucleotide sequence of the probe ET-HP is shown in SEQ ID No.

5.

2. The LAMP-LFD primer-probe combination according to claim 1, characterized in that, The 5' end of the internal upstream primer FIP is labeled with biotin, and the 5' end of the probe ET-HP is labeled with 6-carboxyfluorescein.

3. A kit for detecting maize leaf spot pathogen, characterized in that, Includes the LAMP-LFD primer-probe combination as described in claim 1 or 2.

4. The use of the LAMP-LFD primer-probe combination according to any one of claims 1 to 2 or the kit according to claim 3 in the detection of maize leaf spot pathogen.

5. A method for detecting maize leaf spot pathogen, characterized in that, Includes the following steps: 1) Extract genomic DNA from the sample to be tested; 2) Using the genomic DNA described in step 1) as a template, LAMP amplification is performed using the outer primer pair and the inner primer pair in the LAMP-LFD primer-probe combination described in claim 1 or 2 to obtain the amplification product; 3) Mix the amplification product described in step 2) with probe ET-HP from the LAMP-LFD primer-probe combination described in claim 1 or 2 to obtain the hybridization solution; The solution to be hybridized is subjected to a hybridization reaction to obtain a hybridization solution; 4) Mix the hybridization solution described in step 3) with the buffer solution to obtain a mixture. Immerse the detection end of the LFD test strip vertically into the mixture. When a purple-red band appears simultaneously in the control area and the detection area, the sample to be tested contains corn leaf blight.

6. The method according to claim 5, characterized in that, Step 2) The LAMP amplification system is as follows: 1.0 μL of 5 μM external upstream primer F3, 1.0 μL of 5 μM external downstream primer B3, 1.0 μL of 40 μM internal downstream primer FIP, 1.0 μL of 40 μM internal downstream primer BIP, 12.5 μL of LAMP reaction mixture, and 8 U... Bst Polymerase 1.0 μL, genomic DNA 1.0 μL, and sterile ultrapure water to make up to 25 μL; The LAMP reaction mixture comprises: 40 mM Tris-HCl, 20 mM (NH4)2SO4, 20 mM KCl, 16 mM MgSO4, 1.6 mol / L betaine, 2.0 mM dNTPs, and 0.2 wt.% Trion X-100.

7. The method according to claim 5, characterized in that, Step 2) The conditions for LAMP amplification are: incubation at 63°C for 60 min.

8. The method according to claim 5, characterized in that, Step 3) The probe ET-HP is mixed in the form of a probe ET-HP solution, wherein the concentration of probe ET-HP in the probe ET-HP solution is 20 pmol; The volume ratio of the probe ET-HP solution to the amplification product is 4:5; The conditions for the hybridization reaction include hybridization at 63.5°C for 5 minutes.

9. The method according to claim 5, characterized in that, Step 4) The volume ratio of the hybridization solution to the buffer solution is 1:9; The buffer solution is HybriDetect Assay Buffer.

10. The method according to claim 5, characterized in that, Step 4) The immersion time in the mixture is 5 minutes.

Images