A kasp molecular marker related to the internode length of cucurbita pepo, primer combination and use
Patent Information
- Application Number
- CN202611547769.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-10-08
- Publication Date
- 2026-11-03
AI Technical Summary
Existing technologies are insufficient for effectively screening and improving the internode length of American squash, resulting in high cultivation costs, management difficulties, and low light utilization efficiency, which affect yield and quality.
A KASP-based SNP marker was developed to detect the SNP site at 353905 bp on chromosome 10 of pumpkin. Primer combinations were designed for PCR amplification, and the genotype was determined by fluorescence signal to identify intersegmental length.
This technology enables early screening of internode length traits in pumpkins, simplifies the breeding process, improves breeding efficiency, allows for targeted selection and improvement of internode length, and enhances pumpkin yield and management efficiency.
Smart Images
Figure CN123027367A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker development and molecular marker-assisted breeding technology, and particularly relates to a KASP molecular marker, primer combination and application related to internode length in pumpkin. Background Technology
[0002] Plant architecture is a key factor affecting yield, and achieving simplified cultivation of squash is one of the breeding goals. Internodes, as a component of plant architecture, directly participate in plant height formation and have always been a focus of research in compact plant architecture breeding. An ideal plant architecture can increase crop planting density, improve land use efficiency, enhance lodging resistance, thereby increasing yield and profits (Hedden 2003; Wang et al., 2022). Many factors contribute to plant dwarfing phenotypes, mainly including hormone-related, light signal transduction-related, cell wall synthesis-related, and transcription factor-related factors (Liu et al., 2021; Zhu et al., 2022). Among these, hormone-related dwarfing has been the most studied in cucurbit crops. Gibberellin (GA) biosynthesis involves the synergistic action of multiple enzymes; mutations in the genes of these enzymes can lead to inhibited gibberellin synthesis, thus causing plant dwarfing. Dong et al. used BSA-seq to identify a watermelon in natural materials... dsh The short-vine gene is located on chromosome 7, and its candidate gene is speculated to encode a GA20-oxidase-like protein (Dong et al., 2018). Jang et al. in Cla015407 Another short-vine watermelon gene was located nearby. Cla015405 It encodes a gibberellin 2β-dioxygenase (GA2ox) (Jang et al., 2020). Brassinosteroids (BRs), as important plant hormones regulating plant growth and development, also participate in regulating dwarfing in cucurbit crops. Cucumber dwarf mutants... si It is by CsVFB1 Premature termination leads to truncation of the F-Box protein, including mutations induced by EMS. scp-1 and SCP-2 These are all important genes in the brassinolide synthesis pathway. Progress has also been made in research on auxin's role in regulating plant architecture in cucurbit crops. Watermelon. Cldw-1 candidate genes Cla010337 Encodes an ABCB transporter protein that affects plant height by regulating auxin transport (Zhu et al., 2019).
[0003] American squash ( Cucurbita pepoZucchini (L.), also known as creeping zucchini, is an important horticultural vegetable crop. Its long internodes and vine-like growth habit require a large area, making pruning tedious, time-consuming, labor-intensive, and costly. With the development of the pumpkin industry and the improvement of facilities, most regions in China now cultivate pumpkins in greenhouses or simple sheds, often using the trellising method. The vines can reach up to 2 meters in length, which has disadvantages such as being difficult to manage and not fully utilizing sunlight. This severely affects ventilation and light penetration within the cultivation group, hindering not only leaf photosynthesis but also making it susceptible to pumpkin diseases, thus impacting yield and quality.
[0004] Therefore, further research is needed to locate the genes for the short internode and short vine traits of pumpkin, and to develop usable molecular markers to provide a scientific basis for molecular design breeding of internode length in pumpkin. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a KASP molecular marker for the internode length trait of pumpkin and its application, which addresses the shortcomings of the prior art. The KASP molecular marker CpIN (Internode length) is closely linked to the internode length trait of pumpkin and can be used for assisted selection breeding to identify and screen pumpkin materials with different internode lengths and their offspring.
[0006] To address the aforementioned technical problems, this invention provides a novel and simple method for molecular labeling and assisted selection, as detailed below: In a first aspect, the present invention provides a KASP molecular marker related to internode length in pumpkin, wherein the KASP molecular marker is an SNP marker detected based on KASP technology, and the SNP marker is located at 353905 bp on chromosome 10 of pumpkin; the 100 bp sequence before and after the molecular marker site is shown in SEQ ID NO: 1: AGTTTGTTGGAATGAGTAATGACATAGGCTTATTGTACAAGTTATTGTAAGCAAGAAGAAGAGCAACCAAATGTTCACATAGTCTTGAAAGTAAAAGATG G / A GGCCGTTAAGAAAATAGGGCAAAAATAGAATAGTGCCAAAAAAAAAGTATAATAAGTAGGCAAAGGGCAAAGGTAATAATTTAGGCCACTTTGTCTGTGC; The 101st base is an SNP site; the polymorphism of the SNP site is G / A; The A genotype at the SNP locus corresponds to the phenotype of long intersegmental loci, and the G genotype corresponds to the phenotype of short intersegmental loci.
[0007] In a second aspect, the present invention provides a KASP primer combination for detecting the KASP molecular marker of internode length trait in squash, the primer combination comprising forward primer F1, forward primer F2 and reverse primer R, the sequences of which are as follows: Forward primer F1: 5'- GAAGGTGACCAAGTTCATGCTCCCTATTTTCTTAACGGCCC-3' Forward primer F2: 5'-GAAGGTCGGAGTCAACGGATTCCCTATTTTCTTAACGGCCT-3' Reverse primer R: 5'- GAAGAAGAGCAACCAAATGTTCACA-3'.
[0008] A third aspect of the present invention is a kit for identifying internode length in squash, comprising a KASP primer combination for detecting the KASP molecular marker for internode length trait in squash.
[0009] In a fourth aspect of the present invention, there is the use of a KASP molecular marker associated with internode length in pumpkin or a combination of KASP primers for detecting internode length traits in pumpkin, wherein the use is to identify internode length in pumpkin by detecting the genotype of the SNP locus.
[0010] A fifth aspect of the present invention provides a method for developing KASP molecular markers associated with the internode length trait of Cucurbita moschata, comprising the following steps: (1) Using long-internode squash and short-internode squash as parents, a genetic segregation population was constructed. (2) Extract genomic DNA from the parents and hybrid offspring populations; (3) The segregating population analysis method was used to locate the genomic regions associated with the internode length trait of pumpkin; (4) Identify SNP variants and / or InDel insertion / deletion variants that are closely linked to the internode length trait of Cucurbita moschata; (5) Based on the variants identified in step (4), molecular markers were screened using the KASP method, and KASP molecular markers closely linked to the internode length trait of pumpkin were developed.
[0011] A sixth aspect of the present invention also provides a method for determining the internode length of pumpkin, comprising the following steps: (1) Extract genomic DNA from the pumpkin sample to be tested; (2) The genomic DNA obtained in step (1) was amplified by PCR using the primer combination described above; (3) Detect the fluorescence signal of the PCR amplification result, and determine the SNP genotype of the sample to be tested as GG, AA or GA based on the fluorescence signal type; (4) Based on the correspondence between the genotype and the phenotype, determine the internode length type of the American pumpkin to be tested: GG genotype is short internode, AA genotype is long internode, and GA genotype is intermediate type.
[0012] Furthermore, step (3) specifically includes: If the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the forward primer F1, then the tested American pumpkin is homozygous GG genotype. If the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the forward primer F2, then the pumpkin to be tested is homozygous AA genotype. If the fluorescence signal color of the PCR amplification result is different from the fluorescence adapter color of both forward primer F1 and forward primer F2, then it is a heterozygous G / A genotype.
[0013] Specifically, the homozygous GG genotype has a short intersegmental phenotype; Homozygous AA genotype, phenotype of long intersegments; Heterozygous G / A genotype, with an intermediate phenotype.
[0014] Specifically, the PCR amplification reaction system was as follows: 5.0 μl of 20-50 ng / μl pumpkin genomic DNA, 5.0 μl of KASPMaster Mix, and 0.14 μl of KASP Assay Mix. The volume ratio of F1, F2, and R in the KASP Assay Mix was 2:2:5. The concentration of all three primers was 10 ng / μl, and the total volume was 10.14 μl. The PCR reaction program was as follows: 30℃ for 1 minute, then read the fluorescence signal; 94℃ for 15 minutes of pre-denaturation; 94℃ for 20 seconds of denaturation; annealing temperature starting from 61℃, decreasing by 0.6℃ per cycle, annealing for 60 seconds, for 10 cycles; 94℃ for 20 seconds of denaturation; 55℃ for 60 seconds of annealing, for 35 cycles; 30℃ for 1 minute, then read the fluorescence signal.
[0015] The beneficial effects of this invention are as follows: This invention designs and develops a KASP molecular marker closely linked to the internode length trait of pumpkin (Cucumis melo var. rubrum), which can be used for preliminary screening of early (seed) internode length varieties of pumpkin (Cucumis melo var. rubrum) to achieve the purpose of molecular marker-assisted breeding. In addition, by crossing short-internode material pe9 and long-internode material pe14, followed by self-pollination, and combining molecular marker-assisted selection, individual plants with suitable internode lengths in the segregating population can be selected for breeding improvement. This allows for targeted selection and improvement of internode length in pumpkin (Cucumis melo var. rubrum), accelerating the molecular breeding process for the target trait of internode length. Attached Figure Description
[0016] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0017] Figure 1 This is a schematic diagram of the chromosome location of genes regulating internode length in squash based on BSA. Figure 2 This is a typing diagram of the CpIN molecular markers of the parental materials pe9 and pe14 and their F1 generation; Figure 3 This is a genotyping diagram of CpIN molecular markers in the F2 generation of hybrid populations of pumpkin materials with different internode lengths; Figure 4 This is a statistical distribution chart of internode length in the F2 segregating population of different genotypes of Pumpkin davidiana. Detailed Implementation
[0018] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto.
[0019] Example 1: QTL mapping of the main effect of internode length trait in Cucurbita moschata Parental materials were selected from laboratory squash germplasm resources: pe14 is a long-internode type squash material (Connecticut field squash), with an average internode length (10th-25th internodes) of 13.86 cm during the reproductive growth period; PE9 is a short-internode type American squash material (WEE miniature squash, also known as: miniature toy squash), with an average internode length (10-25th internodes) of 2.63 cm during the reproductive growth period.
[0020] By self-pollinating the above-mentioned parental hybrids, a genetic segregating population F2 was constructed to obtain individual plants with different internode lengths.
[0021] Genomic DNA was extracted from the leaves of seedlings of the parental pumpkin (Cucumis melo var. pekinensis) and from the F2 population of hybrid offspring using the CTAB (hexadecyl trimethyl ammonium bromide) method. Extreme phenotypic materials from the progeny were selected to construct BSA pools for genome resequencing. Association analysis was performed using the ΔAll-index method, selecting 95% confidence intervals, such as... Figure 1 As shown, it was located in the region 244400-660777 on chromosome 10.
[0022] Example 2: Development of KASP molecular markers for internode length trait in Cucurbita moschata Based on the gene mapping results of Example 1, SNPs and InDels of the parental materials (i.e., pe9 and pe14) in the chromosome 10 region were extracted and analyzed, and related molecular markers were developed using KASP technology for fine mapping.
[0023] After molecular marker screening, the KASP molecular marker CpIN, which is closely linked to the internode length trait of pumpkin, was finally obtained. This molecular marker is an SNP marker, located at 353905 bp on chromosome 10 of pumpkin (reference genome: CuGenDBv2(cucurbitgenomics.org)). The 100 bp sequence before and after the molecular marker site is as follows: AGTTTGTTGGAATGAGTAATGACATAGGCTTATTGTACAAGTTATTGTAAGCAAGAAGAAGAGCAACCAAATGTTCACATAGTCTTGAAAGTAAAAGATG G / A GGCCGTTAAGAAAATAGGGCAAAAATAGAATAGTGCCAAAAAAAAAGTATAATAAGTAGGCAAAGGGCAAAGGTAATAATTTAGGCCACTTTGTCTGTGC (SEQ ID NO: 1); where the underscore corresponds to G / A It is an SNP site with a polymorphism of G / A. The phenotype corresponding to the A genotype is long intersegmentation, and the phenotype corresponding to the G genotype is short intersegmentation.
[0024] The primer combination sequence designed based on molecular markers is as follows: Forward primer F1: 5'- GAAGGTGACCAAGTTCATGCTCCCTATTTTCTTAACGGCCC-3' Forward primer F2: 5'-GAAGGTCGGAGTCAACGGATTCCCTATTTTCTTAACGGCCT-3' Reverse primer R: 5'- GAAGAAGAGCAACCAAATGTTCACA-3'.
[0025] Each of the forward primers F1 and F2 has its own fluorescent adapter (displayed as different colors on the genotyping map; in this example, the AA genotype is red and the GG genotype is blue). If the material being tested is homozygous, only one corresponding primer will be selected for amplification; for example, the homozygous AA genotype can only react with F2, and the homozygous GG genotype can only react with F1. Finally, the fluorescence difference is used to distinguish whether the tested material is homozygous AA or GG. If the material being tested is heterozygous, both primers will amplify, producing a different fluorescence signal than the homozygous material, thus achieving heterozygous genotype differentiation.
[0026] Specifically: The forward primer corresponding to the AA genotype is GAAGGTCGGAGTCAACGGATTCCCTATTTTCTTAACGGCCT, therefore it is in red; The forward primer corresponding to the GG genotype is GAAGGTGACCAAGTTCATGCTCCCTATTTTCTTAACGGCCC, therefore it is blue; When the tested American squash shows the same color (red) as pe14, it indicates that it is of the AA genotype; When the tested American pumpkin shows the same color (blue) as pe9, it indicates that it is of the GG genotype; When the tested American pumpkin turns green, it indicates that it has the G / A genotype.
[0027] Example 3: Validation of KASP molecular markers for internode length trait in squash parents and F1 populations of squash. I. DNA Extraction Genomic DNA was extracted from seedlings of American squash parental materials and F1 hybrid offspring seedlings using the CTAB (hexadecyl trimethyl ammonium bromide) method.
[0028] II. PCR Amplification PCR amplification was performed directly on an ABI Step One PCR instrument (the core amplicon length after removing the FAM / HEX adapter sequence was 66 bp in primer design; the full-length amplicon including the adapter sequence was 87 bp). The PCR reaction system was as follows: 20-50 ng / μl of pumpkin genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix (F1:F2:R = 2:2:5 volume ratio; the primer concentrations for all three types designed in Example 2 were 10 ng / μl), for a total volume of 10.14 μl. The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle), annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, 60 seconds (annealing), 35 cycles. 30℃, 1 minute (read fluorescence signal).
[0029] The instrument can directly obtain genotyping information after detecting fluorescence signals, and the results are as follows: Figure 2 As shown, the genotype of pe14 is AA, which is expressed in red; the genotype of pe9 is GG, which is expressed in blue; and the genotype of F1 is G / A, which is expressed in green.
[0030] This molecular marker clearly differentiates parental materials with different internode lengths, and genotypes can be determined based on differences in fluorescence signals. The long-internode squash material pe14 exhibits a homozygous AA genotype, represented in red in the figure; the short-internode squash material pe9 exhibits a homozygous GG genotype, represented in blue; and the F1 generation from the cross between pe14 and pe9 shows a heterozygous G / A genotype, represented in green. This demonstrates that the KASP molecular marker CpIN can be used for genotyping of the long-internode squash material pe14 and the short-internode squash material pe9, as well as their offspring.
[0031] Example 4: Validation of the KASP molecular marker for internode length trait in the offspring F2 segregating population of Cucurbita moschata F2 is obtained by self-crossing of F1 generation.
[0032] I. DNA Extraction Genomic DNA was extracted from seedlings of American squash parental materials and seedlings of the self-pollinated F2 population after hybridization using the CTAB (hexadecyl trimethyl ammonium bromide) method.
[0033] II. PCR Amplification PCR amplification was performed directly on the IntelliQube high-throughput genotyping platform. The PCR reaction system was as follows: 0.8 μl of 10-50 ng / μl pumpkin genomic DNA, 0.8 μl of KASP Master Mix, and 0.02 μl of KASP Assay Mix (F1:F2:R = 2:2:5 volume ratio, and the primer concentrations designed in all three examples 2 were 10 ng / μl), for a total volume of 1.62 μl. The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle), annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, 60 seconds (annealing), 35 cycles. 30℃, 1 minute (read fluorescence signal).
[0034] The instrument can directly obtain genotyping information after detecting fluorescence signals, and the results are as follows: Figure 3 As shown in the partial illustration, red indicates the AA genotype consistent with the long-internode material pe14; blue indicates the GG genotype consistent with the short-internode material pe9; and green indicates the G / A genotype consistent with F1. Genotyping was performed in the segregating F2 population using CpIN molecular markers, and all F2 plants were fully genotyped. Based on fluorescence signals, the genotypes of F2 plants were determined as follows: those with red corresponding to the long-internode parent pe14 had the genotype AA; those with blue corresponding to the short-internode parent pe9 had the genotype GG; and those with green corresponding to the F1 generation had the genotype G / A. It should be noted that the F2 population consisted of 214 plants: 53 AA plants, 62 GG plants, and 99 G / A plants. Figure 3 This is a partial result display.
[0035] according to Figure 4 As shown, analysis of the internode length phenotype of F2 plants revealed that during reproductive growth, the internode length of AA genotype plants in the F2 segregating population was significantly longer than that of GG genotype plants. This indicates that the KASP molecular marker CpIN is closely linked to the internode length trait of Cucurbita moschata and can be used for genotyping of Cucurbita moschata materials with different internode lengths.
[0036] In addition, in practical applications, the above primer combinations can be packaged together with conventional PCR reaction reagents (such as KASP MasterMix, purified water, etc.) to form a kit for rapid identification of intersegment length.
[0037] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.
Claims
1. A KASP molecular marker associated with internode length in pumpkin, characterized in that: The KASP molecular marker is a SNP marker detected based on KASP technology, and the SNP marker is located at 353905 bp on chromosome 10 of pumpkin. The 100 bp sequence before and after the molecular marker site is shown in SEQ ID NO:
1. AGTTTGTTGGAATGAGTAATGACATAGGCTTATTGTACAAGTTATTGTAAGCAAGAAGAAGAGCAACCAAATGTTCACATAGTCTTGAAAGTAAAAGATG G / A GGCCGTTAAGAAAATAGGGCAAAAATAGAATAGTGCCAAAAAAAAAGTATAATAAGTAGGCAAAGGGCAAAGGTAATAATTTAGGCCACTTTGTCTGTGC; The 101st base is an SNP site; the polymorphism of the SNP site is G / A; The A genotype at the SNP locus corresponds to the phenotype of long intersegmental loci, and the G genotype corresponds to the phenotype of short intersegmental loci.
2. A KASP primer combinatorial based on the KASP molecular marker for detecting the internode length trait of pumpkin, characterized in that: The primer combination includes forward primer F1, forward primer F2, and reverse primer R, with the following sequence: Forward primer F1: 5'- GAAGGTGACCAAGTTCATGCTCCCTATTTTCTTAACGGCCC-3' Forward primer F2: 5'-GAAGGTCGGAGTCAACGGATTCCCTATTTTCTTAACGGCCT-3' Reverse primer R: 5'- GAAGAAGAGCAACCAAATGTTCACA-3'.
3. A kit for identifying the internode length of pumpkin, characterized in that: Includes the KASP primer combination as described in claim 2.
4. The use of the KASP molecular marker as described in claim 1 or the primer combination as described in claim 2 in detecting the internode length trait of Cucurbita moschata, characterized in that: The purpose is to identify the internode length of pumpkin by detecting the genotype of the SNP locus.
5. A method for developing KASP molecular markers related to the internode length trait of Cucurbita moschata, characterized in that: Includes the following steps: (1) Using long-internode squash and short-internode squash as parents, a genetic segregation population was constructed. (2) Extract genomic DNA from the parents and hybrid offspring populations; (3) The segregating population analysis method was used to locate the genomic regions associated with the internode length trait of pumpkin; (4) Identify SNP variants and / or InDel insertion / deletion variants that are closely linked to the internode length trait of Cucurbita moschata; (5) Based on the variants identified in step (4), molecular markers were screened using the KASP method, and KASP molecular markers closely linked to the internode length trait of pumpkin were developed.
6. A method for determining the internode length of pumpkin (Cucurbita moschata), characterized in that: Includes the following steps: (1) Extract genomic DNA from the pumpkin sample to be tested; (2) PCR amplification of the genomic DNA obtained in step (1) using the primer combination described in claim 2; (3) Detect the fluorescence signal of the PCR amplification result, and determine the SNP genotype of the sample to be tested as GG, AA or GA based on the fluorescence signal type; (4) Based on the correspondence between the genotype and the phenotype, determine the internode length type of the American pumpkin to be tested: GG genotype is short internode, AA genotype is long internode, and GA genotype is intermediate type.
7. The method according to claim 6, characterized in that: Step (3) specifically involves: If the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the forward primer F1, then the tested American pumpkin is homozygous GG genotype. If the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the forward primer F2, then the pumpkin to be tested is homozygous AA genotype. If the fluorescence signal color of the PCR amplification result is different from the fluorescence adapter color of both forward primer F1 and forward primer F2, then it is a heterozygous G / A genotype.
8. The method according to claim 7, characterized in that: Homozygous GG genotype, with short intersegmental phenotype; Homozygous AA genotype, phenotype of long intersegments; Heterozygous G / A genotype, with an intermediate phenotype.
9. The method according to claim 6, characterized in that: The PCR amplification reaction system was as follows: 5.0 μl of 20-50 ng / μl pumpkin genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix. The volume ratio of F1, F2, and R in the KASP Assay Mix was 2:2:
5. The concentration of the three primers was 10 ng / μl, and the total volume was 10.14 μl. The PCR reaction program was as follows: 30℃ for 1 minute, then read the fluorescence signal; 94℃ for 15 minutes pre-denaturation; 94℃ for 20 seconds denaturation; annealing temperature starting from 61℃, decreasing by 0.6℃ per cycle, annealing for 60 seconds, for 10 cycles; 94℃ for 20 seconds denaturation; 55℃ for 60 seconds annealing, for 35 cycles; 30℃ for 1 minute, then read the fluorescence signal.