Oligonucleotides targeting chmp2b and methods of use thereof

Abstract

The present disclosure provides nucleic acids, compositions, and methods of preventing or treating a neurodegenerative disease in a subject, the methods comprising administering to the subject an agent that targets CHMP2B. In some embodiments, the present disclosure provides a method of preventing or reducing CHMP7 nuclear accumulation in a cell, the method comprising contacting the cell with an agent that targets CHMP2B expression in the cell.

Description

[0001] Cross-reference to related applications This application claims the benefit of priority to U.S. Provisional Application No. 63 / 552,597, filed February 12, 2024, pursuant to 35 USC §119(e). The content of the earlier application is considered part of this application and is hereby incorporated in its entirety by reference.

[0002] Statement regarding government funding This invention was made with the support of the U.S. government under Approval No. HT9425-23-1-0860 granted by the Defense Health Agency, Medical Research and Development Branch, and under a collaboration agreement CA247576 granted by the National Institutes of Health. The U.S. government holds certain rights in this invention.

[0003] By referencing and incorporating into the sequence list The material in the accompanying sequence list is incorporated herein by reference. The attached sequence list XML file, named JHU4730-1WO sequence list ST26.xml, was created on February 5, 2025, and is 31,018 bytes in size. Background of the Invention Invention Field This invention relates generally to neurodegenerative disorders, and more specifically to the treatment of sporadic amyotrophic lateral sclerosis (ALS).

[0004] Background Information Alterations in the composition and function of the neuronal nuclear pore complex (NPC) have been documented in various neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS). Furthermore, recent research has shown that NPC damage can at least partially lead to TDP-43 dysfunction and mislocalization (a pathological feature of ALS and related neurodegenerative diseases). Overall, these studies highlight the role of NPC homeostasis and surveillance disruption as a crucial pathophysiological event in neurodegeneration. The ESCRT-III nuclear surveillance pathway plays a key role in the surveillance and maintenance of the NPC and its surrounding nuclear environment. Importantly, pathological alterations to this pathway and its protein components have been associated with neurodegenerative diseases such as ALS. However, the mechanisms by which this pathway leads to disease-related changes in the NPC remain unknown.

[0005] Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease that affects the survival and function of neurons and glial cells that make up the up-and-down motor circuits in the brain and spinal cord. Approximately 10% of ALS cases are hereditary and are therefore referred to as familial ALS (fALS). The remaining 90% are sporadic (sALS) cases with no known family history. Although mutations in more than 20 genes playing roles in a variety of cellular processes, including RNA metabolism, protein homeostasis, lysosomal transport and autophagy, and cytoskeleton organization, have been associated with both fALS and sALS, the majority of sALS cases have no known genetic cause. Despite the heterogeneity of ALS etiology, 97% of cases show characteristic nuclear depletion of the RNA-binding protein TDP-43 and cytoplasmic mislocalization and aggregation in CNS cell subsets in end-stage disease. Although the genetic and pathological record of ALS is becoming increasingly detailed, the molecular mechanisms leading to these cellular physiological and pathological changes, particularly in sALS, remain poorly understood.

[0006] Multiple studies have documented the role of impaired nucleocytoplasmic compartmentalization as a key contributing factor to the pathophysiology of ALS. Recently, patient-induced pluripotent stem cell (iPSC)-derived neuronal (iPSN) models of sALS and C9orf72ALS / FTD have been used to detail damage to the nuclear pore complex (NPC), which begins with a reduction in the transmembrane nuclear pore protein (Nup) POM121 as an early and important contributing factor to the disease. Given that multiple copies of the NPC and its ~30 individual Nup components collectively and critically control a variety of cellular processes, including nucleoplasmic transport (NCT), gene expression, and genome organization, alterations to NPC homeostasis can have detrimental and widespread effects on neuronal function and survival. Indeed, a collective reduction in eight Nup components has been shown to be sufficient to affect the localization of active nuclear input and NCT mediators, the localization and function of TDP-43, and neuronal survival in sALS and C9orf72 ALS / FTD iPSNs. Therefore, these studies indicate that changes in NPC homeostasis are a key mediator of pathophysiological events in sALS.

[0007] Recent research has established the fundamental role of the ESCRT-III pathway in the surveillance and maintenance of proper NPC assembly, insertion, and function during nuclear membrane resealing and cell division. The ESCRT-III pathway comprises multiple protein components, including CHMP1-7 and the AAA-ATPase VPS4, and plays a broad role in membrane remodeling events occurring during cell division, neuronal pruning, endosome and exosome transport, and multivesicle formation. Furthermore, it has been shown that the ESCRT-III pathway can facilitate the stepwise turnover and replacement of individual nuclei (NPs) within NPCs in non-neuronal cell model systems. Pathological nuclear accumulation of CHMP7 has recently been demonstrated to be sufficient to induce NPC damage and consequently TDP-43 dysfunction in sALS iPSNs, highlighting alterations in the nuclear surveillance function of the ESCRT-III pathway as a contributing factor to neurodegenerative pathophysiology. However, ESCRT-III proteins typically do not function as a single protein unit, and pathway function usually continues after coordinated recruitment and ESCRT protein “activation” (e.g., elimination of autoinhibition) and aggregation. This activation step is achieved via protein-protein interactions and can occur between the ESCRT-III protein itself. Therefore, the molecular mechanisms underlying CHMP7-mediated NPC damage and the involvement of the ESCRT-III protein partner in this process remain unknown. Invention Overview This disclosure is based on a groundbreaking discovery that CHMP2B promotes the pathological accumulation or retention of CHMP7 in the nucleus and triggers a reduction in POM121 in the early stages of the NPC damage cascade, and that inhibiting CHMP2B with antisense oligonucleotides can prevent and restore the loss of TDP-43 function associated with NPC damage in neurons.

[0009] In some embodiments, this disclosure provides an isolated oligonucleotide comprising the nucleic acid sequence of SEQ ID NO: 3-12.

[0010] In some aspects, this disclosure provides compositions comprising one or more of the above-described oligonucleotides.

[0011] In some embodiments, this disclosure provides a method for regulating CHMP2B expression in cells, the method comprising contacting cells with an oligonucleotide comprising a nucleic acid sequence comprising SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof, thereby regulating CHMP2B expression.

[0012] In some respects, regulating CHMP2B expression includes reducing CHMP2B expression in cells compared to CHMP2B expression in cells exposed to control oligonucleotides or in cells not exposed to oligonucleotides.

[0013] In some respects, immunostaining, confocal imaging, nuclear isolation, Western blotting, or combinations thereof are used to measure CHMP2B expression.

[0014] In some embodiments, this disclosure provides a method for reducing or inhibiting the nuclear accumulation of CHMP7 in cells, comprising contacting cells with an agent that targets CHMP2B expression in cells, thereby reducing or inhibiting the nuclear accumulation of CHMP7 in cells.

[0015] In some respects, targeting CHMP2B expression includes reducing CHMP2B expression in cells.

[0016] In some respects, the cells are neurons. In some respects, the neurons exhibit pathological nuclear accumulation of CHMP7 or are at risk of pathological nuclear accumulation of CHMP7. In some respects, the neurons are derived from subjects with amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration.

[0017] In some respects, agents targeting CHMP2B expression are siRNA, ASO, or combinations thereof. In some respects, ASO comprises nucleic acid sequences of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or combinations thereof.

[0018] In some embodiments, this disclosure provides a method for reducing or inhibiting nucleoporin (Nup) turnover in cells, the method comprising contacting cells with an agent targeting CHMP2B expression in the cells, thereby reducing or inhibiting Nup turnover in the cells.

[0019] In some respects, targeting CHMP2B expression includes reducing CHMP2B expression in cells.

[0020] In some respects, reducing CHMP2B in cells includes: reducing or inhibiting the accumulation of CHMP7 nuclei in cells compared to the accumulation of CHMP7 nuclei in cells treated with a control agent or before cells are exposed to an agent targeting CHMP2B.

[0021] In some respects, reducing or inhibiting the nuclear accumulation of CHMP7 in cells includes reducing or inhibiting Nup turnover in cells compared to Nup turnover in cells treated with a control agent or in cells before exposing cells to an agent targeting CHMP2B.

[0022] In some respects, neurons exhibit pathological Nup turnover or are at risk of Nup turnover occurring within the cell.

[0023] In some embodiments, this disclosure provides a method for reducing or inhibiting nuclear pore complex (NPC) damage in cells, the method comprising contacting cells with an agent that targets CHMP2B expression in the cells, thereby reducing or inhibiting NPC damage in the cells.

[0024] In some respects, reducing CHMP2B in cells includes: reducing or inhibiting the accumulation of CHMP7 nuclei in cells compared to the accumulation of CHMP7 nuclei in cells treated with a control agent or before cells are exposed to an agent targeting CHMP2B.

[0025] In some respects, reducing or inhibiting the nuclear accumulation of CHMP7 in cells includes reducing or inhibiting Nup turnover in cells compared to Nup turnover in cells treated with a control agent or in cells before exposing cells to an agent targeting CHMP2B.

[0026] In some respects, reducing or inhibiting Nup turnover in cells includes reducing or inhibiting NPC damage in cells compared to NPC damage in cells treated with a control agent or NPC damage in cells before exposing cells to an agent targeting CHMP2B.

[0027] In some respects, cells are neurons. In other respects, neurons exhibit NPC damage or are at risk of NPC damage within the cell.

[0028] In some embodiments, this disclosure provides a method for reducing or inhibiting TDP-43 mislocalization in cells, the method comprising contacting cells with an agent targeting CHMP2B expression in the cells, thereby reducing or inhibiting TDP-43 mislocalization in the cells.

[0029] In some respects, reducing CHMP2B in cells includes: reducing or inhibiting the accumulation of CHMP7 nuclei in cells compared to the accumulation of CHMP7 nuclei in cells treated with a control agent or before cells are exposed to an agent targeting CHMP2B.

[0030] In some respects, reducing or inhibiting the nuclear accumulation of CHMP7 in cells includes reducing or inhibiting Nup turnover in cells compared to Nup turnover in cells treated with a control agent or in cells before exposing cells to an agent targeting CHMP2B.

[0031] In some respects, reducing or inhibiting Nup turnover in cells includes reducing or inhibiting NPC damage in cells compared to NPC damage in cells treated with a control agent or NPC damage in cells before exposing cells to an agent targeting CHMP2B.

[0032] In some respects, reducing or inhibiting NPC damage in cells includes reducing or inhibiting TDP-43 mislocalization in cells compared to TDP-43 mislocalization in cells treated with a control agent or in cells before exposing cells to an agent targeting CHMP2B.

[0033] In some respects, the cell is a neuron.

[0034] In some respects, neurons exhibit TDP-43 mislocalization or are at risk of TDP-43 mislocalization within the cell.

[0035] In some embodiments, this disclosure provides a method for reducing or inhibiting TDP-43 loss of function in cells, the method comprising regulating CHMP2B expression in cells, including contacting cells with an agent targeting CHMP2B expression in cells, thereby reducing or inhibiting TDP-43 loss of function in cells.

[0036] In some respects, reducing or inhibiting NPC damage in cells includes reducing or inhibiting the loss of TDP-43 function in cells compared to the loss of TDP-43 function in cells treated with a control agent or the loss of TDP-43 function in cells before exposing cells to an agent targeting CHMP2B.

[0037] In some respects, TDP-43 loss of function is caused by TDP-43 nuclear depletion, TDP-43 cytoplasmic mislocalization, TDP-43 aggregation, or a combination thereof.

[0038] In some embodiments, this disclosure provides a method for treating neurodegenerative diseases in a subject, the method comprising modulating CHMP2B expression in the subject, including administering an agent targeting CHMP2B to the subject, thereby treating the neurodegenerative disease.

[0039] In some respects, targeting CHMP2B expression involves reducing CHMP2B expression in cells from the subject.

[0040] In some respects, reducing CHMP2B expression in cells reduced CHMP7 nuclear accumulation in subjects' cells compared to CHMP7 nuclear accumulation in subjects' cells treated with a control agent or CHMP7 nuclear accumulation in subjects' cells before treatment with a CHMP2B-targeting agent.

[0041] In some respects, reducing or inhibiting the accumulation of CHMP7 nuclei in the cells of the subjects reduced Nup turnover in the cells of the subjects compared with Nup turnover in the cells of the subjects treated with the control agent or with Nup turnover in the cells of the subjects before treatment with the agent targeting CHMP2B.

[0042] In some respects, reducing Nup turnover from subjects' cells reduces NPC damage from subjects' cells compared to NPC damage from subjects' cells treated with a control agent or from subjects' cells before treatment with an agent targeting CHMP2B.

[0043] In some respects, reducing NPC damage is compared with reducing TDP-43 mislocalization in the cells of subjects treated with a control agent or in the cells of subjects before treatment with an agent targeting CHMP2B.

[0044] In some respects, reducing TDP-43 mislocalization is compared with TDP-43 loss of function in cells from subjects treated with a control agent or TDP-43 loss of function in cells from subjects before treatment with an agent targeting CHMP2B.

[0045] In some respects, TDP-43 loss of function is caused by nuclear depletion of TDP-43 in cells from the subject, mislocalization of TDP-43 in the cytoplasm, TDP-43 aggregation, or a combination thereof.

[0046] In some respects, the cell is a neuron.

[0047] In some respects, CHMP2B-targeting agents target the CHMP7-CHMP2B protein interaction. In other respects, CHMP2B-targeting agents are nucleic acids, proteins, peptides, or small molecules.

[0048] In some respects, neurodegenerative diseases include amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration. In some respects, neurodegenerative diseases are amyotrophic lateral sclerosis (ALS). In some respects, ALS is sporadic.

[0049] In some respects, the treatment of neurodegenerative diseases also includes administering edaravone, riluzole, AMX0035, tofensin, or combinations thereof to the subject.

[0050] In some cases, it is administered orally, systemically, parenterally, intrathecally, intranasally, intravenously, subcutaneously, intraventricularly, by inhalation, or via suppositories. Brief description of the attached diagram Figures 1A-1D The illustration shows CHMP7-mediated overactivity of Nup turnover in sALS iPSN. Figure 1AFigure 1B shows the maximum intensity projection of POM121 cells with Myc tags (old) and Flag tags (new) in the nuclei of control and sALS iPSN cells using Airyscan imaging. Figure 1C shows the quantification of old, mixed, and new spots before tag exchange. Figure 1D It is a graph showing the quantification of old, mixed, and new spots two weeks after the label exchange.

[0052] Figures 2A-2B The figure shows siRNA-mediated CHMP2B knockdown in the iPSN 3 weeks after nuclear transfection with CHMP2B or non-target (NT) control siRNA. Figure 2A This is a set of images showing Western blots of CHMP2B expression. siRNA is indicated at the bottom, and the antibody used for Western blotting is indicated on the right. Figure 2B This is a graph showing the quantitative expression of CHMP2B protein in iPSN lysates.

[0053] Figures 3A-3D The figure shows ASO-mediated CHMP2B knockdown in the iPSN after 3 weeks of treatment with either a 5 µM randomized control or CHMP2B-targeting ASO. Figure 3A This is an image showing a Western blot of CHMP2B expression. The ASO is indicated at the bottom, and the antibody used for the Western blot is indicated on the right. Figure 3B This is a graph showing the quantitative expression of CHMP2B protein in iPSN lysates. Figure 3C This is an image showing a Western blot of CHMP2B expression. ASO and concentrations are indicated at the bottom, and the antibody used for the Western blot is indicated on the right. Figure 3D This is a graph showing the quantitative expression of CHMP2B protein in iPSN lysates.

[0054] Figures 4A-4B This is a schematic diagram of a set of preventive and restorative siRNA and ASO treatment paradigms. Figure 4A This is a schematic diagram showing the pathological events in the NPC damage cascade, examples of preventative treatment, and the experimental time points used in this study. Figure 4B This is a schematic diagram showing the pathological events, reparative treatment paradigms, and experimental time points used in this study within the NPC damage cascade.

[0055] Figure 5A- Figure 5HThe reduction in CHMP2B is sufficient to mitigate the increase in CHMP7 nuclear localization in sALS iPSNs (3 weeks after nuclear transfection with CHMP2B or non-targeted (NT) siRNA). Figure 5A is a set of images showing the maximum intensity projection of immunostaining and confocal imaging of CHMP7 in controls and sALS iPSNs at day 46 of differentiation. siRNA and genotype are indicated on the left, and antibodies used for immunostaining are indicated at the top. Figure 5B is a graph showing the nucleocytoplasmic ratio quantification of CHMP7. Figure 5C is a set of images showing the maximum intensity projection of immunostaining and confocal imaging of CHMP7 in controls and sALS iPSNs at day 46 of differentiation. ASO and genotype are indicated on the left, and antibodies used for immunostaining are indicated at the top. ASO treatment was initiated on day 15 of differentiation (the time point at which the increase in CHMP7 nuclear localization in sALS iPSNs began). Figure 5D Figure 5E is a set of images showing the maximum intensity projection of CHMP7 in the control and sALS iPSNs at day 81 of differentiation, obtained through immunostaining and confocal imaging. siRNA and genotype are indicated on the left, and the antibody used for immunostaining is indicated at the top. Knockdown was initiated at day 60 of differentiation, following NPC damage and the occurrence of TDP-43 loss of function and mislocalization. Figure 5F is a set of images showing the quantification of the nucleocytoplasmic ratio of CHMP7. Figure 5G is a set of images showing the maximum intensity projection of CHMP7 in the control and sALS iPSNs at day 81 of differentiation, obtained after 3 weeks of treatment with either a disordered control or ASO targeting CHMP2B. ASO and genotype are indicated on the left, and the antibody used for immunostaining is indicated at the top. ASO treatment was initiated at day 60 of differentiation, following NPC damage and the occurrence of TDP-43 loss of function and mislocalization. Figure 5H This is a graph showing the nucleocytoplasmic ratio quantification of CHMP7. n = 5 controls and 8 sALS iPSC lines, 100 Map2+ cells per line / treatment. Statistical significance was calculated using two-way ANOVA and Tukey's multiple comparison test. p < 0.0001. Scale bar = 50 μm Figure 6A- Figure 6DThese are high-magnification images of CHMP7 in the control and sALS iPSNs after CHMP2B knockdown (3 weeks after nuclear transfection with CHMP2B or non-targeted (NT) siRNA). Figure 6A is a set of images showing the maximum intensity projection of immunostaining and confocal imaging of CHMP7 in the control and sALS iPSNs at day 46 of differentiation. siRNA and genotype are indicated on the left, and antibodies used for immunostaining are indicated at the top. Figure 6B Figure 6C is a set of images showing the maximum intensity projection of immunostaining and confocal imaging of CHMP7 in the control and sALS iPSNs at day 46 of differentiation, after 3 weeks of treatment with either a disordered control or CHMP2B-targeting ASO. ASO and genotypes are indicated on the left, and the antibodies used for immunostaining are indicated at the top. ASO treatment was initiated on day 15 of differentiation (the time point at which the nuclear localization of CHMP7 in the sALS iPSN began to increase). Figure 6D This is a set of images showing the maximum intensity projection of CHMP7 in the control and sALS iPSNs at day 81 of differentiation, after 3 weeks of ASO treatment with either a scrambled control or a CHMP2B-targeting control. ASO and genotype are indicated on the left, and the antibodies used for immunostaining are indicated at the top. ASO treatment was initiated at day 60 of differentiation, following NPC damage and the occurrence of TDP-43 loss of function and mislocalization. Scale bar = 5 µm.

[0056] Figure 7A- Figure 7H The figures illustrate that a reduction in CHMP2B is sufficient to mitigate the reduction in nuclear POM121 in sALS iPSNs (3 weeks after nuclear transfection with CHMP2B or non-targeted (NT) siRNA). Figure 7A is a set of images showing the maximum intensity projection of POM121 in control and sALS iPSNs via immunostaining and confocal imaging at day 46 of differentiation. siRNA and genotype are indicated on the left, and antibodies used for immunostaining are indicated at the top. Figure 7B is a graph showing the quantification of POM121 nuclear intensity. Figure 7C is a set of images showing the maximum intensity projection of POM121 in control and sALS iPSNs via immunostaining and confocal imaging at day 46 of differentiation, 3 weeks after treatment with scrambled control or CHMP2B-targeted ASO. ASO and genotype are indicated on the left, and antibodies used for immunostaining are indicated at the top. ASO treatment was initiated on day 15 of differentiation (the time point at which the nuclear localization of CHMP7 in sALS iPSNs began to increase). Figure 7DFigure 7E shows the quantification of POM121 nuclear intensity. n = 5 controls and 8 sALSiPSC lines, with 100 Map2+ cells per line / treatment. Figure 7E is a set of images showing the maximum intensity projection of POM121 in the control and sALS iPSNs via immunostaining and confocal imaging at day 81 of differentiation. siRNA and genotype are indicated as on the left, and antibodies used for immunostaining are indicated as on the top. Figure 7F shows the quantification of POM121 nuclear intensity. Figure 7G is a set of images showing the maximum intensity projection of POM121 in the control and sALS iPSNs via immunostaining and confocal imaging at day 81 of differentiation after 3 weeks of treatment with either a disordered control or CHMP2B-targeted ASO. ASO and genotype are indicated as on the left, and antibodies used for immunostaining are indicated as on the top. ASO treatment was initiated at day 61 of differentiation, following NPC damage and the occurrence of TDP-43 loss of function and mislocalization. Figure 7H This is a graph showing the quantitative analysis of the nuclear strength of POM121. Scale bar = 50 μm.

[0057] Figure 8A- Figure 8D These are high-magnification images of POM121 in the control and sALS iPSNs after CHMP2B knockdown (3 weeks after nuclear transfection with CHMP2B or non-targeted (NT) siRNA). Figure 8A is a set of images showing the maximum intensity projection of POM121 in the control and sALS iPSNs via immunostaining and confocal imaging at day 46 of differentiation. siRNA and genotype are indicated on the left, and antibodies used for immunostaining are indicated at the top. Figure 8B Figure 8C is a set of images showing the maximum intensity projection of POM121 in the control and sALS iPSNs on day 46 of differentiation, after 3 weeks of treatment with either a disordered control or CHMP2B-targeting ASO. ASO and genotypes are indicated on the left, and the antibodies used for immunostaining are indicated at the top. ASO treatment was initiated on day 15 of differentiation (the time point at which the nuclear localization of CHMP7 in the sALS iPSN began to increase). Figure 8C is a set of images showing the maximum intensity projection of POM121 in the control and sALS iPSNs on day 81 of differentiation, using immunostaining and confocal imaging. siRNA and genotypes are indicated on the left, and the antibodies used for immunostaining are indicated at the top. Figure 8DThis is a set of images showing the maximum intensity projection of POM121 in the control and sALS iPSNs at day 81 of differentiation, after 3 weeks of ASO treatment with either a scrambled control or CHMP2B-targeting antibodies. ASO and genotype are indicated on the left, and the antibodies used for immunostaining are indicated at the top. ASO treatment was initiated on day 61 of differentiation, following NPC damage and the appearance of TDP-43 loss of function and mislocalization. Scale bar = 5 µm.

[0058] Figures 9A-9F The illustration shows that siRNA and ASO-mediated CHMP2B knockdown restored the level of POM121 in the nucleus of sALS iPSN cells. Figure 9A This is a set of images showing Western blots of POM121 expression in nuclei isolated on day 46 of differentiation, 3 weeks after nuclear transfection with CHMP2B or non-targeted (NT) control siRNA, or 3 weeks after treatment with 5 µM randomized control or CHMP2B-targeted ASO. Genotypes are indicated at the top, siRNA and ASO at the bottom, and antibodies used for Western blotting are indicated on the right. siRNA nuclear transfection or ASO treatment was initiated on day 15 of differentiation (the time point at which the nuclear localization of CHMP7 in sALS iPSNs began to increase). Figure 9B is a graph showing the quantification of POM121 protein expression in Ipsn cell nuclear lysates 3 weeks after nuclear transfection with CHMP2B or NT control siRNA. Figure 9C This is a graph showing the quantification of POM121 protein expression in Ipsn cell nuclear lysates after 3 weeks of treatment with either a randomized control or CHMP2B-targeting ASO. GAPDH was used for normalization. Figure 9D This is a set of images showing Western blots of POM121 expression in cell nuclei isolated on day 81 of differentiation, 3 weeks after nuclear transfection with CHMP2B or non-targeted (NT) control siRNA, or 3 weeks after treatment with 5 µM scrambled control or CHMP2B-targeted ASO. Genotypes are indicated at the top, siRNA and ASO at the bottom, and antibodies used for Western blotting are indicated on the right. siRNA nuclear transfection or ASO treatment was initiated on day 60 of differentiation, following NPC damage and the occurrence of TDP-43 loss of function and mislocalization. Figure 9E is a graph showing the quantification of POM121 protein expression in iPSN cell nuclear lysates 3 weeks after nuclear transfection with CHMP2B or NT control siRNA. Figure 9F This graph shows the quantitative expression of POM121 protein in iPSN cell nuclear lysates 3 weeks after nuclear transfection with CHMP2B or NT control siRNA, and 3 weeks after treatment with a disordered control or CHMP2B-targeting ASO. GAPDH was used for normalization.

[0059] Figures 10A-10C The reduction in CHMP2B, as shown in the diagram, decreases the turnover of POM121 in the iPSN. Figure 10A This is a set of images showing the maximum intensity projections of POM121 cells with Myc tags (old) and Flag tags (new) in the nuclei of control and sALS iPSN cells. Treatments and time points are indicated as on the left. Figure 10B is a graph showing the quantification of old, mixed, and new spots one week after tag exchange. Figure 10C It is a graph showing the quantification of old, mixed, and new spots two weeks after the label exchange.

[0060] Figure 11A- Figure 11S The illustration shows that early siRNA-mediated CHMP2B knockdown restored TDP-43 function in sALS iPSNs on day 46 of differentiation (3 weeks after nuclear transfection with CHMP2B or non-targeted (NT) siRNA). Figure 11A is a qRT-PCR diagram showing ELAVL3 mRNA in control and sALSiPSNs. Figure 11B shows the function of ELAVL3 mRNA in control and sALS iPSNs. PFKP Figure 11C shows the qRT-PCR results of mRNA in the control and sALS iPSN. RCAN1 Figure 11D shows the qRT-PCR of mRNA. SELPLG Figure 11E shows the qRT-PCR results. STMN2 Figure 11F shows the qRT-PCR results in the control and sALSiPSN. ACTL6B Figure 11G shows the qRT-PCR of mRNA. ARHGAP32 Figure 11H shows the qRT-PCR results in the control and sALS iPSN. CAMK2B Figure 11I shows the qRT-PCR results of mRNA in the control and sALS iPSN. CDK7 Figure 11J shows the qRT-PCR of mRNA. DNM1 Figure 11K shows the qRT-PCR results in the control and sALSiPSN. HDGFL2 Figure 11L shows the qRT-PCR results of mRNA in the control and sALS iPSN. MYO18A Figure 11M shows the qRT-PCR results of mRNA in the control and sALS iPSN. SYT7 Figure 11N shows the qRT-PCR results of mRNA in control and sALS iPSNs, as well as the truncated mRNAs. STMN2 Figure 110 shows the qRT-PCR diagram of mRNA in the control and sALS iPSN. Actin A diagram of qRT-PCR of mRNA. Figure 11P It shows the control and sALSiPSN. POM121 A graph of qRT-PCR for mRNA. GAPDH was used for normalization. Actin and POM121 It was used as a negative control mRNA that is known to be unregulated by TDP-43. Figure 11Q This is a set of images showing the maximum intensity projection and confocal imaging of TDP-43 in the control and sALS iPSN. siRNA and genotype are indicated on the left, and antibodies used for immunostaining are indicated at the top. Figure 11R is a graph showing the nucleocytoplasmic ratio quantification of TDP-43. Figure 11S It is a graph that shows the quantitative analysis of the nuclear strength of TDP-43.

[0061] Figure 12A- Figure 12SThe illustrations show that early ASO-mediated CHMP2B knockdown restored TDP-43 function in sALS iPSNs. Figure 12A shows qRT-PCR of ELAVL3 mRNA in control and sALS iPSNs at day 46 of differentiation after 3 weeks of treatment with either a disordered control or CHMP2B-targeted ASO. Figure 12B shows PFKP mRNA in control and sALS iPSNs at day 46 of differentiation after 3 weeks of treatment with either a disordered control or CHMP2B-targeted ASO. Figure 12C shows RCAN1 mRNA in control and sALS iPSNs at day 46 of differentiation after 3 weeks of treatment with either a disordered control or CHMP2B-targeted ASO. Figure 12D shows SELPLG mRNA in control and sALS iPSNs at day 46 of differentiation after 3 weeks of treatment with either a disordered control or CHMP2B-targeted ASO. Figure 12E shows the STMN2 mRNA levels in the control and sALS iPSNs at day 46 after 3 weeks of ASO treatment with either the disordered control or CHMP2B-targeted ASO. Figure 12F shows the ACTL6B mRNA levels in the control and sALS iPSNs at day 46 after 3 weeks of ASO treatment with either the disordered control or CHMP2B-targeted ASO. Figure 12G shows the ARHGAP32 mRNA levels in the control and sALS iPSNs at day 46 after 3 weeks of ASO treatment with either the disordered control or CHMP2B-targeted ASO. Figure 12H shows the CAMK2B mRNA levels in the control and sALS iPSNs at day 46 after 3 weeks of ASO treatment with either the disordered control or CHMP2B-targeted ASO. Figure 12I shows the CDK7 mRNA levels in the control and sALS iPSNs at day 46 after 3 weeks of ASO treatment with either the disordered control or CHMP2B-targeted ASO. Figure 12J shows the DNM1 mRNA in the control and sALS iPSNs at day 46 after 3 weeks of ASO treatment with either the disordered control or CHMP2B-targeted ASO. Figure 12K shows the HDGFL2 mRNA in the control and sALS iPSNs at day 46 after 3 weeks of ASO treatment with either the disordered control or CHMP2B-targeted ASO. Figure 12L shows the MYO18A mRNA in the control and sALS iPSNs at day 46 after 3 weeks of ASO treatment with either the disordered control or CHMP2B-targeted ASO. Figure 12M shows the mRNA containing the SYT7 cryptic exon (CE) in the control and sALSiPSNs at day 46 after 3 weeks of ASO treatment with either the disordered control or CHMP2B-targeted ASO.Figure 12N shows the truncated STMN2 mRNA in the control and sALS iPSNs at day 46 of differentiation after 3 weeks of treatment with either the disordered control or CHMP2B-targeted ASO. Figure 12O shows the actin mRNA in the control and sALS iPSNs at day 46 of differentiation after 3 weeks of treatment with either the disordered control or CHMP2B-targeted ASO. Figure 12P This is a graph showing POM121 mRNA in control and sALS iPSNs at day 46 of differentiation after 3 weeks of treatment with either a disordered control or CHMP2B-targeting ASO. GAPDH was used for normalization. Actin and POM121 were used as negative control mRNAs known to be unregulated by TDP-43. Figure 12Q This is a set of images showing the maximum intensity projection and confocal imaging of TDP-43 in the control and sALS iPSNs at day 46 of differentiation, after 3 weeks of treatment with either a disordered control or CHMP2B-targeted ASO. ASO and genotype are indicated on the left, and antibodies used for immunostaining are indicated at the top. Figure 12R is a plot showing the nucleocytoplasmic ratio quantification of TDP-43. Figure 12S It is a graph that shows the quantitative analysis of the nuclear strength of TDP-43.

[0062] Figure 13A- Figure 13S The illustration shows that late siRNA-mediated CHMP2B knockdown restored TDP-43 function in sALS iPSNs (3 weeks after nuclear transfection with CHMP2B or non-targeted (NT) siRNA). Figure 13A shows the TDP-43 function in control and sALSiPSNs at day 81 of differentiation. ELAVL3 Figure 13B shows the qRT-PCR results of mRNA in the control and sALS iPSN at day 81 of differentiation. PFKP Figure 13C illustrates the mRNA levels in the control and sALS iPSNs at day 81 of differentiation. RCAN1 Figure 13D shows the mRNA levels in the control and sALS iPSNs at day 81 of differentiation. SELPLG Figure 13E shows the mRNA levels in the control and sALS iPSNs at day 81 of differentiation. STMN2 Figure 13F shows the mRNA levels in the control and sALS iPSNs at day 81 of differentiation. ACTL6B Figure 13G shows the mRNA levels in the control and sALS iPSNs at day 81 of differentiation. ARHGAP3 Figure 13H shows the mRNA levels in the control and sALS iPSN at day 81 of differentiation. CAMK2B Figure 13I shows the mRNA levels in the control and sALS iPSN at day 81 of differentiation. CDK7 Figure 13J shows the mRNA levels in the control and sALS iPSNs at day 81 of differentiation. DNM1 A diagram of the mRNA containing cryptic exons (CEs). Figure 13K shows the mRNA content of cryptic exons (CEs) in control and sALS iPSNs at day 81 of differentiation. HDGFL2 A diagram of the mRNA containing cryptic exons (CEs). Figure 13L shows the mRNA content of cryptic exons (CEs) in control and sALS iPSNs at day 81 of differentiation. MYO18A A diagram of the mRNA containing cryptic exons (CEs). Figure 13M shows the mRNA content of cryptic exons (CEs) in control and sALS iPSNs at day 81 of differentiation. SYT7 A diagram of the mRNA of the cryptic exon (CE). Figure 13N shows the truncated mRNA in the control and sALS iPSN at day 81 of differentiation. STMN2 Figure 13O shows the mRNA levels in the control and sALS iPSNs at day 81 of differentiation. Actin A diagram of mRNA. Figure 13P This shows that at day 81 of differentiation, in the control and sALS iPSN POM121 A diagram of mRNA. Actin and POM121 It was used as a negative control mRNA that is known to be unregulated by TDP-43. Figure 13Q This is a set of images showing the maximum intensity projection and confocal imaging of TDP-43 in the control and sALS iPSN at day 81 of differentiation. siRNA and genotype are indicated as on the left, and antibodies used for immunostaining are indicated as on the top. Figure 13R is a graph showing the nucleocytoplasmic ratio quantification of TDP-43. Figure 13S It is a graph that shows the quantitative analysis of the nuclear strength of TDP-43.

[0063] Figure 14A- Figure 14S The illustration shows that late ASO-mediated CHMP2B knockdown restored TDP-43 function in sALS iPSNs. Figure 14A shows the levels of TDP-43 in control and sALS iPSNs at day 81 after 3 weeks of treatment with either a disordered control or CHMP2B-targeted ASO. ELAVL3 Figure 14B shows the qRT-PCR results of cryptic exon (CE) mRNA. Figure 14B illustrates the concentrations of cryptic exon (CE) mRNA in control and sALS iPSNs at day 81 after 3 weeks of treatment with either a disordered control or ASO targeting CHMP2B. PFKP Figure 14C shows the qRT-PCR results of cryptic exon (CE) mRNA. Figure 14C illustrates the concentrations of cryptic exon (CE) mRNA in control and sALS iPSNs at day 81 of differentiation after 3 weeks of treatment with either a disordered control or ASO targeting CHMP2B. RCAN1Figure 14D shows the qRT-PCR results of cryptic exon (CE) mRNA at day 81 of differentiation after 3 weeks of treatment with either the disordered control or ASO targeting CHMP2B. SELPLG Figure 14E shows the qRT-PCR results of cryptic exon (CE) mRNA. Figure 14E illustrates the concentrations of cryptic exon (CE) mRNA in control and sALS iPSNs at day 81 after 3 weeks of treatment with either a disordered control or ASO targeting CHMP2B. STMN2 Figure 14F shows the qRT-PCR results of cryptic exon (CE) mRNA at day 81 of differentiation, after 3 weeks of treatment with either a disordered control or ASO targeting CHMP2B. ACTL6B Figure 14G shows the qRT-PCR results of cryptic exon (CE) mRNA at day 81 of differentiation after 3 weeks of treatment with either the disordered control or ASO targeting CHMP2B. ARHGAP32 Figure 14H shows the qRT-PCR results of cryptic exon (CE) mRNA at day 81 of differentiation, after 3 weeks of treatment with either a disordered control or ASO targeting CHMP2B. CAMK2B Figure 14I shows the qRT-PCR results of cryptic exon (CE) mRNA. Figure 14I illustrates the concentrations of cryptic exon (CE) mRNA in control and sALS iPSNs at day 81 after 3 weeks of treatment with either a disordered control or ASO targeting CHMP2B. CDK7 Figure 14J shows the qRT-PCR results of cryptic exon (CE) mRNA at day 81 of differentiation after 3 weeks of treatment with either the disordered control or ASO targeting CHMP2B. DNM1 A diagram of qRT-PCR for cryptic exon (CE) mRNA. Figure 14K shows the concentrations of cryptic exon (CE) mRNA in control and sALS iPSNs at day 81 after 3 weeks of treatment with either a disordered control or ASO targeting CHMP2B. HDGFL2 Figure 14L shows the qRT-PCR results of cryptic exon (CE) mRNA at day 81 of differentiation, after 3 weeks of treatment with either a disordered control or ASO targeting CHMP2B. MYO18A A diagram of qRT-PCR for cryptic exon (CE) mRNA. Figure 14M shows the concentrations of cryptic exon (CE) mRNA in the control and sALSiPSN at day 81 of differentiation after 3 weeks of treatment with either a disordered control or ASO targeting CHMP2B. SYT7Figure 14N shows the qRT-PCR results of cryptic exon (CE) mRNA. Figure 14N illustrates the truncated mRNA in the control and sALS iPSNs at day 81 of differentiation after 3 weeks of treatment with either the disordered control or ASO targeting CHMP2B. STMN2 Figure 140 shows the qRT-PCR results of mRNA in the control and sALS iPSNs at day 81 after 3 weeks of treatment with either the disordered control or ASO targeting CHMP2B. Actin A diagram of qRT-PCR of mRNA. Figure 14P This demonstrates that, after 3 weeks of ASO treatment using either a disordered control or CHMP2B-targeted therapy, at day 81 of differentiation, the control and sALS iPSN levels were significantly lower. POM121 Figure of qRT-PCR for mRNA. ASO treatment was initiated on day 60 of differentiation, following NPC damage and the occurrence of TDP-43 loss of function and mislocalization. GAPDH was used for normalization. Actin and POM121 It was used as a negative control mRNA that is known to be unregulated by TDP-43. Figure 14Q This is a set of images showing the maximum intensity projection and confocal imaging of TDP-43 in the control and sALSiPSN at day 81 of differentiation, after 3 weeks of treatment with either a disordered control or CHMP2B-targeted ASO. ASO and genotype are indicated on the left, and antibodies used for immunostaining are indicated at the top. ASO treatment was initiated on day 60 of differentiation, following NPC damage and the occurrence of TDP-43 loss of function and mislocalization. Figure 14R is a plot quantifying the TDP-43 nucleocytoplasmic ratio. Figure 14S This is a graph showing the quantification of TDP-43 nuclear intensity. n = 5 controls and 8 sALS iPSC lines, each line / knockdown containing 100 Map2+ cells.

[0064] Figure 15A- Figure 15DFigure 15A shows the percentage of cell viability in control and sALS iPSNs after exposure to excess glutamate, mediated by siRNA and ASO, indicating that CHMP2B reduction mediated by siRNA and ASO improved sALS iPSN viability following exposure to excess glutamate. PBS was used for normalization. Triton X-100 was used as a positive control for inducing neuronal death. Figure 15B shows the percentage of cell viability in control and sALS iPSNs after exposure to 0 µM or 10 µM glutamate for 4 weeks on day 46 of differentiation, mediated by Alamar Blue, following treatment with either a disordered control or CHMP2B-targeting ASO for 3 weeks. Figure 15C shows the percentage of cell viability in control and sALS iPSNs after exposure to 0 µM or 10 µM glutamate for 4 weeks on day 81 of differentiation, mediated by Alamar Blue. Triton X-100 was used as a positive control for inducing neuronal death. n = 5 controls and 8 sALS iPSC lines. Data points represent the mean survival percentage of 3 technical repeat wells for each line / siRNA. Figure 15D This is a graph showing the percentage of cell viability in control and sALS iPSNs measured by Alamar Blue after 3 weeks of treatment with either a disordered control or CHMP2B-targeted ASO, followed by 4 hours of exposure to 0 µM or 10 µM glutamate on day 81 of differentiation.

[0065] Figure 16A- Figure 16D Figure 16A shows the percentage of propidium iodide (PI) positive spots normalized to DAPI-positive nuclei after 4 hours of exposure to 0 µM or 10 µM glutamate on day 46 of differentiation. Figure 16B shows the percentage of propidium iodide (PI) positive spots normalized to DAPI-positive nuclei after 4 hours of exposure to 0 µM or 10 µM glutamate on day 46 of differentiation, after 3 weeks of treatment with either a randomized control or CHMP2B-targeting ASO. ASO treatment was initiated on day 15 of differentiation (the time point at which the nuclear localization of CHMP7 in sALS iPSNs began to increase). Figure 16C shows the percentage of propidium iodide (PI) positive spots normalized to DAPI-positive nuclei after 4 hours of exposure to 0 µM or 10 µM glutamate on day 81 of differentiation. Figure 16DThis is a graph quantifying the percentage of propidium iodide (PI) positive spots in DAPI-positive nuclei normalized to DAPI-positive cells 3 weeks after exposure to 0 µM or 10 µM glutamate for 4 hours on day 46 of differentiation, following treatment with either a disordered control or CHMP2B-targeted ASO. ASO treatment was initiated on day 60 of differentiation, after NPC damage and the appearance of TDP-43 loss of function and mislocalization. n = 5 controls and 8 sALS iPSC lines.

[0066] Figures 17A-17G The illustration shows that the proximity between CHMP7 and CHMP2B increases and persists in the nucleus of sALS cells. Figure 17A This is a set of images showing the maximum intensity projection of the CHMP7-CHMP2B PLA signal in confocal imaging in the control and sALS iPSNs. Time points are indicated on the left; genotypes are indicated at the top. Figure 17B This is a graph showing the quantitative number of PLA signals in each cell nucleus on day 18. Figure 17C This is a graph showing the quantitative number of PLA signals in each cell nucleus on day 25. Figure 17D This is a graph showing the quantitative number of PLA signals in each cell nucleus on day 32. Figure 17E This is a set of images showing a single z-section of apotome-based CHMP7-CHMP2B PLA signal imaging in the motor and occipital cortical tissues of the V layer after death in control and sALS patients. Brain regions are indicated as on the left; genotypes are indicated as at the top. Figure 17F It is a graph that quantitatively displays the number of PLA signals in each cell nucleus in the motor cortex. Figure 17G It is a graph that shows the quantitative number of PLA signals in each cell nucleus in the occipital cortex.

[0067] Figures 18A-18B Images showing the localization of CHMP2B and CHMP7 in control and saLS iPSN and postmortem human tissues. Figure 18A This is a set of images showing the maximum intensity projection of CHMP7 and CHMP2B in immunostaining and confocal imaging in the control and sALS iPSN. Time points are indicated on the left, and antibodies and genotypes used for immunostaining are indicated at the top. Figure 18B This is a set of images showing immunostaining and apotome-based fluorescence imaging of CHMP7 and CHMP2B in controls, sALS, and post-mortem human tissue. Brain regions are indicated as on the left, and antibodies and genotypes used for immunostaining are indicated as on the top.

[0068] Figures 19A-19B It shows an image of CHMP7 and CHMP2B binding in vitro. Figure 19AThis is an image showing Coomassie staining after in vitro binding of recombinant His-tagged CHMP7 and GST-tagged CHMP2B proteins. The binding reaction is indicated at the top; the recombinant proteins are indicated on the right. This experiment was repeated three times in total. Figure 19B This is an image showing Coomassie staining after in vitro binding of recombinant GST-tagged CHMP7 and His-tagged CHMP2B proteins. The binding reaction is indicated at the top; the recombinant proteins are indicated on the right. This experiment was repeated three times in total.

[0069] Figures 20A-20C The diagram shows that knocking down CHMP2B does not restore the NPC permeability barrier integrity in sALS iPSN. Figure 20A This is a set of images showing a single z-section of fluorescently labeled 70 kDa dextran confocal imaging in a sALS iPSN after 3 weeks of treatment with untargeted or CHMP2B siRNA (left) or 3 weeks of treatment with a disordered control or CHMP2B-targeted ASO (right), on day 46 of differentiation. Genotypes and treatments are indicated as on the left, and dextran is indicated as on the top. DAPI was used to define the nucleus. Figure 20B is a graph showing the quantification of 70 kDa dextran nuclear intensity in the untargeted and CHMP2B siRNA-treated controls and sALS iPSNs. Figure 20C This is a graph showing the quantification of 70 kDa dextran nuclear intensity in the disordered control, the CHMP2B-targeted ASO-treated control, and the sALS iPSN.

[0070] Figures 21A-21E The diagram illustrates that CHMP2B promotes the activation of CHMP7, thereby inducing NPC damage in sALS iPSN. Figure 21A It is a schematic diagram showing the CHMP7 mutant and its functional consequences. Figure 21B It is a diagram that shows a schematic overview of the experimental paradigm. Figure 21C This is a set of images showing the maximum intensity projection of immunostaining and confocal imaging of flag-tagged CHMP7 and endogenous POM121 in the control and sALS iPSN. CHMP7 plasmid and ASO treatment are indicated on the left, and the antibodies and genotypes used for immunostaining are indicated at the top. Figure 21D This is a graph showing the nucleo-cytoplasmic ratio quantification of CHMP7. Figure 21E This is a graph showing the quantitative analysis of the nuclear strength of POM121. Scale bar = 50 μm.

[0071] Figures 22A-22B The illustration shows that the CHMP7 “open” and CHMP7 ΔHelix 6 mutants do not associate with CHMP2B in the iPSN. Figure 22AThis is a set of images showing the maximum intensity projection of the Flag-CHMP2B PLA signal in confocal imaging in the control and sALS iPSN. The CHMP7 plasmid is indicated on the left, and the genotype is indicated at the top. Note: An anti-Flag antibody was used to detect the Flag-tagged CHMP7 protein. Figure 22B This is a graph showing the quantitative number of PLA signals in each cell nucleus. Scale bar = 5 µm.

[0072] Figures 23A-23B It is a graphical model depicting the role of CHMP2B in promoting the retention and activation of CHMP7 cell nuclei to facilitate pathological ESCRT-III-mediated Nup degradation in sALS. Figure 23A This diagram illustrates the passive diffusion of ESCRT-III protein across the NPC in control human neurons used for normal NPC maintenance and Nup turnover, where it is activated via association with CHMP2B. Following ESCRT-III-mediated Nup degradation, CHMP7 is inactivated and actively exported from the nucleus. This replenishes Nup molecules and maintains NPC homeostasis. Figure 23B This diagram illustrates how, in sALS neurons, SUN1-mediated disruption of the NPC permeability barrier leads to increased passive diffusion of CHMP7 into the nucleus. Within the nucleus, CHMP7 is activated via association with CHMP2B, resulting in the degradation of specific Nup cells in the NPC. Continued CHMP2B-mediated CHMP7 activation leads to ongoing ESCRT-III-mediated Nup removal and degradation, causing the NPC pathology observed in sALS.

[0073] Detailed description of the publicly available information This disclosure is based on a groundbreaking discovery that CHMP2B promotes the pathological accumulation or retention of CHMP7 in the nucleus and triggers a reduction in POM121 in the early stages of the NPC damage cascade, and that inhibiting CHMP2B with antisense oligonucleotides can prevent and restore the loss of TDP-43 function associated with NPC damage in neurons.

[0074] Before describing the systems and methods of the present invention, it is to be understood that the invention is not limited to the specific systems, methods, and experimental conditions described, as such systems, methods, and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting, as the scope of the invention will be limited only by the appended claims.

[0075] As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural indicators unless the context clearly indicates otherwise. Thus, for example, references to “the method” include one or more methods and / or steps of the type described herein, as will become apparent to those skilled in the art upon reading this disclosure, etc.

[0076] As used herein, the term “and / or” includes any and all combinations of one or more of the related items listed.

[0077] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference as if each individual publication, patent, and patent application were specifically and individually indicated as incorporated by reference. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although any methods and materials similar to or equivalent to those described herein may be used in the practice or testing of this invention, it is understood that modifications and variations are covered within the spirit and scope of this disclosure. Preferred methods and materials are now described.

[0078] Importantly, this disclosure demonstrates that partial knockdown of CHMP2B is sufficient to alleviate NPC damage and downstream TDP-43 dysfunction in sALS neurons, thereby highlighting CHMP2B as a potential therapeutic target in the disease.

[0079] This article describes the central role of the ESCRT-III protein CHMP2B in initiating CHMP7-mediated NPC damage in sALS iPSNs. Specifically, CHMP2B promotes the "activation" of CHMP7 within the nucleus, thereby triggering a reduction in POM121 in the early stages of the NPC damage cascade. Interestingly, sustained CHMP2B-mediated activation underlies the pathological nuclear accumulation / retention of CHMP7 observed in sALS. Crucially, modest reduction of CHMP2B protein via antisense oligonucleotides (ASO) or siRNA approaches eliminates CHMP7 nuclear accumulation, restores POM121 nuclear localization and expression, and alleviates TDP-43 dysfunction in sAL iPSNs. Thus, these data define the potential cellular biological mechanisms underlying CHMP7 nuclear accumulation and subsequent NPC damage initiation in sALS pathogenesis. Furthermore, this study highlights the potential of CHMP2B itself, targeting the CHMP7-CHMP2B protein interaction, as a therapeutic strategy for sALS.

[0080] In some embodiments, this disclosure provides an oligonucleotide comprising the nucleic acid sequences of SEQ ID NO: 3-12.

[0081] In some aspects, this disclosure provides compositions comprising one or more of the above-described oligonucleotides.

[0082] As used herein, the term "oligonucleotide" refers to a short chain of DNA or RNA, which may be single-stranded or double-stranded. Oligonucleotides bind to their complementary DNA or RNA sequences and can be chemically modified to enhance their properties in vivo. Examples of oligonucleotides include, but are not limited to, antisense oligonucleotides (ASOs), RNA interference (RNAi), small interfering RNA (siRNA), and aptamer RNA. In some respects, oligonucleotides are antisense oligonucleotides (ASOs).

[0083] In some embodiments, this disclosure provides a method for regulating CHMP2B expression in cells, the method comprising contacting cells with an oligonucleotide comprising a nucleic acid sequence comprising SEQ ID NO: 3 (TGTGACAAGTCCTAGTGGGA), SEQ ID NO: 4 (AGGGTGAGAAAGAGTATGGG), SEQ ID NO: 5 (GGGATGCAGAAATACAGAGG), SEQ ID NO: 6 (AAGTGGCATCTGAAGTAGGG), SEQ ID NO: 7 (TGGTAAGCGAAGATGCCAGA), SEQ ID NO: 8 (ATCACTTACCACCTGCCATG), SEQ ID NO: 9 (GTTGGTGGGACAGAGCAATA), SEQ ID NO: 10 (CACCTAACTCTCTAGTGGCT), SEQ ID NO: 11 (TCAATGGAACAGAGCCCAGA), SEQ ID NO: 12 (CATTTACCCTATGACCCAGC), or a combination thereof, thereby regulating CHMP2B expression.

[0084] This document also includes oligonucleotides comprising nucleic acid sequences having approximately 80% or higher sequence identity with SEQ ID NO: 3-12. In this document, the terms “sequence identity” and “percentage of identity” are used interchangeably. To determine the percentage of identity between two polypeptide molecules or two polynucleotide sequences, the sequences are aligned for optimal comparison purposes (e.g., a gap may be introduced into the sequence of the first polypeptide or polynucleotide to allow for optimal alignment with the second polypeptide or polynucleotide sequence). The amino acids or nucleotides at corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid or nucleotide at the corresponding position in the second sequence, the molecules are identical at that position. The percentage of identity between two sequences is a function of the number of common positions shared by the sequences (i.e., identity % = number of common positions / total number of positions (i.e., overlapping positions) x 100). In some embodiments, the length of the reference sequence (e.g., SEQ ID NO: 3-12) aligned for comparison purposes is at least 80% of the length of the comparison sequence, and in some embodiments at least 90% or 100%. In one embodiment, the two sequences have the same length.

[0085] The desired degree of sequence identity ranges from approximately 80% to 100% and integer values ​​in between. The percentage of identity between the disclosed sequence and the claimed sequence can be at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9%. Typically, an exact match indicates 100% identity in length of the reference sequence (e.g., SEQ ID NO: 3-12).

[0086] Polynucleotides that are approximately 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or higher of the polynucleotides described herein are embodied in this disclosure.

[0087] For example, the polynucleotide may have 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with SEQ ID NO: 3-12.

[0088] "Pharmaceutical acceptable" means that the carrier, diluent, or excipient must be compatible with the other components of the formulation and not be harmful to the recipient. Pharmaceutically acceptable carriers, excipients, or stabilizers are well known in the art, for example, Remington's *Pharmaceutical Sciences*, 16th edition, Osol, A. Ed. (1980). Pharmaceutically acceptable carriers, excipients, or stabilizers are non-toxic to the recipient at the dosage and concentration used. Examples of carriers, excipients, or stabilizers include, but are not limited to, liposomes, nanoparticles, ointments, micelles, microspheres, microparticles, creams, emulsions, gels; anti-adhesion agents such as magnesium stearate; adhesives such as sugars and their derivatives (sucrose, lactose, starch, cellulose, sugar alcohols, etc.), gelatin and other proteins and synthetic polymers; lubricants such as talc and silica; and preservatives such as antioxidants, vitamin A, vitamin E, vitamin C, retinyl palmitate, selenium, cysteine, methionine, citric acid, sodium sulfate, parabens, water, alcohols, saline solutions, glycols, mineral oils, dimethyl sulfoxide (DMSO), phosphates, citrates and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (such as octadecyl dimethyl benzyl ammonium chloride; hexamethyl ammonium chloride; benzalkonium chloride, benzyl chloride); Phenol, butanol, or benzyl alcohol; alkyl esters of p-hydroxybenzoate such as methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants such as TWEEN™, PLURONICS™, or polyethylene glycol (PEG).

[0089] The pharmaceutical composition may also contain other therapeutic agents and may be formulated, for example, using conventional mediators or diluents, and pharmaceutical additives (e.g., excipients, preservatives, etc.) suitable for the desired type of administration, according to techniques known in the pharmaceutical formulation field.

[0090] In some embodiments, the compositions disclosed herein are formulated together with additional agents that promote entry into desired cells or tissues. Such additional agents include micelles, liposomes, and dendritic polymers.

[0091] The therapeutically effective agents useful in the methods of this invention are applicable for parenteral injection in physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents, or media include water, ethanol, polyols (propylene glycol, polyethylene glycol, glycerol, etc.), suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters such as ethyl oleate. Suitable flowability can be maintained, for example, by using coatings such as lecithin, by maintaining the desired particle size in the case of dispersions, and by using surfactants.

[0092] Solid dosage forms for oral administration of the inhibitors or pharmaceutically acceptable salts or prodrugs useful herein include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the compounds described herein or their derivatives are mixed with at least one inert conventional excipient (or carrier), such as sodium citrate or dicalcium phosphate, or (a) a filler or extender, such as starch, lactose, sucrose, glucose, mannitol, and silicate; (b) a binder, such as carboxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, and gum arabic; (c) a humectant, such as glycerin; or (d) a disintegrant, such as agar-agar, calcium carbonate, potato or cassava starch, alginate, certain complex silicates, for example.

[0093] Similar types of solid compositions can also be used as fillers in soft-filled and hard-filled gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycol.

[0094] Solid dosage forms such as tablets, sugar-coated pills, capsules, pellets, and granules can be prepared with coatings and shells, such as enteric coatings and other coatings and shells known in the art. Liquid dosage forms for oral administration of the compounds described herein or their pharmaceutically acceptable salts or prodrugs include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compound, liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizers, and emulsifiers, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butanediol, dimethylformamide, oils (particularly cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil, sesame oil), glycerin, tetrahydrofurfuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitol, or mixtures of these substances.

[0095] The inhibitors or agents described herein, or their pharmaceutically acceptable salts or prodrugs, for rectal administration are optionally suppositories, which can be prepared by mixing the compound with a suitable non-irritating excipient or carrier (such as cocoa butter, polyethylene glycol, or suppository wax), which are solid at room temperature but liquid at body temperature, and thus melt in the rectum or vaginal cavity to release the active ingredient.

[0096] In some respects, regulating CHMP2B expression includes reducing CHMP2B expression in cells compared to CHMP2B expression in cells exposed to control oligonucleotides or in cells not exposed to oligonucleotides.

[0097] As used herein, the term "antisense oligonucleotide" or "ASO" refers to a short, synthetic single-stranded DNA or RNA molecule designed to bind to a specific messenger RNA (mRNA) sequence, thereby inhibiting mRNA function and preventing the production of the corresponding protein. ASOs can effectively regulate gene expression at the RNA level. Examples of ASOs include, but are not limited to, RNase H-dependent oligonucleotides, steric-blocker oligonucleotides, gapmer ASOs, small interfering RNA (siRNA), splice conversion ASOs (ssASOs), and nanoparticles.

[0098] As used in this article, "small interfering RNA" or "siRNA" refers to a class of non-coding RNA molecules that regulate gene expression. siRNA binds to messenger RNA (mRNA) and promotes its degradation in a process known as RNA interference (RNAi). siRNA silences the expression of target genes in a sequence-specific manner. siRNA can be directly introduced into cells.

[0099] As used herein, the term "modulated expression" refers to a detectable change in expression. "Modulated expression" as used herein means a reduction in expression. A detectable change in expression can be relative to a control sample, such as a sample of the same type from another subject or a sample previously collected from a subject using the methods disclosed herein. A detectable change in expression can also be relative to a database or standard value. As a non-limiting example, the threshold for modulated expression can be a 0.5-fold, 0.75-fold, 1.25-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 10-fold, or more change in expression level.

[0100] As used herein, the term "charged multivesicular protein 2B" or "CHMP2B" refers to a protein that helps regulate intracellular protein degradation and transport. CHMP2B is a component of the ESCRT-III complex, which helps remodel cell membranes. CHMP2B is expressed in many tissues, including the brain, heart, skeletal muscle, and liver. In the brain, CHMP2B is expressed in the cerebral cortex, cerebellum, medulla, and other regions. Mutations in the CHMP2B gene can cause CHMP2B-related diseases. Examples of CHMP2B-related diseases include, but are not limited to, neurodegenerative diseases such as frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS). CHMP2B-related diseases are caused by mutations in the gene encoding charged multivesicular protein 2B (CHMP2B).

[0101] As used in this article, “contacting a cell” refers to the physical interaction between the agent and the cell. Contact can occur via diffusion, blood circulation, direct contact, or intercellular connections.

[0102] In some respects, immunostaining, confocal imaging, nuclear isolation, Western blotting, or combinations thereof are used to measure CHMP2B expression.

[0103] In some embodiments, this disclosure provides a method for reducing or inhibiting the nuclear accumulation of CHMP7 in cells, comprising contacting cells with an agent that targets CHMP2B expression in cells, thereby reducing or inhibiting the nuclear accumulation of CHMP7 in cells.

[0104] In some embodiments, this disclosure provides a method for preventing the nuclear accumulation of CHMP7 in cells, comprising contacting cells with an agent that targets CHMP2B expression in the cells, thereby preventing the nuclear accumulation of CHMP7 in the cells. In some aspects, targeting CHMP2B expression includes reducing CHMP2B expression in cells.

[0105] The ASO and siRNA described in this article reduce CHMP2B expression. For example, relative to the corresponding CHMP2B expression in reference cells, CHMP2B expression in cells can be reduced by at least about 5% to about 95%, for example, about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more. CHMP2B expression in cells can be silenced relative to the corresponding CHMP2B expression in reference cells. Reference cells can be, but are not limited to, cells before treatment, another cell from the same subject, or cells from a reference subject.

[0106] As used herein, “nuclear accumulation” refers to the process by which proteins or other molecules accumulate in the cell nucleus. Several factors can influence nuclear accumulation, including but not limited to selective splicing, subunit composition, protein homeostasis, and tyrosine phosphorylation. Nuclear accumulation of CHMP7 can cause damage to the nuclear pore complex, which may lead to TDP-43 dysfunction in ALS. Nuclear accumulation of CHMP7 triggers a series of events involving the recruitment of other ESCRT-III components, resulting in the degradation of proteins that constitute the nuclear pore complex. Due to NPC damage, the protein TDP-43, which normally resides in the nucleus, may leak into the cytoplasm, causing it to lose its normal function in RNA processing. Mislocalization of TDP-43 leads to aberrant RNA splicing and processing, which disrupts the production of proteins essential for neuronal function. TDP-43 dysfunction can trigger cellular stress responses, ultimately leading to neuronal damage and death, characteristic of ALS.

[0107] As used herein, the term "charged multivesicular protein 7" or "CHMP7" refers to a protein involved in a variety of cellular processes, including but not limited to nuclear pore surveillance, nuclear membrane closure, endosome sorting pathways, mitotic nuclear division, and vacuolar transport. CHMP7 is associated with diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia, and spinal muscular atrophy. CHMP7 is part of the ESCRT-III complex, which promotes nuclear membrane sealing and mitotic spindle disintegration. Aberrant nuclear expression and localization of CHMP7 may lead to Nup alterations in ALS.

[0108] The ASO and siRNA described in this article reduce CHMP2B expression, which inhibits or reduces CHMP7 nuclear accumulation. For example, relative to the corresponding CHMP7 nuclear accumulation in reference cells, CHMP7 nuclear accumulation in cells can be reduced by at least about 5% to about 95%, for example, about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more. CHMP7 nuclear accumulation in cells can be completely inhibited relative to the corresponding CHMP7 nuclear accumulation in reference cells. Reference cells can be, but are not limited to, cells before treatment, another cell from the same subject, or cells from a reference subject.

[0109] As used herein, the terms “control” or “reference” refer to a standard or comparative group used to evaluate the efficacy of treatment. Examples of controls or references may include, but are not limited to, untreated cells or subjects, the same cells or subjects before treatment, or cells or subjects treated with non-targeted or disordered oligonucleotides.

[0110] A "targeting agent" or "targeting agent" refers to a molecule that specifically binds to a particular biological target within a cell (such as a protein, enzyme, receptor, or DNA sequence) to produce a desired physiological effect by altering its function. A targeting agent is a specific substance designed to interact with its target to achieve a therapeutic outcome.

[0111] As used in this article, "pathological" refers to abnormal structural or functional changes in cells, tissues, or organs that deviate from their normal state, usually indicating the presence of a disease process.

[0112] As used herein, the term “block” includes inhibition and / or reduction. For example, the CHMP2B agent (1) described herein reduces or decreases CHMP7 nuclear accumulation, i.e., in cells with increased CHMP7 nuclear accumulation, the CHMP2B target agent described herein reduces said nuclear accumulation. Reduction includes any reduction in nuclear accumulation (e.g., a 1% reduction in nuclear accumulation) up to a complete reduction in nuclear accumulation (e.g., restoration to normal levels, or a 100% reduction in nuclear accumulation). After exposure of cells to the CHMP2B target agent, CHMP7 nuclear accumulation in the cells may be reduced or decreased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. Furthermore, the CHMP2B agent (2) described herein inhibits CHMP7 nuclear accumulation, that is, in cells at increased risk of CHMP7 nuclear accumulation, the CHMP2B target described herein inhibits nuclear accumulation before it actually occurs in the cells. Inhibition includes any inhibition of nuclear accumulation (e.g., 1% inhibition of expected / anticipated nuclear accumulation) up to complete inhibition of nuclear accumulation (e.g., complete prevention of nuclear accumulation, or 100% inhibition of nuclear accumulation). After contacting cells with the CHMP2B target, CHMP7 nuclear accumulation in the cells can be inhibited by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0113] In some respects, the cells are neurons. In some respects, the neurons exhibit pathological nuclear accumulation of CHMP7 or are at risk of pathological nuclear accumulation of CHMP7. In some respects, the neurons are derived from subjects with neurodegenerative diseases. In some respects, neurodegenerative diseases include amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration.

[0114] As used herein, "neurodegenerative disease" refers to a disease or condition that, for example, damages motor neurons or their function. The methods described herein can be applied to any neurodegenerative disease. Exemplary neurodegenerative diseases include synucleinopathies, tau diseases, prions, motor neuron diseases, dementia, infectious spongiform encephalopathy, systemic atrophy primarily affecting the central nervous system, trinucleotide repeat disorders, proteopathies, amyloidosis, neuronal cerebrospinal deposits, and other diseases.

[0115] Amyotrophic lateral sclerosis (ALS), also known as motor neuron disease (MND) or Lou Gehrig's disease, is a neurodegenerative disease that causes the progressive loss of motor neurons that control voluntary muscles. ALS is the most common type of motor neuron disease. Early symptoms of ALS include muscle stiffness, muscle twitching, and progressive weakness and muscle atrophy. Limb-onset ALS begins with weakness in the arm or leg, while medullary-onset ALS begins with difficulty speaking or swallowing. Half of ALS patients develop at least mild cognitive and behavioral difficulties, and about 15% develop frontotemporal dementia. Most people experience pain. The affected muscles are responsible for chewing food, speaking, and walking. The loss of motor neurons continues until the ability to eat, speak, move, and eventually breathe is lost. ALS ultimately leads to paralysis and premature death, usually from respiratory failure.

[0116] Alzheimer's disease is characterized by the loss of neurons and synapses in the cerebral cortex and certain subcortical regions. This loss leads to severe atrophy in the affected areas, including the temporal and parietal lobes, as well as degeneration of parts of the frontal cortex and cingulate gyrus. Degeneration is also present in brainstem nuclei, particularly the locus coeruleus in the pons. Studies using MRI and PET have documented the reduction in the size of specific brain regions in Alzheimer's patients as they progress from mild cognitive impairment to Alzheimer's disease, and compared to similar images of healthy older adults. In the brains of Alzheimer's patients, particularly in the hippocampus, both Aβ plaques and neurofibrillary tangles are clearly visible under a microscope. However, Alzheimer's disease can occur without neurofibrillary tangles in the neocortex. Plaques are dense, primarily insoluble deposits of β-amyloid peptides and cellular material outside and around neurons. Tangles (neurofibrillar tangles) are aggregates of the microtubule-associated protein tau, which has become hyperphosphorylated and accumulates within the cell itself. While many older adults develop plaques and tangles as a result of aging, the brains of Alzheimer's patients contain a greater number of plaques and tangles in specific brain regions, such as the temporal lobe. Lewy bodies are not uncommon in the brains of Alzheimer's patients.

[0117] Parkinson's disease (PD), or simply Parkinson's, is a chronic degenerative disorder of the central nervous system that primarily affects the motor system. Symptoms typically develop slowly, and non-motor symptoms become more common as the disease progresses. The most obvious early symptoms are tremor, rigidity, bradykinesia, and difficulty walking. Cognitive and behavioral problems can also occur; many PD patients experience depression, anxiety, and apathy. Parkinson's dementia becomes common in the later stages of the disease. Patients with Parkinson's may also experience problems with their sleep and sensory systems. The motor symptoms of the disease are caused by cell death in the substantia nigra, a region of the midbrain, leading to a lack of dopamine. The cause of this cell death is poorly understood, but it involves the accumulation of misfolded proteins within neurons, forming Lewy bodies. In general, the primary motor symptoms are also referred to as Parkinsonism or Parkinsonian syndrome. There is no known cure for PD; treatment aims to reduce the impact of symptoms. Initial treatment typically involves medications such as levodopa (L-DOPA), MAO-B inhibitors, or dopamine agonists. As the disease progresses, these medications become less effective, producing side effects characterized by involuntary muscle movements. At this point, medications can be used in combination, and the dosage can be increased. Diet and certain forms of rehabilitation have shown some effectiveness in improving symptoms. In severe cases where medication is ineffective, surgical placement of microelectrodes for deep brain stimulation has been used to alleviate motor symptoms. The main pathological feature of PD is cell death in the basal ganglia of the brain (affecting up to 70% of dopamine-secreting neurons in the substantia nigra pars compacta by the end of life). In Parkinson's disease, alpha-synuclein becomes misfolded and aggregates with other alpha-synuclein proteins. Cells are unable to clear these aggregates, and the alpha-synuclein proteins become cytotoxic, damaging cells. These aggregates can be observed in neurons under a microscope and are called Lewy bodies. Neuronal loss is accompanied by the death of astrocytes (star-shaped glial cells) and a significant increase in the number of microglia (another type of glial cell) in the substantia nigra. The Braak staging is a way of explaining the progression of PD in affected brain regions. According to this staging, PD begins in the medulla and olfactory bulb, then moves to the substantia nigra pars compacta and the rest of the midbrain / basal forebrain. When the disease begins to affect the substantia nigra pars compacta, it is associated with the onset of motor symptoms. Brain cells may be lost through several proposed mechanisms. One mechanism involves the abnormal accumulation of α-synuclein, a protein that binds to ubiquitin, in damaged cells. This insoluble protein accumulates within neurons, forming inclusion bodies called Lewy bodies.According to the Braak staging system (a disease classification based on pathological findings proposed by Heiko Braak), Lewy bodies first appear in the olfactory bulb, medulla oblongata, and pontine tegmentum; individuals at this stage may be asymptomatic or may have early nonmotor symptoms (such as loss of smell, or some sleep or autonomic dysfunction). As the disease progresses, Lewy bodies develop in the substantia nigra, midbrain, and basal forebrain regions, and finally the neocortex. These brain regions are the main sites of neuronal degeneration in PD, but Lewy bodies may not cause cell death, and they may be protective (abnormal proteins are isolated or blocked).

[0118] Pick's disease is a rare form of dementia that affects the frontal and temporal lobes of the brain. It is also known as frontotemporal dementia (FTD). FTD is likely caused by damage to nerve cells in the frontal and temporal lobes and the breakdown of connections between the frontal and temporal lobes and the rest of the brain.

[0119] Frontotemporal degeneration (FTLD) is characterized by progressive neuronal loss primarily involving the frontal or temporal lobes, with typical loss of over 70% of spindle neurons while other neuronal types remain intact. Three main histological subtypes have been identified postmortem: FTLD-tau, FTLD-TDP, and FTLD-FUS. In rare cases, patients with clinical FTD have been found to have alterations consistent with Alzheimer's disease at autopsy. The most severe brain atrophy is associated with behaviorally variant FTD and corticobasal degeneration. Regarding identified genetic defects, duplication amplification in the C9orf72 gene is considered a major contributing factor to frontotemporal degeneration, although defects in the GRN and MAPT genes are also associated.

[0120] Huntington's disease, also known as chorea, is a genetic disorder that causes involuntary movements and other symptoms. It is characterized by uncontrollable, spastic movements affecting the face, arms, legs, and trunk; difficulties with memory, learning, concentration, and multitasking; irritability, depression, bipolar disorder, paranoia, and psychosis; impulsivity, outbursts of anger, and aggression; muscle stiffness, balance problems, and difficulty swallowing. Huntington's disease is caused by a genetic mutation in the HTT gene.

[0121] Mild cognitive impairment (MCI) is a condition that causes problems with memory or thinking, which are more severe than those typically seen in a person of that age. The symptoms of MCI are less severe than those of Alzheimer's disease or related dementias. MCI is a diagnosis that reflects an intermediate stage of cognitive impairment.

[0122] Lewy body dementia (LBD) is a progressive brain disorder that causes abnormal protein deposits to accumulate in the brain. These deposits, known as Lewy bodies, disrupt brain chemicals and lead to problems with thinking, movement, mood, and behavior.

[0123] Multiple system atrophy (MSA) is a rare, progressive, and debilitating disease that affects the brain and nervous system. MSA causes gradual damage to nerve cells in the brain. This affects the balance, motor, and autonomic nervous systems, which control several basic functions such as breathing, digestion, and bladder control.

[0124] Progressive supranuclear palsy (PSP) is a rare neurological disorder that affects body movement, walking, balance, and eye movements. PSP is caused by damage to nerve cells in brain regions that control thought and body movement. PSP is caused by the accumulation of tau, a protein that is normally broken down in the brain.

[0125] Corticobasal degeneration (CBD) is a rare brain disease that leads to the gradual loss of brain cells and function. CBD is characterized by the degeneration of brain cells in the cerebral cortex and basal ganglia.

[0126] As used herein, the terms “TAR DNA-binding protein 43” or “TDP-43” refer to a protein that accumulates in the brain and is associated with several neurodegenerative diseases. TDP-43 is an intracellular protein essential for RNA processing. Examples of neurodegenerative diseases associated with TDP-43 include, but are not limited to, ALS, frontotemporal dementia (FTD), Alzheimer's disease, and limbic-predominant age-related TDP-43 encephalopathy (LATE).

[0127] As used in this article, “TDP-43 loss of function” refers to a condition in which TDP-43 fails to function properly, leading to disrupted gene expression and ultimately contributing to neurodegeneration, commonly associated with diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal degeneration (FTLD). In TDP-43-related neurodegenerative diseases, this protein may accumulate and aggregate in the cytoplasm (cytoplasmic mislocalization and aggregation), resulting in the depletion of functional TDP-43 in the nucleus, where it is needed (nuclear depletion).

[0128] In some respects, agents targeting CHMP2B expression are siRNA, ASO, small molecule inhibitors, or combinations thereof. In some respects, ASO comprises nucleic acid sequences of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or combinations thereof.

[0129] In some embodiments, this disclosure provides a method for reducing or inhibiting Nup turnover in cells, the method comprising contacting cells with an agent that targets CHMP2B expression in cells, thereby reducing or inhibiting Nup turnover in the cells. For example, Nup turnover in the cell may be reduced by at least about 5% to about 95% relative to a corresponding Nup turnover in a reference cell, for example, about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. Nup turnover in the cell may be silenced relative to a corresponding Nup turnover in a reference cell. The reference cell may be, but is not limited to, a cell before treatment, another cell from the same subject, or a cell from a subject treated with a control.

[0130] In some embodiments, this disclosure provides a method for preventing Nup turnover in cells, including contacting cells with an agent that targets CHMP2B expression in the cells, thereby preventing Nup turnover in the cells.

[0131] As used herein, the term “block” includes inhibition and / or reduction. For example, the CHMP2B agent (1) described herein reduces or decreases Nup turnover, i.e., in cells with increased Nup turnover, the CHMP2B target described herein reduces Nup turnover. This reduction includes any reduction in Nup turnover (e.g., a 1% reduction in Nup turnover) up to a complete reduction in Nup turnover (e.g., a return to normal levels, or a 100% reduction in Nup turnover). After exposing cells to the CHMP2B target, Nup turnover in cells may be reduced or decreased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. Furthermore, the CHMP2B agent (2) described herein inhibits Nup turnover, that is, in cells at risk of increased Nup turnover, the CHMP2B target described herein inhibits said Nup turnover before it actually occurs in the cell. Inhibition includes any inhibition of Nup turnover (e.g., 1% inhibition of Nup turnover that would otherwise be expected / anticipated) up to complete inhibition of Nup turnover (e.g., complete prevention of Nup turnover, or 100% inhibition of Nup turnover). After exposing cells to the CHMP2B target, Nup turnover in the cell can be inhibited by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0132] In some respects, targeting CHMP2B expression includes reducing CHMP2B expression in cells.

[0133] In some respects, reducing CHMP2B in cells includes: reducing or inhibiting the accumulation of CHMP7 nuclei in cells compared to the accumulation of CHMP7 nuclei in cells treated with a control agent or before cells are exposed to an agent targeting CHMP2B.

[0134] In some respects, reducing or inhibiting the accumulation of CHMP7 nuclei in cells reduces Nup turnover in cells compared to Nup turnover in cells treated with a control agent or in cells before exposing them to an agent targeting CHMP2B.

[0135] In some respects, the cell is a neuron.

[0136] In some respects, neurons exhibit pathological Nup turnover or are at risk of Nup turnover occurring within the cell.

[0137] In some respects, the neurons were derived from subjects with amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration.

[0138] In some respects, agents targeting CHMP2B expression are siRNA, ASO, or combinations thereof. In some respects, ASO comprises nucleic acid sequences of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or combinations thereof.

[0139] In some embodiments, this disclosure provides a method for reducing or inhibiting nuclear pore complex (NPC) damage in cells, the method comprising contacting cells with an agent that targets CHMP2B expression in the cells, thereby reducing or inhibiting NPC damage in the cells.

[0140] In some embodiments, this disclosure provides a method for preventing damage to the nuclear pore complex (NPC) in cells, the method comprising contacting cells with an agent targeting CHMP2B expression in the cells, thereby preventing NPC damage in the cells.

[0141] As used herein, the term “block” includes inhibition and / or reduction. For example, the CHMP2B agent (1) described herein reduces or diminishes NPC damage, i.e., in cells with increased NPC damage, the CHMP2B target described herein reduces NPC damage. Reduction includes any reduction in NPC damage (e.g., a 1% reduction in NPC damage) up to a complete reduction in NPC damage (e.g., restoration to normal levels, or a 100% reduction in NPC damage). Upon exposure of cells to the CHMP2B target, Nup damage in cells may be reduced or diminished by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. Furthermore, the CHMP2B agent (2) described herein inhibits Nup damage, that is, in cells at an increased risk of Nup damage, the CHMP2B target described herein inhibits said Nup damage before it actually occurs in the cells. Inhibition includes any inhibition of NPC damage (e.g., 1% inhibition of NPC damage that would otherwise be expected / anticipated) up to complete inhibition of NPC damage (e.g., complete prevention of NPC damage, or 100% inhibition of NPC damage). After contacting cells with the CHMP2B target, Nup damage in cells can be inhibited by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0142] In some respects, targeting CHMP2B expression includes reducing CHMP2B expression in cells.

[0143] In some respects, reducing CHMP2B in cells includes: reducing or inhibiting the accumulation of CHMP7 nuclei in cells compared to the accumulation of CHMP7 nuclei in cells treated with a control agent or before cells are exposed to an agent targeting CHMP2B.

[0144] In some respects, reducing or inhibiting the nuclear accumulation of CHMP7 in cells includes reducing or inhibiting Nup turnover in cells compared to Nup turnover in cells treated with a control agent or in cells before exposing cells to an agent targeting CHMP2B.

[0145] In some respects, reducing or inhibiting Nup turnover in cells includes reducing or inhibiting NPC damage in cells compared to NPC damage in cells treated with a control agent or NPC damage in cells before exposing cells to an agent targeting CHMP2B.

[0146] In some respects, the cells are neurons. In some respects, neurons exhibit NPC damage or are at risk of developing NPC damage within the cell. In some respects, the neurons are derived from subjects with amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration.

[0147] In some respects, agents that target CHMP2B expression are siRNA, ASO, or combinations thereof.

[0148] In some respects, the ASO contains nucleic acid sequences of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or combinations thereof.

[0149] In some embodiments, this disclosure provides a method for reducing or inhibiting TDP-43 mislocalization in cells, the method comprising contacting cells with an agent targeting CHMP2B expression in the cells, thereby reducing or inhibiting TDP-43 mislocalization in the cells.

[0150] In some embodiments, this disclosure provides a method for preventing TDP-43 mislocalization in cells, the method comprising contacting cells with an agent targeting CHMP2B expression in the cells, thereby preventing TDP-43 mislocalization in the cells.

[0151] As used herein, the term “block” includes inhibition and / or reduction. For example, the CHMP2B agent (1) described herein reduces or diminishes TDP-43 mislocalization, i.e., in cells with increased TDP-43 mislocalization, the CHMP2B target described herein reduces TDP-43 mislocalization. Reduction includes any reduction in TDP-43 mislocalization (e.g., a 1% reduction in TDP-43 mislocalization) up to a complete reduction in TDP-43 mislocalization (e.g., restoration to normal levels, or a 100% reduction in TDP-43 mislocalization). After exposure of cells to the CHMP2B target, TDP-43 mislocalization in cells may be reduced or diminished by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. Furthermore, the CHMP2B agent (2) described herein inhibits TDP-43 mislocalization, that is, in cells exhibiting an increased risk of TDP-43 mislocalization, the CHMP2B agent described herein inhibits TDP-43 mislocalization before it actually occurs in the cell. Inhibition includes any inhibition of TDP-43 mislocalization (e.g., 1% inhibition of TDP-43 mislocalization that would otherwise be expected / anticipated) up to complete inhibition of TDP-43 mislocalization (e.g., complete prevention of TDP-43 mislocalization, or 100% inhibition of TDP-43 mislocalization). After exposing cells to the CHMP2B target, TDP-43 mislocalization in cells was inhibited by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0152] In some respects, CHMP2B expression includes the reduction of CHMP2B expression in cells.

[0153] In some respects, reducing CHMP2B in cells includes: reducing or inhibiting the accumulation of CHMP7 nuclei in cells compared to the accumulation of CHMP7 nuclei in cells treated with a control agent or before cells are exposed to an agent targeting CHMP2B.

[0154] In some respects, reducing or inhibiting the nuclear accumulation of CHMP7 in cells includes reducing or inhibiting Nup turnover in cells compared to Nup turnover in cells treated with a control agent or in cells before exposing cells to an agent targeting CHMP2B.

[0155] In some respects, reducing or inhibiting Nup turnover in cells includes reducing or inhibiting NPC damage in cells compared to NPC damage in cells treated with a control agent or NPC damage in cells before exposing cells to an agent targeting CHMP2B.

[0156] In some respects, reducing or inhibiting NPC damage in cells includes reducing or inhibiting TDP-43 mislocalization in cells compared to TDP-43 mislocalization in cells treated with a control agent or in cells before exposing cells to an agent targeting CHMP2B.

[0157] In some respects, the cell is a neuron.

[0158] In some respects, neurons exhibit TDP-43 mislocalization or are at risk of TDP-43 mislocalization within the cell.

[0159] In some respects, the neurons were derived from subjects with amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration.

[0160] In some respects, agents targeting CHMP2B expression are siRNA, ASO, or combinations thereof. In some respects, ASO comprises nucleic acid sequences of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or combinations thereof.

[0161] In some embodiments, this disclosure provides a method for reducing or inhibiting TDP-43 loss of function in cells, the method comprising regulating CHMP2B expression in cells, including contacting cells with an agent targeting CHMP2B expression in cells, thereby reducing or inhibiting TDP-43 loss of function in cells.

[0162] In some embodiments, this disclosure provides a method for preventing TDP-43 loss of function in cells, comprising contacting cells with an agent that targets CHMP2B expression in the cells, thereby preventing TDP-43 loss of function.

[0163] As used herein, the term “block” includes inhibition and / or reduction. For example, the CHMP2B agent (1) described herein reduces or diminishes TDP-43 loss of function, i.e., in cells with increased TDP-43 loss of function, the CHMP2B target described herein reduces TDP-43 loss of function. Reduction includes any reduction in TDP-43 loss of function (e.g., a 1% reduction in TDP-43 loss of function) up to a complete reduction in TDP-43 loss of function (e.g., restoration to normal levels, or a 100% reduction in TDP-43 loss of function). After exposure of cells to the CHMP2B target, TDP-43 loss of function in cells may be reduced or diminished by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. Furthermore, the CHMP2B agent (2) described herein inhibits TDP-43 loss of function, that is, in cells presenting an increased risk of TDP-43 loss of function, the CHMP2B target described herein inhibits said TDP-43 loss of function before it actually occurs in the cells. Inhibition includes any inhibition of TDP-43 loss of function (e.g., 1% inhibition of TDP-43 loss of function that would otherwise be expected / anticipated) up to complete inhibition of TDP-43 loss of function (e.g., complete prevention of TDP-43 loss of function, or 100% inhibition of TDP-43 loss of function). After exposing cells to the CHMP2B target, the loss of TDP-43 function in cells was inhibited by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0164] In some respects, targeting CHMP2B expression includes reducing CHMP2B expression in cells.

[0165] In some respects, reducing CHMP2B in cells includes: reducing or inhibiting the accumulation of CHMP7 nuclei in cells compared to the accumulation of CHMP7 nuclei in cells treated with a control agent or before cells are exposed to an agent targeting CHMP2B.

[0166] In some respects, reducing or inhibiting the nuclear accumulation of CHMP7 in cells includes reducing or inhibiting Nup turnover in cells compared to Nup turnover in cells treated with a control agent or in cells before exposing cells to an agent targeting CHMP2B.

[0167] In some respects, reducing or inhibiting Nup turnover in cells includes reducing or inhibiting NPC damage in cells compared to NPC damage in cells treated with a control agent or NPC damage in cells before exposing cells to an agent targeting CHMP2B.

[0168] In some respects, reducing or inhibiting NPC damage in cells includes reducing or inhibiting TDP-43 mislocalization in cells compared to TDP-43 mislocalization in cells treated with a control agent or in cells before exposing cells to an agent targeting CHMP2B.

[0169] In some respects, reducing or inhibiting NPC damage in cells includes reducing or inhibiting the loss of TDP-43 function in cells compared to the loss of TDP-43 function in cells treated with a control agent or the loss of TDP-43 function in cells before exposing cells to an agent targeting CHMP2B.

[0170] In some respects, TDP-43 loss of function is caused by TDP-43 nuclear depletion, TDP-43 cytoplasmic mislocalization, TDP-43 aggregation, or a combination thereof.

[0171] In some respects, the cell is a neuron.

[0172] In some respects, neurons exhibit loss of TDP-43 function or are at risk of losing TDP-43 function in the cell.

[0173] In some respects, the neurons were derived from subjects with amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration.

[0174] In some respects, agents that target CHMP2B expression are siRNA, ASO, or combinations thereof.

[0175] In some respects, the ASO contains nucleic acid sequences of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or combinations thereof.

[0176] In some embodiments, this disclosure provides a method for treating neurodegenerative diseases in a subject, the method comprising modulating CHMP2B expression in the subject, including administering an agent targeting CHMP2B to the subject, thereby treating the neurodegenerative disease.

[0177] In some embodiments, this disclosure provides a method for preventing neurodegenerative diseases in subjects at risk of developing such diseases, the method comprising modulating CHMP2B expression in the subject, including administering an agent targeting CHMP2B to the subject to prevent neurodegenerative diseases.

[0178] In this document, the term “treatment” is used interchangeably with the terms “treatment method” or “therapy” and refers to 1) therapeutic treatments or measures that cure, alleviate, or reduce the symptoms of a diagnosed pathological condition or ailment, and / or prevent its progression, and / or 2) preventive / protective measures. Individuals requiring treatment may include those who already have a specific medical condition, as well as those who may eventually develop the condition (i.e., those requiring preventive measures).

[0179] The terms “therapeutic effective dose,” “effective dose,” “therapeutic effective dose,” and “effective amount” refer to the amount of a subject compound that will elicit a biological or medical response in a tissue, system, animal, or human that is sought by an investigator, veterinarian, physician, or other clinician. Typically, a response is an improvement in symptoms or a desired biological outcome in a patient (e.g., treatment of ALS). Such an amount should be sufficient to increase neuronal survival. An effective dose can be determined as described herein.

[0180] The terms “administration of” and / or “administering” should be understood as referring to the provision of a therapeutically effective amount of a pharmaceutical composition to a subject in need of treatment. Routes of administration may be enteric, topical, or parenteral. Therefore, routes of administration include, but are not limited to, intradermal, subcutaneous, intravenous, intraperitoneal, intraarterial, intrasheathal, intracapsular, intraorbital, intracardiac, intradermal, percutaneous, transtracheal, subepidermal, intra-articular, subcapsular, subarachnoid, intraspinal, and intrasternal, oral, sublingual, sublingual, rectal, vaginal, nasal / ocular administration, as well as infusion, inhalation, and nebulization. As used herein, the terms “parenteral administration” and “administered parenterally” refer to modes of administration other than enteric and topical administration. Examples of routes of administration include, but are not limited to, inhalation, ear, mouth, conjunctiva, teeth, cervix, sinus, trachea, intestine, epidural, extraamniotic, in vitro, hemodialysis, infiltration, interstitium, intraperitoneal cavity, amniotic cavity, artery, joint, bile duct, bronchus, sac, heart, cartilage, tail, corpus cavernosum, cavity, ventricle, cisterns, cornea, coronary plane, coronary artery, corpus cavernosum of the penis, skin, intervertebral disc, duct, duodenum, dura mater, epidermis, esophagus, stomach, gingiva, hippocampus, ileum, lesion, lumen, lymphatic vessels, intramedullary, meninges, muscle, eye, ovary, and pericardium. Intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinus, intraspinal, intrasynovial, intratendonal, intratesticular, intrathoracic cavity, intracanal, intratumoral, intratympanic cavity, intrauterine, intravascular, intravenous, intravenous bolus, intravenous drip, intravesical, intravitreal, iontophoresis, irrigation, larynx, nose, nasogastric, ocular, oral, oropharyngeal, extraintestinal, percutaneous, periarticular, epidural, perineural, periodontal, rectal, retroocular, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, local, transdermal, transmucosal, transplacental, transtracheal, transtympanic membrane, ureter, urethra, vagina, infraorbital, intraparenchymal, intrathecal, intravenous, stereotactic, or any combination thereof.

[0181] Depending on the method of administration, pharmaceutical compositions can be administered in a variety of unit dosage forms. Suitable unit dosage forms include, but are not limited to, powders, tablets, pills, capsules, lozenges, suppositories, patches, nasal sprays, injectable formulations, implantable sustained-release formulations, and lipid complexes.

[0182] In some respects, administration may be combined with one or more other therapeutic agents. The terms "combination therapy," "in combination with," etc., refer to the simultaneous use of more than one drug or treatment to enhance response. The compositions of the present invention may be used, for example, in combination with other drugs or treatments for the treatment of neurodegenerative diseases. Specifically, administration of a CHMP2B-targeting agent to a subject may be combined with edaravone, riluzole, AMX0035, and / or tovson. Such therapy may be administered before, simultaneously with, or after the administration of the compositions of the present invention.

[0183] Throughout, "treat," "treating," and "treatment" refer to methods that reduce or delay one or more effects or symptoms of a neurodegenerative disease or disorder. The subject may be diagnosed with a disease or disorder. Treatment can also refer to methods that reduce underlying pathology rather than just symptoms. Effects administered to the subject may include, but are not limited to, reducing one or more symptoms of a neurodegenerative disease or disorder, reducing the severity of a neurological disease or injury, completely eliminating a neurological disease or injury, or delaying the onset or worsening of one or more symptoms.

[0184] For example, if a subject experiences a reduction of approximately 10% in one or more symptoms of the disease compared to before treatment, or compared to a control subject or control value, the disclosed method is considered a treatment. Therefore, the reduction can be approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any reduction in between.

[0185] As used herein, the term “block” includes inhibition and / or reduction. For example, the CHMP2B agent (1) described herein reduces or decreases neuronal cell death in subjects where neuronal cell death is present, and the CHMP2B target agent described herein reduces neuronal cell death. Reduction includes any reduction in neuronal cell death (e.g., a 1% reduction in neuronal cell death) up to a complete reduction in neuronal cell death (e.g., restoration to normal levels, or a 100% reduction in neuronal cell death). After administration of a CHMP2B target agent to a subject, neuronal cell death in the subject may be reduced or decreased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. Furthermore, the CHMP2B agent (2) described herein inhibits neuronal cell death in subjects presenting with an increased risk of neuronal cell death, and the CHMP2B target agent described herein inhibits said neuronal cell death before it actually occurs in the subject. Inhibition includes any inhibition of neuronal cell death (e.g., 1% inhibition of expected / anticipated neuronal cell death) up to complete inhibition of neuronal cell death (e.g., complete prevention of neuronal cell death, or 100% inhibition of neuronal cell death). After administration of the CHMP2B target agent to a subject, neuronal cell death in the subject can be inhibited by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0186] As used herein, the term "subject" refers to any individual or patient to whom the methods of this subject matter are applied. Typically, a subject is a human being, although, as those skilled in the art will understand, a subject may be a non-human animal. Thus, other animals, including vertebrates such as rodents (including mice, rats, hamsters, and guinea pigs), cats, dogs, rabbits, farm animals including cattle, horses, goats, sheep, pigs, chickens, etc., and primates (including monkeys, chimpanzees, orangutans, and gorillas), are also included in the definition of a subject.

[0187] The methods described in this article for treating or preventing neurodegenerative diseases include administering agents that target CHMP2B expression to modulate CHMP2B expression in a subject. In some aspects, targeting CHMP2B expression includes reducing CHMP2B expression in cells derived from the subject.

[0188] In some respects, reducing CHMP2B expression in cells includes reducing or inhibiting CHMP7 nuclear accumulation in the subject's cells compared to CHMP7 nuclear accumulation in the subject's cells treated with a control agent or CHMP7 nuclear accumulation in the subject's cells prior to treatment with an agent targeting CHMP2B.

[0189] In some respects, reducing or inhibiting the nuclear accumulation of CHMP7 in the cells of the subject includes reducing or inhibiting Nup turnover in the cells of the subject compared to Nup turnover in the cells of the subject treated with a control agent or Nup turnover in the cells of the subject prior to treatment with an agent targeting CHMP2B.

[0190] In some respects, reducing or inhibiting Nup turnover from the subject's cells includes: reducing or inhibiting NPC damage from the subject's cells compared to NPC damage from the subject's cells treated with a control agent or NPC damage from the subject's cells before treatment with an agent targeting CHMP2B.

[0191] In some respects, reducing or inhibiting NPC damage includes: reducing or inhibiting TDP-43 mislocalization in the subject's cells compared to TDP-43 mislocalization in the subject's cells before treatment with a CHMP2B-targeting agent or in the subject's cells before treatment with a CHMP2B-targeting agent.

[0192] In some respects, reducing TDP-43 mislocalization includes reducing or inhibiting TDP-43 loss of function in the subject's cells compared to TDP-43 loss of function in the subject's cells before treatment with an agent targeting CHMP2B.

[0193] In some respects, TDP-43 loss of function is caused by nuclear depletion of TDP-43 in cells from the subject, mislocalization of TDP-43 in the cytoplasm, TDP-43 aggregation, or a combination thereof.

[0194] In some respects, the cell is a neuron.

[0195] In some respects, CHMP2B-targeting agents target the CHMP7-CHMP2B protein interaction. In other respects, CHMP2B-targeting agents are nucleic acids, proteins, peptides, or small molecules.

[0196] In some respects, agents targeting CHMP2B expression are siRNA, ASO, or combinations thereof. In some respects, ASO comprises nucleic acid sequences of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or combinations thereof.

[0197] In some respects, neurodegenerative diseases include amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration. In some respects, neurodegenerative diseases are amyotrophic lateral sclerosis (ALS). In some respects, ALS is sporadic.

[0198] In some respects, the treatment of neurodegenerative diseases also includes administering edaravone, riluzole, AMX0035, tofensin, or combinations thereof to the subject.

[0199] In some cases, it is administered orally, systemically, parenterally, intrathecally, intranasally, intravenously, subcutaneously, intraventricularly, by inhalation, or via suppositories.

[0200] As used in this article, the term "nuclear pore complex" or "NPC" refers to a large protein assembly embedded in the nuclear membrane that regulates molecular movement between the cell nucleus and cytoplasm. NPCs are present in the nuclear membrane of eukaryotic cells. Damage to NPCs may be caused by the abnormal accumulation of CHMP7 in the nucleus. Disruption of normal NPC transport function is commonly associated with neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS).

[0201] In some respects, reducing NPC damage includes increasing POM121 expression, POM121 turnover, or a combination thereof.

[0202] As used herein, the term "POM121" refers to a transmembrane nuclear pore protein that functions as a key component of the nuclear pore protein (NPC). POM121 plays a crucial role in NPC assembly, particularly during interphase of nuclear membrane remodeling following cell division. POM121 anchors the NPC to the nuclear membrane by forming a pre-pore around it as part of a complex. POM121 is a type I transmembrane protein essential for the early stages of NPC assembly. POM121 has a very low turnover rate in living mammalian cells.

[0203] Nup turnover is the process by which nuclear pore complex (NPC) proteins, or Nup, are degraded and replaced. The rate of Nup turnover varies depending on cell type, the role of Nup, and whether the cell is dividing. Mechanisms affecting Nup turnover include, but are not limited to, the ESCRT-III pathway, NPC autophagy, and proteasome degradation.

[0204] In some respects, administration of agents targeting CHMP2B increased cell survival in subjects. For example, cell survival in subjects could increase by at least 0.5-10 times compared to pre-treatment cell survival or cell survival in diseased subjects. Cell survival in subjects could increase by at least 0.5 times compared to pre-treatment cell survival or cell survival in diseased subjects. Cell survival in subjects could increase by at least 1.5 times compared to pre-treatment cell survival or cell survival in diseased subjects. Cell survival in subjects could increase by at least 3 times compared to pre-treatment cell survival or cell survival in diseased subjects. Cell survival in subjects could increase by at least 5 times compared to pre-treatment cell survival or cell survival in diseased subjects. Cell survival in subjects could increase by at least 10 times compared to pre-treatment cell survival or cell survival in diseased subjects.

[0205] Edaravone is used to treat patients with amyotrophic lateral sclerosis (ALS). Edaravone is a free radical scavenger that eliminates and inhibits the production of hydroxyl radicals and peroxynitroso radicals. Edaravone can be administered intravenously and orally.

[0206] Riluzole is a neuroprotective drug used to treat amyotrophic lateral sclerosis (ALS) and other motor neuron diseases. Riluzole works by blocking the release of glutamate and increasing its reuptake.

[0207] AMX0035 or Relyvrio combines two compounds, sodium phenylbutyrate and taurine, to target and alleviate neurodegeneration by addressing two key cellular pathways believed to significantly contribute to neuronal cell death: endoplasmic reticulum (ER) stress and mitochondrial dysfunction. This combination of drugs aims to reduce neuronal death by alleviating stress within the ER and improving mitochondrial function.

[0208] Qalsody, or toffson, is an antisense oligonucleotide used to treat amyotrophic lateral sclerosis (ALS). By binding to superoxide dismutase 1 (SOD1) mRNA, Qalsody leads to the degradation of SOD1 mRNA and a reduction in SOD1 protein synthesis.

[0209] This disclosure also relates to methods for using the peptide in the diagnosis and treatment of diseases such as amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, and frontotemporal degeneration. Neurodegenerative diseases are characterized by selective neurodegeneration in specific regions of the brain and spinal cord. Amyotrophic lateral sclerosis (ALS), commonly known as Lou Gehrig's disease, is a progressive neurodegenerative disease of unknown etiology. The disease gradually impairs an individual's ability to control voluntary muscle movement. It tends to progress rapidly, leading to paralysis and death within 2–5 years of diagnosis in most cases.

[0210] This disclosure demonstrates that the ESCRT-III protein CHMP2B plays a central role in initiating CHMP7-mediated NPC damage in sALS iPSNs. Specifically, CHMP2B promotes the "activation" of CHMP7 within the nucleus, thereby triggering a reduction in POM121 in the early stages of the NPC damage cascade. Interestingly, sustained CHMP2B-mediated activation underlies the pathological nuclear accumulation / retention of CHMP7 observed in sALS. Crucially, modest reduction of CHMP2B protein via antisense oligonucleotides (ASO) or siRNA approaches eliminates CHMP7 nuclear accumulation, restores POM121 nuclear localization and expression, and alleviates TDP-43 dysfunction in sALS iPSNs. Thus, these data define the potential cellular biological mechanisms underlying CHMP7 nuclear accumulation and subsequent NPC damage initiation in sALS pathogenesis. Furthermore, this study highlights the potential of CHMP2B itself, targeting the CHMP7-CHMP2B protein interaction, as a therapeutic strategy for sALS.

[0211] In summary, this disclosure provides evidence of the role of CHMP2B in promoting CHMP7 activation in human iPSNs to monitor and maintain NPCs via ESCRT-III mediated surveillance. Furthermore, it demonstrates that sustained CHMP7 activation is sufficient to drive NPC damage in sALS. Therefore, ASO or siRNA-mediated CHMP2B knockdown alleviates the pathological reduction of POM121 and downstream defects in TDP-43 function in sALS iPSNs. Thus, these data mechanistically suggest that CHMP2B-mediated CHMP7 activation is a significant contributor to ESCRT-III NPC surveillance and maintenance in human neurons, and highlight partial reduction of CHMP2B as a potential therapeutic strategy to mitigate the cascade of NPC damage in sALS.

[0212] The following presents examples discussing targeting CHMP2B expression to treat the anticipated ALS pathology in the discussed applications. The examples are provided to further illustrate embodiments of the invention but are not intended to limit the scope of the invention. While they are typical of those that can be used, other procedures, methods, or techniques known to those skilled in the art may be used alternatively.

[0213] Example Example 1 method iPSC maintenance and differentiation Control and sALS iPSC lines were obtained from Cedars Sinai's Answer ALS repository (see Table 1 for demographic information). Based on a recent analysis of 180 iPSC lines, patient iPSC lines with similar TDP-43 loss-of-function molecular marker patterns were selected for this study. iPSCs were maintained in mTeSR Plus medium as previously described. Hybrid spinal cord neuron cultures were generated using a recently described improved direct induced motor neuron (diMN) differentiation protocol. All iPSC and iPSN cultures were maintained at 37 °C with 5% CO2 and routinely tested negative for mycoplasma.

[0214] Table 1: Demographic Information of the iPSC System iPSN ASO processing The previously described non-targeted disordered control and ASO targeting human CHMP7 are provided. The ASO targeting human CHMP2B was independently designed and synthesized by IDT. All ASOs were gapmers containing thiophosphate bonds and modified with 2'-O-methoxyethyl (2'MOE). ASO sequences are provided in Table 2. Throughout this manuscript, CHMP2B ASO 3 was used in all iPSN experiments. ASO administration (5 µM) began at the time points indicated in the figure description. During the experimental duration, the medium was changed and ASO was replenished every 3–4 days.

[0215] Table 2: ASO Sequences siRNA-mediated knockdown in iPSN The Dharmacon ON-TARGETplus SMARTPool CHMP2B and untargeted (NT) SMARTPool siRNA were delivered to iPSNs using the Lonza 4D nuclear transfection system. At the time points indicated in the figure description, iPSNs were nuclear transfected in suspension with 500 nM siRNA using the Lonza P3 Primary Cell 4D Nucleofector kit and program DC-104. Following nuclear transfection, iPSNs were replated, and the medium was changed every 3–4 days for the duration of the experiment, as indicated in the figure.

[0216] CHMP2B knockdown begins on day 15 of differentiation (the time when the nuclear localization of CHMP7 in sALS iPSN begins to increase).

[0217] Differentiation was initiated on day 60 following knockdown of NPC damage and TDP-43 loss of function and mislocalization in control and saLS iPSN.

[0218] Plasmid expression in iPSN The CHMP7 and POM121 RITE plasmids and their sources are detailed in Table 3. Flag-tagged CHMP7 open plasmids, CHMP7 ΔHelix 6 plasmids, and CHMP7 NES1 plasmids are also included. / NES2 The plasmids were synthesized using Genscript. The gene sequences were cloned into the pcDNA3.1 plasmid backbone using BamHI and XhoI restriction sites. CHMP7 open was generated by removing the last 84 amino acids, truncating CHMP7 at amino acid 369. CHMP7 Δhelix6 was generated by removing amino acids 420-430. CHMP7 NES1 / NES2 The iPSNs were generated by L-to-A amino acid substitutions at amino acid positions 388 and 430 within the CHMP7 NES1 and NES2 sequences, respectively. At the time points indicated in the legend, iPSNs were dissociated with acutase to generate single-cell suspensions, as previously described. Plasmid DNA was delivered to the iPSNs in the suspension using the P3 Primary Cell 4D Nucleofector kit and program DC-104 on a 4D Nucleofector. Each cuvette contained 4 × 10^6 iPSNs and 4 µg of plasmid DNA. Following nuclear transfection, the iPSNs were replated. The medium was changed after 24 h, and thereafter every 3–4 days for the duration of the experiment. For experiments using the flag-tagged CHMP7 plasmid, iPSNs were treated with neomycin for 24 h each time the medium was changed to enrich iPSNs expressing the plasmid DNA of interest.

[0219] Table 3: Plasmid Information Immunostaining and confocal imaging in iPSN To facilitate monolayer-based imaging, iPSNs were re-plated onto a glass-based imaging plate 10 days prior to fixation, following a recently described protocol. At the time points indicated in the figure description, iPSNs were fixed for 15 min at room temperature with 4% paraformaldehyde (PFA) in 1X PBS. The iPSNs were then washed 3 × 10⁻⁶ min with 1X PBS at room temperature and permeabilized for 15 min with 1X PBS containing 0.01% Triton X-100 at room temperature. Blocking was then performed by incubating the iPSNs in 10% goat serum / 1X PBS solution for 30 min at room temperature. The iPSNs were then incubated with primary antibody diluted in the blocking solution (see Table 4) at room temperature for 2 h. After incubation with primary antibody, the iPSNs were washed 3 × 10⁻⁶ min with 1X PBS and then incubated with secondary antibody diluted in the blocking solution (see Table 4) at room temperature for 45 min. The iPSN 1X was then washed with 1X PBS, incubated with Hoechst solution (1:1000 in 1X PBS) at room temperature for 10 min, and finally washed with 1X PBS for 10 min. No rotation was used in any step. All additions and removals of solutions were performed manually using a P1000 pipette to prevent iPSN detachment from the culture dish. The iPSN was secured with Prolong Gold Antifade reagent and clipped in a 15 mm glass coverslip for imaging and storage. Confocal imaging was performed using a Zeiss LSM 980 confocal microscope with an AiryScan 2 and either a 20X or 63X objective. Standard frame-scan confocal imaging parameters were used for image acquisition. All images were acquired using the same imaging parameters for each immunostaining protein in a given experiment. Nucleus, cytoplasm, and whole-cell intensity were measured in FIJI. As previously described, regions of interest were manually delineated using DAPI and Map2 to define the nucleus and cell body compartments, respectively. Then, based on the defined region of interest, the integrated density is measured in the channel of interest. Corrected total cellular fluorescence (CTCF) measurements for the nucleus and cell body are calculated as follows: CTCF = Integrated density - (Area of ​​region of interest x Mean fluorescence background reading). Cytoplasmic CTCF is calculated by subtracting the nuclear CTCF from the cell body CTCF. The nucleus / cytoplasm ratio is calculated as previously described. Genotype and treatment are blinded during imaging and analysis. All images are rendered as maximum intensity projections generated using Zeiss Zen Blue 2.3 software.

[0220] Table 4: Antibody Information RITE and AiryScan imaging As described above, the POM121 RITE plasmid was expressed in iPSNs. Expression of the POM121 RITE plasmid began on day 15 of differentiation. Randomized control or CHMP2B-targeted ASO treatment began on day 19 of differentiation. 4-OHT treatment began on day 22 of differentiation. To allow for complete incorporation into NPCs, tag exchange was induced one week after nuclear transfection by adding 4-hydroxytamoxifen (4-OHT) directly to the culture medium to a final concentration of 1 µM. The culture medium was changed and 4-OHT was replenished every 3–4 days for 1–2 weeks. At the time points indicated in the legend, iPSNs were fixed and immunostained as described above. AiryScan imaging was performed using the AiryScan 2 super-resolution module on a Zeiss LSM 980 confocal microscope. All images were acquired with a 63X objective and 3X digital zoom. The same imaging parameters (e.g., laser power, gain) were used to acquire all images.

[0221] The number of Myc and Flag-tagged POM121 spots was calculated using an automated analysis pipeline, with the region of interest defined by the DAPI mask in the previously described FIJI. Double counting was avoided by analyzing each tag individually, followed by analysis of the co-localization images. The number of co-localized Myc / Flag spots was subtracted from the total number of each individual count. The percentage of “old” (Myc), “new” (Flag), or “mixed” (Myc / Flag) POM121 spots was calculated by dividing by the total number of detected spots. Genotype, treatment, and time points were blinded during imaging and analysis.

[0222] Immunofluorescence staining and imaging of postmortem human tissues Formalin-fixed, paraffin-embedded slides of postmortem motor cortex and occipital cortex tissue were obtained from the Target ALS Human Postmortem Tissue Core. Demographic information of tissues from non-neurological controls and sALS patients can be obtained from [the following text is missing from the original] Figure 8A- Figure 8DThe tissue sections were dewaxed by immersing the slides in xylene for 3 × 5 min, followed by gradual rehydration by immersion in a series of washing solutions for 5 min each: 2 × 100% ethanol, 1 × 90% ethanol, 1 × 70% ethanol, and 3 × dH2O. Antigen retrieval was performed by incubating the slides in Tissue-Tek antigen retrieval solution (IHC World) in a steam sterilizer for 1 h. After cooling to room temperature for 10 min, the slides were washed with dH2O for 3 × 5 min and then with 1X PBS for 2 × 5 min. The tissue sections were permeabilized on a shaker for 10 min using 0.4% Triton-X solution (in 1X PBS) and then washed with 1X PBS for 3 × 5 min. Slides were blocked overnight at 4 °C in DAKO protein-free serum blocking solution (DAKO), and then incubated with primary antibody diluted in DAKO antibody dilution reagent containing background reducer (DAKO) (see Table 4 for antibody information) at 4 °C for 48 h. Tissue sections were then washed with 1X PBS 3 × 5 min and incubated with secondary antibody diluted in DAKO antibody dilution reagent containing background reducer (DAKO) (see Table 4 for antibody information) at room temperature for 1 h. Slides were washed with 1X PBS 3 × 5 min, incubated with 2–3 drops of autofluorescence eliminator reagent (Millipore) for 10 s, and washed with 1X PBS 5 × 5 min. Tissue sections were then incubated with Hoechst solution (1:1000 in 1X PBS) for 20 min, and then subsequently washed with 1X PBS 3 × 5 min. The final PBS wash buffer was replaced with dH2O, and the slides were then covered with a coverslip using Prolong Gold anti-fading reagent. Map2-positive layer V neurons were imaged using a 20X objective on a Zeiss Axioimager Z2 fluorescence microscope with Apotome2. The same imaging parameters (e.g., exposure time) were used for all images, and 10 images were acquired for each slide. Zeiss Zen Blue 2.3 was used to generate the default apotome-processed images.

[0223] Proximity connectivity determination (PLA) iPSN: At the time points indicated in the figures and legend, iPSNs were washed twice with 1X PBS and fixed in 4% PFA (in 1X PBS) for 15 min. The fixed iPSNs were then washed 3 × 5 min with 1X PBS and permeabilized at room temperature with 0.01% PBST (1X PBS containing 0.01% Triton X-100) for 15 min. Neighbor-to-neighbor ligation was then performed according to the Duolink PLA fluorescence protocol (Sigma Aldrich). In summary, iPSNs were blocked with Duolink blocking solution in a humidified 37 °C incubator for 1 h and then incubated with primary antibodies (CHMP2B and CHMP7, see Table 4) diluted in 1X Duolink antibody dilution buffer at room temperature for 2 h. iPSNs were washed 2 × 5 min at room temperature with 1X wash buffer A, and then incubated for 1 h in a humidified 37 °C incubator with Duolink anti-rabbit PLUS and Duolink anti-mouse MINUS probes in 1X Duolink antibody dilution buffer (80 µL total solution per well of a Cellvis 24-well glass plate). After probe incubation, iPSNs were washed 2 × 5 min at room temperature with 1X wash buffer A, and then ligated by incubating with ligase diluted 1:40 in 1X ligation buffer (80 µL total solution per well of a Cellvis 24-well glass plate) in a humidified 37 °C incubator for 30 min. iPSNs were washed 2 × 5 min at room temperature with 1X wash buffer A, and then amplified by incubating with polymerase diluted 1:80 in 1X amplification buffer (80 µL total solution per well of a Cellvis 24-well glass plate) in the dark in a humidified 37 °C incubator for 100 min. After amplification, iPSNs were washed 2 × 10 min with 1X wash buffer B at room temperature, and then washed 1 × 1 min with 0.01X wash buffer B. One to two drops of Duolink in-situ mounting medium containing DAPI were added to each well, and each well was sealed with a coverslip. All buffers were freshly prepared before use. Confocal imaging was performed using a 63X objective on a Zeiss LSM 980 with an AiryScan 2 confocal microscope. The same imaging parameters (e.g., laser power, gain) were used for all samples. Individual PLA signals within cell nuclei were counted using automated spot detection in the region of interest defined by a DAPI mask on the maximum intensity projection in FIJI. Genotype and time points were blinded during imaging and analysis. Postmortem human tissue: Postmortem human tissue slides were dewaxed, antigen-retrievaled, washed, and permeabilized as described above.Tissue sections were blocked with Duolink blocking solution in a humidified chamber at 37 °C for 1 h and incubated with primary antibodies (CHMP7 and CHMP2B; see Table 4) diluted in Duolink antibody dilution buffer at 4 °C for 48 h. Neighbor-to-neighbor ligation was then performed against the iPSN as described above. After a final wash with 0.01X wash buffer B, slides were incubated with an autofluorescence eliminator reagent for 10 s and thoroughly washed with 1X PBS (5 × 5 min), then mounted with Duolink in situ mounting medium containing DAPI. Cover slips were sealed with nail polish, and tissue sections were imaged using a 63X objective on a Zeiss Axioimager Z2 fluorescence microscope with Apotome 2. Layer V was identified based on DAPI, and 10–20 images were acquired for each slide. The same imaging parameters (e.g., exposure time) were used for all images and slides. Zeiss Zen Blue 2.3 was used to generate default apotome-processed images for analysis. In FIJI, automated blot detection within regions of interest defined by a DAPI mask is used to count individual PLA signals within the cell nucleus. Genotype and brain regions are blinded during imaging and analysis.

[0224] iPSN assay of digitalis saponins The iPSN permeabilized with digitalisin was measured as recently described. First, the iPSN was washed with 1X PBS and then permeabilized on ice in permeabilization buffer (10% OptiPrep, 200 µg / mL digitalisin) for 5 min. The iPSN was then briefly washed with ice-cold transfer buffer (4 mM HEPES-KOH pH 7.5, 22 mM KOAc, 0.4 mM Mg(OAc)2, 1 mM NaOAc, 0.1 mM MEGTA, 50 mM sucrose) and washed 3 × 5 min with ice-cold transfer buffer. The permeabilized and washed iPSN was then incubated with 0.6 mg / mL fluorescent 70 kDa dextran at room temperature in the dark for 25 min. During incubation, one drop of NucBlue Live Ready probe (Thermo Fisher Scientific) was added to each well.

[0225] iPSNs were imaged immediately after incubation on a Zeiss LSM 930 with an AiryScan 2 confocal microscope. Single z-section images were acquired using a 40X objective and standard line scanning confocal parameters. Plates were discarded after 15 min. FIJI was used to determine the nuclear intensity of 70 kDa dextran fluorescence. Genotype and treatment were blinded during imaging and analysis.

[0226] Protein blot To generate iPSN lysates, at the time points indicated in the legend, iPSNs were washed with pre-chilled 1X PBS. RIPA buffer (Sigma Aldrich) supplemented with 1X EDTA-free protease inhibitor mixture (Roche) was added directly to the wells of the culture plate, and the iPSNs were incubated on ice for 5 min. The lysates were then collected by scraping with a cell scraper, transferred to Eppendorf tubes, and vortexed vigorously for 30 s to promote complete iPSN lysis. Debris in the lysates was removed by centrifugation at 12,000 g for 15 min at 4 °C. The supernatant was transferred to new Eppendorf tubes, and protein concentrations were determined using the BCA Protein Estimation Kit. 4X Laemmli buffer supplemented with β-mercaptoethanol was added to each sample to a final concentration of 1X. To obtain nuclear lysates, nuclei were first isolated from the iPSNs using the Nuclei PURE Prep Nuclear Isolation Kit as described previously. The isolated nuclei were then lysed, and lysates were prepared as described above. Prior to SDS-PAGE, the sample was heated at 100 °C for 5 min and cooled to room temperature. 10 µg of protein was loaded into a 4%–20% acrylamide gel. The gel was run until the dye front flowed out, and the protein was transferred to a nitrocellulose membrane using a Trans-Blot Turbo transfer system. The membrane was blocked for 30 min at room temperature on a shaker with 5% skim milk powder in 1X TBST (1X TBS containing 0.1% Tween-20). The blot was incubated overnight at 4 °C on a shaker with the primary antibody diluted in the blocking buffer (see Table 4 for antibody information). After primary antibody incubation, the blot was washed with 1X TBST 3 × 10⁻¹⁰ min and incubated on a shaker at room temperature for 1 h with the secondary antibody diluted in the blocking buffer (see Table 4 for antibody information). The blot was then washed with 1X TBST 3 × 10⁻¹⁰ min. ECL substrate was applied for 30 s, and chemiluminescence images were acquired using an ImageQuant LAS 4000 system. To allow for sequential probing of the imprint without stripping, the chemiluminescence signal was quenched by incubating the film in 30% H2O2 on an oscillator at room temperature for 15 min. Signal density analysis was performed at FIJI. GAPDH was used as a normalized loading control.

[0227] qRT-PCR At the time points indicated in the legend, iPSN was incubated with 1 ml Trizol in the wells of the culture plate for 5 min at room temperature. The solution was then transferred to Eppendorf tubes, and Trizol-based RNA isolation was performed according to the manufacturer's protocol. cDNA synthesis was performed using a high-capacity cDNA reverse transcription kit. 1 µg of RNA was used for each reaction. All qRT-qPCR reactions were performed using SYBR GreenMaster Mix or TaqMan Gene Expression Master Mix and Applied Biosystems QuantStudio3. The primer set previously described (see Table 5) was used to detect truncated STMN2 and mRNA transcripts containing cryptic exons. TaqMan gene expression assays (see Table 5) were used to detect mRNA targets. GAPDH was used for gene expression normalization.

[0228] Table 5: Primer sequences and TaqMan probe IDs for qRT-PCR In vitro binding For each reaction, 2 µg of CHMP7 His, CHMP2B GST, CHMP7 GST, CHMP2B His, GST, and His were added to 50 µL of binding buffer (50 mM Tris pH 7.4, 150 mM NaCl, 2 mM MgCl2, 2 mM CaCl2, 10% glycerol, 0.5% NP-40, 1 mM DTT, and a 1X EDTA-free protease inhibitor mixture). For reactions with multiple recombinant proteins, the proteins were added in a 1:1 ratio (2 µg each), and the total reaction volume remained constant. The binding reaction was incubated at 4 °C by inverting for 2 h. After approximately 1.5 h of incubation, the magnetic GST or His beads were washed with binding buffer 3 × 10⁻¹⁰ min. The binding buffer wash was removed, and the appropriate binding reactants were added to the washed beads. The reaction was then incubated at 4 °C by inverting for an additional 1 h. After incubation, 25 µL of supernatant was collected as the unbound component and added to 25 µL of 2X Laemmli buffer.

[0229] Discard the remaining supernatant and wash the protein-bead complex with binding buffer at 4 °C by inverting and rotating for 3 × 5 min. Discard the wash buffer and resuspend the beads in 50 µL of 1X Laemmli buffer. Perform SDS-PAGE on 20 µL of each sample using a 4%–20% acrylamide gel. Run the gel at a constant 150 V for approximately 45 min until the dye front reaches the gel tip. After electrophoresis, wash the gel with ddH2O for 3 × 5 min and then incubate with SimplyBlue SafeStain at room temperature with gentle shaking for 1 h.

[0230] The SimplyBlue stained gel was washed with ddH2O for 3 × 1 h, and the protein bands were imaged using an ImageQuant LAS 4000 system.

[0231] Statistical analysis Throughout the experiment, researchers blinded iPSC line genotypes, treatment conditions, and time points. All data analyses were performed using FIJI version 2.3.0 / 1.53q and were entirely automated based on automatic spot counting and mask-based region of interest (ROI) definition using DAPI and / or Map2 signals. In cases where ROI was manually defined, researchers remained blinded to genotype, treatment, and time point information to eliminate bias when defining ROI in DAPI and / or Map2 channels. No data points were excluded from the analysis in this study. All statistical analyses were performed using GraphPadPrism versions 9 and 10 (GraphPad). Statistical analyses were performed as previously described, where the mean of individual cells or nuclei for each iPSC line and treatment condition was calculated to represent n = 1. The total n value (iPSC line and cells for each iPSC line) is reported in the legend. As illustrated in the figure, the Student's t-test, one-way ANOVA with Tukey's multiple comparison test, two-way ANOVA with Tukey's multiple comparison test, Student's t-test, or Fisher's exact test were used. p < 0.05, p < 0.01, p < 0.001, p < 0.0001. The superplot is used to detail the full range of variation in a large dataset and to indicate the iPSC line mean (a single data point displayed) used for statistical analysis. In each violin plot, the middle dashed line indicates the median of all data points within the larger single-cell dataset, and two additional dashed lines indicate the 25th and 75th percentiles. Bar plots are used to display individual data points with error bars (representing + / - SEM), from batch data (e.g., Western blot, qRT-PCR) that have not been quantified for individual cells or nuclei.

[0232] Example 2 CHMP7 / ESCRT-III mediated Nup turnover is overactive in sALS iPSN CHMP7 / ESCRT-III-mediated Nup turnover is overactive in sALS iPSNs. Previous studies using batch mass spectrometry-based analyses have shown that many (but not all) Nup proteins have long lifespans within the CNS. Therefore, it was assumed that the entire new NPC would not insert into the nuclear membrane after initial assembly in undividing neurons. However, the NPC is a highly organized octamer structure composed of multiple individual copies of Nup protein molecules, which exhibit different residence times within the NPC. Thus, within a given NPC, individual molecules of each Nup protein may turn over at different rates to maintain NPC homeostasis. Indeed, recent evidence suggests that Nup96, Nup93, Nup133, and POM121 Nup molecules in myoblast and myotubular NPCs turn over at different rates, with many NPCs containing both new and old Nup molecules within 1–2 weeks. The ESCRT-III pathway plays a fundamental role in maintaining nuclear membrane and NPC homeostasis across many cellular functions. To ensure the sealing of the nuclear membrane and the proper insertion and assembly of nuclei (NPCs) during cell division, the ESCRT-III protein CHMP7 passively translocates from the cytoplasm to the nucleus, where it participates in specific protein-protein interactions to initiate its “activation” and subsequent recruitment and aggregation of other ESCRT-III proteins. Ultimately, this leads to the removal of misassembled NPCs and / or nuclear membrane sealing. Furthermore, recent studies have suggested that ESCRT-III proteins play a role in the stepwise turnover of individual nuclei (NPs) within existing NPCs in non-dividing, non-neuronal cells. Therefore, these data support the fundamental role of the ESCRT-III pathway in maintaining NPCs throughout the cell's lifespan. However, whether the CHMP7 / ESCRT-III nuclear surveillance pathway plays a role in maintaining NPCs throughout the lifespan of human neurons remains unknown.

[0233] It has been previously shown that the NPC damage cascade begins with a reduction in POM121 in ALS neuronal NPCs. Therefore, preserving POM121 within human neuronal NPCs is crucial for maintaining NPC composition and function to prevent or reverse downstream pathophysiological events. Given previous evidence that nuclear accumulation of CHMP7 is sufficient to drive aberrant and pathological reduction of specific Nup molecules in neuronal NPCs, this paper describes whether the CHMP7 / ESCRT-III nuclear surveillance pathway may be overactive in sALS, thereby promoting aberrant Nup molecule / protein turnover to induce this recorded NPC damage. Recombination-induced tag exchange (RITE) technology was used to monitor the expression of neo- and neo-POM121 in controls and sALS. After initial expression on the previously detailed POM121 RITE plasmid, exogenous POM121 can be visualized using an antibody against the Myc tag. After the addition of 4-hydroxytamoxifen (4-OHT) to induce tag replacement via the loxP-Cre recombinase system, the newly synthesized POM121 molecules can be visualized using an antibody against the Flag tag. Therefore, the old POM121 protein will be tagged with Myc, and the new POM121 protein will be tagged with Flag. When combined with Airyscan imaging (which provides the increased imaging resolution needed to visualize individual NPC spots), this method offers the opportunity to examine POM121 protein turnover within iPSN NPCs, although not at the resolution of a single Nup molecule within an NPC. NPCs in control iPSNs contain only the "old" POM121 protein until 2 weeks after tag exchange induction, at which point the NPCs are primarily composed of a mixture of "new" and "old" POM121 proteins. Figures 1A-1D n = 6 controls and 6 sALS iPSC lines, with 50 iPSNs per line / treatment. Statistical significance was calculated using Fisher's exact test. p < 0.0001. Scale bar = 5 μm. These data suggest that in cultured iPSNs, each NPC may have a large number of POM121 molecules exchanging at a rate of approximately once every 2 weeks. In contrast, 1 week after tag exchange induction, sALS NPCs were almost entirely composed of “new” POM121 protein. Figures 1A-1D These data indicate that POM121 protein replenishment occurs much more frequently in sALS iPSN NPCs. Consistent with previous publications detailing the pathological reduction of POM121 in sALS iPSNs, even “new” POM121 protein is shown to be partially depleted from sALS iPSNs at 2 weeks post-tag exchange induction. Figures 1A-1D ).

[0234] To examine whether the CHMP7 / ESCRT-III nuclear surveillance pathway plays a role in the basal turnover / replenishment of POM121 protein in the iPSN, antisense oligonucleotides (ASOs) were used to reduce CHMP7, and the "new" and "old" POM121 proteins in the iPSN NPC were examined by Airyscan microscopy. ASO-mediated CHMP7 knockdown was sufficient to prevent the incorporation of "new" POM121, thereby retaining "old" POM121 in the NPC and slowing down POM121 turnover in the control iPSN. Figures 1A-1D Furthermore, the reduction of CHMP7 resulted in partial retention of the "old" POM121 one week after tag exchange induction in the saLS iPSN. Figures 1A-1D This indicates a slowdown in POM121 turnover. This mixed expression of "old" and "new" POM121 within the saLS iPSN NPC was maintained for 2 weeks following tag exchange induction. Figures 1A-1D Therefore, pathological CHMP7 / ESCRT-III-mediated POM121 reduction was blocked, consistent with previous reports that knockdown of CHMP7 could restore the localization and expression of POM121 within ALS NPCs. In summary, these data suggest that the essential function of the CHMP7 / ESCRT-III nuclear surveillance pathway in promoting stepwise Nup turnover within neuronal NPCs is "overactive" in sALS, leading to pathological Nup reduction.

[0235] Example 3 CHMP2B promotes nuclear retention of CHMP7 in sALS iPSNs. Typically, individual ESCRT-III proteins do not function alone. Instead, they function as a unit with other pathway components. Previously, it has been confirmed that the nuclear expression and localization of two well-studied ESCRT-III proteins, CHMP2B and CHMP4B, are not pathologically altered in sALS. However, given the basal nuclear distribution of ESCRT-III proteins in the iPSN, it is hypothesized that they may be functionally associated with disease-related pathological and functional alterations in the CHMP7 / ESCRT-III-mediated nuclear surveillance pathway. For this study, the focus is on the role of CHMP2B, as mutations in CHMP2B have been associated with frontotemporal dementia (FTD) and lower motor neuron-dominated forms of ALS. Given that CHMP7-dependent Nup turnover is “overactive” in the sALS iPSN... Figures 1A-1D The data on the abnormal accumulation of CHMP7 in the nuclei of sALS cells first tested whether CHMP2B is functionally involved in the pathogenesis of CHMP7 in sALS. For this purpose, two independent strategies were used: siRNA (… Figures 2A-2BGAPDH was used for normalization. n = 3 control iPSC systems. Student's t-test was used to calculate statistical significance. p < 0.01) and antisense oligonucleotides ( Figures 3A-3D GAPDH was used for normalization. n = 3 control iPSC lines. Statistical significance was calculated using one-way ANOVA and Tukey's multiple comparison test. p < 0.01, p < 0.001, p < 0.0001 was used to knock down human CHMP2B in iPSN. Additionally, two processing paradigms were used ( Figures 2A-2B The first example is the "preventative treatment" paradigm, where knockdown begins before CHMP7 nucleus accumulation occurs. Figure 4A This is to facilitate the analysis of the function of CHMP2B in promoting CHMP7 pathology in sALS. The second approach is "reparative treatment," in which knockdown begins after multiple NPC injury-related events occur. Figure 4B This was used to simulate a clinically relevant scenario where patients receive treatment after symptom onset. Immunostaining and confocal imaging of CHMP7 demonstrated a ~50% reduction in endogenous CHMP2B over 3 weeks. Figures 2A-2B and Figures 3A-3D GAPDH was used for normalization. n = 3 control iPSC lines. Statistical significance was calculated using two-way ANOVA and Tukey's multiple comparison test. The significance of CHMP2B ASO 3 compared to the disordered control is shown at the top; the significance of CHMP2B ASO 4 compared to the disordered control is shown at the bottom. p < 0.01, p < 0.001, p < 0.0001. This is sufficient to both prevent and reverse the pathological nuclear accumulation of CHMP7 in sALS iPSN. Figure 5A- Figure 5H n = 5 controls and 8 sALS iPSC lines, with 100 Map2+ cells knocked down per line. Statistical significance was calculated using two-way ANOVA and Tukey's multiple comparison test. p < 0.0001, see high magnification images. Figure 6A- Figure 6D There was no difference in the extent of inhibition whether siRNA or ASO was used. Figure 5A- Figure 5H This article describes the key role of CHMP2B in promoting the aberrant nuclear accumulation / retention of CHMP7 observed in sALS.

[0236] Example 4 Knocking down CHMP2B mitigates NPC damage cascade in sALS iPSN It has recently been shown that nuclear accumulation of CHMP7 can trigger a reduction in specific Nup in the nuclei of ALS iPSN cells. Given that a reduction in CHMP2B alleviates nuclear accumulation of CHMP7 in sALS iPSNs (…),… Figure 5A- Figure 5H , Figure 6A- Figure 6D Next, we investigated whether knocking down CHMP2B was sufficient to alleviate NPC damage in sALS. Similar to a recent study, POM121 was chosen as an indicator of NPC damage because previous studies have shown that reduction in POM121 is one of the earliest pathological events within the NPC itself in ALS iPSNs. Immunostaining and confocal imaging targeting POM121 showed that reducing CHMP2B via ASO or siRNA significantly increased the nuclear immunoreactivity of POM121 in sALS iPSNs, up to the levels observed in control iPSNs. Figure 7A- Figure 7H n = 5 controls and 8 sALS iPSC lines, with 100 Map2+ cells knocked down per line. Statistical significance was calculated using two-way ANOVA and Tukey's multiple comparison test. p < 0.0001, see high magnification images. Figure 8A- Figure 8D Nuclear isolation and Western blotting support this imaging-based observation. Figures 9A-9F n = 5 controls and 8 sALSiPSC lines. Tukey's multiple comparison test was used to calculate statistical significance. p < 0.0001. Importantly, this restorative effect was observed in both preventative and restorative siRNA and ASO treatment paradigms. Figure 7A- Figure 7H , Figure 8A- Figure 8D and Figures 9A-9F Next, the POM121 RITE plasmid was used to examine the effect of reduced CHMP2B expression on POM121 turnover in sALSiPSN cell nuclei and NPCs. Airyscan imaging revealed that, after tag exchange induction, the incorporation of "new" POM121 was significantly reduced in both control and sALS iPSN cell nuclei. Figures 10A-10C n = 6 controls and 6 sALS iPSC lines, with 50 iPSNs per line / treatment. Statistical significance was calculated using Fisher's exact test. p < 0.0001. Scale bar = 5 μm. Interestingly, the maintenance of this "old" POM121 expression showed a stronger effect than knocking down CHMP7. Figures 1A-1D and Figures 10A-10C This suggests that CHMP2B may play an upstream role in ESCRT-III-mediated Nup turnover in human neurons. In summary, these data functionally imply that CHMP2B is associated with overactive Nup turnover in sALS and the initiation of ESCRT-III / CHMP7-mediated NPC lesions.

[0237] In neurodegenerative diseases such as ALS, autopsy studies have documented alterations in the nucleoplasmic distribution of the RNA-binding protein TDP-43. While normally predominantly localized in the nucleus, in disease-related conditions, TDP-43 mislocalizes to the cytoplasm, where, in a small subset of cells, it can subsequently assemble into cytoplasmic aggregates. Although detectable in the vast majority of ALS autopsies, the degree to which TDP-43 subcellular distribution is altered in individual neurons is highly variable. Nevertheless, varying degrees of nuclear depletion are thought to cause loss of TDP-43 nuclear function, leading to detectable and quantifiable alterations in gene expression and the inclusion of cryptic exons in mRNA, a hallmark of splicing changes. It has recently been demonstrated that, despite the variable nature of these molecular signatures of TDP-43 dysfunction, they are detectable in the iPSN of individual sALS patients. Furthermore, CHMP7-mediated NPC damage has been shown to be a significant contributing factor to TDP-43 dysfunction in ALS iPSNs. Therefore, a subgroup of 14 gene expression and mRNA splicing alterations previously identified following artificial TDP-43 depletion in human neurons was selected to monitor “TDP-43 function” via qRT-PCR after CHMP2B reduction in sALS iPSNs. In doing so, it was found that both siRNA- and ASO-mediated CHMP2B reduction significantly prevented TDP-43 function loss events. Figure 11A- Figure 11S n = 5 controls and 8 sALS iPSC lines, with 100 Map2+ cells knocked down per line. Statistical significance was calculated using two-way ANOVA and Tukey's multiple comparison test. p < 0.05, p < 0.01, p < 0.001. Scale = 5 µm; and Figure 12A- Figure 12N) and restored the TDP-43 function in sALS iPSN ( Figure 13A- Figure 13S n = 5 controls and 8 sALS iPSC lines, with 100 Map2+ cells knocked down per line. Statistical significance was calculated using two-way ANOVA and Tukey's multiple comparison test. p < 0.05, p < 0.01, p < 0.001. Scale = 5 µm; and Figure 14A-Figure 14N). ASO treatment was initiated on day 15 of differentiation (the time point at which the nuclear localization of CHMP7 in sALS iPSNs began to increase). Importantly, knockdown of CHMP2B had no effect on the expression of two mRNAs (actin and POM121) not previously thought to be regulated by TDP-43. Figure 11A- Figure 11S -Figure 14O- Figure 14P Consistent with preventing or restoring TDP-43 function loss, the reduction of CHMP2B mediated by both siRNA and ASO also prevented and reversed the subtle TDP-43 mislocalization observed in sALS iPSN. Figure 11A- Figure 11S - Figures 14Q-14S Therefore, in summary, these data highlight CHMP2B as an effective mediator of the CHMP7-mediated NPC damage cascade in sALS.

[0238] Example 5 Knocking down CHMP2B reduces glutamate-induced neuronal death in sALS iPSN. It has been established that partial reduction of CHMP2B can target and reverse multiple pathophysiological events in the NPC damage cascade in sALS iPSN. Figure 5A- Figure 5H , Figure 7A- Figure 7H , Figure 6A- Figure 6D , Figure 8A- Figure 8D , Figures 9A-9F , Figure 11A- Figure 11S , Figure 12A- Figure 12S , Figure 13A- Figure 13S and Figure 14A- Figure 14S n = 5 controls and 8 sALS iPSC lines. Statistical significance was calculated using two-way ANOVA and Tukey's multiple comparison test. p < 0.01, (p < 0.0001) The next question is whether knocking down CHMP2B is sufficient to increase neuronal survival. Consistent with previous publications, no basal levels of cell death were detected in sALS iPSN cultures. Figure 15A- Figure 15DASO treatment was initiated on day 60 of differentiation, following NPC damage and the occurrence of TDP-43 function loss and mislocalization. PBS was used for normalization. Triton X-100 was used as a positive control for inducing neuronal death. Figure 16A- Figure 16D n = 5 controls and 8 sALS iPSC lines. Data points represent mean cell death per well across 10 images for each line / ASO. Statistical significance was calculated using two-way ANOVA and Tukey's multiple comparison test. p < 0.0001). ASO treatment was initiated on day 15 of differentiation (the time point at which the nuclear localization of CHMP7 in sALS iPSNs began to increase). PBS was used for normalization. Triton X-100 was used as a positive control for inducing neuronal death. However, as previously demonstrated, sALS iPSNs were sensitive to glutamate-induced cell death as assessed by independent cell death measures: Alamar blue cell viability ( Figure 15A- Figure 15D ; n = 5 controls and 8 sALS iPSC lines. Data points represent the mean survival percentage of 3 technical replicate wells for each line / siRNA. Statistical significance was calculated using two-way ANOVA and Tukey's multiple comparison test. p < 0.001, p < 0.0001) and propidium iodide uptake ( Figure 16A- Figure 16D This phenomenon was both prevented and reversed by treatment with siRNA and ASO targeting CHMP2B. Figure 15A- Figure 15D , Figure 16A- Figure 16D Importantly, partial reduction of CHMP2B had no significant toxicity to control iPSNs and no negative impact on neuronal survival in the absence of glutamate-induced cell death. Figure 15A- Figure 15D , Figure 16A- Figure 16D In summary, these data support a partial reduction in the protective role of CHMP2B in sALS iPSN.

[0239] Example 6 CHMP7 and CHMP2B are persistently associated in close proximity in the nuclei of sALS iPSN cells. ESCRT-III proteins frequently interact within multi-protein complexes to promote aggregation and function. To determine whether CHMP7 and CHMP2B interact within a near-spatial distance within the nucleus of sALS iPSN cells, a proximity-to-joint (PLA) assay was performed. PLA is a specific and sensitive method capable of detecting protein-protein interactions in an intact cellular environment. Briefly, when two proteins of interest (detected by a specific primary antibody) are close to each other, hybridization oligonucleotides and ligases ligate PLA probes (bound to a secondary antibody), creating closed DNA loops for amplification. Thus, each discrete PLA spot represents two proteins located within ~40 nm of each other. Using this method, a significant increase in the number of CHMP2B-CHMP7 PLA spots was observed in sALS iPSNs at day 25 compared to control iPSNs, and this increase persisted until day 32. Figure 17A , Figures 17C-17D n = 5 controls and 8 sALS iPSC lines, with 100 cell nuclei per line / time point. Student's t-test was used to calculate statistical significance. p < 0.05, p < 0.0001. Interestingly, although CHMP7 was mainly localized in the nucleus in sALS iPSN on day 18 ( Figure 18A However, very little nuclear PLA signal was detected. Figures 17A-17B This is consistent with the time-dependent occurrence of pathological CHMP7 / ESCRT-III-mediated POM121 reduction in ALS. Figures 1A-1D and Figures 10A-10C Compared to controls, an increased number of CHMP2B-CHMP7 PLA spots were also detected in the motor cortex of post-mortem sALS patients (but not in the occipital cortex unaffected during the disease). Figures 17E-17G Consistent with previous studies, no changes in the distribution of CHMP2B subcellular cells were observed in sALS iPSN or post-mortem patient tissues. Figure 18B Nevertheless, these data provide evidence for an increased and persistent association between CHMP2B and CHMP7 in the nuclei of sALS patients. In vitro binding assays demonstrated the ability of recombinant CHMP2B and CHMP7 proteins to bind directly. Figures 19A-19B Although PLA assays cannot distinguish between directly bound proteins and closely adjacent proteins in multi-protein complexes, this data suggests that CHMP2B and CHMP7 are closely adjacent, at least in the nucleus of ALS cells. Figures 17E-17G), possessing the potential for direct integration ( Figures 19A-19B ).

[0240] Example 7 CHMP2B promotes the activation of CHMP7 / ESCRT-III nucleoporin turnover to initiate the pathological reduction of POM121. Given the observed interaction between CHMP2B and CHMP7 in the nuclei of iPSN cells in sALS ( Figures 17E-17G ), and functionally facilitates the NPC damage cascade triggered by CHMP7 ( Figure 5A- Figure 5D , Figure 7A- Figure 7H , Figure 6A- Figure 6D , Figure 8A- Figure 8D , Figures 9A-9F , Figure 11A- Figure 11S , Figure 12A- Figure 12S , Figure 13A- Figure 13S and Figure 14A- Figure 14S ) and the abnormal turnover of POM121 ( Figures 10A-10C The mechanism of this process was then investigated. It has been previously demonstrated that impaired NPC passive diffusion permeability barrier integrity is a key contributing factor to increased CHMP7 nuclear localization and the CHMP7-mediated NPC damage cascade in sALS. To test whether CHMP2B reduction alters passive diffusion through NPCs, a digitalisol permeation assay was used to selectively permeate the plasma membrane of iPSNs while maintaining nuclear membrane integrity, thus enabling the assessment of passive influx through NPCs. Similar to previous publications, a significant increase in the fluorescence of 70 kDa dextran molecules was observed in the nuclei of sALS iPSNs. Figures 20A-20C n = 5 controls and 8 sALS iPSC lines, each with at least 50 nuclei per dextran. Statistical significance was calculated using two-way ANOVA and Tukey's multiple comparison test. p < 0.0001. Interestingly, siRNA or ASO-mediated CHMP2B knockdown did not change this ( Figures 20A-20C Due to its size, a 70 kDa dextran molecule should normally be unable to passively diffuse through the NPC and is therefore excluded from the cell nucleus, as observed in the control iPSN. Figures 20A-20C Therefore, these data suggest that knocking down CHMP2B does not restore the NPC permeability barrier integrity, and thus may act through a unique mechanism to alleviate CHMP7-mediated NPC damage.

[0241] ESCRT-III proteins are typically in a state of self-inhibition to prevent inappropriate aggregation. To function properly, they must first be “activated,” a process involving conformational changes induced by protein-protein interactions to remove this self-inhibition. During nuclear membrane sealing events, the nuclear membrane protein LEM2 / LEMD2 interacts with CHMP7 to ultimately promote its activation in yeast and non-neuronal mammalian cells. In contrast, CHMP7-mediated NPC damage events in the human iPSN have been shown to not require LEMD2. Given previous reports suggesting that interactions between individual ESCRT proteins may promote their activation, CHMP2B may promote CHMP7 activation in the iPSN. To investigate this hypothesis, numerous flag-tagged CHMP7 mutant plasmid constructs were first generated. Figure 21A Previous studies have shown that removing the C-terminal region of the ESCRT-III protein to eliminate autoinhibition leads to a “open” conformation that promotes activation and polymerization. As a result, similar to studies in yeast, a flag-tagged “open” CHMP7 mutant was generated by truncating CHMP7 at amino acid 369 by removing the last 84 amino acids. Figure 21A As another method to eliminate self-inhibition, the helix 6 mutant (Helix 6) was generated by removing amino acids 420-430, thus deleting helix 6. Figure 21A This mutant CHMP7 protein is known to behave similarly to the "open" CHMP7 mutant in promoting CHMP7 activation in non-neuronal mammalian cells. Notably, both approaches also affect the nuclear export sequences (NES) within helix 5 and helix 6 of CHMP7. Therefore, based on the properties of removing these NES sequences in the "open" and ΔHelix 6 mutants ( Figure 21A The flag-tagged CHMP7 will be artificially retained in the nucleus, as previously demonstrated. Since it has been previously shown that CHMP7 nuclear retention triggers NPC damage in the iPSN, a double NES mutant (CHMP7 NES1) was generated by L-to-A substitutions at amino acids 388 (NES1) and 430 (NES2). / NES2 ()( Figure 21A This serves as an additional control to differentiate between the effects of activation and nuclear accumulation. Previous studies have demonstrated that this double mutation is sufficient to inactivate both NES within CHMP7 while maintaining self-inhibitory activity. For comparison, the previously described flag-tagged wild-type CHMP7 plasmid ( Figure 21AImportantly for this experimental design, these plasmids are insensitive to ASO-mediated knockdown because the CHMP7 ASO targets intron 2 of the human CHMP7 pre-mRNA. To avoid any complex artifacts that might arise from the interaction between endogenous wild-type CHMP7 and flag-tagged CHMP7 mutants, iPSNs were subjected to CHMP7 ASO treatment. Figure 21B This method, aimed at depleting endogenous CHMP7, consistently resulted in a >90% reduction in endogenous CHMP7 protein. Flag-tagged CHMP7 plasmids expressed CHMP7 at the neuronal stage (…). Figure 21B This was used to specifically examine the maintenance of NPCs, rather than the formation of NPCs that would occur during iPSCs or early neuronal differentiation phases. Treatment with neomycin ( Figure 21B iPSN cultures enriched with CHMP7 plasmids tagged with a flag were observed. Crucially, immunostaining and confocal imaging against the flag demonstrated that ASO-mediated reduction of CHMP2B alleviated nuclear accumulation of flag-tagged WT CHMP7 in sALS iPSNs. Figures 21C-21E ; n = 5 controls and 8 sALS iPSC lines, each line / overexpressing / treated with 100 Map2+ and Flag+ cells. Statistical significance was calculated using two-way ANOVA and Tukey's multiple comparison test. p < 0.0001, similar to the results of endogenous CHMP7 ( Figure 5A- Figure 5H Furthermore, all three CHMP7 mutants were localized to the cell nucleus as expected. Figures 21C-21E This highlights our approach of “replacing” endogenous CHMP7 with a flag-tagged CHMP7 variant as a viable strategy for investigating ESCRT-III protein interactions to facilitate NPC damage events in disease iPSN.

[0242] After validating the experimental methods, immunostaining and confocal imaging were performed to assess the role of CHMP2B in CHMP7-mediated NPC damage, specifically the reduction in nuclear POM121 immunoreactivity. As expected, a significant reduction in POM121 immunoreactivity was observed in sALS iPSNs expressing flag-tagged WT CHMP7, which was eliminated by CHMP2B ASO treatment. Figures 21C-21E Next, by utilizing the flag-tagged CHMP7 "open" and ΔHelix 6 plasmids (where self-inhibition has been eliminated) Figure 21AThis artificially "activated" CHMP7, as previously established, and tested whether CHMP2B was involved in CHMP7 activation. Expression of either flag-tagged CHMP7 "open" or flag-tagged CHMP7 ΔHelix 6 significantly reduced nuclear POM121 immunoreactivity in both controls and sALS iPSNs. Figures 21C-21E However, compared with endogenous ( Figure 7A- Figure 7H ) or WT CHMP7 with the Flag tag ( Figures 21C-21E In stark contrast to the results obtained against the background of ) expression, ASO-mediated CHMP2B knockdown had no effect on the immunoreactivity of POM121 in iPSNs expressing either flag-tagged CHMP7 "open" or flag-tagged CHMP7 ΔHelix 6. Figures 21C-21E CHMP7 is retained in the nucleus simply by eliminating its nuclear export (CHMP7 NES1). / NES2 This led to a significant decrease in POM121 immunoreactivity, which was mitigated by ASO-mediated reduction in CHMP2B. Figures 21C-21E This indicates that, in the absence of CHMP2B, nuclear retention of CHMP7 alone is insufficient to initiate the reduction of POM121 in the iPSN. Crucially, PLA confirmed that CHMP7 "open" and CHMP7 ΔHelix 6 no longer associate with CHMP2B in the iPSN nucleus at near-spatial distances. Figures 22A-22B n = 5 controls and 8 sALS iPSC lines, each line / plasmid with at least 100 nuclei. Statistical significance was calculated using two-way ANOVA and Tukey's multiple comparison test. p < 0.05, p < 0.01, (p < 0.0001). Therefore, these data collectively support the role of CHMP2B in promoting and maintaining CHMP7 activation and / or eliminating self-inhibition to initiate NPC damage in sALS iPSN.

[0243] Example 8 discuss Impaired nucleoplasmic compartmentalization has become a significant contributing factor to the pathophysiology of ALS and related neurodegenerative diseases. Recently, it has been demonstrated that increased nuclear influx of the ESCRT-III protein CHMP7, mediated by SUN1-mediated alterations in NPC permeability barrier integrity, occurs prior to the reduction of specific nuclei (Nup) from the NPC itself in sALS iPSN. However, the molecular mechanisms by which increased CHMP7 nuclear localization affects pathological changes in the nuclei of sALS neurons and the Nup pool within the NPC remain unclear. In this study, the role of the ESCRT-III protein CHMP2B in physiological and pathological CHMP7 / ESCRT-III Nup turnover activation was demonstrated in human neurons. In summary, this paper describes a model in which prolonged overactivation of CHMP7 / ESCRT-III Nup turnover mediated by CHMP2B leads to pathological NPC damage in the sALS iPSN. Figures 23A-23B Importantly, CHMP2B-mediated activation of the CHMP7 / ESCRT-III nuclear surveillance pathway was demonstrated to promote the nuclear localization of CHMP7 in sALS neurons, highlighting the importance of ESCRT-III function in determining subunit localization. In turn, two methods of reducing CHMP2B protein expression—siRNA and ASO-mediated knockdown—were demonstrated to eliminate persistent “overactivation” of Nup turnover, thereby mitigating pathophysiological events associated with NPC injury, including POM121 expression and TDP-43 dysfunction.

[0244] Numerous reports have established the role of CHMP7 in nuclear membrane resealing during cell division. Furthermore, one study has shown that ESCRT-III proteins, including CHMP2B and CHMP7, can promote nuclear / cytoplasmic compartmentalization in yeast during nuclear membrane rupture. Although nuclear membrane aberrations have been reported in C9orf72 ALS / FTD and Profilin1 ALS models, it remains unclear whether these represent alterations to the reported resident nuclear membrane proteins or pathological rupture sites. Therefore, future research is necessary to determine whether small ruptures within the nuclear membrane affect ESCRT-III nuclear surveillance in ALS. Nevertheless, recent studies have demonstrated that aberrant nuclear localization of CHMP7 is sufficient to initiate pathological changes in the NPC itself, highlighting the crucial role of the CHMP7 and ESCRT-III nuclear surveillance pathways in NPC disruption in sALS. However, the mechanism by which this pathological increase in CHMP7 nuclear localization drives disease-related NPC changes remains unknown.

[0245] In addition to their role in nuclear membrane sealing, recent studies have also demonstrated the role of the CHMP7 and ESCRT-III pathways in the proper assembly and insertion of NPCs into the nuclear membrane during cell division. However, little is known about the function of ESCRT-III proteins in maintaining previously assembled NPCs throughout the lifetime of non-dividing cells (such as neurons, where the entire NPC is not considered to be reassembled and inserted throughout its life). In fact, many Nup proteins are reported to be among the longest-lived proteins in the mammalian CNS. As a result, in order to maintain properly functioning NPCs, individual Nup protein molecules are likely to be turned over and replenished within the NPC throughout its lifetime. Indeed, previous studies have supported this, showing that Nup proteins are exchanged at different rates in myoblast and myotube cell nuclei, resulting in individual NPCs containing a mixture of new and old Nup proteins. This disclosure provides evidence supporting the essential role of the ESCRT-III pathway and its two protein components (CHMP7 and CHMP2B) in the stepwise POM121 Nup turnover in human iPSNs. Figures 1A-1D and Figures 10A-10C Specifically, the findings described in this paper are that a reduction in CHMP7 or CHMP2B significantly slowed POM121 turnover in control human iPSNs. Figures 1A-1D and Figures 10A-10C Furthermore, this fundamental function of the ESCRT-III pathway is exhibited as "overactive," accelerating the turnover of POM121 in the sALS iPSN. Figures 1A-1D and Figures 10A-10C This leads to the NPC pathology observed in the disease, a process that is again slowed by a reduction in CHMP7 or CHMP2B. Figures 1A-1D and Figures 10A-10C This data is consistent with previous reports, documenting the roles of ESCRT-III proteins CHMP3 and CHMP2A in the stepwise turnover of Nup93 in non-dividing mouse myoblasts. Overall, this highlights the indispensable role of nuclear surveillance function of the ESCRT-III pathway in maintaining NPCs throughout their lifetime.

[0246] To maintain NPC and NE homeostasis, the ESCRT-III protein CHMP7 passively diffuses into the nucleus, typically in its inactive, self-inhibited, or "off" state, preventing aberrant ESCRT polymerization and regulated function. For ESCRT-III-mediated NPC and nuclear membrane surveillance and maintenance events to occur, CHMP7 must subsequently transition to an active or "on" state via protein-protein interactions. Normally, for ESCRT-III-mediated nuclear surveillance and maintenance events during cell division, CHMP7 interacts with the nuclear membrane protein LEMD2 to promote its "activation" and polymerization. Furthermore, previous reports have demonstrated that interactions between individual ESCRT proteins can lead to their activation, highlighting the multiple pathways for ESCRT protein activation. Given that previous publications have demonstrated that LEMD2 is not essential for the nuclear localization and function of CHMP7 in the iPSN, it is inferred that specific ESCRT protein interactions may promote the nuclear localization and activation of CHMP7 / ESCRT-III function in the iPSN. Indeed, following CHMP2B reduction, CHMP7 relocalizes to the cytoplasm in sALS iPSNs. Figure 5A- Figure 5H Although the passive diffusion through NPCs is still out of balance ( Figures 20A-20C By utilizing CHMP7 mutant plasmids where self-suppression has been removed (thus promoting constitutive activation of CHMP7), it was demonstrated that pathological POM121 reduction no longer requires CHMP2B. Figures 20A-20C Therefore, combining CHMP2B knockdown with reduction of POM121 in sALS iPSN ( Figure 7A- Figure 7H And slow down the turnover of POM121. Figures 10A-10C These observations suggest that CHMP2B is sufficient to promote activation of the CHMP7 / ESCRT-III NPC surveillance pathway in the iPSN and is a key mediator of excessive activation of ESCRT-III nuclear surveillance in sALS. In summary, this study not only establishes that CHMP2B is essential for pathological ESCRT-III NPC alterations, but also that the functionality of ESCRT-III proteins (in this case, CHMP7) is a significant contributor to their localization in human neurons. This is consistent with previous studies on the ESCRT-III pathway, which have shown that ESCRT-III function proceeds in a stepwise sequence, involving localization / membrane targeting, removal of autoinhibition, ESCRT-III subunit polymerization, VPS4-mediated cleavage and depolymerization following remodeling events, restoration of autoinhibition, and redistribution throughout the cell. Therefore, although many factors, including NPC permeability barrier integrity and RNA splicing, can influence CHMP7 localization, this study highlights the importance of ESCRT-III protein function in determining its localization.

[0247] Using proximity connections, an increased and persistent association between CHMP2B and CHMP7 was observed in sALS iPSN and postmortem human tissue. Figures 17E-17G Under physiological conditions, the nuclear pools of CHMP7 and CHMP2B may interact close to each other to promote physiological ESCRT-III-mediated Nup turnover. In fact, weakening the association between CHMP7 and CHMP2B by reducing either ESCRT-III subunit via ASO-mediated reduction has been shown to significantly slow both physiological and pathological turnover of POM121 within human neuronal NPCs. Figures 1A-1D and Figures 10A-10C Although the nuclear localization of CHMP2B is extremely rare in control and sALS human neurons (). Figures 18A-18B However, the increased localization of the CHMP7 nucleus observed in sALS may have led to an increase in the detection of CHMP2B at close physical distances in ALS neurons. Figures 17E-17G Although PLA cannot distinguish between direct binding and intra-protein conjugation, in vitro binding experiments show that CHMP7 and CHMP2B proteins can bind directly. Figures 19A-19B The stoichiometry of this relationship, and whether this direct binding is enhanced by the presence of another CHMP7 protein, will be important topics for future research.

[0248] Based on recent publications, a scenario has been proposed whereby sALS-related CHMP7 pathology is at least in part due to increased passive nuclear influx caused by SUN1-mediated alterations in NPC permeability barrier integrity, combined with persistent activation of CHMP7 / ESCRT-III nuclear surveillance mediated by CHMP2B. Figures 23A-23B This highlights the role of function in determining the localization of ESCRT-III proteins in human neurons. Interestingly, ASO-mediated reduction in CHMP2B is still sufficient to alleviate impaired nuclear output (CHMP7 NES1). / NES2 (Figure 7) This results in a reduction of POM121 caused by the artificial nuclear retention of CHMP7. Although future research is necessary, these data suggest that impaired nuclear output of CHMP7 alone may not be a major driver of CHMP7-mediated NPC damage in sALS neurons. Furthermore, a scenario is proposed whereby the persistent interaction between CHMP7 and CHMP2B leads to overactivation / prolonged activation of ESCRT-III-mediated Nup removal and degradation, thereby causing the NPC pathology observed in sALS. Figures 23A-23BHowever, it remains unclear whether this persistent interaction is due to a continuous nuclear influx of CHMP7, providing a constant flow of new CHMP7 molecules for activation, and / or due to the inability of activated ESCRT-III protein polymers to dissociate after their NPC and surveillance functions. Typically, recruitment of the AAA-ATPase VPS4 promotes ESCRT-III polymer degradation. VPS4 has recently been shown to be recruited and pathologically increased in the nuclei of ALS cells. However, CHMP7 cannot directly bind VPS4 due to charge substitution within the microtubule-interacting and transport domain-interacting motif (MIM) domain of helix 6. Therefore, other ESCRT-III protein subunits may be involved in promoting VPS4 recruitment for polymer degradation after ESCRT-III nuclear surveillance function. Interestingly, previous studies have indicated that CHMP2B can bind to VPS4 in vitro. However, given the data that a reduction in CHMP2B alleviates the pathological reduction of POM121 (…),… Figure 7A- Figure 7H and Figures 10A-10C This suggests that CHMP2B is unlikely to be involved in VPS4 recruitment for ESCRT-III polymerase breakdown in human neurons. Therefore, future research is necessary to examine the functions of other ESCRT-III subunits in promoting VPS4 recruitment and polymerase breakdown in the iPSN. Nevertheless, in summary, this paper describes the involvement of the essential ESCRT-III nuclear surveillance pathway in the stepwise turnover of POM121 in human neurons. Crucially, given that aberrant POM121 reduction is the initiating event of the NPC damage cascade in ALS neurons, this study provides important mechanistic insights into this early event in ALS pathogenesis.

[0249] Notably, mutations in CHMP2B are involved in a subset of FTD and lower motor neuron-dominant ALS cases. Mutations resulting in C-terminal truncation (thus removing the self-inhibitory domain and VPS4 binding site of CHMP2B) have been shown to enhance the association between CHMP2B and CHMP4B and impair VPS4 recruitment. This suggests that disease-associated CHMP2B mutations in this genetic form of FTD / ALS can additionally lead to NPC injury events in a manner similar to that observed in sALS.

[0250] In summary, this data provides evidence that CHMP2B plays a role in promoting the activation of the CHMP7 / ESCRT-III nuclear surveillance pathway in human iPSNs to maintain physiological NPCs (NPCs). Furthermore, it demonstrates that sustained activation of CHMP7 / ESCRT-III nuclear surveillance is sufficient to drive NPC damage in sALS. Therefore, ASO or siRNA-mediated CHMP2B knockdown alleviates the pathological reduction of POM121 and downstream defects in TDP-43 function in sALS iPSNs. Thus, this data mechanistically suggests that CHMP2B-mediated CHMP7 / ESCRT-III nuclear surveillance activation is a significant contributing factor to both physiological NPC maintenance and pathological NPC destruction in human neurons. Previous studies have reported defects in neurite extension and branching, as well as synaptic dysfunction, in cultured rodent neurons following shRNA-mediated CHMP2B depletion, consistent with the role of CHMP2B at the synapse. However, consistent with the observation that CHMP2B knockout mice are phenotypically normal, this study suggests that even partial reduction of CHMP2B after neuronal development may be beneficial in ALS. To support this, recent observations indicate that knocking down CHMP2B prevents the toxicity caused by TDP-43 overexpression in Drosophila and can modulate TDP-43 phosphorylation in overexpression models. Therefore, in addition to providing crucial mechanistic insights into CHMP7 / ESCRT-III-mediated disruption of NPC homeostasis, these data support the potential of partially reducing CHMP2B as a potential therapeutic strategy to mitigate the NPC damage cascade in sALS. While future studies are needed to extend these studies to a larger cohort of sALS patient iPSC lines, a recent analysis of 180 control, sALS, C9orf72, TDP-43, and SOD1 iPSC lines revealed that ~75% of patient lines showed CHMP7 pathology and ~85% had evidence of aberrant POM121 reduction. Therefore, this suggests that therapeutically targeting the overactivation of ESCRT-III-mediated POM121 turnover may be beneficial for a large number of sALS patients. Given the potential for direct binding between CHMP7 and CHMP2B (… Figures 19A-19B This study also suggests that small molecule inhibitors of persistent nuclear CHMP7-CHMP2B interactions may be a potential alternative treatment for mitigating the NPC damage cascade in the disease.

[0251] Example 9 in conclusion This study demonstrates that CHMP2B is essential for physiological neuronal Nup turnover and, in turn, is a key mediator of pathological NPC damage in human neurons with sALS. Mechanistically, CHMP2B is associated with CHMP7 to promote ESCRT-III-mediated Nup turnover activation. In sALS neurons, the persistent association between CHMP7 and CHMP2B leads to persistent overactivation of the ESCRT-III nuclear surveillance / Nup turnover pathway, causing disease-associated NPC damage and subsequently resulting in TDP-43 mislocalization and loss of nuclear function. Importantly, it was demonstrated that partial reduction of CHMP2B via siRNA or ASO is sufficient to both prevent and reverse NPC alterations and TDP-43 pathology. Therefore, these studies provide crucial mechanistic insights into early events in sALS pathogenesis and highlight CHMP2B as a potential therapeutic target for sALS.

[0252] sequence list ASO sequence ASO out of order (lonis ID: 676630): CCTATAGGACTATCCAGGAA (SEQ ID NO:1) ASO CHMP7 (lonis ID: 1508917): TGTTACCCTCAGATACCGCC (SEQ ID NO:2) ASO CHMP2B ASO 1: TGTGACAAGTCCTAGTGGGA (SEQ ID NO:3) ASO CHMP2B ASO 2: AGGGTGAGAAAGAGTATGGG (SEQ ID NO:4) ASO CHMP2B ASO 3: GGGATGCAGAAATACAGAGG (SEQ ID NO:5) ASO CHMP2B ASO 4: AAGTGGCATCTGAAGTAGGG (SEQ ID NO:6) ASO CHMP2B ASO 5: TGGTAAGCGAAGATGCCAGA (SEQ ID NO:7) ASO CHMP2B ASO 6: ATCACTTACCACCTGCCATG (SEQ ID NO:8) ASO CHMP2B ASO 7: GTTGGTGGGACAGAGCAATA (SEQ ID NO:9) ASO CHMP2B ASO 8: CACCTAACTCTCTAGTGGCT (SEQ ID NO:10) ASO CHMP2B ASO 9: TCAATGGAACAGAGCCCAGA (SEQ ID NO:11) ASO CHMP2B ASO 10: CATTTACCCTATGACCCAGC (SEQ ID NO:12) Primer sequence STMN2 positive: AGCTGTCCATGCTGTCACTG (SEQ ID NO:33) STMN2 reverse: GGTGGCTTCAAGATCAGCTC (SEQ ID NO:34) Truncated STMN2 forward: GGACTCGGCAGAAGACCTTC (SEQ ID NO:13) Truncated STMN2 in reverse: GCAGGCTGTCTGTCTCTCTC (SEQ ID NO:14) Forward GAPDH: GAAGGTGAAGGTCGGAGTC (SEQ ID NO:15) GAPDH reverse: GAAGATGGTGATGGGATTTC (SEQ ID NO:16) ACTL6B CE forward: ATCCTGGATCACACCTACAGC (SEQ ID NO:17) ACTL6B CE reverse: AGGAGGATTGCTTGAACCC (SEQ ID NO:18) ARHGAP32 CE forward: CACCTTCTAAATTCTGGTTTTGAAG (SEQ ID NO:19) ARHGAP32 CE Reverse: CAGATACAGACGAAAAAGCTGAGTT (SEQ ID NO:20) CAMK2B CE forward: GAGTGCAGAGACTTCCCCC (SEQ ID NO:21) CAMK2B CE reverse: CTGCTCCGTGGTCTTAATGAT (SEQ ID NO:22) CDK7 CE forward: GCAGTGTGGACATGACTGATA (SEQ ID NO:23) CDK7 CE Reverse: GTCCACACCTACACCATACATC (SEQ ID NO:24) DNM1 CE forward: TGACCCTTTCGGCCCT (SEQ ID NO:25) DNM1 CE reverse: CACGAAATCAACATGGCAGT (SEQ ID NO:26) HDGFL2 CE forward: TCACCTGAGAAGAAAGCAG (SEQ ID NO:27) HDGFL2 CE reverse: TCCTCTCTTCTGTGTCCCTCT (SEQ ID NO:28) MYO18A CE forward: AAGTCECAGGGATGAGATTGTG (SEQ ID NO:29) MYO18A CE reverse: GCAGAGTTTTGTCCTCCTCTTTA (SEQ ID NO:30) SYT7 CE forward: GCAGTGAGAAGAAGGCTATCAA (SEQ ID NO:31) SYT7 CE reverse: CGGCAGACTGGAGCCT (SEQ ID NO:32) Although the invention has been described with reference to the presently preferred embodiments, it should be understood that various modifications can be made without departing from the spirit of the invention. Therefore, the invention is limited only by the appended claims.

Claims

1. An isolated oligonucleotide comprising the nucleic acid sequence of any one of SEQ ID NO: 3-12.

2. A composition comprising one or more oligonucleotides according to claim 1.

3. A method for regulating CHMP2B expression in cells, the method comprising contacting the cells with an oligonucleotide comprising a nucleic acid sequence comprising SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or a combination thereof, thereby regulating CHMP2B expression.

4. The method of claim 3, wherein regulating CHMP2B expression comprises: CHMP2B expression in the cells was reduced compared to CHMP2B expression in cells exposed to the control oligonucleotide or in cells not exposed to the oligonucleotide.

5. The method of claim 4, wherein the expression of CHMP2B is measured using immunostaining, confocal imaging, nuclear dissociation, Western blotting, or a combination thereof.

6. A method for reducing or inhibiting the nuclear accumulation of CHMP7 in cells, the method comprising contacting the cells with an agent targeting CHMP2B expression in the cells, thereby reducing or inhibiting the nuclear accumulation of CHMP7 in the cells.

7. The method of claim 6, wherein targeting CHMP2B expression comprises reducing CHMP2B expression in the cells.

8. The method of claim 6, wherein the cell is a neuron.

9. The method of claim 7, wherein the neuronal cells exhibit pathological nuclear accumulation of CHMP7 or are at risk of pathological nuclear accumulation of CHMP7.

10. The method of claim 7, wherein the neuronal cells are derived from a subject suffering from amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration.

11. The method of claim 6, wherein the agent targeting CHMP2B expression is siRNA, antisense oligonucleotide (ASO), or a combination thereof.

12. The method of claim 11, wherein the ASO comprises nucleic acid sequences of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or combinations thereof.

13. A method for reducing or inhibiting nucleoporin (Nup) turnover in cells, the method comprising contacting the cells with an agent targeting CHMP2B expression in the cells, thereby reducing or inhibiting Nup turnover in the cells.

14. The method of claim 13, wherein targeting CHMP2B expression comprises reducing CHMP2B expression in the cells.

15. The method of claim 14, wherein reducing CHMP2B in the cells comprises: The accumulation of CHMP7 nuclei in cells is reduced or inhibited compared to the accumulation of CHMP7 nuclei in cells treated with a control agent or in cells before contact with an agent targeting CHMP2B.

16. The method of claim 15, wherein reducing or inhibiting the nuclear accumulation of CHMP7 in the cells comprises: Nup turnover in the cells was reduced or inhibited compared to Nup turnover in cells treated with a control agent or in the cells before the cells were exposed to an agent targeting CHMP2B.

17. The method according to any one of claims 13-15, wherein the cell is a neuron.

18. The method of claim 17, wherein the neuronal cells exhibit pathological Nup turnover or are at risk of Nup turnover occurring in the cells.

19. The method of claim 17, wherein the neuronal cells are derived from a subject suffering from amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration.

20. The method of claim 13, wherein the agent targeting CHMP2B expression is siRNA, ASO, or a combination thereof.

21. The method of claim 20, wherein the ASO comprises a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.

22. A method for reducing or inhibiting nuclear pore complex (NPC) damage in cells, the method comprising contacting the cells with an agent targeting CHMP2B expression in the cells, thereby reducing or inhibiting NPC damage in the cells.

23. The method of claim 22, wherein targeting CHMP2B expression comprises reducing CHMP2B expression in the cells.

24. The method of claim 23, wherein reducing CHMP2B in the cells comprises: The accumulation of CHMP7 nuclei in cells is reduced or inhibited compared to the accumulation of CHMP7 nuclei in cells treated with a control agent or in cells before contact with an agent targeting CHMP2B.

25. The method of claim 24, wherein reducing or inhibiting the nuclear accumulation of CHMP7 in the cells comprises: Nup turnover in the cells was reduced or inhibited compared to Nup turnover in cells treated with a control agent or in the cells before the cells were exposed to an agent targeting CHMP2B.

26. The method of claim 25, wherein reducing or inhibiting Nup turnover in the cells comprises: The NPC damage in the cells was reduced or inhibited compared to NPC damage in cells treated with a control agent or in the cells before the cells were exposed to an agent targeting CHMP2B.

27. The method according to any one of claims 22-26, wherein the cell is a neuron.

28. The method of claim 27, wherein the neuronal cells exhibit NPC damage or are at risk of NPC damage occurring in the cells.

29. The method of claim 28, wherein the neuronal cells are derived from a subject suffering from amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration.

30. The method of claim 22, wherein the agent targeting CHMP2B expression is siRNA, ASO, or a combination thereof.

31. The method of claim 30, wherein the ASO comprises nucleic acid sequences of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or combinations thereof.

32. A method for reducing or inhibiting TDP-43 mislocalization in cells, the method comprising contacting the cells with an agent that targets CHMP2B expression in the cells, thereby reducing or inhibiting TDP-43 mislocalization in the cells.

33. The method of claim 32, wherein targeting CHMP2B expression comprises reducing CHMP2B expression in the cells.

34. The method of claim 33, wherein reducing CHMP2B in the cells comprises: The accumulation of CHMP7 nuclei in cells is reduced or inhibited compared to the accumulation of CHMP7 nuclei in cells treated with a control agent or in cells before contact with an agent targeting CHMP2B.

35. The method of claim 34, wherein reducing or inhibiting the nuclear accumulation of CHMP7 in the cells comprises: Nup turnover in the cells was reduced or inhibited compared to Nup turnover in cells treated with a control agent or in the cells before the cells were exposed to an agent targeting CHMP2B.

36. The method of claim 35, wherein reducing or inhibiting Nup turnover in the cells comprises: The NPC damage in the cells was reduced or inhibited compared to NPC damage in cells treated with a control agent or in the cells before the cells were exposed to an agent targeting CHMP2B.

37. The method of claim 36, wherein reducing or inhibiting NPC damage in the cells comprises: The TDP-43 mislocalization in the cells was reduced or inhibited compared to TDP-43 mislocalization in cells treated with a control agent or in the cells before contacting the cells with an agent targeting CHMP2B.

38. The method according to any one of claims 32-37, wherein the cell is a neuron.

39. The method of claim 38, wherein the neuronal cells exhibit TDP-43 mislocalization or are at risk of TDP-43 mislocalization occurring in the cells.

40. The method of claim 39, wherein the neuronal cells are derived from a subject suffering from amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration.

41. The method of claim 32, wherein the agent targeting CHMP2B expression is siRNA, ASO, or a combination thereof.

42. The method of claim 41, wherein the ASO comprises a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.

43. A method for reducing or inhibiting the loss of TDP-43 function in cells, the method comprising regulating CHMP2B expression in the cells, including contacting the cells with an agent targeting CHMP2B expression in the cells, thereby reducing or inhibiting the loss of TDP-43 function in the cells.

44. The method of claim 43, wherein targeting CHMP2B expression comprises reducing CHMP2B expression in the cells.

45. The method of claim 44, wherein reducing CHMP2B in the cells comprises: The accumulation of CHMP7 nuclei in cells is reduced or inhibited compared to the accumulation of CHMP7 nuclei in cells treated with a control agent or in cells before contact with an agent targeting CHMP2B.

46. ​​The method of claim 45, wherein reducing or inhibiting the nuclear accumulation of CHMP7 in the cells comprises: Nup turnover in the cells was reduced or inhibited compared to Nup turnover in cells treated with a control agent or in the cells before the cells were exposed to an agent targeting CHMP2B.

47. The method of claim 46, wherein reducing or inhibiting Nup turnover in the cells comprises: The NPC damage in the cells was reduced or inhibited compared to NPC damage in cells treated with a control agent or in the cells before the cells were exposed to an agent targeting CHMP2B.

48. The method of claim 47, wherein reducing or inhibiting NPC damage in the cells comprises: The TDP-43 mislocalization in the cells was reduced or inhibited compared to TDP-43 mislocalization in cells treated with a control agent or in the cells before contacting the cells with an agent targeting CHMP2B.

49. The method of claim 48, wherein reducing or inhibiting NPC damage in the cells comprises: Compared with the loss of TDP-43 function in cells treated with a control agent or the loss of TDP-43 function in cells before exposure to an agent targeting CHMP2B, the loss of TDP-43 function in the cells is reduced or inhibited.

50. The method of claim 43, wherein the loss of TDP-43 function is caused by TDP-43 nuclear depletion, TDP-43 cytoplasmic mislocalization, TDP-43 aggregation, or a combination thereof.

51. The method according to any one of claims 43-50, wherein the cell is a neuron.

52. The method of claim 51, wherein the neuronal cells exhibit TDP-43 loss of function or are at risk of TDP-43 loss of function in the cells.

53. The method of claim 51, wherein the neuronal cells are derived from a subject suffering from amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration.

54. The method of claim 43, wherein the agent targeting CHMP2B expression is siRNA, ASO, or a combination thereof.

55. The method of claim 54, wherein the ASO comprises a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.

56. A method for treating a neurodegenerative disease in a subject, the method comprising modulating CHMP2B expression in the subject, including administering a CHMP2B-targeting agent to the subject to treat the neurodegenerative disease.

57. The method of claim 56, wherein targeting CHMP2B expression comprises reducing CHMP2B expression in cells from the subject.

58. The method of claim 57, wherein reducing CHMP2B expression in the cells comprises: CHMP7 nuclear accumulation in the subject's cells was reduced or inhibited compared to CHMP7 nuclear accumulation in the subject's cells before treatment with a CHMP2B-targeting agent or compared to CHMP7 nuclear accumulation in the subject's cells before treatment with a CHMP2B-targeting agent.

59. The method of claim 58, wherein reducing or inhibiting the nuclear accumulation of CHMP7 in the cells of the subject comprises: Nup turnover from the subject's cells was reduced or inhibited compared to Nup turnover from the subject's cells before treatment with a CHMP2B-targeting agent or compared to Nup turnover from the subject's cells before treatment with a CHMP2B-targeting agent.

60. The method of claim 59, wherein reducing Nup turnover from the cells of the subject comprises: The NPC damage in the subject's cells was reduced or inhibited compared to NPC damage in the subject's cells treated with a control agent or NPC damage in the subject's cells before treatment with an agent targeting CHMP2B.

61. The method of claim 60, wherein reducing NPC damage comprises: The TDP-43 mislocalization in the subject's cells was reduced or inhibited compared to TDP-43 mislocalization in the subject's cells before treatment with a CHMP2B-targeting agent or before treatment with a CHMP2B-targeting agent.

62. The method of claim 61, wherein reducing TDP-43 error location comprises: Compared with TDP-43 loss of function in cells from subjects treated with a control agent or TDP-43 loss of function in cells from subjects prior to treatment with an agent targeting CHMP2B, the loss of TDP-43 function in cells from subjects was reduced or inhibited.

63. The method of claim 62, wherein the loss of TDP-43 function is caused by TDP-43 nuclear depletion, TDP-43 cytoplasmic mislocalization, TDP-43 aggregation, or a combination thereof, in cells from the subject.

64. The method according to any one of claims 56-63, wherein the cell is a neuron.

65. The method of claim 56, wherein the CHMP2B-targeting agent targets the CHMP7-CHMP2B protein interaction.

66. The method of claim 56, wherein the agent targeting CHMP2B is a nucleic acid, protein, peptide, or small molecule.

67. The method according to any one of claims 56-66, wherein the agent targeting CHMP2B expression is siRNA, ASO, or a combination thereof.

68. The method of claim 67, wherein the ASO comprises a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.

69. The method according to any one of claims 56-68, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), Alzheimer's disease, motor neuron disease, Parkinson's disease, Pick's disease, Huntington's disease, mild cognitive impairment, Lewy body disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, or frontotemporal degeneration.

70. The method of claim 69, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

71. The method of claim 70, wherein the ALS is disseminated ALS.

72. The method of claim 56 further comprises administering edaravone, riluzole, AMX0035, tovson, or a combination thereof to the subject.

73. The method of claim 56, wherein the administration is by oral, systemic, parenteral, intrathecal, intranasal, intravenous, subcutaneous, intraventricular, inhalation, or via suppository.

Images