Recombinant microorganism capable of growing using only carbon dioxide and formic acid, and method for producing useful substances using the recombinant microorganism

Abstract

Recombinant microorganism in which a gene encoding a transcriptional repressor of the glycine cleavage system, pyruvate formate lyase or phosphoglycerate dehydrogenase, is attenuated or deleted from a host microorganism with a formic acid assimilation pathway, a ppsR gene encoding a phosphoenolpyruvate synthase regulatory protein, or a purT gene encoding a phosphoribosylglycinamide formyltransferase, is attenuated or deleted, a gcvTHP gene, consisting of the gcvT gene, the gcvH gene and the gcvP gene, which encodes an enzyme involved in a glycine cleavage system reaction in which host microorganism with the formic acid assimilation pathway is highly expressed, and a gene encoding formate tetrahydrofolate ligase, methenyl tetrahydrofolate cyclohydrolase or methylene tetrahydrofolate dehydrogenase is introduced into the host microorganism via the formic acid assimilation pathway.

Description

BACKGROUND OF THE INVENTION Area of ​​the invention

[0001] The present invention relates to a recombinant microorganism capable of growing using only carbon dioxide and formic acid, and to a method for producing useful substances using the recombinant microorganism. More specifically, the present invention relates to a recombinant microorganism capable of growing using only carbon dioxide and formic acid by introducing and improving the metabolic pathway for the synthesis of pyruvic acid from carbon dioxide and formic acid in order to improve the efficiency of pyruvic acid synthesis, and by carrying out additional genetic manipulations, as well as to a method for producing useful substances using the recombinant microorganism. Description of the state of the art

[0002] In an effort to reduce greenhouse gas emissions, a major cause of rapid climate change, research is actively focused on synthesizing liquid or solid organic compounds with a higher carbon number, rather than gaseous compounds consisting of only one carbon atom, such as carbon dioxide, the main component of greenhouse gases. Research into converting a single-carbon compound (C1 compound) can be broadly divided into chemical and biological methods. Chemical methods employ electrochemical reactions based on metallic and non-metallic catalysts. These reactions convert carbon dioxide into a non-gaseous carbon compound such as methanol or formic acid, and examples from relevant research include conversion using a carbon nanotube catalyst (Kumar et al., Nat.Comm. 2819, 2013), the conversion with an iron catalyst (Christopher et al., Angew. Chem. Int. Ed. 49:50, 9777-9780, 2010), the conversion with an alloy catalyst (Studt et al., Nat. Chem., 6, 320-324, 2014), and the like. The conversion using these chemical methods has the advantage of relatively high speed, but the disadvantage that the products obtained by the process for converting C1 compounds are single-carbon substances such as formic acid and methanol, and not useful compounds containing multiple carbon atoms.

[0003] In the field of biological conversion methods, research focuses on the conversion of a gaseous C1 compound into a non-gaseous compound and on the conversion of a C1 compound into a useful compound consisting of several carbon atoms. In the first case, research has explored the utilization and improvement of naturally occurring metabolic pathways (PCT / US2008 / 083056), the development of new metabolic pathways (Schwander et al., Science, 354: 6314, 900-904, 2016), and similar approaches. Examples of the latter include the production of useful compounds using methanol-assimilating microorganisms (US 2003 / 0124687 A1), the synthesis of three-carbon compounds from formic acid (US 2013 / 0196359 A1), and the like.However, this research is limited because its low efficiency makes it difficult to determine its effects under in vivo conditions, and it has not been verified whether its function is compatible with metabolic pathways in living organisms.

[0004] Therefore, ongoing research is being conducted in industry to overcome the limitations of the biological C1 compound conversion process described above and thereby develop an efficient C1 compound conversion process. Among the C1 compounds, formic acid, in particular, has the advantage of being relatively less toxic to organisms than other C1 compounds and, compared to other C1 compounds, is advantageous for assimilation (anabolic) reactions in terms of reaction mechanics. Furthermore, it can be easily and rapidly synthesized from carbon dioxide using chemical methods. However, the genomic information of the genus Methylobacterium, a representative formic acid-assimilating bacterium, was only discovered in 2009; that is, the fundamental research for its application was conducted relatively recently.Currently, theoretically proven methods for converting C1 carbon sources into useful chemicals are being tested. A recent study reported that E. coli grows using only carbon dioxide and formic acid (Gleizer, S. et al. Cell 179, 1255-1263, 2019; Kim, S. et al. Nat. Chem. Biol. 1-8, 2020). However, one limitation is that the level of cell growth is remarkably low.

[0005] Document DE 11 2017 006 592 T5 discloses a recombinant microorganism into which a xenogeneic gene has been introduced and a method for producing a useful material from formic acid and carbon dioxide using the microorganism.

[0006] Document Bang et al., 2018, PNAS, 115, 40, E9271-E9279 reveals the assimilation of formic acid and CO2 by genetically modified Escherichia coli with reconstructed one-carbon assimilation pathways.

[0007] Therefore, in an earlier study (Korean Patent No. 10-2000755), the inventors of the present invention developed and verified a new metabolic pathway for converting formic acid, a C1 compound, into a useful compound composed of several carbons, and, using the same, conducted further investigations into the development of microorganisms that grow using only carbon dioxide and formic acid as carbon sources. As a result, the inventors of the present invention found that microorganisms can be cultivated that use only carbon dioxide and formic acid as carbon sources by extracting the gene encoding the enzyme phosphoribosylglycinamide formyltransferase from the genome of E.coli is removed, the metabolic flow of gluconeogenesis is increased, and formate dehydrogenase, which originates from microorganisms of the genus Candida, and a mutated gene of formate dehydrogenase, which originates from plants of the genus Arabidopsis, are introduced.Furthermore, the inventors of the present invention have found that the microorganisms can grow to a sufficiently high cell density to be suitable for the production of useful chemicals by regulating the expression levels of the gene expressing the reconstructed tetrahydrofolate metabolic cycle, the gene expressing formate dehydrogenase derived from the microorganism of the genus Candida, and a formate dehydrogenase mutant derived from plants of the genus Arabidopsis; by effectively regulating the expression level of membrane proteins required for energy supply in microorganisms by changing the culture temperature conditions; by developing a culture method to increase aeration depending on the growth of the microorganisms; and by developing a culture method to maintain the concentration of formic acid in the culture medium at an optimal level.Based on these findings, the present invention was completed. [State of the art document][Patent documents] (Patent Document 1) PCT / US2008 / 083056 (Patent Document 2) US 2003 / 0124687 (Patent Document 3) US 2013 / 0196359 (Patent Document 4) KR 10-2000755 [Non-patent documents] (Non-patent document 1) Kumar et al., Nat. Comm, 2819, 2013 (Non-patent document 2) Christopher et al., Angew. Chem. Int. Ed. 49:50, 9777-9780, 2010 (Non-patent document 3) Studt et al., Nat. Chem, 6, 320-324, 2014 (Non-patent document 4) Schwander et al., Science, 354:6314. 900-904, 2016 (Non-patent document 5) Gleizer, S. et al. Cell 179, 1255-1263, 2019 (Non-patent document 6) Kim, S. et al. Nat. Chem. Biol. 1-8, 2020 SUMMARY OF THE INVENTION

[0008] Therefore, the present invention was made with regard to the problems mentioned above, and it is an object of the present invention to provide a recombinant microorganism with improved efficiency in the synthesis of C3 compounds from formic acid and carbon dioxide.

[0009] Another object of the present invention is to provide a process for the production of C3 compounds from formic acid and carbon dioxide using the recombinant microorganism.

[0010] According to one aspect of the present invention, the above and other problems can be achieved by providing a recombinant microorganism in which a gene encoding a transcription repressor of the glycine cleavage system, pyruvate formate lyase or phosphoglycerate dehydrogenase, is attenuated or deleted from a host microorganism with a formic acid assimilation pathway. a ppsR gene encoding a phosphoenolpyruvate synthase regulatory protein, or a purT gene encoding a phosphoribosylglycinamide formyltransferase, is attenuated or deleted, a gcvTHP gene, consisting of the gcvT gene, the gcvH gene and the gcvP gene, which encodes an enzyme involved in a glycine cleavage system reaction in which host microorganism with the formic acid assimilation pathway is highly expressed, and a gene encoding formate tetrahydrofolate ligase, methenyl tetrahydrofolate cyclohydrolase or methylene tetrahydrofolate dehydrogenase is introduced into the host microorganism via the formic acid assimilation pathway.

[0011] According to a further aspect of the present invention, a method for producing a C3 compound is provided, comprising (a) a step of cultivating the recombinant microorganism with formic acid and carbon dioxide as carbon sources to produce a C3 compound and (b) a step of collecting the produced C3 compound. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The above and other tasks, features and other advantages of the present invention will be more clearly understood from the following detailed description in conjunction with the accompanying drawings, in which: Fig. Figure 1 shows the central metabolic pathway for the assimilation of carbon dioxide and formic acid in recombinant microorganisms, as well as the genes, enzymes, and metabolites involved; Fig.2 is a plasmid card produced by introducing the gene involved in the assimilation of carbon dioxide and formic acid, a plasmid into which formate dehydrogenase derived from Candida and Arabidopsis is inserted, and a mutant of formate dehydrogenase derived from the genus Arabidopsis; Fig. Figure 3 is a diagram showing the cell growth of the produced strains DH5α FC1 to DH5α FC5 when cultivated using only carbon dioxide and formic acid; Fig. Figure 4 is a diagram showing the amount of change in CFU of the DH5α FC5 strain over time; Fig. 5 is a diagram comparing cell growth depending on the optimization of culture conditions; Fig. Figure 6 shows a map of the plasmids that were produced in such a way that they were different depending on the plasmid type. exhibit different plasmid copy numbers and changes in gene expression levels; Fig. Figure 7 is a diagram showing the cell growth of the DH5α strains FC5, FC7 and FC8, which were cultivated using only carbon dioxide and formic acid; Fig. Figure 8 is a diagram showing the cell growth of a DH5α FC8 strain in a flask culture using only carbon dioxide and formic acid; Fig. Figure 9 is a diagram showing the relative expression levels of cyoA, cyoB, cydA and cydB by the DH5α FC8 strain in a culture at 32°C compared to 37°C; Fig. Figure 10 is a diagram showing the cell growth of the DH5α FC8 strain in a fermenter culture using only carbon dioxide and formic acid; Fig. Figure 11 is a diagram showing the cell growth of the DH5α FC8 strain in a fermenter culture using only carbon dioxide and formic acid; Fig. Figure 12 is a diagram showing the cell growth of the DH5α FC8 strain in a fermenter culture using only carbon dioxide and formic acid; and Fig. 13 is a diagram showing the formic acid-derived 13 C-carbon shown, which was detected in serine in the Mannheimia strain introduced via the formic acid assimilation pathway (LPK7_FTF) and the Mannheimia wild type strain (LPK7). DETAILED DESCRIPTION OF THE INVENTION

[0013] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as understood by those skilled in the art in the field of the present invention. The nomenclature used herein is generally known and commonly used in the field of engineering.

[0014] The present invention is based on the finding that the conversion rate of carbon dioxide and formic acid to pyruvic acid can be significantly increased by further improving a recombinant microorganism with a novel circulating metabolic pathway capable of synthesizing C3 compounds from formic acid and carbon dioxide, as conceived by the present inventors (KR Patent No. 10-2000755), in particular that the recombinant microorganisms can be enabled to grow using only carbon dioxide and formic acid, without the additional supply of glucose that was conventionally used to cultivate recombinant microorganisms, and that the efficiency of C3 compound synthesis can be significantly improved compared to the prior art by improving the fermentation process in which the recombinant microorganism can also synthesize pyruvic acid.

[0015] In one aspect, the present invention relates to a recombinant microorganism in which a gene encoding a transcription repressor of the glycine cleavage system, pyruvate formate lyase or phosphoglycerate dehydrogenase, is attenuated or deleted from a host microorganism with a formic acid assimilation pathway. a ppsR gene encoding a phosphoenolpyruvate synthase regulatory protein, or a purT gene encoding a phosphoribosylglycinamide formyltransferase, is attenuated or deleted, a gcvTHP gene, consisting of the gcvT gene, the gcvH gene and the gcvP gene, which encodes an enzyme involved in a glycine cleavage system reaction in which host microorganism with the formic acid assimilation pathway is highly expressed, and a gene encoding formate tetrahydrofolate ligase, methenyl tetrahydrofolate cyclohydrolase or methylene tetrahydrofolate dehydrogenase is introduced into the host microorganism via the formic acid assimilation pathway.

[0016] According to the present invention, the formic acid-carbon assimilation pathway is a cyclic pathway for the assimilation of carbon dioxide and formic acid to three-carbon pyruvic acid in microorganisms. Genes, coenzymes, and energy carriers involved in the formic acid assimilation pathway of E. coli are described in Fig. 1 shown.

[0017] Within the scope of the present invention, the formic acid assimilation pathway can be combined with the central carbon assimilation pathway to synthesize a carbon compound with three or more carbon atoms. The host microorganism: i) naturally possesses a central carbon assimilation pathway; or ii) has introduced a central carbon assimilation pathway into it.

[0018] According to the present invention, the host microorganism is selected from the group consisting of the genera Escherichia, Mannheimia, Rhodobacter and Methylobacterium, but is not limited to these.

[0019] According to the present invention, the expression of the gene encoding the enzyme involved in the glycine cleavage system reaction can be enhanced by replacing a native promoter with a strong promoter, but the invention is not limited thereto.

[0020] According to the present invention, the strong promoter is selected from the group consisting of a trc promoter, a tac promoter, a T7 promoter, a lac promoter and a trp promoter, but is not limited to this group.

[0021] According to the present invention, the formate tetrahydrofolate ligase, the methenyl tetrahydrofolate cyclohydrolase, and the ethylene tetrahydrofolate dehydrogenase are derived from Methylobacterium extorquens, but the invention is not limited thereto. The gene encoding formate tetrahydrofolate ligase has the nucleotide sequence SEQ ID NO: 1, the gene encoding methenyl tetrahydrofolate cyclohydrolase has the nucleotide sequence SEQ ID NO: 2, and the gene encoding methylene tetrahydrofolate dehydrogenase has the nucleotide sequence SEQ ID NO: 3, but the present invention is not limited thereto.

[0022] According to the present invention, a gene encoding a phosphoenolpyruvate synthase regulatory protein or phosphoribosylglycinamide formyltransferase can be further attenuated or deleted in the recombinant microorganism, thereby reducing the expression of a gene encoding phosphoenolpyruvate synthase or H + The expression of translocating NAD(P) transhydrogenase can be further enhanced in the recombinant microorganism, and a gene encoding formate dehydrogenase and / or a mutant thereof can be further introduced into the recombinant microorganism.

[0023] According to the present invention, the expression of the gene responsible for phosphoenolpyruvate synthase (ppsA) and the H +-translocating NAD(P) transhydrogenase (pntAB) encoded, enhanced by replacing a native promoter with a strong promoter, wherein the strong promoter is selected from the group consisting of a trc promoter, a tac promoter, a T7 promoter, a lac promoter and a trp promoter, wherein the present invention is not limited thereto.

[0024] According to the present invention, genes encoding one or more from the group consisting of formate tetrahydrofolate ligase, methenyl tetrahydrofolate cyclohydrolase, methylene tetrahydrofolate dehydrogenase, formate dehydrogenase and formate dehydrogenase mutant are introduced by cloning them into a vector containing an origin of replication with 1 to 12 copies, preferably by cloning them into a vector containing an origin of replication with 1 to 5 copies, although the invention is not limited thereto.

[0025] According to the present invention, the formate dehydrogenase can be derived from Candida boidinii, and the gene encoding the formate dehydrogenase mutant can be derived from Arabidopsis thaliana, but the present invention is not limited thereto.

[0026] According to the present invention, the gene encoding formate dehydrogenase is represented by a nucleotide sequence of SEQ ID NO: 18, and the gene encoding the formate dehydrogenase mutant is represented by a nucleotide sequence of SEQ ID NO: 21, but the present invention is not limited thereto. According to one aspect of the present invention, the native promoter has been replaced by a strong promoter to enhance the gene encoding the enzyme involved in the glycine cleavage system reaction in the recombinant microorganism, and the gene encoding the transcriptional repressor of the glycine cleavage system has been deleted to suppress the glycine cleavage system. Furthermore, the gene encoding pyruvate formate lyase has been deleted to prevent unnecessary conversion of pyruvic acid to formic acid and to improve pyruvate formation flux.Furthermore, the gene encoding D-3-phosphoglycerate dehydrogenase is essential for growth in glucose-containing M9 minimal medium. When this gene is deleted, 5,10-CH2-THF, required for the biosynthesis of metabolites such as purine and methionine, can only be produced via the C1 compound assimilation pathway. Therefore, strain growth is promoted when the metabolic flux of the C1 compound assimilation pathway is improved. Consequently, the gene encoding D-3-phosphoglycerate dehydrogenase was deleted.

[0027] The recombinant microorganism according to the present invention is able to produce a C3 compound using only formic acid and carbon dioxide as carbon sources.

[0028] The recombinant microorganism according to the present invention is also able to grow using only formic acid and carbon dioxide as carbon sources.

[0029] The genes of the present invention can be modified in various ways in the coding region, as long as the amino acid sequence of the protein expressed by the coding region is not altered, and they can be freely varied or modified as long as the expression of the genes in a region outside the coding region is not affected, and such varied or modified genes also fall within the scope of the present invention.

[0030] Therefore, the present invention also comprises a polynucleotide having a nucleotide sequence that is substantially identical to the gene, as well as a fragment of the gene. The term "substantially identical polynucleotide" means a gene that codes for an enzyme having the same function as the one used in the present invention, regardless of the homology of the sequence. The term "fragment of the gene" also means a gene that codes for an enzyme having the same function as the one used in the present invention, regardless of the length of the fragment.

[0031] Furthermore, the amino acid sequence of the protein, which is an expression product of the gene of the present invention, can be obtained from biological resources such as various microorganisms, as long as the titer and activity of the corresponding enzyme are not affected, and these biological resources also fall within the scope of the present invention.

[0032] Therefore, the present invention also includes polypeptides with amino acid sequences that are substantially identical to the protein, as well as fragments of the polypeptides. The term "substantially identical polypeptide" means a protein with the same function as the one used in the present invention, regardless of the homology of the amino acid sequence. The term "fragment of the polypeptide" also refers to a protein that has the same function as the one used in the present invention, regardless of the length of the fragment.

[0033] The term “vector” as used here refers to a DNA product containing a DNA sequence functionally linked to a regulatory sequence capable of expressing DNA in a suitable host, and may be a plasmid, a phage particle, or a simple potential genome insertion. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases, it can be integrated into the host genome. Since the plasmid is the most commonly used type of vector, the terms “plasmid” and “vector” are sometimes used interchangeably in the description of the present invention. For the purposes of the present invention, a plasmid vector is preferably used.A typical plasmid vector suitable for this purpose comprises (a) an origin of replication to efficiently carry out replication, resulting in several to several hundred plasmid vectors per host cell, (b) an antibiotic resistance gene to screen a host cell transformed with the plasmid vector, and (c) a restriction enzyme cleavage site into which a foreign DNA fragment is inserted. Even if a suitable restriction enzyme cleavage site is not present, the vector and the foreign DNA can be readily ligated using a synthetic oligonucleotide adapter or linker via a conventional procedure. Following ligation, the vector should be transformed into a suitable host cell. Transformation can be easily accomplished using a calcium chloride or electroporation method (Neumann et al., EMBO J., 1: 841, 1982).

[0034] For the purposes of the present invention, “gene is attenuated (or inactivated)” means that the expression of the gene is attenuated compared to the wild type, or that the function or activity of the protein encoded by the gene is attenuated compared to the wild type.

[0035] Known expression vectors can be used as vectors for the enhancement or overexpression of genes in accordance with the present invention.

[0036] When one nucleotide sequence is aligned with another based on a functional relationship, it is said to be "functionally linked" to it. This can involve a gene(s) and a regulatory sequence(s) that are linked in such a way that they enable gene expression when a suitable molecule (e.g., a transcription activator protein) binds to the regulatory sequence(s).For example, the DNA for a pre-sequence or secretory leader is functionally linked to the DNA for a polypeptide if it is expressed as a pre-protein involved in the secretion of the polypeptide; a promoter or enhancer is functionally linked to a coding sequence if it influences the transcription of the sequence; a ribosome binding site is functionally linked to a coding sequence if it is positioned to influence the transcription of the sequence; or a ribosome binding site is functionally linked to a coding sequence if it is positioned to facilitate translation. In general, "functionally linked" means that the linked DNA sequence is in contact with it, or that a secretory leader is in contact with it and present in the reading frame. The enhancer, however, does not need to be in contact.These sequences are linked by ligation (joining) at a suitable restriction enzyme site. If such a site is not present, a synthetic oligonucleotide adapter or a linker is used according to a conventional procedure. As is known in the field, to increase the expression level of a transgene in a host cell, the gene should be linked with a... The transcriptional / translational expression regulation sequence is functionally linked to a selected expression host. Preferably, the expression regulation sequence and the corresponding gene are contained in a recombinant vector that includes both a bacterial selection marker and an origin of replication. If the host cell is a eukaryotic cell, the recombinant vector should also contain a useful expression marker in the eukaryotic expression host.

[0037] The host cell transformed with the recombinant vector described above is a further aspect of the present invention. The term "transformation" used here means the introduction of DNA into a host and making the DNA replicable by means of an extrachromosomal factor or chromosomal integration.

[0038] It should be clear that not all vectors function identically in the expression of the DNA sequences of the present invention. Likewise, not all hosts function identically for the same expression system. However, the person skilled in the art will be able to make a suitable selection from a variety of vectors, expression regulation sequences, and hosts without excessive experimentation and without deviating from the scope of the present invention. For example, the selection of a vector should be made with consideration of the host in which the vector is to be replicated. The number of replications of the vector, the ability to control the number of replications, and the expression of other proteins encoded by the vector, such as the expression of antibiotic markers, should also be taken into account.

[0039] Furthermore, the gene introduced within the scope of the present invention can be introduced into the genome of a host cell and exist as a chromosomal factor.

[0040] The expert will understand that even the insertion of the gene into the host cell's genome has the same effect as introducing the recombinant vector into the host cell.

[0041] In the meantime, it has been found that the growth of the recombinant microorganism can be improved by a factor of 7-11 in the present invention by adjusting the IPTG dose, culture temperature, aeration, formic acid concentration and pH conditions in the cultivation step of the recombinant microorganism.

[0042] In another aspect, the present invention relates to a method for producing a C3 compound, comprising: (a) a step of cultivating the recombinant microorganism with formic acid and carbon dioxide as carbon sources to produce a C3 compound; and (b) a step of collecting the produced C3 compound.

[0043] According to the present invention, 0.02 to 0.08 mM IPTG, preferably 0.04 to 0.06 mM IPTG, most preferably 0.05 mM IPTG, is added during the cultivation step of the recombinant microorganism. This induces gene expression with a significantly lower IPTG dose than in related methods that use 1 mM IPTG. This promotes the growth of the microorganisms while simultaneously allowing for fine control of the pyruvic acid synthesis pathway using carbon dioxide and formic acid.

[0044] According to the present invention, the recombinant microorganism can be cultivated at 31 to 33°C, preferably at 32°C, but is not limited to this temperature range. Under the aforementioned temperature conditions, cytochrome b3-ubiquinol oxidase (Cyo) and cytochrome bd-I-ubiquinol oxidase (Cyd) convert the reducing power most efficiently into cellular energy, namely ATP.

[0045] According to the present invention, during the cultivation step, the formic acid concentration is maintained at 2 to 3 g / l and the pH value at 6.6 to 7.0, but the present invention is not limited thereto. Furthermore, the recombinant microorganism can initially be cultivated at a stirring speed of 450 to 550 rpm and then cultivated by increasing the stirring speed to a final speed of 700 to 800 rpm, and the present invention is not limited thereto. By providing such a formic acid concentration, such a pH value, and such aeration, the growth rate of the recombinant microorganism according to the present invention is significantly improved.

[0046] The recombinant microorganism and the process for producing a C3 compound using the same according to the present invention have the following features.

[0047] First, the recombinant microorganism according to the present invention improves the conversion rate of carbon dioxide and formic acid to pyruvic acid by improving the metabolically modified strain. For example, the pflB gene and the serA gene were further removed from the recombinant microorganism that can synthesize pyruvic acid using carbon dioxide and formic acid and which was first developed by the present inventors, in order to develop a strain that can synthesize pyruvic acid from carbon dioxide and formic acid at an improved rate (DH5α RG5).This strain synthesizes pyruvic acid from carbon dioxide and formic acid at a rate that is 12.9% of the rate of synthesis of pyruvic acid from glucose, which is increased to 70% compared to the conventional recombinant microorganisms that can synthesize pyruvic acid from carbon dioxide and formic acid developed by the present inventors.

[0048] The recombinant microorganism according to the present invention can be cultivated using only carbon dioxide and formic acid. The recombinant microorganisms previously developed by the present inventors are capable of producing pyruvic acid using carbon dioxide and formic acid, but glucose must be supplied separately for the growth of the recombinant microorganisms.However, the recombinant microorganism according to the present invention can grow using only carbon dioxide and formic acid without the supply of glucose, by removing the ppsR gene and the purT gene from the genome of the recombinant microorganism (DH5α RG5) with an improved synthesis rate of pyruvic acid from carbon dioxide and formic acid, replacing the native promoter of the ppsA gene with the strong trc promoter, and further introducing the formate dehydrogenase gene derived from Candida boidinii and the mutated formate dehydrogenase gene derived from Arabidopsis thaliana via the plasmid.

[0049] To further improve the growth rate of the recombinant microorganism (DH5α FC5), a recombinant microorganism (DH5α FC8) was developed according to the present invention in which the number of copies of the introduced plasmid was further adjusted. As a result, the growth rate of the recombinant microorganism DH5α FC8 was increased to 1.14 times that of the recombinant microorganism DH5α FC5. To further improve the growth rate of the recombinant microorganism (DH5α FC8), a recombinant microorganism (DH5α FC9) was developed according to the present invention in which the native promoter of the pntAB gene was replaced by a strong trc promoter. As a result, the growth rate of the recombinant microorganism DH5α FC9 was twice that of the recombinant microorganism DH5α FC8.

[0050] Within the scope of the present invention, culture and fermentation conditions have been determined that can maximize the growth of the recombinant microorganism. These culture and fermentation conditions provide the maximum growth limit, OD. 600 =7.38-11.1, which is 7-11 times higher than the maximum growth limit, OD 600 (about 1), of E. coli grown using only carbon dioxide and formic acid, as previously reported in the literature (Kim, S. et al. Nat. Chem. Biol. 1-8, 2020), achieved by reducing the IPTG dose for gene expression, lowering the culture temperature, improving aeration, and controlling the formic acid concentration and pH. Example

[0051] The present invention is described in more detail below with reference to the following examples. However, it will be clear to those skilled in the art that the following examples serve only to illustrate the present invention and are not to be understood as limiting its scope. Example 1: Improving the metabolic flow for the formation of pyruvic acid from carbon dioxide and formic acid by establishing a carbon dioxide and formic acid assimilation pathway and a metabolic engineering strategy

[0052] To improve carbon assimilation flux in the carbon dioxide and formic acid assimilation pathways, a plasmid containing the genes ftl, fch and mtd involved in the carbon dioxide and formic acid assimilation pathways was introduced into a recombinant E. coli strain in which the genes gcvR, pflB and serA of E. coli were deleted and the gcvT promoter was replaced by the strong trc promoter to develop a recombinant strain that synthesizes 12.9% of total pyruvic acid from carbon dioxide and formic acid.

[0053] Specifically, the foreign gene fragments required for plasmid production were generated by performing PCR using the genomic DNA of microorganisms that carry the corresponding gene as a template, and using a primer designed for gene amplification. The amplified gene fragments were then collected and purified. The corresponding genes and primer sequences are listed in Tables 1 and 2 below. [Table 1] Target gene NCBI information Derived microorganism ftfL Formate tetrahydrofolate ligase CP001298REGION: 434499-436172 [SEQ ID NO: 01] Methylobacterium extorquens CM4 fch Methenyltetrahydrofolate cyclohydrolaseCP001298 REGION: 2231946-2232572 [SEQ ID NO: 02] Methylobacterium extorquens CM4 mtdA Methylene tetrahydrofolate dehydrogenaseCP001298 REGION: 2230986-2231852[SEQ ID NO: 03] Methylobacterium extorquens CM4

[0054] A plasmid containing genes encoding the above-mentioned enzymes was produced to construct the carbon dioxide and formic acid assimilation pathway. [Table 3] Plasmid Features p100THF Contains pBR322 origin of replication, ampicillin resistance gene, BBa_23100 synthetic promoter, SEQ ID NO:01 formate tetrahydrofolate ligase, SEQ ID NO:02 methenyl tetrahydrofolate cyclohydrolase and SEQ ID NO:03 methylene tetrahydrofolate dehydrogenase

[0055] The plasmids were produced from the gene fragments of the plasmid backbone and the amplified gene fragments using the Gibson assembly method (Gibson et al., Nat. Methods, 6:5, 343-345, 2009), which is commonly used for the assembly of gene fragments, and each plasmid was produced to contain one or more of the foreign genes listed in the table above.

[0056] The recombinant plasmid produced by the method described above was transformed into E. coli to produce recombinant E. coli. The E. coli used in the present invention was E. coli DH5α (Invitrogen, USA), and the transformation into E. coli was carried out using a chemical transformation method commonly used in the art.

[0057] Furthermore, the native promoter was replaced with a strong trc promoter to enhance the gcvTHP gene (gcvT, NCBI GeneID: 947390; gcvH, NCBI GeneID: 947393; gcvP, NCBI GeneID: 947394), which encodes the enzyme involved in the glycine cleavage system reaction in the recombinant microorganism, and the gcvR gene, which suppresses the glycine cleavage system, was deleted. Additionally, the pflB gene, which encodes pyruvate formate lyase, was deleted to prevent unnecessary conversion of pyruvic acid to formic acid and to improve pyruvate production flux. Furthermore, the serA gene, which encodes D-3-phosphoglycerate dehydrogenase, is essential for growth in glucose-containing M9 minimal medium. If this gene is deleted, 5,10-CH2-THF, required for the biosynthesis of metabolites such as purine and methionine, can only be produced via the C1 compound assimilation pathway.Therefore, improving the metabolic flow of the C1 compound assimilation pathway facilitates stem growth. For this reason, the serA gene was deleted. The enhanced and deleted genes are listed below. [Table 4] Target gene NCBI information Derived microorganism gcvT AminomethyltransferaseNCBI GeneID:947390[SEQ ID NO: 10] Escherichia coli gcvH Glycine cleavage system H-proteinNCBI GeneID:947393[SEQ ID NO: 11] Escherichia coli gcvP Glycine decarboxylaseNCBI GeneID:947394[SEQ ID NO: 12] Escherichia coli pflB Pyruvate formate lyaseNCBI GeneID:945514[SEQ ID NO: 13] Escherichia coli serA Phosphoglycerate dehydrogenaseNCBI GeneID:945258[SEQ ID NO: 14] Escherichia coli gcvR Transcription repressor for the glycine cleavage system GeneID: 946950[SEQ ID NO: 15] Escherichia coli [Table 5] Name of the tribe Type of gene DH5α GTPS DH5a strain in which the gcvR, pflB and serA genes were deleted and the native promoter of gcvT was replaced by the trc promoter.

[0058] The p100THF plasmid was introduced into the generated strain to create the following strain. [Table 6] DH5α RG5 DH5α_GTPS, which houses the p100THF

[0059] Carbon isotope analysis was performed on recombinant E. coli (DH5α RG5) as the experimental group and on wild-type E. coli (DH5α WT) as the control group to determine the increased metabolic flux for the assimilation of carbon dioxide and formic acid in the produced recombinant E. coli (DH5α RG5). [Table 7] ingredient Salary (g / l) Na2HPO4 3,6 KH2PO4 3 NaCl 0,5 NH4Cl 1 MgSO4 0,24 CaCl2 0,011 glucose 5 Sodium formate 13 C 2,76 Folate 0,01 Sodium bicarbonate 13 C 3,4 FeSO4 0,00455 NiSO4 0,00464 Sodium molybdate 0,00618 Thiamine 0,01

[0060] The control and experimental E. coli were cultured in M9 medium enriched with a 13 The sample contained carbon-14 isotope-labeled formate and bicarbonate ions (see the composition given in Table 7), and then the E. coli cell samples were analyzed. The mass number of the amino acids comprising E. coli was analyzed using E. coli cell samples by gas chromatography / mass spectrometry after hydrolysis of all proteins comprising Escherichia coli under strongly acidic and high-temperature conditions (Zamboni et al., Nat. Protocols, 4:6, 878-892, 2009).

[0061] The results of the isotope analysis showed that the DH5α RG5 strain increased the metabolic flux for the formation of pyruvic acid by assimilation with carbon dioxide and formic acid to 12.9% of the total metabolic flux for the formation of pyruvic acid. Example 2: Development of recombinant microorganisms that can grow using only carbon dioxide and formic acid by improving a metabolically modified strain

[0062] The genes ppsR and purT were deleted from the genome of the recombinant E. coli strain produced in Example 1, the promoter of the ppsA gene was replaced by a strong trc promoter to generate a recombinant E. coli strain (DH5α AKO1), and a plasmid (p100FA2) generated by adding the fdh gene and the fdhmut gene to the plasmid produced in Example 1 was introduced into the recombinant E. coli strain (DH5α AKO1) to generate E. coli (DH5α FC5) that can grow using only carbon dioxide and formic acid. [Table 8] Target gene NCBI information Derived microorganism ppsR Phosphoenolpyruvate synthase regulatory protein NCBI GeneID:946207[SEQ ID NO: 16] Escherichia coli purT Phosphoribosylglycinamide formyltransferaseNCBI GeneID:946368[SEQ ID NO: 17] Escherichia coli [Table 9] Plasmid Features p100FA2 Contains pBR322 origin of replication, ampicillin resistance gene, BBa_23100 synthetic promoter, SEQ ID NO: 01 formate tetrahydrofolate ligase, SEQ ID NO: 02 methenyl tetrahydrofolate cyclohydrolase, SEQ ID NO: 03 methylene tetrahydrofolate dehydrogenase, SEQ ID NO: 18 formate dehydrogenase and SEQ ID NO: 21 formate dehydrogenase mutant

[0063] For cells to grow using only carbon dioxide and formic acid without glucose, a continuous supply of energy and reducing power (redox) is required. This necessitates a metabolic pathway for the production of NADH and NADPH while simultaneously converting formic acid to carbon dioxide. Therefore, the fdh gene derived from Candida boidinii, which encodes for formic acid dehydrogenase using NAD+, and a mutant fdh were developed. mut The fdh gene, derived from Arabidopsis thaliana and encoding for formic acid dehydrogenase using NADP+, was introduced into the p100THF plasmid to create a p100FA2 plasmid. [Table 10] Plasmid Features p100FA2 Contains pBR322 origin of replication, ampicillin resistance gene, BBa_23100 synthetic promoter, SEQ ID NO: 01 formate tetrahydrofolate ligase, SEQ ID NO: 02 methenyl tetrahydrofolate cyclohydrolase, SEQ ID NO: 03 methylene tetrahydrofolate dehydrogenase, SEQ ID NO: 18 formate dehydrogenase and SEQ ID NO: 21 formate dehydrogenase mutant [Table 11] Target gene NCBI information Derived microorganism fdh Formate dehydrogenase EC:1.17.1.9[SEQ ID NO: 18] Candida boidinii [Table 12] Target gene Primer sequence fdh [SEQ IDNO:18] [SEQ ID NO: 19]:5'- attgtgagcggataacaatttcacacaggaaacagaccatgaagatcgttttagtcttata -3'[SEQ ID NO: 20]: 5'- gtaccgagctcgaattccatttatttcttatcgtgtttac -3' [Table 13] Target gene NCBI information Derived microorganism fdh mut Formate dehydrogenase mutantNCBI_GeneID:831330[SEQ ID NO: 21]L229H mutant Arabidopsis thaliana [Table 14] Target gene Primer sequence fdh mut [SEQ ID NO:21] [SEQ ID NO: 22]: 5'-gtaaacacgataagaaataaaggaggaattcatggcgatgagacaagccgc-3' [SEQ ID NO: 23]: 5'-tcatccgccaaaacagccaagttaccggtactgaggagcaag -3'

[0064] The DH5α-FC5 strain, generated by introducing the p100FA2 plasmid into the DH5α-AKO1 strain, grew from an initial optical density of 0.051 to an optical density of 0.285 after 150 hours of culture when only carbon dioxide and formic acid were added to the M9 minimum medium (Table 15). In contrast, the negative control group (DH5α FC1, FC2, FC3) showed no strain growth. [Table 15] ingredient Salary (g / l) Na2HPO4 6,8 KH2PO4 3 NaCl 0,5 NH4Cl 2 MgSO4 0,8 NaHCO3 4,2 IPTG 0,24 EDTA 0,05 Thiamine 0,002 Solution of trace elements 5ml Sodium formate 4,43 [Table 16] Name of the tribe Type of gene DH5α AKO The ppsR gene was switched off and the native promoter of the ppsA gene was replaced by the trc promoter in the DH5α_GTPS strain. DH5α_AKO1 The purT gene was deactivated from the AKO strain. DH5α_FC1 DH5α_GTPS, which houses p100FA1 DH5α FC2 AKO, which houses the p100FA1 DH5α FC3 AKO1, which houses the p100FA1 DH5α FC5 AKO1, which houses the p100FA2

[0065] Additionally, the number of colony-forming units (CFU) was determined to measure the increase in cell count through cell division. The result showed that the initial CFU was 4.8 × 10⁻⁶. 7 CFU / ml (OD 600 (of 0.051) was that the CFU after 50 hours was 14.1 × 10 7 CFU / ml (OD 600 from 0.2) and that the CFU then gradually increased to 5.2 × 10 after 150 hours 7 CFU / ml (OD 600 from 0.285) decreased ( Fig. 3 and Fig. 4). Example 3: Improving the growth rate by optimizing the culture environment and gene expression levels

[0066] The culture conditions of the DH5α FC5 strain produced in Example 2 were optimized, and a plasmid with a reduced number of copies compared to the plasmid described above was generated to construct a DH5α FC8 strain that grows rapidly upon the addition of only carbon dioxide and formic acid. Furthermore, the DH5α FC8 strain was observed to grow at optical densities ranging from 0.018 to 3.59 using only carbon dioxide and formic acid when the conventional culture temperature was reduced from 37°C to 32°C to increase the Cyo expression level and decrease the Cyd expression level. Example 3-1: Optimizing the culture conditions for recombinant strains that can grow using only carbon dioxide and formic acid

[0067] The culture conditions for the DH5α FC5 strain produced in Example 2 were optimized. To reduce the concentration of IPTG, an inducer to promote gene expression, from a conventional concentration of 1 mM to 0.05 mM, the conventional culture conditions (30 ml of culture solution added to a 100 ml baffle flask) were changed to new conditions (50 ml of culture solution added to a 300 ml baffle flask) to improve aeration. The culture results showed that the final cell density increased to 2.16 times that of the conventional culture conditions. Fig. 5). Example 3-2: Growth improvement of recombinant strains that can grow using only carbon dioxide and formic acid by optimizing gene expression

[0068] The gene expression level was optimized to achieve a sufficiently high cell concentration, as excessive expression beyond the required level negatively impacts cell growth due to the limited nutrient supply during growth using only carbon dioxide and formic acid. The p15A origin of replication, with 10 to 12 plasmid copies, and the pSC101 origin of replication, with 1 to 5 plasmid copies, were each introduced into the p100FA1 plasmid to construct the following plasmids ( Fig. 6). [Table 17] Plasmid Features p184FA Contains p15A origin of replication, chloramphenicol resistance gene, BBa_23100 synthetic promoter, SEQ ID NO: 01 formate tetrahydrofolate ligase, SEQ ID NO: 02 methenyl tetrahydrofolate cyclohydrolase, SEQ ID NO: 03 methylene tetrahydrofolate dehydrogenase, SEQ ID NO: 18 formate dehydrogenase and SEQ ID NO: 21 formate dehydrogenase mutant p518FA Contains pSC101 origin of replication, chloramphenicol resistance gene, BBa_23100 synthetic promoter, SEQ ID NO: 01 formate tetrahydrofolate ligase, SEQ ID NO: 02 methenyl tetrahydrofolate cyclohydrolase, SEQ ID NO: 03 methylene tetrahydrofolate dehydrogenase, SEQ ID NO: 18 formate dehydrogenase and SEQ ID NO: 21 formate dehydrogenase mutant

[0069] PCR was performed using the pACYC184 plasmid, which contains a chloramphenicol resistance gene, a p15A origin of replication and a synthetic promoter BBa_23100, and the pJH518 plasmid, which contains a chloramphenicol resistance gene, a pSC101 origin of replication and a synthetic promoter BBa_23100, as well as the primers from SEQ ID NO: 24 to SEQ ID NO: 27, and the amplified gene fragments were collected and purified to produce gene fragments to be used as plasmid backbone for the production of recombinant plasmids.

[0070] Plasmid p184FA was introduced into the DH5α AKO1 strain to generate a DH5α FC7 strain, and plasmid p518FA was introduced into the DH5α FC7 strain to generate a DH5α FC8 strain. When the two strains were cultured under the optimal culture conditions developed in Example 3-1, the DH5α FC8 strain grew from an initial optical density of 0.06 to 0.607 for 200 hours, which was 1.14 times that of the DH5α FC5 strain, and the DH5α FC8 strain exhibited the highest growth rate ( Fig. 7). [Table 18] Name of the tribe Type of gene DH5α FC7 AKO1, which houses p184FA DH5α FC8 AKO1, which houses the p518FA Example 3-3: Improvement of the growth of recombinant strains that can grow using only carbon dioxide and formic acid by optimizing the expression levels of the enzyme cytochrome b3 ubiquinol oxidase (Cyo) and the enzyme cytochrome bd-I ubiquinol oxidase (Cyd)

[0071] The enzymes cytochrome b3 ubiquinol oxidase (Cyo) (NCBI GeneID: 945080, 945615, 946897, 944918) and cytochrome bd I ubiquinol oxidase (Cyd) (NCBI GeneID: 945341, 945347) are located in the inner membrane of E. coli and convert reducing power into ATP, which is cellular energy. An article (Gadgil, M., Kapur, V. & Hu, WS Biotechnol. Prog. 21, 689-699, 2005) reported that the expression level of Cyo increased and the expression level of Cyd decreased when E. coli was cultured at a temperature below 37°C. Of the two enzymes, Cyo converts the reducing power into ATP more efficiently than Cyd. For this reason, the FC8 strain was cultured at 30, 32, and 33°C to increase the expression level of Cyo and decrease the expression level of Cyd. As a result of the culture at 32°C, E. coli grew from an initial optical density of 0.018 to 3.59 for 791.5 hours ( Fig.8), the expression level of Cyo increased and the expression level of Cyd decreased ( Fig. 9) The change in expression level was determined by comparing the amount of mRNA used for Cyo expression with the amount of mRNA used for Cyd expression by relative RNA quantification using real-time quantification PCR. The primers used in the relative mRNA quantification are listed in Table 19 below. [Table 19] Target gene Primer sequence rrsA [SEQ ID NO: 28]: 5'- tgcataaaccgacactggcg -3'[SEQ ID NO: 29]: 5'- ttaacctgcttgccgtgctc -3' cyoA [SEQ ID NO: 30]: 5'- tggctgcgttcgaaaaactg -3'[SEQ ID NO: 31]: 5'- acatcggcaaacaagtctgg -3' cyoB [SEQ ID NO: 32]: 5'- ttgcgcacttccataacgtg -3'[SEQ ID NO: 33]: 5'- tgaaaccgaacgctttaggc -3' cydA [SEQ ID NO: 34]: 5'- ttacgcactgggcatcattg -3'[SEQ ID NO: 35]: 5'- atgcgttcttcatgctgcac -3' cydB [SEQ ID NO: 36]: 5'- aactccattgcaccacactg -3'[SEQ ID NO: 37]: 5'- aagaacaaagacgccagcac -3' Example 4: Development of an optimized fermentation process for recombinant strains that can grow using only carbon dioxide and formic acid

[0072] The growth of the recombinant strains was improved by developing a fermentation process optimized for recombinant strains that can grow using only carbon dioxide and formic acid. To maintain the formic acid concentration and pH of the culture medium at a predetermined level, a 30% formic acid solution was automatically added, using pH-Stat mode to maintain the formic acid concentration (2–3 g / L) and pH (6.8) in the medium at optimal levels during culture. To improve aeration, the stirring speed was also increased by 50 rpm from the initial 500 rpm to the final 750 rpm as the optical density increased by 1. With the optimized fermentation process, the DH5α FC8 strain grew from an initial optical density of 1.02 to an optical density of 7.38 after 450 hours. Fig. 10). In addition, another fermentation process was carried out. In the optimized fermentation process, the DH5α FC8 strain grew from an initial optical density of 0.91 to 11.1 after 577 hours ( Fig. 11). Example 5: Development of a recombinant strain with a higher growth rate by applying an optimized fermentation process to a recombinant strain that can grow using only carbon dioxide and formic acid.

[0073] In the optimized fermentation process developed in Example 4, the DH5α FC8 strain grew from an initial optical density of 1.02 to 7.38 after 450 hours and from an initial optical density of 0.91 to 11.1 after 577 hours ( Fig. 10 and Fig.11) The promoter of the pntAB gene was replaced by the strong trc promoter on the DH5α FC8 genome to produce a recombinant E. coli strain (DH5α FC9). In the optimized fermentation process developed in Example 4, the DH5α FC9 strain grew from an initial optical density of 1.01 to 10.2 after 206 hours. This shows that the DH5α FC9 strain grew at approximately twice the rate of the DH5α FC8 strain, which grew from an initial optical density of 0.91 to about 5, in the same time period (206 hours). Fig. 12). Example 6: Introduction of the formic acid assimilation pathway in microorganisms of the genus Mannheimia and verification of formic acid assimilation capacity

[0074] It has been found that formic acid assimilation occurs even in host microorganisms with a central carbon pathway, as well as in E. coli, via the formic acid assimilation pathway developed in the present invention. In this example, the formic acid assimilation pathway was introduced into the microorganism of the genus Mannheimia, and whether or not formic acid assimilation took place was determined by carbon isotope analysis.

[0075] First, a plasmid containing the genes ftl, fch, and mtd, which are involved in the formic acid assimilation pathway, was introduced into a microorganism of the genus Mannheimia to generate a recombinant microorganism with the formic acid assimilation pathway. Specifically, the foreign gene fragments required for plasmid production were generated by PCR using the p100THF plasmid prepared in Example 1 with the corresponding gene as a template and primers designed for gene amplification, followed by collection and purification of the amplified gene fragments. The primer sequences are listed in Table 21 below.

[0076] To construct the formic acid assimilation pathway, a plasmid was produced that contains genes encoding the enzymes mentioned above. [Table 22] Plasmid Features pMS3-THF Contains pMB 1 origin of replication, Mannheimia origin of replication, ampicillin resistance gene, frdA promoter, SEQID NO:01 formate tetrahydrofolate ligase, SEQ ID NO:02 methenyl tetrahydrofolate cyclohydrolase and SEQ ID NO:03 methylene tetrahydrofolate dehydrogenase

[0077] The plasmids were produced from the gene fragments of the plasmid backbone and the amplified gene fragments using the Gibson assembly method (Gibson et al., Nat. Methods, 6:5, 343-345, 2009), which is commonly used for the assembly of gene fragments, and each plasmid was produced to contain one or more of the foreign genes listed in the table above.

[0078] The recombinant plasmid produced by the method described above was transformed into Mannheimia to produce recombinant Mannheimia. The Mannheimia used in the present invention was Mannheimia succiniciproducens LPK7, and the transformation into Mannheimia was carried out by electroporation, a method commonly used in the art.

[0079] For the analysis of formic acid assimilation capacity, the recombinant Mannheimia strain (LPK7_FTF), introduced via the formic acid assimilation pathway, and the negative control strain (LPK7), introduced via the empty vector, were cultured in brain-heart infusion medium (BHI) containing 2 g / l glycine and 4.43 g / l acetylcysteine. 13 The sample was supplemented with C-labeled formate, and then the ratio of carbon isotopes contained in the serine within the biomass was measured. If formic acid assimilation occurs via the formic acid assimilation pathway, the carbon derived from the formic acid is located at carbon 1 of the serine via the [missing information]. Fig. 1. Formic acid assimilation pathway. The measurement result showed that 13Carbon-14 from formic acid was detected in approximately 19.5% of the total serine contained in the biomass of the LPK7_FTF strain introduced via the formic acid assimilation pathway, while 13 C-carbon was not detected at all in the serine of the negative control strain ( Fig. 13). Industrial applicability

[0080] The present invention provides a recombinant microorganism that synthesizes pyruvic acid, an organic C3 compound, at a significantly improved rate compared to the prior art, using carbon dioxide, which is abundant in nature, and formic acid, which has low toxicity. It is suitable for an assimilation reaction with respect to its reaction kinetics and can be easily and rapidly synthesized from carbon dioxide. In particular, it can also grow at a significantly improved rate in a medium containing only carbon dioxide and formic acid as carbon sources, without glucose. Therefore, the recombinant microorganism according to the present invention has the advantage of synthesizing pyruvic acid and various value-enhancing compounds using it as an intermediate in an economically efficient manner.

[0081] Although specific configurations of the present invention have been described in detail, the person skilled in the art will understand that this detailed description is provided as preferred embodiments for illustrative purposes and should not be interpreted as limiting the scope of the present invention. Therefore, the essential scope of the present invention is defined by the accompanying claims and their equivalents. The following is a sequence protocol as an electronic document. This can be accessed in both DEPATISnet and the DPMA register.

Claims

[1] Recombinant microorganism in which a gene encoding a transcription repressor of the glycine cleavage system, pyruvate formate lyase or phosphoglycerate dehydrogenase, has been attenuated or deleted from a host microorganism with a formic acid assimilation pathway, a ppsR gene encoding a phosphoenolpyruvate synthase regulatory protein, or a purT gene encoding a phosphoribosylglycinamide formyltransferase, is attenuated or deleted, a gcvTHP gene, consisting of the gcvT gene, the gcvH gene and the gcvP gene, which encodes an enzyme involved in a glycine cleavage system reaction in which host microorganism with the formic acid assimilation pathway is highly expressed, and a gene encoding formate tetrahydrofolate ligase, methenyl tetrahydrofolate cyclohydrolase or methylene tetrahydrofolate dehydrogenase is introduced into the host microorganism via the formic acid assimilation pathway. [2] Recombinant microorganism according to claim 1, wherein the host microorganism is selected from the group consisting of the genera Escherichia, Mannheimia, Rhodobacter and Methylobacterium. [3] Recombinant microorganism according to claim 1, wherein the expression of the gene encoding the enzyme involved in the glycine cleavage system reaction is enhanced by replacing a native promoter with a strong promoter. [4] Recombinant microorganism according to claim 3, wherein the strong promoter is selected from the group consisting of a trc promoter, a tac promoter, a T7 promoter, a lac promoter and a trp promoter. [5] Recombinant microorganism according to claim 1, wherein the gene encoding formate tetrahydrofolate ligase is represented by a nucleotide sequence of SEQ ID NO: 1, the gene encoding methenyl tetrahydrofolate cyclohydrolase is represented by a nucleotide sequence of SEQ ID NO: 2 and the gene encoding methylene tetrahydrofolate dehydrogenase is represented by a nucleotide sequence of SEQ ID NO:

3. [6] Recombinant microorganism according to claim 1, wherein the expression of a gene encoding phosphoenolpyruvate synthase (ppsA) or H + -translocating NAD(P) transhydrogenase (pntAB) is encoded, which is further enhanced in the recombinant microorganism, and a gene encoding formate dehydrogenase and / or a mutant thereof is additionally introduced into the recombinant microorganism. [7] Recombinant microorganism according to claim 6, wherein the expression of the gene encoding phosphoenolpyruvate synthase (ppsA) or the H + -translocating NAD(P) transhydrogenase (pntAB) is encoded, and its activity is enhanced by replacing a native promoter with a strong promoter. [8] Recombinant microorganism according to claim 7, wherein the strong promoter is selected from the group consisting of a trc promoter, a tac promoter, a T7 promoter, a lac promoter and a trp promoter. [9] Recombinant microorganism according to claim 6, wherein genes encoding one or more selected from the group consisting of formate tetrahydrofolate ligase, methenyl tetrahydrofolate cyclohydrolase, methylene tetrahydrofolate dehydrogenase, formate dehydrogenase and formate dehydrogenase mutant are introduced by cloning them into a vector containing an origin of replication with 1 to 12 copies. [10] Recombinant microorganism according to claim 9, wherein the vector contains an origin of replication with 1 to 5 copies. [11] Recombinant microorganism according to claim 9, wherein the gene encoding formate dehydrogenase is represented by a nucleotide sequence of SEQ ID NO: 18 and the gene encoding formate dehydrogenase mutant is represented by a nucleotide sequence of SEQ ID NO:

21. [12] Recombinant microorganism according to claim 1, wherein the recombinant microorganism is able to produce a C3 compound using only formic acid and carbon dioxide as carbon sources. [13] Recombinant microorganism according to claim 12, wherein the C3 compound is pyruvic acid. [14] Method for producing a C3 compound, comprising: (a) a step of cultivating the recombinant microorganism according to any one of claims 1 to 13 using formic acid and carbon dioxide as carbon sources for the production of a C3 compound; and (b) a step of collecting the produced C3 compound. [15] Method according to claim 14, wherein 0.02 to 0.08 mM IPTG is added in the step of cultivating the recombinant microorganism. [16] Method according to claim 14, wherein the recombinant microorganism is cultivated at 31 to 33°C. [17] Method according to claim 14, wherein in the cultivation step the formic acid is maintained at a concentration of 2 to 3 g / l and the pH is maintained at 6.6 to 7.

0. [18] Method according to claim 14, wherein the recombinant microorganism is first cultured at a stirring speed of 450 to 550 rpm and is subsequently cultured while the stirring speed is increased to a final speed of 700 to 800 rpm.

Images