Humanized monoclonal anti-human PD-L1 antibody and use thereof

DE602016093332T2Active Publication Date: 2025-08-20REYOUNG SUZHOU BIOLOGY SCI & TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
DE602016093332
Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
Priority Date
2016-05-20
Filing Date
2016-06-03
Publication Date
2025-08-20
Estimated Expiration
2036-06-03

AI Technical Summary

Technical Problem

Current anti-PD-L1 antibodies face challenges in achieving high specificity, affinity, and stability, limiting their effectiveness in blocking the PD-L1/PD-1 signal pathway for treating tumors and viral infections.

Method used

Development of an anti-human PD-L1 humanized monoclonal antibody with specific sequences for the heavy and light chains (SEQ ID NO: 10 and 26) that enhances T-cell activation and inhibits tumor growth by specifically binding to PD-L1, using a combination of CDR-grafting and phage display to achieve high affinity and stability.

Benefits of technology

The antibody demonstrates enhanced specificity and stability, effectively inhibiting PD-L1/PD-1 interaction, leading to increased T-cell activation and significant tumor growth inhibition.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application claims priority for the Chinese patent application "Anti-Human PD-L1 Humanized Monoclonal Antibody and Its Applications", with filling date Friday, May 20, 2016 and application number 201610340678.3. All the contents of present invention are combined in this application by reference.Field of the invention

[0002] The present invention relates to the biomedicine field, in particular to an anti-human PD-L1 humanized monoclonal antibody and its applications.Background of the invention

[0003] The adaptive response of human immune system mainly includes the activation, differentiation and proliferation of T-cells and B-cells. Among them, the activation of T-cell function is regulated by two types of signals. One is the antigen-specific signal provided by T-cell receptor (TCR) recognizing the MHC-antigen complex on antigen-presenting cells (APC). The other is the co-stimulation and inhibition signal formed between T-cells and immuno-checkpoint proteins expressed on APC cells. This kind of co-stimulatory or inhibitory signal often plays an important role in the proliferation, differentiation and activation of T-cells. Normally, the immuno-checkpoint is critical in maintaining body's self-tolerance (preventing autoimmunity) and protecting the body from being infected by external pathogens.

[0004] PD-L1 / PD1 signal pathway is a very important co-inhibitory signal pathway in immune response. Programmed death receptor-1 (PD-1, also known as CD279) has two glycoprotein ligands on cell surface: PD-L1 (also known as B7-H1, CD274) and PD-L2 (also known as B7-DC, CD273).

[0005] The human PD-L1 gene encodes 290 amino acids (including 1-18 amino acids as signal peptides, 19-238 amino acids as extracellular segments, 239-259 amino acids as transmembrane segments, and 260-290 amino acids as intracellular segments). It is a type I membrane protein that is generally expressed in T-cells, B-cells, dendritic cells, macrophages and many non-hematopoietic cells. Studies have shown that when PD-L1 binds to PD-1, protein tyrosine phosphatases SHP-1 and SHP-2 with SH2 domain will be supplemented. These two phosphatases can reduce the phosphorylation of the immunoreceptor tyrosine activating motif (ITAM) of the CD3_chain, weaken the activation of ZAP-70, and inhibit the downstream signal transduction of TCR, thus co-inhibiting the activation of T cells. This negative regulatory effect can prevent the over-activation of effector T-cells leading to autoimmune damage.

[0006] However, if PD-L1 is expressed in tumor tissues, the killing effect of the immune system on tumor tissues can be weakened by binding to PD-1 of immune cells. PD-L1 has been found to be highly expressed in many tumor tissues (gastric cancer, breast cancer, pancreatic cancer, ovarian cancer, lung cancer, prostate cancer, malignant melanoma, etc.) and in bone marrow cells in tumour-infiltrating microenvironment. The expression of PD-L1 is also closely related to the poor prognosis of melanoma, breast cancer and ovarian cancer. If the link reaction between PD-L1 and PD-1 is blocked, the effector function of T-cells can be restored. Tumors, such as melanoma, can express PD-L1 at the beginning of their formation, thus possessing innate immune escape ability. The expression level of PD-L1 is often closely related to the prognosis of the disease.

[0007] Therefore, the expression of PD-L1 has become a vital biomarker in the use of immunotherapy targeting the PD-1 / PD-L1 signal pathway, helping researchers to speculate which patients are more likely to respond to such immunotherapy.

[0008] At present, the antibody drugs targeted at PD-L1 have shown excellent application prospects clinically. For example, Roche's all-human IgG1 monoclonal antibody MPDL3280A can block the binding of PD-L1 to PD-1 and CD80, and weaken the antibody-mediated cytotoxicity by engineering transformation on its Fc fragments. In Phase I clinical trials, patients with metastatic bladder cancer with positive PD-L1 expression develop a response rate of 52% after 12 weeks of MPDL 3280A treatment. Adverse reactions just include low-grade fatigue and nausea, and there is no evidence of nephrotoxicity. Continuous response to drugs is also observed in melanoma patients, so MPDL3280A is granted with the breakthrough treatment status by FDA. Its clinical research is also being carried out in patients with advanced renal cell carcinoma and non-small cell lung cancer. Another PD-L1 monoclonal antibody, Avelumab, co-developed by Pfizer and Merck, is also being evaluated for efficacy and safety in patients with metastatic Merkel cell carcinoma.

[0009] Not only that, studies have shown that some viral infections are also closely related to PD-L1 / PD-1 signal pathway. For example, in chronic HIV infection, PD-1 is found to be highly expressed on the surface of HIV-specific CD8+T cells. The virus inhibits the activity of HIV-specific CD8+T cells by activating the PD-L1 / PD-1 signal pathway. The secretion of cytokines and the proliferation of T cells are greatly weakened, resulting in acquired immunodeficiency. Therefore, blocking the PD-L1 / PD-1 signal pathway, in the treatment of such diseases, also has considerable application value.

[0010] Consequently, the development of drugs with the ability to block the PD-L1 / PD-1 signal pathway will bring new methods for the treatment of tumor, viral infection and a variety of immune system-related diseases, with great application potential and market value.

[0011] Yan, L. et al.(2016) A fully human monoclonal antibody targeting PD-L1 with potent anti-tumor activity. International Immunopharmacology,vol.31, 248-256 disclosed a fully human anti-PD-L1 monoclonal antibody (mAb) B60-55 which was identified by yeast surface display, mAb B60--55 is an antagonistic antibody, which can block PD-L1 binding to its receptors, including PD-1 (PDCD1) and B7.1 (CD80). The affinity, specificity, activity, and efficacy of mAb B60-55 were investigated in vitro or in vivo: in vitro assays demonstrated the ability of mAb 860-55 to enhance T cell responses and cytokine production in the mixed lymphocyte reaction; in vivo studies showed that administration of mAb B60-55 exhibited a potent antitumor activity toward tumor cell carcinoma xenograft.

[0012] Stewart, R. et al. (2015) Identification and Characterization of MEDI4736, an Antagonistic Anti-PD-L1 Monoclonal Antibody. Cancer Immunology Research, vol. 3, no. 9, 1051-1062, disclosed MEDI4736, a human IgG1 monoclonal antibody that binds with high affinity and specificity to PD-L1 and is uniquely engineered to prevent antibody-dependent cell-mediated cytotoxicity. MEDI4736 is a potent antagonist of PD-L1 function, blocking interaction with PD-1 and CD80 to overcome inhibition of primary human T-cell activation, thus MEDI4736 can significantly inhibits the growth of human tumors.

[0013] WO 2016061142A1 disclosed antibody molecules (e.g., humanized antibody molecules) that bind to Programmed Death-L1 gand 1 (PD-Ll) with high affinity and specificity. Example 3 of WO 2016061142A1 disclosed the characterization of murine and humanized anti-PD1-L1 antibodies which were found to have a pronounced effect on the levels of IFNy detectable in the supernatants collected from the cell cultures, i.e. 'antibody treatment led to a dose-dependent increase in IFNy release by an average factor of ~4-7 times the levels observed with an isotype control antibody at doses ranging between 0.04µg / ml and 20µg / ml. Moreover, 'exemplary anti-PO-L 1 antibodies enhanced SE8-induced IL-2 secretion by T cells as compared to an isotype control Ab in all donors, with an average fold stimulation of 4.4±2.0 (n=5)'.

[0014] WO 2016022630A1 provided antibodies and antigen-binding fragments thereof that bind to programmed death- 1 ligand 1 (PD-Ll). Example 3 of WO 2016022630A1 demonstrated that anti-PD-Ll antibodies (hybridoma, chimeric, and humanized) can block PD-1 's binding with PD-Ll on the cell surface, as measured by ELISA; example 4 of WO 2016022630A1 demonstrated that anti-PD-L1 antibodies (hybridoma, chimeric, and humanized) bind PD-L1, as measuerd by FACS analysis; example 6 of WO 2016022630A1 suggesting that anti-PD-Ll antibodies can modulate the immune suppression function of T regulatory cells; example 7 of WO 2016022630A1 suggested that PD-L1 blockage by humanized anti-PD-Ll antibodies enhanced IFN- γ secretion by T cells; example 8 of WO 2016022630A1demonstrate that, compared to TT antigen alone, PD-L1 blockage with anti-PD-Ll antibody resulted in enhanced IFN-y secretion by memory T cells.

[0015] Deng R. et al.(2016) Preclinical pharmacokinetics, pharmacodynamics, tissue distribution, and tumor penetration of anti-PD-L1 monoclonal antibody, an immune checkpoint inhibitor. MABS, vol. 8, no. 3, 593-603 provided a human monoclonal antibody MPDL3280A that targets programmed cell death-1 ligand 1 (PD-L1), and exerts anti-tumor activity mainly by blocking PD-L1 interaction with programmed cell death-1 (PD-1) and B7.1. The purpose of the study was to characterize the pharmacokinetics, pharmacodynamics, tissue distribution and tumor penetration of MPDL3280A to help further clinical development.Summary of the invention

[0016] To solve these technical problems, the present invention aims to provide an anti-human PD-L1 humanized monoclonal antibody with good specificity, high affinity and stability.

[0017] The invention is defined by the apended claims.

[0018] The invention relates to an anti-human PD-L1 humanized monoclonal antibody or an antigen binding part thereof, which sequence of heavy chain is as shown in SEQ ID NO: 10, and sequence of light chain is as shown in SEQ ID NO: 26.

[0019] A nucleic acid molecule according to the invention contains a nucleic acid sequence that is capable of encoding anti-human PD-L1 humanized monoclonal antibody or an antigen binding part as described.

[0020] The invention relates to host cells, which contain any nucleic acid molecule as defined by the appended claims.

[0021] invention relates to conjugates, as defined by the claims which contain the anti-human PD-L1 humanized monoclonal antibody or its antigen binding part as defined by the claims and other bioactive substances. The anti-human PD-L1 humanized monoclonal antibody or its antigen binding part is directly or through junction fragments, coupled with other bioactive substances.

[0022] The other bioactive substances can be selected from chemicals, toxins, peptides, enzymes, isotopes, or cytokines that can directly or indirectly inhibit cell growth or kill cells, or inhibit or kill cells by activating the immune response of organism for the treatment of tumors, or selected from other single or mixed substances with biological activity.

[0023] The following is a further description of the invention, where unless otherwise specified, the scientific and technical terms used herein have meanings commonly understood by those skilled in the art. In addition, the terms used in this document, including those related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology and laboratory procedures, refer to terms or procedures widely used in their fields. The following terms are defined and explained here to ensure a better understanding of the present invention.

[0024] In the present description, the term "antibody" refers to an immunoglobulin molecule normally consisted of two pairs of identical polypeptide chains, each with a "light" (L) chain and a "heavy" (H) chain. The light chains of antibody can be classified as κ and λ light chains. The heavy chains can be classified as µ, δ, γ, α and ε, with antibody isotypes defined as IgM, IgD, IgG, IgA and IgE, respectively. In light and heavy chains, the variable region and the constant region are linked with each other through the "J" region of about 12 or more amino acids, and the heavy chain also contains the "D" region of about three or more amino acids. Each heavy chain is consisted of a heavy chain variable region (V H ) and a heavy chain constant region (C H ). The heavy chain constant region is consisted of 3 domains (C H 1, C H 2 and C H 3). Each light chain is consisted of a light chain variable region (V L ) and a light chain constant region (C L ). The light chain constant region is consisted of a domain C L . The constant region of antibody can mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g. effector cells) and the first component of classical complement system (C1q). The V H and V L regions can also be subdivided into highly variable regions (called as complementary determinant regions (CDR)), amongst of which conservative regions known as framework regions (FR) are distributed. Each V H or V L region is consisted of three CDRs and four FRs arranged from the amino terminal to the carboxyl terminal in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions (V H and V L ) of each heavy / light chain pair form antibody binding sites separately. The distribution of amino acids to regions or domains follows the definitions in Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md.(1987and 1991)), or in Chothia&Lesk(1987) J.Mol.Biol.196:901-917; Chothia et al. (1989) Nature 342: 878-883. The term "antibody" is not limited by any specific antibody production method. For example, it particularly includes recombinant antibodies, monoclonal antibodies and polyclonal antibodies. Antibodies can be of different types, such as IgG (e.g. IgG1, IgG2, IgG3 or IgG4 subtypes), IgA1, IgA2, IgD, IgE, or IgM antibody.

[0025] In the present description, the term "antigen-binding part" of an antibody refers to one or more parts of a full-length antibody that retain the ability of binding the same antigen (e.g. PD-L1) of the antibody, so as to compete with the intact antibody for antigen specific binding. Usually, see Fundamental Immunology, Ch.7 (Paul, W., ed., 2nd Edition, Raven Press, N.Y. (1989)), which is incorporated in this article by citation for all purposes. The antigen binding part can be produced by recombinant DNA technology or by enzymatic or chemical cleavage of intact antibody. In some cases, the antigen binding part includes Fab, Fab', F (ab') 2, Fd, Fv, dAb, and complementary determinant region (CDR) fragments, single chain antibodies (e.g. scFv), chimeric antibodies, diabodies and such kind of peptides, which contain at least a part of the antibody sufficient to give the peptides a capacity for antigen specific binding.

[0026] The invention obtains an anti-human PD-L1 humanized monoclonal as defined by the claims with good specificity, high affinity and stability by screening, and the antibody can specifically bind to human PD-L1 instead of binding to other members of B728 family, and it can bind to active T-cells to strengthen the activation of T-cells, so it can significantly inhibit the growth of tumor.

[0027] The above description only provides an overview of the technical scheme of the present findings. The technical disclosure set out below may in some respects go beyond the scope of the invention, which is defined by the appended claims.

[0028] Elements and aspects of the disclosure which do not fall within the scope of the claims are provided for information only, namely to place the actual invention claimed in a broader technical context.Brief description of the figures

[0029] Fig. 1 shows the result of ELISA binding activity of mouse PD-L1 antibody; Fig. 2 shows the result of ELISA inhibitory activity of mouse PD-L1 antibody; Fig. 3 shows the result of cell binding activity of mouse PD-L1 antibody; Fig. 4 shows the result of cell inhibitory activity of mouse PD-L1 antibody; Fig. 5 shows the binding kinetics curve of humanized PD-L1 antibody; Fig. 6 shows the result of the binding specificity of humanized PD-L1 antibody to other B7 family members and the binding to PD-L1 protein of different species; Fig. 7 shows the result of the binding specificity of humanized PD-L1 antibody to CHO cells with PD-L1 expressed on the surface; Fig. 8 shows the result of the binding specificity of humanized PD-L1 antibody to recombinant human PD-L1 fusion protein; Fig. 9 shows the result of the blocking effect of humanized PD-L1 antibody on PD-L1 binding to PD-1; Fig. 10 shows the result of the effect of humanized PD-L1 antibody on cytokine IFN-y secretion in mixed lymphocyte reaction; Fig. 11 shows the result of the effect of humanized PD-L1 antibody on cytokine IL-2 secretion in mixed lymphocyte reaction; Fig. 12 shows the stability result of humanized PD-L1 antibody in serum. Examples

[0030] The technical disclosure set out below may in some respects go beyond the scope of the invention, which is defined by the appended claims.

[0031] Elements and aspects of the disclosure which do not fall within the scope of the claims are provided for information only, namely to place the actual invention claimed in a broader technical context.Example 1: screening of mouse antibody1.1 Animal immunity

[0032] The classical immunization schedule is used to immunize BALB / c mice. The immunogen is hPD-L1 (human PD-L1) protein (purchased from Beijing YiqiaoShenzhou Biotechnology Co., Ltd.) so that the mice can produce anti-hPD-L1 antibodies. The specific scheme is shown in Table 1: Table 1 Animal Immunization Scheme for hPD-L1 ProteinStepDaysMethodPreimmune serum collection-4Collect blood at orbital cavity, expect to obtainserum of 15-30µL and store at -20°CPrimary immunization0Amount of immunogen: 50µg; injection method: IP (intraperitoneal injection); adjuvant: FCA (freund's complete adjuvant)First boosted immunization14Amount of immunogen: 50µg; injection method: IP (intraperitoneal injection); adjuvant: FIA (freund'sincomplete adjuvant)Second boosted immunization35Amount of immunogen: 50µg; injection method: IP (intraperitoneal injection); adjuvant: FIA (freund'sincomplete adjuvant)Valence measurement by serum collection42Collect blood at orbital cavity, expect to obtainserum of 15-30µL. Measure the serum titer of mouse by indirect ELISA assay.Final immunization56Amount of immunogen: 50µg; injection method: IV (intravenous injection)Feeding cells preparation58Six mice needed for each time (aged about 10 weeks)1. Remove eyeballs from unimmunized mice to collect blood. Separate the serum to use it as the negative control serum in antibody detection. Kill the mice by cervical dislocation, soak them in 75% ethyl alcohol for 5 min, and then fix them on dissecting table.2. Use sterilizing tweezer to raise abdominal skin from posterior abdomen, so as to expose the peritoneum. Disinfect the peritoneum with alcohol wipes.3. Inject 10mL medium by syringe into the abdominal cavity, without passing through the intestinal canal. Fix the syringe with right hand to keep the needle staying in the abdominal cavity. Hold the alcohol wipe with left hand to flip the abdomen for 1 min, and then suck out the injected culture fluid so as to obtain cells effused from the abdominal cavity and use as the feeder cells.Spleen harvest59Kill the mice to collect spleens. Put the spleens into a 10mL plate with no serummedium. Use a needle to break the spleens and use a plunger to slightly press them, so as to collect immune spleen cells. Filter with a 200-mesh screen, centrifuge at 1200rpm for 5 min, and remove supernatant. Use RBC lysate buffer to re-suspend the spleen cells, centrifuge at 1200rpm for 5 min, then wash with serum-free medium for one time, and re-suspend by 20mL serum-free medium. Count the cells and store them under 4°C. 1.2 Cell Fusion and Screening of Hybridoma Cell

[0033] Before fusion, the state of mouse myeloma SP2 / 0 is adjusted to ensure that its growth density does not exceed 1.0×10 6< cells. The final immunization is carried out 3 days ahead of schedule, for which tail vein injection is used. The feeding cells are prepared 1 day ahead of schedule, with plate layout of 2.0×10 4< cells / well. By PEG fusion, the ratio of spleen cells to SP2 / 0 cells is between 10:1 and 5:1, and the number of spleen cells per well is up to 1.0×10 5< . After 7 days of fusion, harvest the supernatant and replace the medium.

[0034] The harvested supernatant is first screened by direct ELISA binding method. After expansion on obtained positive clones, re-screen the supernatant.

[0035] Two rounds of re-screening are carried out through cell binding and inhibition experiments. The positive clones obtained by screening are subcloned by limited dilution method and arranged on 96-well plates, which are 5 clones / well, 2 clones / well and 1 clone / well. After 7 days of culture, the positive subclones are selected by direct ELISA binding experiment, and then expanded and preserved.

[0036] The specific steps involved in each experiment method are as follows: A. ELISA binding method Envelop hPD-L1-Fc on the plate, add gradient diluted antibody, incubate and wash it, and then add goat anti-mouse-HRP, perform coloration, and draw up the reaction curve by fitting of readings to calculate the EC50 value. B. Cell binding experiment Lay the over-expressed hPD-L1-Fc cells on the cell plate for culture inspection one day ahead of schedule. After closure on the next day, add gradient-diluted antibody, then anti-mouse-EU, and obtain the readings. C. Cell inhibition experiment Lay the over-expressed hPD-L1-Fc cells on the cell plate for culture inspection one day ahead of schedule. After closure on the next day, add gradient-diluted antibody, then PD1-Fc-Biotin, then Europium-labeled streptavidin, and obtain the readings. 1.3 Preparation and activity identification of mouse antibody

[0037] Inoculate the hybridoma cells of selected positive subclones into SFM medium for about 7 days. Collect the supernatant and purify it with Protein G purification column after centrifugal filtration. Then test the purified antibodies for ELISA binding activity, ELISA inhibitory activity, cell binding activity, and cell inhibitory activity. After screening, obtain a mouse anti-PD-L1 monoclonal antibody with the highest activity, and name it as mouse anti-PD-L1.

[0038] The specific steps involved in each experiment method are as follows: A. ELISA binding activity Envelop hPD-L1-Fc on the plate, add gradient diluted antibody, incubate and wash it, and then add goat anti-mouse-HRP, perform coloration, and draw up the reaction curve by fitting of readings (the results as shown in Fig 1) to calculate the EC50 value. The binding activity EC50 to hPD-1 is 1.67ng / mL. B. ELISA inhibitory activity Incubate the gradient diluted antibody and a certain concentration of hPD-L1-Fc-Biotin, then add the mixture to the plate enveloped with hPD-L1-Fc. Add SA-HRP to the plate after incubating and washing. Then perform coloration. Draw up the reaction curve by fitting of readings (see Fig. 2 for results) to calculate the IC50 value. The inhibitory activity IC50 is 0.86nM. C. Cell binding activity Lay hPD-L1-Fc over-expressed cells on the cell plate for culture inspection one day ahead of schedule. After closure on the next day, add gradient-diluted antibody, then anti-mouse-EU. And then obtain the readings. Draw up the reaction curve by fitting of readings (see Fig. 3 for results) to calculate the cell binding activity EC50 which is 30.29ng / mL. D. Cell inhibitory activity Lay PD1-27 (PD1 over-expressed CHO-K1 stable transfected cells) on the cell plate for culture inspection one day ahead of schedule. After closure on the next day, add gradient-diluted antibody, then PD1-Fc-Biotin, then Europium-labeled streptavidin, and obtain the readings. Draw up the reaction curve by fitting of readings (see Fig. 4 for results) to calculate the cell inhibitory activity IC50 which is 637.8ng / mL. Example2: humanization and affinity maturation of mouse antibody2.1 Acquisition of mouse antibody genes

[0039] Use Purelink RNA Micro kit to extract mouse anti-PD-L1 hybridoma total RNA, then use Prime Script ™< II 1st Strand cDNA Synthesis Kit to make the reverse transcription of total RNA and prepare cDNA. Use Leader primer to expand the variable regions of heavy and light chains separately. The reaction system and PCR conditions are shown in Tables 2 and 3, respectively. Table 2: PCR reaction system of mouse antibody gene cDNAReagent nameVolume added10×Buffer5µL10µM dNTP Mix1µL50mM MgSO42µLUpstream and downstream primers1µL for eachcDNA template1µLTaq0.2µLddH2Oup to 50µL Table 3: PCR reaction conditions of mouse antibody gene cDNA TemperatureTime94°C5 min94°C30 sTotally 30 cycles50°C30 s68°C45 s68°C7 minCool to 4°C

[0040] The PCR results are analyzed by electrophoresis.

[0041] Add 0.5µl LA Taq enzyme into the reaction tube containing expansion products and react 10 min at 72°C. After that, perform enzyme linking and the reaction system is as shown in Table 4. Table 4 Enzyme linked reaction systemReagent nameVolume addedPMD18-T1µLReaction product4µLSolution I5µLReaction at 16°C for 1h

[0042] After the enzyme linking, transform, select clones and conserve the breed, then obtain the anti-human PD-L1 antibody. After sequencing, the nucleic acid sequence and amino acid sequence of heavy chain variable region are obtained and shown as SEQ ID NO: 1 and 2, respectively. The nucleic acid sequence and amino acid sequence of light chain variable region are obtained and shown as SEQ ID NO: 3 and 4, respectively.2.2 Humanization design

[0043] The screened mouse antibody sequences are analyzed and compared with the human germline genes. The results show that KV1-9*01 is a light chain humanized frame sequence and HV1-46*03 is a heavy chain humanized frame sequence. By CDR-grafting, the CDRs of heavy and light chains are juxtaposed into the framework sequence to construct humanized antibodies and synthesize fragments of humanized antibody variable regions. The nucleic acid sequence and amino acid sequence of heavy chain variable region are obtained and shown as SEQ ID NO: 5 and 6, respectively. The nucleic acid sequence and amino acid sequence of light chain variable region are obtained and shown as SEQ ID NO:7 and 8, respectively.2.3 Construction of antibody library

[0044] The DNA sequence of mouse antibody CDR is analyzed to identify the mutation site in variable region CDR. The primer sequence is designed, and the location of the mutation site is designed as NNS to encode any amino acid. By using humanized antibody scFv as template, the scFv antibody library is expanded by PCR. The scFv antibody library is constructed into phage plasmid through sfiI digestion site, so as to build the secondary antibody library.2.4 Screening of antibody library

[0045] Afterwards, the high affinity antibodies are screened by phage display, where the specific method is as follows: A. Transform the phage plasmids of antibody library containing scFv into escherichia coli TG1 by electroporation. After recovery at 37°C, 220 rpm for 1h, add the helper phage to the remaining bacteria solution, and add ampicillin. Then cultivate at 37°C, 220 rpm for 1h. Centrifuge at 2500rpm×5min to remove the supernatant, and sowing bacteria with 2×YT-AK medium, then cultivate it at 37°C and 220rpm overnight. B. Envelop antigen: dilute hPD-L1-FC with enveloping buffer, mix it and add it into the immune tube and envelop overnight at 4°C. C. Collection of recombinant phage: centrifuge the overnight culture medium at 2500rpm×5min, collect 10 ml supernatant, add 2 ml PEG / NaCl, mix and place it on ice for 30-60 min. Afterwards, centrifuge for 10000g×20min, then remove the supernatant and dissolve the phage library by 2×YT medium. D. Blocking: wash the immune tube with PBS twice, add the blocking buffer and then place at room temperature for 1h. In addition, mix the blocking solution with the same volume of phage library to block 10-15 min at room temperature. E. Incubate phage library: wash the immune tube twice with PBS, add blocked phage library and then incubate it at 37°C for 2-3h. F. Elution: add 100ml TG1 bacteria solution (inoculated the day before) into 10ml 2×YT and culture it to A600 value of 0.4-0.5 at 37°C, 220rpm. Wash the immune tube with PBST for 8 times, then wash with PBS twice, add 5 ml bacteria solution with logarithmic growth phase and then cultivate at 37°C, 220rpm for 1h. G. Output: dilute the bacteria solution to 10 -1< and 10 -2< , and apply 100ul on the plate. H. Next round of screening: add 200µl helper phage into 5ml eluted bacteria solution, then add 5 µl ampicillin into the bacteria solution, and cultivate at 37 °C, 220rpm for 1h. Centrifuge at 2500rpm×5min to remove the supernatant, and sow bacteria with 10ml 2×YT-AK, then cultivate it at 37°C and 220rpm overnight. Repeat steps B-H.

[0046] After 3 rounds of screening, select monoclones and prepare recombinant phages. Phage ELISA method is used to detect the activity of recombinant phages. See below for details: A. Envelop hPD-L1-FC and place at 4°C overnight; B. Wash with PBST for twice, add phage supernatant, and cultivate at 25°C for 1h; C. Wash with PBST for three times, add diluted anti-M13-biotinAb, and place at 25°C for 1h; D. Wash with PBST for three times, add diluted HRP-streptavidin, and place at 25°C for 1h; E. Wash with PBST for three times, add preheated TMB and cultivate at 25°C for 10 min. Add 1M H 2 SO 4 to stop the reaction, and detect the absorbance by OD450. Select positive clones and send them for sequencing. The heavy or light chain variable region is spliced into the corresponding constant region sequence of human antibody by PCR. The full length fragments of expanded antibody heavy and light chains (including signal peptide) are cloned into pcDNA3.1GS.

[0047] Three humanized antibodies, named anti-PD-L1-1, anti-PD-L1-2 and anti-PD-L1-3, are obtained by screening in above experiments. Correspondingly, the heavy-chain and light-chain plasmids of anti-PD-L1-1 are named as P3.1GS-anti-PD-L1-1-HC and P3.1GS-anti-PD-L1-1-LC; the heavy-chain and light-chain plasmids of anti-PD-L1-2 are P3.1GS-anti-PD-L1-2-HC and P3.1GS-anti-PD-L1-2-LC; and the heavy-chain and light-chain plasmids of anti-PD-L1-3 are P3.1GS-anti-PD-L1-3-HC and P3.1GS-anti-PD-L1-3-L. The sequence information is as follows:

[0048] Anti-PD-L1-1 heavy chain nucleotide sequence and amino acid sequence are shown in SEQ ID NO: 9 and 10, respectively. Among them, the nucleotide sequence of heavy chain variable region is:

[0049] The underlined parts represent CDR1, CDR2 and CDR3, with serial numbers SEQ ID NO: 11-13, respectively, and the parts with no underline are FR1, FR2, FR3 and FR4 with serial numbers SEQ ID NO:14-17, respectively.

[0050] Accordingly, the amino acid sequence of heavy chain variable region is:

[0051] The underlined parts represent CDR1, CDR2 and CDR3, with serial numbers SEQ ID NO: 18-20, respectively, and the parts with no underline are FR1, FR2, FR3 and FR4 with serial numbers SEQ ID NO:21-24, respectively.

[0052] Anti-PD-L1-1 light chain nucleotide sequence and amino acid sequence are shown in SEQ ID NO:25 and 26, respectively. Among them, the nucleotide sequence of light chain variable region is:

[0053] The underlined parts represent CDR1, CDR2 and CDR3, with serial numbers SEQ ID NO:27-29, respectively, and the parts with no underline are FR1, FR2, FR3 and FR4 with serial numbers SEQ ID NO:30-33, respectively.

[0054] Accordingly, the amino acid sequence of light chain variable region is:

[0055] The underlined parts represent CDR1, CDR2 and CDR3, with serial numbers SEQ ID NO: 34-36, respectively, and the parts with no underline are FR1, FR2, FR3 and FR4 with serial numbers SEQ ID NO:37-40, respectively.

[0056] 2) Anti-PD-L1-2 heavy chain nucleotide sequence and amino acid sequence are shown in SEQ ID NO:9 and 10, respectively. Among them, the nucleotide sequence of heavy chain variable region is:

[0057] The underlined parts represent CDR1, CDR2 and CDR3, with serial numbers SEQ ID NO:11-13, respectively, and the parts with no underline are FR1, FR2, FR3 and FR4 with serial numbers SEQ ID NO:14-17, respectively.

[0058] Accordingly, the amino acid sequence of heavy chain variable region is:

[0059] The underlined parts represent CDR1, CDR2 and CDR3, with serial numbers SEQ ID NO: 18-20, respectively, and the parts with no underline are FR1, FR2, FR3 and FR4 with serial numbers SEQ ID NO: 21-24, respectively.

[0060] Anti-PD-L1-2 light chain nucleotide sequence and amino acid sequence are shown in SEQ ID NO: 41 and 42, respectively. Among them, the nucleotide sequence of light chain variable region is:

[0061] The underlined parts represent CDR1, CDR2 and CDR3, with serial numbers SEQ ID NO: 44, 28, 29, respectively, and the parts with no underline are FR1, FR2, FR3 and FR4 with serial numbers SEQ ID NO: 30-33, respectively.

[0062] Accordingly, the amino acid sequence of light chain variable region is:

[0063] The underlined parts represent CDR1, CDR2 and CDR3, with serial numbers SEQ ID NO: 46, 35, 36, respectively, and the parts with no underline are FR1, FR2, FR3 and FR4 with serial numbers SEQ ID NO: 37-40, respectively.

[0064] 3) Anti-PD-L1-3 heavy chain nucleotide sequence and amino acid sequence are shown in SEQ ID NO:9 and 10, respectively. Among them, the nucleotide sequence of heavy chain variable region is:

[0065] The underlined parts represent CDR1, CDR2 and CDR3, with serial numbers SEQ ID NO: 11-13, respectively, and the parts with no underline are FR1, FR2, FR3 and FR4 with serial numbers SEQ ID NO: 14-17, respectively.

[0066] Accordingly, the amino acid sequence of heavy chain variable region is:

[0067] The underlined parts represent CDR1, CDR2 and CDR3, with serial numbers SEQ ID NO: 18-20, respectively, and the parts with no underline are FR1, FR2, FR3 and FR4 with serial numbers SEQ ID NO: 21-24, respectively.

[0068] Anti-PD-L1-3 light chain nucleotide sequence and amino acid sequence are shown in SEQ ID NO: 47 and 48, respectively. Among them, the nucleotide sequence of light chain variable region is:

[0069] The underlined parts represent CDR1, CDR2 and CDR3, with serial numbers SEQ ID NO: 50, 28, 29, respectively, and the parts with no underline are FR1, FR2, FR3 and FR4 with serial numbers SEQ ID NO: 30-33, respectively.

[0070] Accordingly, the amino acid sequence of light chain variable region is:

[0071] The underlined parts represent CDR1, CDR2 and CDR3, with serial numbers SEQ ID NO: 52, 35, 36, respectively, and the parts with no underline are FR1, FR2, FR3 and FR4 with serial numbers SEQ ID NO: 37-40, respectively.Example 3: Construction of humanized antibody expression plasmid

[0072] Because all the three antibodies expressed well specificity, only P3.1GS-PD-L1-1-HC and P3.1GS-PD-L1-1-LC were used as templates for further explanation. The heavy and light chain fragments of full-length antibody are expanded by PCR to construct humanized antibody expression plasmid.

[0073] The upstream and downstream primers for light and heavy chains, reaction systems and PCR conditions are shown in Table 5, table 6 and table 7, respectively. Table 5 Upstream and downstream primers of PCR reaction for light and heavy chain of humanized antibodyPrimerSequenceHeavy chain upstreamHeavy chain downstreamLight chain upstreamLightchain downstream5' GGCTCTAGATTAACACTCTCCCCTGTTGAAGC 3' (SEQ ID NO:56) Table 6 PCR reaction system for light and heavy chain of humanized antibody Reagent nameVolume addedHeavy / light chain template1µL5×Buffer10µL2.5µM dNTP Mix4µLUpstream and downstream primers (10µM)1µL for eachTaq0.5µLddH 2 Oup to 50µL Table 7 PCR reaction conditions for light and heavy chain of humanized antibody TemperatureTime94°C5 min94°C30 sTotally 30 cycles50°C30 s72°C1 min 45 s72°C7 minCool to 4°C

[0074] The full-length sequences of light and heavy chains are recovered by PCR product recovery kit. The light chain, heavy chain and plasmid of the antibody fragment are digested by double enzyme digestion. The antibody and plasmid enzyme digestion fragments after electrophoresis are recovered by gel digestion, then linked by enzyme. The humanized antibody expression plasmid after enzyme linking is named as P3.1GS-PD-L1-1. The reaction systems are as shown in Tables 8-10. Table 8 Double enzyme digestion reaction systems for light chain and heavy chain of humanized antibodyReagent nameVolume addedFragment22µLBuffer3µLKpnl1.5µLXba l1.5µLddH 2 OUp to 30µL37°C water bath overnight Table 9 Double enzyme digestion reaction system of expression plasmid Reagent nameVolume addedPlasmid pcDNA3.1GS1µLBuffer2µLKpnl1µLXba l1µLddH 2 OUp to 20µL37°C water bath overnight Table 10 Enzyme linked reaction system of antibody fragments and expression plasmid fragments Reagent nameVolume addedPlasmid fragment1µLLight chain / heavy chain fragment4µLSolution I5µLReaction at 16°C for 1h

[0075] Adding the enzyme linking product to 100 µL XL1-10 competent cells and place it on ice for 30 minutes. Then heat it at 42°C for 90 seconds, and place it on ice rapidly for 2 minutes. Next add 500µL LB medium, culture at 37°C for 1 hour in shaker, centrifuge at 4000rpm for 5 minutes and remove 500 µL supernatant, and then spray on LB solid plate containing 50 µg / mL AMP by gun blowing the suspension, and culture at 37°C overnight. Add single colonies into 5mL LB liquid medium (50µg / mL AMP) and culture for 6 hours at 37°C, 250rpm. Verify the clones by PCR, and preserve the positive strains with 15% sterilized glycerol. Each clone is prepared with 2 copies, one stored in a tube for sequencing, and the other preserved at -20 °C.

[0076] Example 4: Construction of stable expression cell lines

[0077] The humanized antibody expression plasmid P3.1GS-PD-L1-1 is linearized by PvuI before transfection, and the linearized plasmid containing humanized antibody light and heavy chain genes is transfected into CHO-KSM4 by electrotransfection for 2 times.

[0078] After transfection, glutamine is withdrawn for pressurized screening, and the transfected cells are recovered for 2 days and then laid on the plate. After culturing for 30-40 days, growth of clones can be observed in the 96-well plate, when the yield is verified. High-yield clones are transferred and expanded for culturing. When the quantity of cells reaches about 2×10 6< cells / mL, they are inoculated, fed and cultured in batches. After culturing, the supernatant is harvested for yield verification, to obtain the alternative parent clones. Carry out subclonal screening on the high-yield clones: 3000-5000 cells per well are arranged on a 6-well plate through semisolid plating, with 2.5mL medium. After plating, place at 37°C and 5% CO2 for static culture 7-12 days, after which select monoclonal clones. The selected clones are verified for yield to obtain alternative clones.

[0079] Nine high yield cell lines are obtained for flask shaking & feeding experiment. The feeding scheme by flask shaking is as follows: CDM4CHO-based medium is used to inoculate, with the density of inoculation of 5×10 5< cells / mL, and the inoculated cells are cultured at 37°C, 5% CO2 and 120rpm. The day starting the inoculation is marked as Day 0. And 70g / L cell Boost 5 is supplemented on Day 3. The supplemented volume per day is 6% of the inoculation volume until the cells are harvested. After feeding, the highest yield of cell lines reaches1.97g / L, and the antibody expressed is named as anti-PD-L1-1.Example 5: Comparison of binding specificity and binding kinetics of antibodies

[0080] Biacore is used to analyze the affinity and binding kinetics of the antibody expressed in cell line 4. Using standard amine coupling chemistry and the kit provided by Biacore, the goat anti-human IgG is covalently linked to CM5 chip by primary amine. Make the antibody flow in the HBS EP buffer at a flow rate of 10 L / min and measure the binding. The binding time is 300 seconds, and the dissociation time is 1200 seconds. The measured binding kinetics curve is as shown in Fig. 5, and the measured values ka, kd and KD are given in Table 11. Table 11 Binding kinetics results of humanized antibody anti-PD-L1-1Sampleka(1 / Ms)kd(1 / s)KD(M)anti-PD-L 1-11.76×10 5< 1.72×10 -4< 4.06×10 -10< Example 6: ELISA assay and its binding specificity to Other Members of B7 Family and binding to PD-L1 proteins of different species

[0081] The binding of B7 family members B7-1, B7-2 to PD-L2 protein, and the binding of mouse, M.fascicularis and human PD-L1 protein to humanized antibody anti-PD-L1-1 are tested. Different proteins are stored at 0.5 g / mL in enveloping buffer at 4°C overnight. Remove the solution in wells the next day and wash with PBST for twice. Then add 1%BSA, seal at 37°C for 1 hour, then wash with PBST for twice. Add 0.5µg / mL antibody samples, incubate for 1 hour, and wash with PBST for three times. Dilute with goat anti-human FAB-HRP at ratio of 1:10000, incubate for 1 hour at 37 C, and wash with PBST for three times. Add TMB for 15min coloration, stop the reaction with 0.5M H 2 SO 4 and read out the absorbance at 450nm.

[0082] As shown in Figure 6, humanized antibody anti-PD-L1-1 does not bind to other members of B7 family. Humanized antibody anti-PD-L1-1 binds to human or M.fascicularis PD-L1 protein with similar affinity.Example 7 ELISA Assay for Binding Specificity of Antibodies to CHO Cells with PD-L1 Expressed on Surface

[0083] A Chinese hamster ovary (CHO) cell line expressing recombinant human PD-L1 on cell surface is constructed and its binding specificity to humanized antibody anti-PD-L1-1 is determined by ELISA assay. The cells are overlaid on PD-L1 the day before the test, and 1 / 200 cells are filled with T75 bottles on each well. Then add 1%BSA and seal at 37°C for 1 hour. The antibody is diluted three folds starting from 5 µg / mL for 8 concentration gradients, incubated at 25°C for 1 hour, and washed with PBST for one time. The volume of 50ng / mL anti-human-Eu added to each well is 100 µL, with reaction time of 0.5 hours at 25°C, and washing with PBS for one time. Add fluorescence enhancement liquid and read values at exciting light 337nm / emitted light 620nm.

[0084] As shown in Fig. 7, the humanized antibody anti-PD-L 1-1 can effectively bind to the CHO cells transfected by PD-L1, and the EC50 reaches 93.50 ng / mL.Example 8 ELISA Assay for Binding Specificity of Antibodies to Recombinant Human PD-L1 Fusion Protein

[0085] The recombinant human PD-L1 fusion protein of 0.5µg / mL is stored at 4°C overnight in enveloping buffer. Remove the solution in wells the next day and wash with PBST for twice. Then add 1%BSA and seal at 37°C for 1 hour. Wash with PBST for twice. The antibody is diluted three folds starting from 5 µg / mL for 8 concentration gradients, incubated at 25°C for 1 hour, and washed with PBST for three time. Dilute with goat anti-human FAB-HRP at ratio of 1:10000, incubate for 1 hour at 37 C, and wash with PBST for three times. Add TMB for 15min coloration, stop the reaction with 0.5M H 2 SO 4 and read out the absorbance at 450nm.

[0086] As shown in Fig. 8, the humanized antibody anti-PD-L 1-1 can effectively interact with the recombinant human PD-L1 fusion protein, and the EC50 is 19.47 ng / mL.Example 9 Blocking Effect of Antibody on PD-L1 Binding to PD-1

[0087] The recombinant human PD-L1 fusion protein of 0.5µg / mL is stored at 4°C overnight in enveloping buffer. Remove the solution in wells the next day and wash with PBST for twice. Then add 1%BSA, seal at 37°C for 1 hour, then wash with PBST for twice. The antibody is diluted 2.5 folds starting from 10µg / mL for 8 concentration gradients, mixed with same volume of 1µg / mL PD1-Fc-Biotin, incubated at 25°C for 1 hour, and washed with PBST for one time. Incubate with goat streptavidin-HRP at ratio of 1:10000 for 1 hour at 37 C, and wash with PBST for three times. Add TMB for 15min coloration, stop the reaction with 0.5M H 2 SO 4 and read out the absorbance at 450nm.

[0088] As shown in Fig. 9, the humanized antibody anti-PD-L 1-1 can block the binding of ligands PD-L1 to PD-1, and the IC50 is 43.16ng / mL.Example 10 Antibody effect on cytokine secretion in mixed lymphocyte reaction

[0089] Dilute the blood with PBS buffer at 1:1, move 3 mL LSM into the centrifugal tube, and add 4 mL diluted blood. When adding, ensure that the diluted blood to the upper layer of LSM, without mixing. RT centrifuge at 400g for 30-40min. Finally, extract the separated PBMC from the upper layer and centrifuge at 100g for 10min. Separate CD4 + T-cells by using BD's CD4 + cell separation magnetic beads, and separate DC cells by using BD's DC-cell separation magnetic beads. On the 96-well plate, the quantity of CD4+T-cells is 1×10 5< per well; the quantity of DC is 1×10 4< ; and the total volume is 100µL for co-culture. Add gradient-diluted antibody and culture for 5 days so as to test the concentrations of IFN-γ, IL-2.

[0090] As shown in Fig. 10 and 11, the humanized antibody anti-PD-L1-1 can effectively promote the secretion of IFN-y and IL-2 by mixed lymphocytes.Example 11: Stability of antibody in serum

[0091] Dilute the humanized antibody anti-PD-L1-1 with monkey serum, at a concentration of 0.5mg / mL. Place it at 37°C, for 0, 1, 4 and 7 days, respectively.

[0092] The recombinant human PD-L1 fusion protein is stored at the concentration of 0.5µg / mL at 4°C overnight in enveloping buffer. Remove the solution in wells the next day and wash with PBST for twice. Then add 1%BSA, seal at 37°C for 1 hour, then wash with PBST for twice. The stable antibody samples are diluted three folds starting from 1 µg / mL for 8 concentration gradients, incubated at 37°C for 1 hour, and washed with PBST for three times. Dilute with goat anti-human FAB-HRP at ratio of 1:10000, incubate for 1 hour at 37 C, and wash with PBST for three times. Add TMB for 15min coloration, stop the reaction with 0.5M H 2 SO 4 and read out the absorbance at 450nm. With results as shown in Fig. 12, the humanized antibody anti-PD-L1-1 shows good serum stability, without significant activity attenuation within 7 days.

Claims

1. An anti-human PD-L1 humanized monoclonal antibody comprising the heavy chain of SEQ ID NO: 10, and the light chain of SEQ ID NO: 26 or an antigen binding fragment thereof.

2. A nucleic acid molecule encoding the anti-human PD-L1 humanized monoclonal antibody or an antigen binding part according to Claim 1.

3. A host cell comprising the nucleic acid molecule according to Claim 2.

4. A conjugate comprising the anti-human PD-L1 humanized monoclonal antibody or its antigen binding part thereof according to Claim 1, and other bioactive substances; wherein the anti-human PD-L1 humanized monoclonal antibody or its antigen binding part is directly coupled to other bioactive substances or through junction fragments.