MODULATORY POLYNUCLEOTIDS

DE602017092441T2Active Publication Date: 2025-10-29VOYAGER THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
DE602017092441
Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
Priority Date
2017-04-13
Filing Date
2017-05-18
Publication Date
2025-10-29
Estimated Expiration
2037-05-18

AI Technical Summary

Technical Problem

Existing nucleic acid modalities for gene expression regulation, such as microRNAs, suffer from low specificity and high off-target effects, necessitating the development of improved modulatory polynucleotides with enhanced target gene modulation and reduced off-target activity.

Method used

The development of artificial microRNAs, pre-microRNAs, and pri-microRNAs encoded by recombinant adeno-associated viruses (AAV) or plasmids, designed using specific design parameters and molecular scaffolds to enhance target gene modulation while minimizing off-target effects, utilizing modular elements and sequence motifs to achieve precise recognition and low guide-to-passenger strand ratios.

Benefits of technology

The designed modulatory polynucleotides demonstrate high target gene knock-down efficiency with minimal off-target activity, achieving target knock-down of up to 100% and maintaining vector genome integrity, thereby improving the specificity and efficacy of gene regulation.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

FIELD OF THE INVENTION

[0001] The invention relates to modulatory polynucleotides as defined by the claims. In some embodiments such modulatory polynucleotides may be encoded by or within recombinant adeno-associated viruses (AAV) and may comprise artificial microRNAs, artificial pre-microRNAs and / or artificial pri-microRNAs.BACKGROUND OF THE INVENTION

[0002] MicroRNAs (or miRNAs or miRs) are small, non-coding, single stranded ribonucleic acid molecules (RNAs), which are usually 19-25 nucleotides in length. More than a thousand microRNAs have been identified in mammalian genomes. The mature microRNAs primarily bind to the 3' untranslated region (3'-UTR) of target messenger RNAs (mRNAs) through partially or fully pairing with the complementary sequences of target mRNAs, promoting the degradation of target mRNAs at a post-transcriptional level, and in some cases, inhibiting the initiation of translation. MicroRNAs play a critical role in many key biological processes, such as the regulation of cell cycle and growth, apoptosis, cell proliferation and tissue development.

[0003] miRNA genes are generally transcribed as long primary transcripts of miRNAs (i.e. pri-miRNAs). The pri-miRNA is cleaved into a precursor of a miRNA (i.e. pre-miRNA) which is further processed to generate the mature and functional miRNA.

[0004] WO 2013 / 126605 A1 relates to precursor microRNA molecules that have been modified to prevent a protein involved in regulating developmental timing, oncogenesis, and / or neuronal growth from blocking processing of the precursor microRNA sequence to the mature microRNA.

[0005] Grössl et al., 2014 (Plos One 9(3):e92188) describe an artificial microRNA expressing AAV vector for phospholamban silencing in cardiomyocytes.

[0006] Bofill-De Ros et al., 2016 (Methods 103:157-166) relate to guidelines for optimal design of miRNA-based shRNAs.

[0007] While many target expression strategies employ nucleic acid based modalities, there remains a need for improved nucleic acid modalities which have higher specificity and with fewer off target effects.

[0008] The present invention provides such improved modalities in the form of artificial pri-, pre- and mature microRNA constructs. These novel constructs may be synthetic stand-alone molecules or be encoded in a plasmid or expression vector for delivery to cells. Such vectors include, but are not limited to adeno-associated viral vectors such as vector genomes of any of the AAV serotypes or other viral delivery vehicles such as lentivirus, etc.SUMMARY OF THE INVENTION

[0009] Described herein are compositions, methods, processes, kits and devices for the design, preparation, manufacture and / or formulation of modulatory polynucleotides.

[0010] Such modulatory polynucleotides may be encoded by or contained within plasmids or vectors or recombinant adeno-associated viruses (AAV) and may comprise artificial microRNAs, artificial pre-microRNAs and / or artificial pri-microRNAs.

[0011] The invention is defined by the claims and the details of various embodiments of the invention are set forth in the description below.BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The foregoing and other objects, features and advantages will be apparent from the following description of particular embodiments of the invention, as illustrated in the accompanying drawings in which like reference characters refer to the same parts throughout the different views. The drawings are not necessarily to scale, emphasis instead being placed upon illustrating the principles of various embodiments of the invention. FIG. 1 is a schematic of an artificial pri-microRNA that is part of a viral genome packaged in an AAV vector. FIG. 1 discloses SEQ ID NO: 943. FIG. 2 is a diagram showing the location of the modulatory polynucleotide (MP) in relation to the ITRs, the intron (I) and the polyA (P). DETAILED DESCRIPTION I. COMPOSITIONS Modulatory Polynucleotides

[0013] According to the present invention, modulatory polynucleotides are provided as defined by the claims which function as artificial microRNAs. As used herein a "modulatory polynucleotide" is any nucleic acid polymer which functions to modulate (either increase or decrease) the level or amount of a target gene. Modulatory polynucleotides include precursor molecules which are processed inside the cell prior to modulation. Modulatory polynucleotides or the processed forms thereof may be encoded in a plasmid, vector, genome or other nucleic acid expression vector for delivery to a cell.

[0014] In the invention, the modulatory polynucleotides comprises at least one nucleic acid sequence encoding at least one siRNA molecule as defined by the claims. The nucleic acids may, independently if there is more than one, encode 1, 2, 3, 4, 5, 6, 7, 8, 9, or more than 9 siRNA molecules.

[0015] In some embodiments modulatory polynucleotides are designed as primary microRNA (pri-miRs) or precursor microRNAs (pre-miRs) which are processed within the cell to produce highly specific artificial microRNAs.

[0016] The modulatory polynucleotides, especially the artificial microRNAs of the invention, may be designed based on the sequence or structure scaffold of a canonical or known microRNA, pri-microRNA or pre-microRNA. Such sequences may correspond to any known microRNA or its precursor such as those taught in US Publication US2005 / 0261218 and US Publication US2005 / 0059005.

[0017] microRNAs (or miRNA or miRs) are 19-25 nucleotide long noncoding RNAs that bind to the 3'UTR of nucleic acid molecules and down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation. The modulatory polynucleotides of the invention may comprise one or more microRNA sequences, microRNA seeds or artificial microRNAs, e.g., sequences which function as a microRNA.

[0018] A microRNA sequence comprises a "seed" region, i.e., a sequence in the region of positions 2-9 of the mature microRNA, which sequence has perfect Watson-Crick complementarity to the miRNA target sequence. A microRNA seed may comprise positions 2-8 or 2-7 or 2-9 of the mature microRNA. In some embodiments, a microRNA seed may comprise 7 nucleotides (e.g., nucleotides 2-8 of the mature microRNA), wherein the seed-complementary site in the corresponding miRNA target is flanked by an adenine (A) opposed to microRNA position 1. In some embodiments, a microRNA seed may comprise 6 nucleotides (e.g., nucleotides 2-7 of the mature microRNA), wherein the seed-complementary site in the corresponding miRNA target is flanked by an adenine (A) opposed to microRNA position 1. See for example, Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell. 2007 Jul 6;27(1):91-105. In naturally occurring microRNA, the bases of the microRNA seed have complete complementarity with the target sequence.

[0019] As taught herein, design parameters, or rules, have been identified and applied to design modulatory polynucleotides (e.g., artificial microRNAs) which have superior target gene modulatory properties with limited off target effects.

[0020] The molecular scaffold of the modulatory polynucleotide described herein may be designed and optimized to create a modulatory polynucleotide that has the desired target gene modulatory properties. As a non-limiting example, the modulatory polynucleotide can have superior target gene modulatory properties with limited off target effects.

[0021] In one embodiment, the modulatory polynucleotides of the invention, such as artificial miRs, are comprised of modular elements or sequence motifs assembled according to a set of rules that result in highly specific target recognition and low guide / passenger ratio. Such modules or sequence motifs include, but are not limited to, double stranded regions, flanking regions, loops, optimized loops, UGUG loops, GU domains, spacers (to control proximal and distal motif or module spacing or to introduce structural elements such as turns, loops or bulges), CNNC motifs, and thermodynamic asymmetry regions which may embrace loops, bulges, mismatches, wobbles, and / or combinations thereof. Non limiting examples of rules which may be applied alone or in combination when constructing artificial miRs include those taught in Seitz et al. Silence 2011, 2:4; Gu, et al., Cell 151, 900-911, November 9, 2012; Schwartz, et al., Cell, Vol. 115, 199-208, October 17, 2003; Park, et al., Nature, Vol. 475, 101, 14 July 2011; Ketley et al., 2013, PLoS ONE 8(6); Liu, et al., Nucleic Acids Research, 2008, Vol. 36, No. 9 2811-2824; Dow, et al., 2013, Nat Protoc. ; 7(2): 374-393. doi:10.1038 / nprot.2011.446; Auyeung, et al., Cell 152, 844-858, February 14, 2013; Gu et al., Cell 2012 Nov 9, 151(4):900-11; Fellmann et al. Molecular Cell 41, 733-746, 2011; Han et al. Cell 125, 887-907, 2006; Betancur et al. Frontiers in Genetics, Vol. 3, Art. 127, 1-6 July 2012; Schwarz et al. Cell Vol 115, 199-208, 2003;

[0022] Any of the known RNAi constructs or RNAi agents may serve as the starting construct for the design of the passenger and / or guide strand of a modulatory polynucleotides or artificial microRNAs. These include canonical siRNAs, small interfering RNAs (siRNA), double stranded RNAs (dsRNAs), inverted repeats, short hairpin RNAs (shRNAs), small temporally regulated RNAs (stRNA), clustered inhibitory RNAs (cRNAs), including radial clustered inhibitory RNA, asymmetric clustered inhibitory RNA, linear clustered inhibitory RNA, and complex or compound clustered inhibitory RNA, dicer substrates, DNA-directed RNAi (ddRNAi), single-stranded RNAi (ssRNAi), microRNA (miRNA) antagonists, microRNA mimics, microRNA agonists, blockmirs (a.k.a. Xmirs), microRNA mimetics, microRNA addbacks, supermiRs, the oligomeric constructs disclosed in PCT Publication WO / 2005 / 013901, tripartite RNAi constructs such as those disclosed in US Publication 20090131360, the solo-rxRNA constructs disclosed in PCT Publication WO / 2010 / 011346; the sd-rxRNA constructs disclosed in PCT Publication WO / 2010 / 033247, dual acting RNAi constructs which reduce RNA levels and also modulate the immune response as disclosed in PCT Publications WO / 2010 / 002851 and WO / 2009 / 141146 and antigene RNAs (agRNA) or small activating RNAs (saRNAs) which increase expression of the target to which they are designed disclosed in PCT Publications WO / 2006 / 130201, WO / 2007 / 086990, WO / 2009 / 046397, WO / 2009 / 149182, WO / 2009 / 086428.

[0023] Likewise, any pri- or pre-microRNA precursor of the above listed microRNA may also serve as the molecular scaffold of the modulatory polynucleotides

[0024] The starting construct may be derived from any relevant species such as, not limited to, mouse, rat, dog, monkey or human.

[0025] In one embodiment, the modulatory polynucleotide may be located in an expression vector downstream of a promoter such as, but not limited to, CMV, U6, H1, CBA or a CBA promoter with a SV40 or a human betaGlobin intron. Further, the modulatory polynucleotide may also be located upstream of the polyadenylation sequence in an expression vector. As a non-limiting example, the modulatory polynucleotide may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence in an expression vector. As another non-limiting example, the modulatory polynucleotide may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence in an expression vector. As a non-limiting example, the modulatory polynucleotide may be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence in an expression vector. As another non-limiting example, the modulatory polynucleotide may be located with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% downstream from the promoter and / or upstream of the polyadenylation sequence in an expression vector.

[0026] In one embodiment, the modulatory polynucleotide may be located upstream of the polyadenylation sequence in an expression vector. Further, the modulatory polynucleotide may be located downstream of a promoter such as, but not limited to, CMV, U6, H1, CBA or a CBA promoter with a SV40 or a human betaGlobin intron in an expression vector. As a non-limiting example, the modulatory polynucleotide may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence in an expression vector. As another non-limiting example, the modulatory polynucleotide may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence in an expression vector. As a non-limiting example, the modulatory polynucleotide may be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence in an expression vector. As another non-limiting example, the modulatory polynucleotide may be located with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% downstream from the promoter and / or upstream of the polyadenylation sequence in an expression vector.

[0027] In one embodiment, the modulatory polynucleotide may be located in a scAAV.

[0028] In one embodiment, the modulatory polynucleotide may be located in an ssAAV.

[0029] In one embodiment, the modulatory polynucleotide may be located near the 5' end of the flip ITR in an expression vector. In another embodiment, the modulatory polynucleotide may be located near the 3'end of the flip ITR in an expression vector. In yet another embodiment, the modulatory polynucleotide may be located near the 5' end of the flop ITR in an expression vector. In yet another embodiment, the modulatory polynucleotide may be located near the 3' end of the flop ITR in an expression vector. In one embodiment, the modulatory polynucleotide may be located between the 5' end of the flip ITR and the 3' end of the flop ITR in an expression vector. In one embodiment, the modulatory polynucleotide may be located between (e.g., half-way between the 5' end of the flip ITR and 3' end of the flop ITR or the 3' end of the flop ITR and the 5' end of the flip ITR), the 3' end of the flip ITR and the 5' end of the flip ITR in an expression vector. As a non-limiting example, the modulatory polynucleotide may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in an expression vector. As a non-limiting example, the modulatory polynucleotide may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in an expression vector. As another non-limiting example, the modulatory polynucleotide may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in an expression vector. As another non-limiting example, the modulatory polynucleotide may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in an expression vector. As a non-limiting example, the modulatory polynucleotide may be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in an expression vector. As another non-limiting example, the modulatory polynucleotide may be located with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in an expression vector.

[0030] In addition to the modules or sequence motifs, modulatory polynucleotides of the invention comprise both a passenger and guide strand. The passenger and guide strand may be positioned or located on the 5' arm or 3' arm of a stem loop structure of the modulatory polynucleotide.

[0031] In one embodiment, the 3' stem arm of the modulatory polynucleotides may have 11 nucleotides downstream of the 3' end of the guide strand which have complementarity to the 11 of the 13 nucleotides upstream of the 5' end of the passenger strand in the 5' stem arm.

[0032] In one embodiment, the modulatory polynucleotides may have a cysteine which is 6 nucleotides downstream of the 3' end of the 3' stem arm of the modulatory polynucleotide.

[0033] In one embodiment, the modulatory polynucleotides comprise a miRNA seed match for the guide strand. In another embodiment, the modulatory polynucleotides comprise a miRNA seed match for the passenger strand. In yet another embodiment, the modulatory polynucleotides do no comprise a seed match for the guide or passenger strand.

[0034] In one embodiment, the modulatory polynucleotides may have almost no significant full-length off targets for the guide strand. In another embodiment, the modulatory polynucleotides may have almost no significant full-length off targets for the passenger strand. In yet another embodiment, the modulatory polynucleotides may have almost no significant full-length off targets for the guide strand or the passenger strand.

[0035] In one embodiment, the modulatory polynucleotides may have high activity in vitro. In another embodiment, the modulatory polynucleotides may have low activity in vitro. In yet another embodiment, the modulatory polynucleotides may have high guide strand activity and low passenger strand activity in vitro.

[0036] In one embodiment, the modulatory polynucleotides have a high guide strand activity and low passenger strand activity in vitro. The target knock-down (KD) by the guide strand may be at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5% or 100%. The target knock-down by the guide strand may be 60-65%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 60-99%, 60-99.5%, 60-100%, 65-70%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 65-99%, 65-99.5%, 65-100%, 70-75%, 70-80%, 70-85%, 70-90%, 70-95%, 70-99%, 70-99.5%, 70-100%, 75-80%, 75-85%, 75-90%, 75-95%, 75-99%, 75-99.5%, 75-100%, 80-85%, 80-90%, 80-95%, 80-99%, 80-99.5%, 80-100%, 85-90%, 85-95%, 85-99%, 85-99.5%, 85-100%, 90-95%, 90-99%, 90-99.5%, 90-100%, 95-99%, 95-99.5%, 95-100%, 99-99.5%, 99-100% or 99.5-100%. As a non-limiting example, the target knock-down (KD) by the guide strand is greater than 70%.

[0037] In one embodiment, the IC50 of the passenger strand for the nearest off target is greater than 100 multiplied by the IC50 of the guide strand for the target. As a non-limiting example, if the IC50 of the passenger strand for the nearest off target is greater than 100 multiplied by the IC50 of the guide strand for the target then the modulatory polynucleotide is said to have high guide strand activity and a low passenger strand activity in vitro.

[0038] In one embodiment, the 5' processing of the guide strand has a correct start (n) at the 5' end at least 75%, 80%, 85%, 90%, 95%, 99% or 100% of the time in vitro or in vivo. As a non-limiting example, the 5' processing of the guide strand is precise and has a correct start (n) at the 5' end at least 99% of the time in vitro. As a non-limiting example, the 5' processing of the guide strand is precise and has a correct start (n) at the 5' end at least 99% of the time in vivo.

[0039] In one embodiment, the guide-to-passenger (G:P) strand ratio is 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1;1, 2:10, 2:9, 2:8, 2:7, 2:6, 2:5, 2:4, 2:3, 2:2, 2:1, 3:10, 3:9, 3:8, 3:7, 3:6, 3:5, 3:4, 3:3, 3:2, 3:1, 4:10, 4:9, 4:8, 4:7, 4:6, 4:5, 4:4, 4:3, 4:2, 4:1, 5:10, 5:9, 5:8, 5:7, 5:6, 5:5, 5:4, 5:3, 5:2, 5:1, 6:10, 6:9, 6:8, 6:7, 6:6, 6:5, 6:4, 6:3, 6:2, 6:1, 7:10, 7:9, 7:8, 7:7, 7:6, 7:5, 7:4, 7:3, 7:2, 7:1, 8:10, 8:9, 8:8, 8:7, 8:6, 8:5, 8:4, 8:3, 8:2, 8:1, 9:10, 9:9, 9:8, 9:7, 9:6, 9:5, 9:4, 9:3, 9:2, 9:1, 10:10, 10:9, 10:8, 10:7, 10:6, 10:5, 10:4, 10:3, 10:2, 10:1, 1:99, 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5, or 99:1 in vitro or in vivo.

[0040] The guide to passenger ratio refers to the ratio of the guide strands to the passenger strands after the excision of the guide strand. For example, a 80:20 guide to passenger ratio would have 8 guide strands to every 2 passenger strands clipped out of the precursor. As a non-limiting example, the guide-to-passenger strand ratio is 8:2 in vitro. As a non-limiting example, the guide-to-passenger strand ratio is 8:2 in vivo. As a non-limiting example, the guide-to-passenger strand ratio is 9:1 in vitro. As a non-limiting example, the guide-to-passenger strand ratio is 9:1 in vivo.

[0041] In one embodiment, the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is greater than 1.

[0042] In one embodiment, the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is greater than 2.

[0043] In one embodiment, the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is greater than 5.

[0044] In one embodiment, the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is greater than 10.

[0045] In one embodiment, the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is greater than 20.

[0046] In one embodiment, the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is greater than 50.

[0047] In one embodiment, the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is at least 3:1.

[0048] In one embodiment, the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is at least 5:1.

[0049] In one embodiment, the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is at least 10:1.

[0050] In one embodiment, the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is at least 20:1.

[0051] In one embodiment, the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is at least 50:1.

[0052] In one embodiment, the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1;1, 2:10, 2:9, 2:8, 2:7, 2:6, 2:5, 2:4, 2:3, 2:2, 2:1, 3:10, 3:9, 3:8, 3:7, 3:6, 3:5, 3:4, 3:3, 3:2, 3:1, 4:10, 4:9, 4:8, 4:7, 4:6, 4:5, 4:4, 4:3, 4:2, 4:1, 5:10, 5:9, 5:8, 5:7, 5:6, 5:5, 5:4, 5:3, 5:2, 5:1, 6:10, 6:9, 6:8, 6:7, 6:6, 6:5, 6:4, 6:3, 6:2, 6:1, 7:10, 7:9, 7:8, 7:7, 7:6, 7:5, 7:4, 7:3, 7:2, 7:1, 8:10, 8:9, 8:8, 8:7, 8:6, 8:5, 8:4, 8:3, 8:2, 8:1, 9:10, 9:9, 9:8, 9:7, 9:6, 9:5, 9:4, 9:3, 9:2, 9:1, 10:10, 10:9, 10:8, 10:7, 10:6, 10:5, 10:4, 10:3, 10:2, 10:1, 1:99, 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5, or 99:1 in vitro or in vivo. The passenger to guide ratio refers to the ratio of the passenger strands to the guide strands after the excision of the guide strand. For example, a 80:20 passenger to guide ratio would have 8 passenger strands to every 2 guide strands clipped out of the precursor. As a non-limiting example, the passenger-to-guide strand ratio is 80:20 in vitro. As a non-limiting example, the passenger-to-guide strand ratio is 80:20 in vivo. As a non-limiting example, the passenger-to-guide strand ratio is 8:2 in vitro. As a non-limiting example, the passenger-to-guide strand ratio is 8:2 in vivo. As a non-limiting example, the passenger-to-guide strand ratio is 9:1 in vitro. As a non-limiting example, the passenger-to-guide strand ratio is 9:1 in vivo.

[0053] In one embodiment, the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is greater than 1.

[0054] In one embodiment, the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is greater than 2.

[0055] In one embodiment, the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is greater than 5.

[0056] In one embodiment, the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is greater than 10.

[0057] In one embodiment, the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is greater than 20.

[0058] In one embodiment, the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is greater than 50.

[0059] In one embodiment, the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is at least 3:1.

[0060] In one embodiment, the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is at least 5:1.

[0061] In one embodiment, the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is at least 10:1.

[0062] In one embodiment, the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is at least 20:1.

[0063] In one embodiment, the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is at least 50:1.

[0064] In one embodiment, a passenger-guide strand duplex is considered effective when the pri- or pre-microRNAs demonstrate, but methods known in the art and described herein, greater than 2-fold guide to passenger strand ratio when processing is measured. As a non-limiting examples, the pri- or pre-microRNAs demonstrate great than 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, or 2 to 5-fold, 2 to 10-fold, 2 to 15-fold, 3 to 5-fold, 3 to 10-fold, 3 to 15-fold, 4 to 5-fold, 4 to 10-fold, 4 to 15-fold, 5 to 10-fold, 5 to 15-fold, 6 to 10-fold, 6 to 15-fold, 7 to 10-fold, 7 to 15-fold, 8 to 10-fold, 8 to 15-fold, 9 to 10-fold, 9 to 15-fold, 10 to 15-fold, 11 to 15-fold, 12 to 15-fold, 13 to 15-fold, or 14 to 15-fold guide to passenger strand ratio when processing is measured.

[0065] In one embodiment, the integrity of the vector genome is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more than 99% of the full length of the construct.Target nucleic acids

[0066] The modulatory polynucleotides of the invention may be targeted to any gene or nucleic acid construct including coding and non-coding genes. Genes (DNA or mRNA) that encode human or primate proteins may be targeted. Further, non-coding genes may also be targeted, e.g., long noncoding RNAs (lncRNA).

[0067] Examples of such lncRNA molecules and RNAi constructs designed to target such lncRNA any of which may be targeted by or encoded in the modulatory polynucleotides, respectively are taught in International Publication, WO2012 / 018881 A2.

[0068] In one embodiment, the modulatory polynucleotides of the invention may target any gene known in the art. As a non-limiting example, the gene may be SOD1.

[0069] In one embodiment, the modulatory polynucleotides of the invention may target any gene known in the art. As a non-limiting example, the gene may be Htt.

[0070] In one embodiment, the modulatory polynucleotide may be designed to target any gene or mRNA in the human genome, e.g., genes associated with CNS disorders such as, but not limited to, Huntington's Disease, ALS and the like.Molecular Scaffolds

[0071] The starting molecular scaffold of the modulatory polynucleotide may be a known or wild type pri- or pre-microRNA or the molecular scaffold of the modulatory polynucleotides may be designed ab initio. (See Cullen, Gene Therapy (2006) 13, 503-508 work with miR30; Chung, et al., Nucleic Acids Research, 2006, Vol. 34, No. 7 working with miR-155).

[0072] As used herein a "molecular scaffold" is a framework or starting molecule that forms the sequence or structural basis against which to design or make a subsequent molecule.

[0073] The modulatory polynucleotides may be designed as a pri-miR as shown in FIG. 1. In the figure, a pri-miR molecular scaffold is shown. The modulatory polynucleotide which comprises the payload (e.g., siRNA, miRNA or other RNAi agent described herein) comprises a leading 5' flanking sequence which may be of any length and may be derived in whole or in part from wild type microRNA sequence or be completely artificial.

[0074] In the invention, the molecular scaffold comprises at least one 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 5. As a non-limiting example, the 5' flanking region may comprise a 5' flanking sequence comprising the nucleotide sequence of SEQ ID NO: 5 which may be of any length and may be derived in whole or in part from wild type microRNA sequence or be a completely artificial sequence.

[0075] In the invention, the molecular scaffold comprises at least one 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 21. As a non-limiting example, the 3' flanking region may comprise a 3' flanking sequence comprising the nucleotide sequence of SEQ ID NO: 21 which may be of any length and may be derived in whole or in part from wild type microRNA sequence or be a completely artificial sequence.

[0076] In the invention, the molecular scaffold comprises at least one loop motif region comprising the nucleotide sequence of SEQ ID NO: 16. As a non-limiting example, the loop motif region may comprise a sequence comprising the nucleotide sequence of SEQ ID NO: 16 which may be of any length.

[0077] In the invention, the molecular scaffold comprises a 5' flanking region, a loop motif region and / or a 3' flanking region as defined by the claims.

[0078] In one embodiment, at least one payload (e.g., siRNA, miRNA or other RNAi agent described herein) may be encoded by a modulatory polynucleotide which also comprises at least one molecular scaffold as defined by the claims. The molecular scaffold may comprise a 5' flanking sequence and / or a 3' flanking sequence which may be of any length and may be derived in whole or in part from wild type microRNA sequence or be completely artificial. The 3' flanking sequence may mirror the 5' flanking sequence in size and origin. The 3' flanking sequence may optionally contain one or more CNNC motifs, where "N" represents any nucleotide.

[0079] Forming the stem of the stem loop structure shown is a minimum of the modulatory polynucleotide encoding at least one payload sequence. In some embodiments the payload sequence comprises at least one nucleic acid sequence which is in part complementary or will hybridize to a target sequence. In some embodiments the payload is a wild type microRNA. In some embodiments the payload is an siRNA molecule or fragment of an siRNA molecule. In some embodiments the payload is a substantially double stranded construct which may comprise one or more microRNAs, artificial microRNAs or siRNAs.

[0080] In some embodiments, the 5' arm of the stem loop of the modulatory polynucleotide comprises a nucleic acid sequence encoding a passenger strand. This strand is also known as the sense strand in that it reflects an identity to a target. The passenger strand may be between 15-30 nucleotides in length. It may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.

[0081] In some embodiments, the 3' arm of the stem loop of the modulatory polynucleotide comprises a nucleic acid sequence encoding a guide strand. This strand is also known as the antisense strand in that it reflects homology to a target. The guide strand may be between 15-30 nucleotides in length, 21-25 nucleotides or 22 nucleotides in length. It may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.

[0082] In some embodiments, where the guide strand comprises a microRNA, or artificial microRNAs, the guide strand may comprise one or more microRNA seed sequences. The seed sequence may be located at positions 2-7, 2-8 or 2-9 of the guide strand relative to the first 5' nucleotide of the guide strand or relative to a dicer cleavage site.

[0083] In other embodiments, the passenger strand may reside on the 3' arm while the guide strand resides on the 5' arm of the stem of the stem loop structure of the modulatory polynucleotide.

[0084] The passenger and guide strands may be completely complementary across a substantial portion of their length. In other embodiments the passenger strand and guide strand may be at least 70, 80, 90, 95 or 99% complementary across independently at least 50, 60, 70, 80, 85, 90, 95, or 99 % of the length of the strands.

[0085] Neither the identity of the passenger strand nor the homology of the guide strand need be 100% complementary to the target sequence.

[0086] In the invention

[0086] In the invention, separating the passenger and guide strand of the stem loop structure of the modulatory polynucleotide is a loop sequence as defined by the claims (also known as a loop motif, linker or linker motif). The loop sequence may be of any length, between 4-30 nucleotides, between 4-20 nucleotides, between 4-15 nucleotides, between 5-15 nucleotides, between 6-12 nucleotides, 6 nucleotides, 7, nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, and / or 15 nucleotides.

[0087] In the invention the loop sequence comprises a nucleic acid sequence encoding at least one UGUG motif. located at the 5' terminus of the loop sequence.

[0088] In one embodiment, spacer regions may be present in the modulatory polynucleotide to separate one or more modules (e.g., 5' flanking region, loop motif region, 3' flanking region, sense sequences, antisense sequence) from one another. There may be one or more such spacer regions present.

[0089] In one embodiment a spacer region of between 8-20, i.e., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides may be present between the passenger strand and a flanking region sequence.

[0090] In one embodiment, the length of the spacer region is 13 nucleotides and is located between the 5' terminus of the passenger strand and the 3' terminus of the flanking sequence. In one embodiment a spacer is of sufficient length to form approximately one helical turn of the sequence.

[0091] In one embodiment a spacer region of between 8-20, i.e., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides may be present between the guide strand and a flanking sequence.

[0092] In one embodiment, the spacer sequence is between 10-13, i.e., 10, 11, 12 or 13 nucleotides and is located between the 3' terminus of the guide strand and the 5' terminus of a flanking sequence. In one embodiment a spacer is of sufficient length to form approximately one helical turn of the sequence.

[0093] In one embodiment the modulatory polynucleotide comprises at least one UG motif at the base of the stem whereby the G nucleotide is paired and the U nucleotide is unpaired. In some embodiments the unpaired U nucleotide is located in a flanking sequence.

[0094] In the invention, the modulatory polynucleotide comprises in the 5' to 3' direction, a 5' flanking sequence, a 5' arm, a loop motif, a 3' arm and a 3' flanking sequence as defined by the claims. The 5' arm comprises a passenger strand and the 3' arm comprises the guide strand or the 5' arm comprises the guide strand and the 3' arm comprises the passenger strand.

[0095] The 5' arm, payload (e.g., passenger and / or guide strand), loop motif and / or 3' arm sequence may be altered (e.g., substituting 1 or more nucleotides, adding nucleotides and / or deleting nucleotides). The alteration may cause a beneficial change in the function of the construct (e.g., increase knock-down of the target sequence, reduce degradation of the construct, reduce off target effect, increase efficiency of the payload, and reduce degradation of the payload).

[0096] In one embodiment, the passenger strand sequence may be altered (e.g., substituting 1 or more nucleotides, adding nucleotides and / or deleting nucleotides). As a non-limiting example, the passenger strand sequence may comprise 1 or 2 substitutions within the last 4 nucleotides of the sequence (e.g., C substituted for a G). As another non-limiting example, the passenger strand sequence may comprise 1 or 2 substitutions within the 7-15 nucleotides from the 5'end of the sequence (e.g., U substituted for an A or C substituted for a G).

[0097] In one embodiment, the 3' arm strand sequence may be altered (e.g., substituting 1 or more nucleotides, adding nucleotides and / or deleting nucleotides). As a non-limiting example, the sequence of the 3' arm may comprise 1 or 2 substitutions within the first 4 nucleotides of the sequence (e.g., A substituted for a U).

[0098] In the invention embodiment, the molecular scaffold of the payload construct may comprise a 5' flanking region, a loop motif and a 3' flanking region as defined by the claims. Between the 5' flanking region and the loop motif may be a first payload region and between the loop motif and the 3' flanking region may be a second payload region. The first and second payload regions may comprise siRNA, miRNA or other RNAi agents, fragments or variants described herein. The first and second payload regions may also comprise a sequence which is the same, different or complementary to each other. As a non-limiting example, the first payload region sequence may be a passenger strand of a siRNA construct and the second payload region sequence may be a guide strand of an siRNA construct. The passenger and guide sequences may be substantially complementary to each other. As another non-limiting example, the first payload region sequence may be a guide strand of a siRNA construct and the second payload region sequence may be a passenger strand of an siRNA construct. The passenger and guide sequences may be substantially complementary to each other.

[0099] In the invention, the molecular scaffold of the modulatory polynucleotides described herein may comprise a 5' flanking region, a loop motif region and a 3' flanking region as defined by the claims. Non-limiting examples of the sequences for the 5' flanking region, loop motif region and the 3' flanking region which may be encoded by a modulatory polynucleotide are shown in Tables 1-3. In the invention, the flanking regions and the loop region are as defined by the claims. Table 1. 5' Flanking Regions for Molecular Scaffold 5' Flanking Region Name 5' Flanking Region Sequence 5' Flanking Region SEQ ID NO 5F115F225F3 35F445F555F665F7CUCCCGCAGAACACCAUGCGCUCCACGGAA75F885F99 Table 2. Loop Motif Regions for Molecular Scaffold Loop Motif Region Name Loop Motif Region Sequence Loop Motif Region SEQ ID NO L1UGUGACCUGG10L2UGUGAUUUGG11L3UAUAAUUUGG12L4CCUGACCCAGU13L5GUCUGCACCUGUCACUAG14L6GUGACCCAAG15L7GUGGCCACUGAGAAG16L8GUGACCCAAU17L9GUGACCCAAC18L10GUGGCCACUGAGAAA19 Table 3. 3'Flanking Regions for Molecular Scaffold 3' Flanking Region Name 3' Flanking Region Sequence 3' Flanking Region SEQ ID NO 3F1203F2213F3223F4233F5243F6253F7263F827

[0100] Any of the regions described in Tables 1-3, where U is T, may be used as modules in molecular scaffolds.

[0101] In one invention, the molecular scaffold comprises at least one nucleic acid sequence encoding at least one 5F5 flanking region.

[0102] In the invention, the molecular scaffold comprises at least one nucleic acid sequence encoding at least one L7 loop motif region.

[0103] In the invention, the molecular scaffold comprises at least one nucleic acid sequence encoding at least one 3F2 flanking region.

[0104] The 5' flanking region and the loop motif region may be

[0105] The molecular scaffold comprises

[0106] In the invention, the molecular scaffold comprises at least one nucleic acid sequence encoding at least one 5F5 flanking region and at least one nucleic acid sequence encoding at least one L7 loop motif region.

[0107] The molecular scaffold comprises

[0108] In the invention, the molecular scaffold may comprises at least one nucleic acid sequence encoding at least one 5F5 5' flanking region and at least one nucleic acid sequence encoding at least one 3F2 3' flanking region.

[0109] In one embodiment, the molecular scaffold may comprise one or more linkers known in the art. The linkers may separate regions or one molecular scaffold from another. As a non-limiting example, the molecular scaffold may be polycistronic.

[0110] In one embodiment, the modulatory polynucleotide is designed using at least one of the following properties: loop variant, seed mismatch / bulge / wobble variant, stem mismatch, loop variant and vassal stem mismatch variant, seed mismatch and basal stem mismatch variant, stem mismatch and basal stem mismatch variant, seed wobble and basal stem wobble variant, or a stem sequence variant.

[0111] In one embodiment, the molecular scaffold may be located between the two ITRs of an expression vector. As a non-limiting example, the molecular scaffold may be inserted into an expression vector at at least one of six different locations as shown in FIG. 2. In FIG. 2, "ITR" is the inverted terminal repeat, "I" represents intron, "P" is the polyA and "MP" is the modulatory polynucleotide.

[0112] In one embodiment, the molecular scaffold may be located downstream of a promoter such as, but not limited to, CMV, U6, H1, CBA or a CBA promoter with a SV40 or a human betaGlobin intron. Further, the molecular scaffold may also be located upstream of the polyadenylation sequence. As a non-limiting example, the molecular scaffold may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence. As another non-limiting example, the molecular scaffold may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence. As a non-limiting example, the molecular scaffold may be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence. As another non-limiting example, the molecular scaffold may be located with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% downstream from the promoter and / or upstream of the polyadenylation sequence.

[0113] In one embodiment, the molecular scaffold may be located upstream of the polyadenylation sequence. Further, the molecular scaffold may be located downstream of a promoter such as, but not limited to, CMV, U6, H1, CBA or a CBA promoter with a SV40 or a human betaGlobin intron. As a non-limiting example, the molecular scaffold may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence. As another non-limiting example, the molecular scaffold may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence. As a non-limiting example, the molecular scaffold may be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence. As another non-limiting example, the molecular scaffold may be located with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% downstream from the promoter and / or upstream of the polyadenylation sequence.

[0114] In one embodiment, the molecular scaffold may be located in a scAAV.

[0115] In one embodiment, the molecular scaffold may be located in an ssAAV.

[0116] In one embodiment, the molecular scaffold may be located near the 5' end of the flip ITR. In another embodiment, the molecular scaffold may be located near the 3' end of the flip ITR. In yet another embodiment, the molecular scaffold may be located near the 5' end of the flop ITR. In yet another embodiment, the molecular scaffold may be located near the 3' end of the flop ITR. In one embodiment, the molecular scaffold may be located between the 5' end of the flip ITR and the 3' end of the flop ITR. In one embodiment, the molecular scaffold may be located between (e.g., half-way between the 5' end of the flip ITR and 3' end of the flop ITR or the 3' end of the flop ITR and the 5' end of the flip ITR), the 3' end of the flip ITR and the 5' end of the flip ITR. As a non-limiting example, the molecular scaffold may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR). As a non-limiting example, the molecular scaffold may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR). As another non-limiting example, the molecular scaffold may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR). As another non-limiting example, the molecular scaffold may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR). As a non-limiting example, the molecular scaffold may be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR). As another non-limiting example, the molecular scaffold may be located with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR).Vectors

[0117] In some embodiments, the modulatory polynucleotides of the invention can be encoded by vectors such as plasmids or viral vectors. In one embodiment, the polynucleotides are encoded by viral vectors. Viral vectors may be, but are not limited to, Herpesvirus (HSV) vectors, retroviral vectors, adenoviral vectors, adeno-associated viral vectors, lentiviral vectors, and the like. In some specific embodiments, the viral vectors are AAV vectors.Retroviral vectors

[0118] In some embodiments, the modulatory polynucleotide targeting SOD1 or HTT may be encoded by a retroviral vector (See, e.g., U.S. Pat. Nos. 5,399,346; 5,124,263; 4,650,764 and 4,980,289).Adenoviral vectors

[0119] Adenoviruses are eukaryotic DNA viruses that can be modified to efficiently deliver a nucleic acid to a variety of cell types in vivo, and have been used extensively in gene therapy protocols, including for targeting genes to neural cells. Various replication defective adenovirus and minimum adenovirus vectors have been described for nucleic acid therapeutics (See, e.g., PCT Patent Publication Nos. WO199426914, WO 199502697, WO199428152, WO199412649, WO199502697 and WO199622378). Such adenoviral vectors may also be used to deliver modulatory polynucleotides of the present invention to cells.Adeno-associated viral (AAV) vectors

[0120] An adeno-associated virus (AAV) is a dependent parvovirus (like other parvoviruses) which is a single stranded non-enveloped DNA virus having a genome of about 5000 nucleotides in length and which contains two open reading frames encoding the proteins responsible for replication (Rep) and the structural protein of the capsid (Cap). The open reading frames are flanked by two Inverted Terminal Repeat (ITR) sequences, which serve as the origin of replication of the viral genome. Furthermore, the AAV genome contains a packaging sequence, allowing packaging of the viral genome into an AAV capsid. The AAV vector requires a co-helper (e.g., adenovirus) to undergo productive infection in infected cells. In the absence of such helper functions, the AAV virions essentially enter host cells but do not integrate into the cells' genome.

[0121] AAV vectors have been investigated for siRNA delivery because of several unique features. Non-limiting examples of the features include (i) the ability to infect both dividing and non-dividing cells; (ii) a broad host range for infectivity, including human cells; (iii) wild-type AAV has not been associated with any disease and has not been shown to replicate in infected cells; (iv) the lack of cell-mediated immune response against the vector and (v) the non-integrative nature in a host chromosome thereby reducing potential for long-term genetic alterations. Moreover, infection with AAV vectors has minimal influence on changing the pattern of cellular gene expression (Stilwell and Samulski et al., Biotechniques, 2003, 34, 148).

[0122] Typically, AAV vectors for siRNA delivery may be recombinant viral vectors which are replication defective as they lack sequences encoding functional Rep and Cap proteins within the viral genome. In some cases, the defective AAV vectors may lack most or all coding sequences and essentially only contains one or two AAV ITR sequences and a packaging sequence.

[0123] The AAV vectors comprising a nucleic acid sequence encoding the modulatory polynucleotides of the present invention may be introduced into mammalian cells.

[0124] AAV vectors may be modified to enhance the efficiency of delivery. Such modified AAV vectors comprising the nucleic acid sequence encoding the modulatory polynucleotide of the present invention can be packaged efficiently and can be used to successfully infect the target cells at high frequency and with minimal toxicity.

[0125] In some embodiments, the AAV vector comprising a nucleic acid sequence encoding the modulatory polynucleotide of the present invention may be a human serotype AAV vector. Such human AAV vector may be derived from any known serotype, e.g., from any one of serotypes AAV1-AAV11. As non-limiting examples, AAV vectors may be vectors comprising an AAV1-derived genome in an AAV1-derived capsid; vectors comprising an AAV2-derived genome in an AAV2-derived capsid; vectors comprising an AAV4-derived genome in an AAV4 derived capsid; vectors comprising an AA V6-derived genome in an AAV6 derived capsid or vectors comprising an AAV9-derived genome in an AAV9 derived capsid.

[0126] In other embodiments, the AAV vector comprising a nucleic acid sequence for encoding modulatory polynucleotide of the present invention may be a pseudotyped hybrid or chimeric AAV vector which contains sequences and / or components originating from at least two different AAV serotypes. Pseudotyped AAV vectors may be vectors comprising an AAV genome derived from one AAV serotype and a capsid protein derived at least in part from a different AAV serotype. As non-limiting examples, such pseudotyped AAV vectors may be vectors comprising an AAV2-derived genome in an AAV 1-derived capsid; or vectors comprising an AAV2-derived genome in an AAV6-derived capsid; or vectors comprising an AAV2-derived genome in an AAV4-derived capsid; or an AAV2-derived genome in an AAV9-derived capsid. In like fashion, the present invention contemplates any hybrid or chimeric AAV vector.

[0127] AAV vectors comprising a nucleic acid sequence encoding the modulatory polynucleotide of the present invention may be used to deliver siRNA molecules to the central nervous system (e.g., U.S. Pat. No. 6,180,613).

[0128] In some aspects, the AAV vectors comprising a nucleic acid sequence encoding the modulator polynucleotide of the present invention may further comprise a modified capsid including peptides from non-viral origin. In other aspects, the AAV vector may contain a CNS specific chimeric capsid to facilitate the delivery of encoded siRNA duplexes into the brain and the spinal cord. For example, an alignment of cap nucleotide sequences from AAV variants exhibiting CNS tropism may be constructed to identify variable region (VR) sequence and structure.

[0129] In one embodiment, the AAV vector comprising a nucleic acid sequence encoding the modulatory polynucleotide of the present invention may encode siRNA molecules which are polycistronic molecules. The siRNA molecules may additionally comprise one or more linkers between regions of the siRNA molecules.Self-Complemtary and Single Strand Vectors

[0130] In one embodiment, the AAV vector used in the present invention is a single strand vector (ssAAV).

[0131] In another embodiment, the AAV vectors may be self-complementary AAV vectors (scAAVs). scAAV vectors contain both DNA strands which anneal together to form double stranded DNA. By skipping second strand synthesis, scAAVs allow for rapid expression in the cell.

[0132] In one embodiment, the AAV vector used in the present invention is a scAAV.

[0133] Methods for producing and / or modifying AAV vectors are disclosed in the art such as pseudotyped AAV vectors (International Patent Publication Nos. WO200028004; WO200123001; WO2004112727; WO 2005005610 and WO 2005072364).AAV Serotypes

[0134] AAV particles of the present invention may comprise or be derived from any natural or recombinant AAV serotype. According to the present invention, the AAV particles may utilize or be based on a serotype selected from any of the following AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12, AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV44.1, AAV44.2, AAV44.5, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV1-7 / rh.48, AAV1-8 / rh.49, AAV2-15 / rh.62, AAV2-3 / rh.61, AAV2-4 / rh.50, AAV2-5 / rh.51, AAV3.1 / hu.6, AAV3.1 / hu.9, AAV3-9 / rh.52, AAV3-11 / rh.53, AAV4-8 / r11.64, AAV4-9 / rh.54, AAV4-19 / rh.55, AAV5-3 / rh.57, AAV5-22 / rh.58, AAV7.3 / hu.7, AAV16.8 / hu.10, AAV16.12 / hu.11, AAV29.3 / bb.1, AAV29.5 / bb.2, AAV106.1 / hu.37, AAV114.3 / hu.40, AAV127.2 / hu.41, AAV127.5 / hu.42, AAV128.3 / hu.44, AAV130.4 / hu.48, AAV145.1 / hu.53, AAV145.5 / hu.54, AAV145.6 / hu.55, AAV161.10 / hu.60, AAV161.6 / hu.61, AAV33.12 / hu.17, AAV33.4 / hu.15, AAV33.8 / hu.16, AAV52 / hu.19, AAV52.1 / hu.20, AAV58.2 / hu.25, AAVA3.3, AAVA3.4, AAVA3.5, AAVA3.7, AAVC1, AAVC2, AAVC5, AAV-DJ, AAV-DJ8, AAVF3, AAVF5, AAVH2, AAVrh.72, AAVhu.8, AAVrh.68, AAVrh.70, AAVpi.1, AAVpi.3, AAVpi.2, AAVrh.60, AAVrh.44, AAVrh.65, AAVrh.55, AAVrh.47, AAVrh.69, AAVrh.45, AAVrh.59, AAVhu.12, AAVH6, AAVLK03, AAVH-1 / hu.1, AAVH-5 / hu.3, AAVLG-10 / rh.40, AAVLG-4 / rh.38, AAVLG-9 / hu.39, AAVN721-8 / rh.43, AAVCh.5, AAVCh.5R1, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVCy.5R1, AAVCy.5R2, AAVCy.5R3, AAVCy.5R4, AAVcy.6, AAVhu.1, AAVhu.2, AAVhu.3, AAVhu.4, AAVhu.5, AAVhu.6, AAVhu.7, AAVhu.9, AAVhu.10, AAVhu.11, AAVhu.13, AAVhu.15, AAVhu.16, AAVhu.17, AAVhu.18, AAVhu.20, AAVhu.21, AAVhu.22, AAVhu.23.2, AAVhu.24, AAVhu.25, AAVhu.27, AAVhu.28, AAVhu.29, AAVhu.29R, AAVhu.31, AAVhu.32, AAVhu.34, AAVhu.35, AAVhu.37, AAVhu.39, AAVhu.40, AAVhu.41, AAVhu.42, AAVhu.43, AAVhu.44, AAVhu.44R1, AAVhu.44R2, AAVhu.44R3, AAVhu.45, AAVhu.46, AAVhu.47, AAVhu.48, AAVhu.48R1, AAVhu.48R2, AAVhu.48R3, AAVhu.49, AAVhu.51, AAVhu.52, AAVhu.54, AAVhu.55, AAVhu.56, AAVhu.57, AAVhu.58, AAVhu.60, AAVhu.61, AAVhu.63, AAVhu.64, AAVhu.66, AAVhu.67, AAVhu.14 / 9, AAVhu.t 19, AAVrh.2, AAVrh.2R, AAVrh.8, AAVrh.8R, AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.13R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh.37R2, AAVrh.38, AAVrh.39, AAVrh.40, AAVrh.46, AAVrh.48, AAVrh.48.1, AAVrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.61, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.67, AAVrh.73, AAVrh.74, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, AAAV, BAAV, caprine AAV, bovine AAV, AAVhE1.1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhEr1.16, AAVhEr1.18, AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4, AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23, AAVhEr3.1, AAV2.5T , AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12, AAV-2-pre-miRNA-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2, AAV Shuffle 100-1 , AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV Shuffle 100-2, AAV SM 10-1, AAV SM 10-8, AAV SM 100-3, AAV SM 100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh.62, AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8 / rh.64, AAVLG-9 / hu.39, AAV54.5 / hu.23, AAV54.2 / hu.22, AAV54.7 / hu.24, AAV54.1 / hu.21, AAV54.4R / hu.27, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV128.1 / hu.43, true type AAV (ttAAV), UPENN AAV 10, Japanese AAV 10 serotypes, AAV CBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3, AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3, AAV CBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV CBr-E5, AAV CBr-e5, AAV CBr-E6, AAV CBr-E7, AAV CBr-E8, AAV CHt-1, AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAV CHt-6.10, AAV CHt-6.5, AAV CHt-6.6, AAV CHt-6.7, AAV CHt-6.8, AAV CHt-P1, AAV CHt-P2, AAV CHt-P5, AAV CHt-P6, AAV CHt-P8, AAV CHt-P9, AAV CKd-1, AAV CKd-10, AAV CKd-2, AAV CKd-3, AAV CKd-4, AAV CKd-6, AAV CKd-7, AAV CKd-8, AAV CKd-B1, AAV CKd-B2, AAV CKd-B3, AAV CKd-B4, AAV CKd-B5, AAV CKd-B6, AAV CKd-B7, AAV CKd-B8, AAV CKd-H1, AAV CKd-H2, AAV CKd-H3, AAV CKd-H4, AAV CKd-H5, AAV CKd-H6, AAV CKd-N3, AAV CKd-N4, AAV CKd-N9, AAV CLg-F1, AAV CLg-F2, AAV CLg-F3, AAV CLg-F4, AAV CLg-F5, AAV CLg-F6, AAV CLg-F7, AAV CLg-F8, AAV CLv-1, AAV CLv1-1, AAV Clv1-10, AAV CLv1-2, AAV CLv-12, AAV CLv1-3, AAV CLv-13, AAV CLv1-4, AAV Clv1-7, AAV Clv1-8, AAV Clv1-9, AAV CLv-2, AAV CLv-3, AAV CLv-4, AAV CLv-6, AAV CLv-8, AAV CLv-D1, AAV CLv-D2, AAV CLv-D3, AAV CLv-D4, AAV CLv-D5, AAV CLv-D6, AAV CLv-D7, AAV CLv-D8, AAV CLv-E1, AAV CLv-K1, AAV CLv-K3, AAV CLv-K6, AAV CLv-L4, AAV CLv-L5, AAV CLv-L6, AAV CLv-M1, AAV CLv-M11, AAV CLv-M2, AAV CLv-M5, AAV CLv-M6, AAV CLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-R1, AAV CLv-R2, AAV CLv-R3, AAV CLv-R4, AAV CLv-R5, AAV CLv-R6, AAV CLv-R7, AAV CLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10, AAV CSp-11, AAV CSp-2, AAV CSp-3, AAV CSp-4, AAV CSp-6, AAV CSp-7, AAV CSp-8, AAV CSp-8.10, AAV CSp-8.2, AAV CSp-8.4, AAV CSp-8.5, AAV CSp-8.6, AAV CSp-8.7, AAV CSp-8.8, AAV CSp-8.9, AAV CSp-9, AAV.hu.48R3, AAV.VR-355, AAV3B, AAV4, AAV5, AAVF1 / HSC1, AAVF11 / HSC11, AAVF12 / HSC12, AAVF13 / HSC13, AAVF14 / HSC14, AAVF15 / HSC15, AAVF16 / HSC16, AAVF17 / HSC17, AAVF2 / HSC2, AAVF3 / HSC3, AAVF4 / HSC4, AAVF5 / HSC5, AAVF6 / HSC6, AAVF7 / HSC7, AAVF8 / HSC8, AAVF9 / HSC9, AAV-PHP.B (PHP.B), AAV-PHP.A (PHP.A), G2B-26, G2B-13, TH1.1-32 and / or TH1.1-35, and variants thereof. As a non-limiting example, the capsid of the recombinant AAV virus is AAV2. As a non-limiting example, the capsid of the recombinant AAV virus is AAVrh10. As a non-limiting example, the capsid of the recombinant AAV virus is AAV9(hu14). As a non-limiting example, the capsid of the recombinant AAV virus is AAV-DJ. As a non-limiting example, the capsid of the recombinant AAV virus is AAV9.47. As a non-limiting example, the capsid of the recombinant AAV virus is AAV-DJ8. As a non-limiting example, the capsid of the recombinant AAV virus is AAV-PHP.B. As a non-limiting example, the capsid of the recombinant AAV virus is AAV-PHP.A.

[0135] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Publication No. US20030138772, such as, but not limited to, AAV1 (SEQ ID NO: 6 and 64 of US20030138772), AAV2 (SEQ ID NO: 7 and 70 of US20030138772), AAV3 (SEQ ID NO: 8 and 71 of US20030138772), AAV4 (SEQ ID NO: 63 of US20030138772), AAV5 (SEQ ID NO: 114 of US20030138772), AAV6 (SEQ ID NO: 65 of US20030138772), AAV7 (SEQ ID NO: 1-3 of US20030138772), AAV8 (SEQ ID NO: 4 and 95 of US20030138772), AAV9 (SEQ ID NO: 5 and 100 of US20030138772), AAV10 (SEQ ID NO: 117 of US20030138772), AAV11 (SEQ ID NO: 118 of US20030138772), AAV12 (SEQ ID NO: 119 of US20030138772), AAVrh10 (amino acids 1 to 738 of SEQ ID NO: 81 of US20030138772), AAV16.3 (US20030138772 SEQ ID NO: 10), AAV29.3 / bb.1 (US20030138772 SEQ ID NO: 11), AAV29.4 (US20030138772 SEQ ID NO: 12), AAV29.5 / bb.2 (US20030138772 SEQ ID NO: 13), AAV1.3 (US20030138772 SEQ ID NO: 14), AAV13.3 (US20030138772 SEQ ID NO: 15), AAV24.1 (US20030138772 SEQ ID NO: 16), AAV27.3 (US20030138772 SEQ ID NO: 17), AAV7.2 (US20030138772 SEQ ID NO: 18), AAVC1 (US20030138772 SEQ ID NO: 19), AAVC3 (US20030138772 SEQ ID NO: 20), AAVC5 (US20030138772 SEQ ID NO: 21), AAVF1 (US20030138772 SEQ ID NO: 22), AAVF3 (US20030138772 SEQ ID NO: 23), AAVF5 (US20030138772 SEQ ID NO: 24), AAVH6 (US20030138772 SEQ ID NO: 25), AAVH2 (US20030138772 SEQ ID NO: 26), AAV42-8 (US20030138772 SEQ ID NO: 27), AAV42-15 (US20030138772 SEQ ID NO: 28), AAV42-5b (US20030138772 SEQ ID NO: 29), AAV42-1b (US20030138772 SEQ ID NO: 30), AAV42-13 (US20030138772 SEQ ID NO: 31), AAV42-3a (US20030138772 SEQ ID NO: 32), AAV42-4 (US20030138772 SEQ ID NO: 33), AAV42-5a (US20030138772 SEQ ID NO: 34), AAV42-10 (US20030138772 SEQ ID NO: 35), AAV42-3b (US20030138772 SEQ ID NO: 36), AAV42-11 (US20030138772 SEQ ID NO: 37), AAV42-6b (US20030138772 SEQ ID NO: 38), AAV43-1 (US20030138772 SEQ ID NO: 39), AAV43-5 (US20030138772 SEQ ID NO: 40), AAV43-12 (US20030138772 SEQ ID NO: 41), AAV43-20 (US20030138772 SEQ ID NO: 42), AAV43-21 (US20030138772 SEQ ID NO: 43), AAV43-23 (US20030138772 SEQ ID NO: 44), AAV43-25 (US20030138772 SEQ ID NO: 45), AAV44.1 (US20030138772 SEQ ID NO: 46), AAV44.5 (US20030138772 SEQ ID NO: 47), AAV223.1 (US20030138772 SEQ ID NO: 48), AAV223.2 (US20030138772 SEQ ID NO: 49), AAV223.4 (US20030138772 SEQ ID NO: 50), AAV223.5 (US20030138772 SEQ ID NO: 51), AAV223.6 (US20030138772 SEQ ID NO: 52), AAV223.7 (US20030138772 SEQ ID NO: 53), AAVA3.4 (US20030138772 SEQ ID NO: 54), AAVA3.5 (US20030138772 SEQ ID NO: 55), AAVA3.7 (US20030138772 SEQ ID NO: 56), AAVA3.3 (US20030138772 SEQ ID NO: 57), AAV42.12 (US20030138772 SEQ ID NO: 58), AAV44.2 (US20030138772 SEQ ID NO: 59), AAV42-2 (US20030138772 SEQ ID NO: 9), or variants thereof.

[0136] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Publication No. US20150159173, such as, but not limited to, AAV2 (SEQ ID NO: 7 and 23 of US20150159173), rh20 (SEQ ID NO: 1 of US20150159173), rh32 / 33 (SEQ ID NO: 2 of US20150159173), rh39 (SEQ ID NO: 3, 20 and 36 of US20150159173), rh46 (SEQ ID NO: 4 and 22 of US20150159173), rh73 (SEQ ID NO: 5 of US20150159173), rh74 (SEQ ID NO: 6 of US20150159173), AAV6.1 (SEQ ID NO: 29 of US20150159173), rh.8 (SEQ ID NO: 41 of US20150159173), rh.48.1 (SEQ ID NO: 44 of US20150159173), hu.44 (SEQ ID NO: 45 of US20150159173), hu.29 (SEQ ID NO: 42 of US20150159173), hu.48 (SEQ ID NO: 38 of US20150159173), rh54 (SEQ ID NO: 49 of US20150159173), AAV2 (SEQ ID NO: 7 of US20150159173), cy.5 (SEQ ID NO: 8 and 24 of US20150159173), rh.10 (SEQ ID NO: 9 and 25 of US20150159173), rh.13 (SEQ ID NO: 10 and 26 of US20150159173), AAV1 (SEQ ID NO: 11 and 27 of US20150159173), AAV3 (SEQ ID NO: 12 and 28 of US20150159173), AAV6 (SEQ ID NO: 13 and 29 of US20150159173), AAV7 (SEQ ID NO: 14 and 30 of US20150159173), AAV8 (SEQ ID NO: 15 and 31 of US20150159173), hu.13 (SEQ ID NO: 16 and 32 of US20150159173), hu.26 (SEQ ID NO: 17 and 33 of US20150159173), hu.37 (SEQ ID NO: 18 and 34 of US20150159173), hu.53 (SEQ ID NO: 19 and 35 of US20150159173), rh.43 (SEQ ID NO: 21 and 37 of US20150159173), rh2 (SEQ ID NO: 39 of US20150159173), rh.37 (SEQ ID NO: 40 of US20150159173), rh.64 (SEQ ID NO: 43 of US20150159173), rh.48 (SEQ ID NO: 44 of US20150159173), ch.5 (SEQ ID NO 46 of US20150159173), rh.67 (SEQ ID NO: 47 of US20150159173), rh.58 (SEQ ID NO: 48 of US20150159173), or variants thereof including, but not limited to Cy5R1, Cy5R2, Cy5R3, Cy5R4, rh.13R, rh.37R2, rh.2R, rh.8R, rh.48.1, rh.48.2, rh.48.1.2, hu.44R1, hu.44R2, hu.44R3, hu.29R, ch.5R1, rh64R1, rh64R2, AAV6.2, AAV6.1, AAV6.12, hu.48R1, hu.48R2, and hu.48R3.

[0137] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent No. US 7198951, such as, but not limited to, AAV9 (SEQ ID NO: 1-3 of US 7198951), AAV2 (SEQ ID NO: 4 of US 7198951), AAV1 (SEQ ID NO: 5 of US 7198951), AAV3 (SEQ ID NO: 6 of US 7198951), and AAV8 (SEQ ID NO: 7 of US7198951).

[0138] In some embodiments, the AAV serotype may be, or have, a mutation in the AAV9 sequence as described by N Pulicherla et al. (Molecular Therapy 19(6):1070-1078 (2011), such as but not limited to, AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.

[0139] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent No. US 6156303, such as, but not limited to, AAV3B (SEQ ID NO: 1 and 10 of US 6156303), AAV6 (SEQ ID NO: 2, 7 and 11 of US 6156303), AAV2 (SEQ ID NO: 3 and 8 of US 6156303), AAV3A (SEQ ID NO: 4 and 9, of US 6156303), or derivatives thereof.

[0140] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Publication No. US20140359799, such as, but not limited to, AAV8 (SEQ ID NO: 1 of US20140359799), AAVDJ (SEQ ID NO: 2 and 3 of US20140359799), or variants thereof.

[0141] In some embodiments, the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al. (Journal of Virology 82(12): 5887-5911 (2008). The amino acid sequence of AAVDJ8 may comprise two or more mutations in order to remove the heparin binding domain (HBD). As a non-limiting example, the AAV-DJ sequence described as SEQ ID NO: 1 in US Patent No. 7,588,772, may comprise two mutations: (1) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (2) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr). As another non-limiting example, may comprise three mutations: (1) K406R where lysine (K; Lys) at amino acid 406 is changed to arginine (R; Arg), (2) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (3) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).

[0142] In some embodiments, the AAV serotype may be, or have, a sequence of AAV4 as described in International Publication No. WO1998011244, such as, but not limited to AAV4 (SEQ ID NO: 1-20 of WO1998011244).

[0143] In some embodiments, the AAV serotype may be, or have, a mutation in the AAV2 sequence to generate AAV2G9 as described in International Publication No. WO2014144229

[0144] In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2005033321, such as, but not limited to AAV3-3 (SEQ ID NO: 217 of WO2005033321), AAV1 (SEQ ID NO: 219 and 202 of WO2005033321), AAV106.1 / hu.37 (SEQ ID No: 10 of WO2005033321), AAV114.3 / hu.40 (SEQ ID No: 11 of WO2005033321), AAV127.2 / hu.41 (SEQ ID NO:6 and 8 of WO2005033321), AAV128.3 / hu.44 (SEQ ID No: 81 of WO2005033321), AAV130.4 / hu.48 (SEQ ID NO: 78 of WO2005033321), AAV145.1 / hu.53 (SEQ ID No: 176 and 177 of WO2005033321), AAV145.6 / hu.56 (SEQ ID NO: 168 and 192 of WO2005033321), AAV16.12 / hu.11 (SEQ ID NO: 153 and 57 of WO2005033321), AAV16.8 / hu.10 (SEQ ID NO: 156 and 56 of WO2005033321), AAV161.10 / hu.60 (SEQ ID No: 170 of WO2005033321), AAV161.6 / hu.61 (SEQ ID No: 174 of WO2005033321), AAV1-7 / rh.48 (SEQ ID NO: 32 of WO2005033321), AAV 1-8 / rh.49 (SEQ ID NOs: 103 and 25 of WO2005033321), AAV2 (SEQ ID NO: 211 and 221 of WO2005033321), AAV2-15 / rh.62 (SEQ ID No: 33 and 114 of WO2005033321), AAV2-3 / rh.61 (SEQ ID NO: 21 of WO2005033321), AAV2-4 / rh.50 (SEQ ID No: 23 and 108 of WO2005033321), AAV2-5 / rh.51 (SEQ ID NO: 104 and 22 of WO2005033321), AAV3.1 / hu.6 (SEQ ID NO: 5 and 84 of WO2005033321), AAV3.1 / hu.9 (SEQ ID NO: 155 and 58 of WO2005033321), AAV3-11 / rh.53 (SEQ ID NO: 186 and 176 of WO2005033321), AAV3-3 (SEQ ID NO: 200 of WO2005033321), AAV33.12 / hu.17 (SEQ ID NO:4 of WO2005033321), AAV33.4 / hu.15 (SEQ ID No: 50 of WO2005033321), AAV33.8 / hu.16 (SEQ ID No: 51 of WO2005033321), AAV3-9 / rh.52 (SEQ ID NO: 96 and 18 of WO2005033321), AAV4-19 / rh.55 (SEQ ID NO: 117 of WO2005033321), AAV4-4 (SEQ ID NO: 201 and 218 of WO2005033321), AAV4-9 / rh.54 (SEQ ID NO: 116 of WO2005033321), AAV5 (SEQ ID NO: 199 and 216 of WO2005033321), AA V52.1 / hu.20 (SEQ ID NO: 63 of WO2005033321), AAV52 / hu.19 (SEQ ID NO: 133 of WO2005033321), AAV5-22 / rh.58 (SEQ ID No: 27 of WO2005033321), AAV5-3 / rh.57 (SEQ ID NO: 105 of WO2005033321), AAV5-3 / rh.57 (SEQ ID No: 26 of WO2005033321), AAV58.2 / hu.25 (SEQ ID No: 49 of WO2005033321), AAV6 (SEQ ID NO: 203 and 220 of WO2005033321), AAV7 (SEQ ID NO: 222 and 213 of WO2005033321), AAV7.3 / hu.7 (SEQ ID No: 55 of WO2005033321), AAV8 (SEQ ID NO: 223 and 214 of WO2005033321), AAVH-1 / hu.1 (SEQ ID No: 46 of WO2005033321), AAVH-5 / hu.3 (SEQ ID No: 44 of WO2005033321), AAVhu.1 (SEQ ID NO: 144 of WO2005033321), AAVhu.10 (SEQ ID NO: 156 of WO2005033321), AAVhu.11 (SEQ ID NO: 153 of WO2005033321), AAVhu.12 (WO2005033321 SEQ ID NO: 59), AAVhu.13 (SEQ ID NO: 129 of WO2005033321), AAVhu.14 / AAV9 (SEQ ID NO: 123 and 3 of WO2005033321), AAVhu.15 (SEQ ID NO: 147 of WO2005033321), AAVhu.16 (SEQ ID NO: 148 of WO2005033321), AAVhu.17 (SEQ ID NO: 83 of WO2005033321), AAVhu.18 (SEQ ID NO: 149 of WO2005033321), AAVhu.19 (SEQ ID NO: 133 of WO2005033321), AAVhu.2 (SEQ ID NO: 143 of WO2005033321), AAVhu.20 (SEQ ID NO: 134 of WO2005033321), AAVhu.21 (SEQ ID NO: 135 of WO2005033321), AAVhu.22 (SEQ ID NO: 138 of WO2005033321), AAVhu.23.2 (SEQ ID NO: 137 of WO2005033321), AAVhu.24 (SEQ ID NO: 136 of WO2005033321), AAVhu.25 (SEQ ID NO: 146 of WO2005033321), AAVhu.27 (SEQ ID NO: 140 of WO2005033321), AAVhu.29 (SEQ ID NO: 132 of WO2005033321), AAVhu.3 (SEQ ID NO: 145 of WO2005033321), AAVhu.31 (SEQ ID NO: 121 of WO2005033321), AAVhu.32 (SEQ ID NO: 122 of WO2005033321), AAVhu.34 (SEQ ID NO: 125 of WO2005033321), AAVhu.35 (SEQ ID NO: 164 of WO2005033321), AAVhu.37 (SEQ ID NO: 88 of WO2005033321), AAVhu.39 (SEQ ID NO: 102 of WO2005033321), AAVhu.4 (SEQ ID NO: 141 of WO2005033321), AAVhu.40 (SEQ ID NO: 87 of WO2005033321), AAVhu.41 (SEQ ID NO: 91 of WO2005033321), AAVhu.42 (SEQ ID NO: 85 of WO2005033321), AAVhu.43 (SEQ ID NO: 160 of WO2005033321), AAVhu.44 (SEQ ID NO: 144 of WO2005033321), AAVhu.45 (SEQ ID NO: 127 of WO2005033321), AAVhu.46 (SEQ ID NO: 159 of WO2005033321), AAVhu.47 (SEQ ID NO: 128 of WO2005033321), AAVhu.48 (SEQ ID NO: 157 of WO2005033321), AAVhu.49 (SEQ ID NO: 189 of WO2005033321), AAVhu.51 (SEQ ID NO: 190 of WO2005033321), AAVhu.52 (SEQ ID NO: 191 of WO2005033321), AAVhu.53 (SEQ ID NO: 186 of WO2005033321), AAVhu.54 (SEQ ID NO: 188 of WO2005033321), AAVhu.55 (SEQ ID NO: 187 of WO2005033321), AAVhu.56 (SEQ ID NO: 192 of WO2005033321), AAVhu.57 (SEQ ID NO: 193 of WO2005033321), AAVhu.58 (SEQ ID NO: 194 of WO2005033321), AAVhu.6 (SEQ ID NO: 84 of WO2005033321), AAVhu.60 (SEQ ID NO: 184 of WO2005033321), AAVhu.61 (SEQ ID NO: 185 of WO2005033321), AAVhu.63 (SEQ ID NO: 195 of WO2005033321), AAVhu.64 (SEQ ID NO: 196 of WO2005033321), AAVhu.66 (SEQ ID NO: 197 of WO2005033321), AAVhu.67 (SEQ ID NO: 198 of WO2005033321), AAVhu.7 (SEQ ID NO: 150 of WO2005033321), AAVhu.8 (WO2005033321 SEQ ID NO: 12), AAVhu.9 (SEQ ID NO: 155 of WO2005033321), AAVLG-10 / rh.40 (SEQ ID No: 14 of WO2005033321), AAVLG-4 / rh.38 (SEQ ID NO: 86 of WO2005033321), AAVLG-4 / rh.38 (SEQ ID No: 7 of WO2005033321), AAVN721-8 / rh.43 (SEQ ID NO: 163 of WO2005033321), AAVN721-8 / rh.43 (SEQ ID No: 43 of WO2005033321), AAVpi.1 (WO2005033321 SEQ ID NO: 28), AAVpi.2 (WO2005033321 SEQ ID NO: 30), AAVpi.3 (WO2005033321 SEQ ID NO: 29), AAVrh.38 (SEQ ID NO: 86 of WO2005033321), AAVrh.40 (SEQ ID NO: 92 of WO2005033321), AAVrh.43 (SEQ ID NO: 163 of WO2005033321), AAVrh.44 (WO2005033321 SEQ ID NO: 34), AAVrh.45 (WO2005033321 SEQ ID NO: 41), AAVrh.47 (WO2005033321 SEQ ID NO: 38), AAVrh.48 (SEQ ID NO: 115 of WO2005033321), AAVrh.49 (SEQ ID NO: 103 of WO2005033321), AAVrh.50 (SEQ ID NO: 108 of WO2005033321), AAVrh.51 (SEQ ID NO: 104 of WO2005033321), AAVrh.52 (SEQ ID NO: 96 of WO2005033321), AAVrh.53 (SEQ ID NO: 97 of WO2005033321), AAVrh.55 (WO2005033321 SEQ ID NO: 37), AAVrh.56 (SEQ ID NO: 152 of WO2005033321), AAVrh.57 (SEQ ID NO: 105 of WO2005033321), AAVrh.58 (SEQ ID NO: 106 of WO2005033321), AAVrh.59 (WO2005033321 SEQ ID NO: 42), AAVrh.60 (WO2005033321 SEQ ID NO: 31), AAVrh.61 (SEQ ID NO: 107 of WO2005033321), AAVrh.62 (SEQ ID NO: 114 of WO2005033321), AAVrh.64 (SEQ ID NO: 99 of WO2005033321), AAVrh.65 (WO2005033321 SEQ ID NO: 35), AAVrh.68 (WO2005033321 SEQ ID NO: 16), AAVrh.69 (WO2005033321 SEQ ID NO: 39), AAVrh.70 (WO2005033321 SEQ ID NO: 20), AAVrh.72 (WO2005033321 SEQ ID NO: 9), or variants thereof including, but not limited to, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVcy.6, AAVrh.12, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.25 / 42 15, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh14. Non limiting examples of variants include SEQ ID NO: 13, 15, 17, 19, 24, 36, 40, 45, 47, 48, 51-54, 60-62, 64-77, 79, 80, 82, 89, 90, 93-95, 98, 100, 101, , 109-113, 118-120, 124, 126, 131, 139, 142, 151,154, 158, 161, 162, 165-183, 202, 204-212, 215, 219, 224-236, of WO2005033321.

[0145] In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2015168666, such as, but not limited to, AAVrh8R (SEQ ID NO: 9 of WO2015168666), AAVrh8R A586R mutant (SEQ ID NO: 10 of WO2015168666), AAVrh8R R533A mutant (SEQ ID NO: 11 of WO2015168666), or variants thereof.

[0146] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent No. US9233131, such as, but not limited to, AAVhE1.1 (SEQ ID NO:44 of US9233131), AAVhEr1.5 (SEQ ID NO:45 of US9233131), AAVhER1.14 (SEQ ID NO:46 of US9233131), AAVhEr1.8 (SEQ ID NO:47 of US9233131), AAVhEr1.16 (SEQ ID NO:48 of US9233131), AAVhEr1.18 (SEQ ID NO:49 of US9233131), AAVhEr1.35 (SEQ ID NO:50 of US9233131), AAVhEr1.7 (SEQ ID NO:51 of US9233131), AAVhEr1.36 (SEQ ID NO:52 of US9233131), AAVhEr2.29 (SEQ ID NO:53 of US9233131), AAVhEr2.4 (SEQ ID NO:54 of US9233131), AAVhEr2.16 (SEQ ID NO:55 of US9233131), AAVhEr2.30 (SEQ ID NO:56 of US9233131), AAVhEr2.31 (SEQ ID NO:58 of US9233131), AAVhEr2.36 (SEQ ID NO:57 of US9233131), AAVhER1.23 (SEQ ID NO:53 of US9233131), AAVhEr3.1 (SEQ ID NO:59 of US9233131), AAV2.5T (SEQ ID NO:42 of US9233131), or variants thereof.

[0147] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150376607, such as, but not limited to, AAV-PAEC (SEQ ID NO:1 of US20150376607), AAV-LK01 (SEQ ID NO:2 of US20150376607), AAV-LK02 (SEQ ID NO:3 of US20150376607), AAV-LK03 (SEQ ID NO:4 of US20150376607), AAV-LK04 (SEQ ID NO:5 of US20150376607), AAV-LK05 (SEQ ID NO:6 of US20150376607), AAV-LK06 (SEQ ID NO:7 of US20150376607), AAV-LK07 (SEQ ID NO:8 of US20150376607), AAV-LK08 (SEQ ID NO:9 of US20150376607), AAV-LK09 (SEQ ID NO:10 of US20150376607), AAV-LK10 (SEQ ID NO:11 of US20150376607), AAV-LK11 (SEQ ID NO:12 of US20150376607), AAV-LK12 (SEQ ID NO:13 of US20150376607), AAV-LK13 (SEQ ID NO:14 of US20150376607), AAV-LK14 (SEQ ID NO:15 of US20150376607), AAV-LK15 (SEQ ID NO:16 of US20150376607), AAV-LK16 (SEQ ID NO:17 of US20150376607), AAV-LK17 (SEQ ID NO:18 of US20150376607), AAV-LK18 (SEQ ID NO:19 of US20150376607), AAV-LK19 (SEQ ID NO:20 of US20150376607), AAV-PAEC2 (SEQ ID NO:21 of US20150376607), AAV-PAEC4 (SEQ ID NO:22 of US20150376607), AAV-PAEC6 (SEQ ID NO:23 of US20150376607), AAV-PAEC7 (SEQ ID NO:24 of US20150376607), AAV-PAEC8 (SEQ ID NO:25 of US20150376607), AAV-PAEC11 (SEQ ID NO:26 of US20150376607), AAV-PAEC12 (SEQ ID NO:27, of US20150376607), or variants thereof.

[0148] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent No. US9163261, such as, but not limited to, AAV-2-pre-miRNA-101 (SEQ ID NO: 1 US9163261), or variants thereof.

[0149] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150376240, such as, but not limited to, AAV-8h (SEQ ID NO: 6 of US20150376240), AAV-8b (SEQ ID NO: 5 of US20150376240), AAV-h (SEQ ID NO: 2 of US20150376240), AAV-b (SEQ ID NO: 1 of US20150376240), or variants thereof.

[0150] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20160017295, such as, but not limited to, AAV SM 10-2 (SEQ ID NO: 22 of US20160017295), AAV Shuffle 100-1 (SEQ ID NO: 23 of US20160017295), AAV Shuffle 100-3 (SEQ ID NO: 24 of US20160017295), AAV Shuffle 100-7 (SEQ ID NO: 25 of US20160017295), AAV Shuffle 10-2 (SEQ ID NO: 34 of US20160017295), AAV Shuffle 10-6 (SEQ ID NO: 35 of US20160017295), AAV Shuffle 10-8 (SEQ ID NO: 36 of US20160017295), AAV Shuffle 100-2 (SEQ ID NO: 37 of US20160017295), AAV SM 10-1 (SEQ ID NO: 38 of US20160017295), AAV SM 10-8 (SEQ ID NO: 39 of US20160017295), AAV SM 100-3 (SEQ ID NO: 40 of US20160017295), AAV SM 100-10 (SEQ ID NO: 41 of US20160017295), or variants thereof.

[0151] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150238550, such as, but not limited to, BNP61 AAV (SEQ ID NO: 1 of US20150238550), BNP62 AAV (SEQ ID NO: 3 of US20150238550), BNP63 AAV (SEQ ID NO: 4 of US20150238550), or variants thereof.

[0152] In some embodiments, the AAV serotype may be or may have a sequence as described in United States Patent Publication No. US20150315612 such as, but not limited to, AAVrh.50 (SEQ ID NO: 108 of US20150315612), AAVrh.43 (SEQ ID NO: 163 of US20150315612), AAVrh.62 (SEQ ID NO: 114 of US20150315612), AAVrh.48 (SEQ ID NO: 115 of US20150315612), AAVhu.19 (SEQ ID NO: 133 of US20150315612), AAVhu.11 (SEQ ID NO: 153 of US20150315612), AAVhu.53 (SEQ ID NO: 186 of US20150315612), AAV4-8 / rh.64 (SEQ ID No: 15 of US20150315612), AAVLG-9 / hu.39 (SEQ ID No: 24 of US20150315612), AAV54.5 / hu.23 (SEQ ID No: 60 of US20150315612), AAV54.2 / hu.22 (SEQ ID No: 67 of US20150315612), AAV54.7 / hu.24 (SEQ ID No: 66 of US20150315612), AAV54.1 / hu.21 (SEQ ID No: 65 of US20150315612), AAV54.4R / hu.27 (SEQ ID No: 64 of US20150315612), AAV46.2 / hu.28 (SEQ ID No: 68 of US20150315612), AAV46.6 / hu.29 (SEQ ID No: 69 of US20150315612), AAV128.1 / hu.43 (SEQ ID No: 80 of US20150315612), or variants thereof.

[0153] In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2015121501, such as, but not limited to, true type AAV (ttAAV) (SEQ ID NO: 2 of WO2015121501), "UPenn AAV10" (SEQ ID NO: 8 of WO2015121501), "Japanese AAV10" (SEQ ID NO: 9 of WO2015121501), or variants thereof.

[0154] According to the present invention, AAV capsid serotype selection or use may be from a variety of species. In one embodiment, the AAV may be an avian AAV (AAAV). The AAAV serotype may be, or have, a sequence as described in United States Patent No. US 9238800, such as, but not limited to, AAAV (SEQ ID NO: 1, 2, 4, 6, 8, 10, 12, and 14 of US 9,238,800), or variants thereof.

[0155] In one embodiment, the AAV may be a bovine AAV (BAAV). The BAAV serotype may be, or have, a sequence as described in United States Patent No. US 9,193,769, such as, but not limited to, BAAV (SEQ ID NO: 1 and 6 of US 9193769), or variants thereof. The BAAV serotype may be or have a sequence as described in United States Patent No. US7427396, such as, but not limited to, BAAV (SEQ ID NO: 5 and 6 of US7427396), or variants thereof.

[0156] In one embodiment, the AAV may be a caprine AAV. The caprine AAV serotype may be, or have, a sequence as described in United States Patent No. US7427396, such as, but not limited to, caprine AAV (SEQ ID NO: 3 of US7427396), or variants thereof.

[0157] In other embodiments the AAV may be engineered as a hybrid AAV from two or more parental serotypes. In one embodiment, the AAV may be AAV2G9 which comprises sequences from AAV2 and AAV9. The AAV2G9 AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20160017005.

[0158] In one embodiment, the AAV may be a serotype generated by the AAV9 capsid library with mutations in amino acids 390-627 (VP1 numbering) as described by Pulicherla et al. (Molecular Therapy 19(6):1070-1078 (2011). The serotype and corresponding nucleotide and amino acid substitutions may be, but is not limited to, AAV9.1 (G1594C; D532H), AAV6.2 (T1418A and T1436X; V473D and I479K), AAV9.3 (T1238A; F413Y), AAV9.4 (T1250C and A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A; F4111), AAV9.9 (G1203A, G1785T; W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720T; N457H, T574S), AAV9.14 (T1340A, T1362C, T1560C, G1713A; L447H), AAV9.16 (A1775T; Q592L), AAV9.24 (T1507C, T1521G; W503R), AAV9.26 (A1337G, A1769C; Y446C, Q590P), AAV9.33 (A1667C; D556A), AAV9.34 (A1534G, C1794T; N512D), AAV9.35 (A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I), AAV9.40 (A1694T, E565V), AAV9.41 (A1348T, T1362C; T450S), AAV9.44 (A1684C, A1701T, A1737G; N562H, K567N), AAV9.45 (A1492T, C1804T; N498Y, L602F), AAV9.46 (G1441C, T1525C, T1549G; G481R, W509R, L517V), 9.47 (G1241A, G1358A, A1669G, C1745T; S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T; P482L, Q579L), AAV9.50 (A1638T, C1683T, T1805A; Q546H, L602H), AAV9.53 (G1301A, A1405C, C1664T, G1811T; R134Q, S469R, A555V, G604V), AAV9.54 (C1531A, T1609A; L511I, L537M), AAV9.55 (T1605A; F535L), AAV9.58 (C1475T, C1579A; T492I, H527N), AAV.59 (T1336C; Y446H), AAV9.61 (A1493T; N498I), AAV9.64 (C1531A, A1617T; L511I), AAV9.65 (C1335T, T1530C, C1568A; A523D), AAV9.68 (C1510A; P504T), AAV9.80 (G1441A,;G481R), AAV9.83 (C1402A, A1500T; P468T, E500D), AAV9.87 (T1464C, T1468C; S490P), AAV9.90 (A1196T; Y399F), AAV9.91 (T1316G, A1583T, C1782G, T1806C; L439R, K528I), AAV9.93 (A1273G, A1421G, A1638C, C1712T, G1732A, A1744T, A1832T; S425G, Q474R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T; M559L) and AAV9.95 (T1605A; F535L).

[0159] In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2016049230, such as, but not limited to AAVF1 / HSC1 (SEQ ID NO: 2 and 20 of WO2016049230), AAVF2 / HSC2 (SEQ ID NO: 3 and 21 of WO2016049230), AAVF3 / HSC3 (SEQ ID NO: 5 and 22 of WO2016049230), AAVF4 / HSC4 (SEQ ID NO: 6 and 23 of WO2016049230), AAVF5 / HSC5 (SEQ ID NO: 11 and 25 of WO2016049230), AAVF6 / HSC6 (SEQ ID NO: 7 and 24 of WO2016049230), AAVF7 / HSC7 (SEQ ID NO: 8 and 27 of WO2016049230), AAVF8 / HSC8 (SEQ ID NO: 9 and 28 of WO2016049230), AAVF9 / HSC9 (SEQ ID NO: 10 and 29 of WO2016049230), AAVF11 / HSC11 (SEQ ID NO: 4 and 26 of WO2016049230), AAVF12 / HSC12 (SEQ ID NO: 12 and 30 of WO2016049230), AAVF13 / HSC13 (SEQ ID NO: 14 and 31 of WO2016049230), AAVF14 / HSC14 (SEQ ID NO: 15 and 32 of WO2016049230), AAVF15 / HSC15 (SEQ ID NO: 16 and 33 of WO2016049230), AAVF16 / HSC16 (SEQ ID NO: 17 and 34 of WO2016049230), AAVF17 / HSC17 (SEQ ID NO: 13 and 35 of WO2016049230), or variants or derivatives thereof.

[0160] In some embodiments, the AAV serotype may be, or have, a sequence as described in United States Patent No. US 8734809, such as, but not limited to, AAV CBr-E1 (SEQ ID NO: 13 and 87 of US8734809), AAV CBr-E2 (SEQ ID NO: 14 and 88 of US8734809), AAV CBr-E3 (SEQ ID NO: 15 and 89 of US8734809), AAV CBr-E4 (SEQ ID NO: 16 and 90 of US8734809), AAV CBr-E5 (SEQ ID NO: 17 and 91 of US8734809), AAV CBr-e5 (SEQ ID NO: 18 and 92 of US8734809), AAV CBr-E6 (SEQ ID NO: 19 and 93 of US8734809), AAV CBr-E7 (SEQ ID NO: 20 and 94 of US8734809), AAV CBr-E8 (SEQ ID NO: 21 and 95 of US8734809), AAV CLv-D1 (SEQ ID NO: 22 and 96 of US8734809), AAV CLv-D2 (SEQ ID NO: 23 and 97 of US8734809), AAV CLv-D3 (SEQ ID NO: 24 and 98 of US8734809), AAV CLv-D4 (SEQ ID NO: 25 and 99 of US8734809), AAV CLv-D5 (SEQ ID NO: 26 and 100 of US8734809), AAV CLv-D6 (SEQ ID NO: 27 and 101 of US8734809), AAV CLv-D7 (SEQ ID NO: 28 and 102 of US8734809), AAV CLv-D8 (SEQ ID NO: 29 and 103 of US8734809), AAV CLv-E1 (SEQ ID NO: 13 and 87 of US8734809), AAV CLv-R1 (SEQ ID NO: 30 and 104 of US8734809), AAV CLv-R2 (SEQ ID NO: 31 and 105 of US8734809), AAV CLv-R3 (SEQ ID NO: 32 and 106 of US8734809), AAV CLv-R4 (SEQ ID NO: 33 and 107 of US8734809), AAV CLv-R5 (SEQ ID NO: 34 and 108 of US8734809), AAV CLv-R6 (SEQ ID NO: 35 and 109 of US8734809), AAV CLv-R7 (SEQ ID NO: 36 and 110 of US8734809), AAV CLv-R8 (SEQ ID NO: 37 and 111 of US8734809), AAV CLv-R9 (SEQ ID NO: 38 and 112 of US8734809), AAV CLg-F1 (SEQ ID NO: 39 and 113 of US8734809), AAV CLg-F2 (SEQ ID NO: 40 and 114 of US8734809), AAV CLg-F3 (SEQ ID NO: 41 and 115 of US8734809), AAV CLg-F4 (SEQ ID NO: 42 and 116 of US8734809), AAV CLg-F5 (SEQ ID NO: 43 and 117 of US8734809), AAV CLg-F6 (SEQ ID NO: 43 and 117 of US8734809), AAV CLg-F7 (SEQ ID NO: 44 and 118 of US8734809), AAV CLg-F8 (SEQ ID NO: 43 and 117 of US8734809), AAV CSp-1 (SEQ ID NO: 45 and 119 of US8734809), AAV CSp-10 (SEQ ID NO: 46 and 120 of US8734809), AAV CSp-11 (SEQ ID NO: 47 and 121 of US8734809), AAV CSp-2 (SEQ ID NO: 48 and 122 of US8734809), AAV CSp-3 (SEQ ID NO: 49 and 123 of US8734809), AAV CSp-4 (SEQ ID NO: 50 and 124 of US8734809), AAV CSp-6 (SEQ ID NO: 51 and 125 of US8734809), AAV CSp-7 (SEQ ID NO: 52 and 126 of US8734809), AAV CSp-8 (SEQ ID NO: 53 and 127 of US8734809), AAV CSp-9 (SEQ ID NO: 54 and 128 of US8734809), AAV CHt-2 (SEQ ID NO: 55 and 129 of US8734809), AAV CHt-3 (SEQ ID NO: 56 and 130 of US8734809), AAV CKd-1 (SEQ ID NO: 57 and 131 of US8734809), AAV CKd-10 (SEQ ID NO: 58 and 132 of US8734809), AAV CKd-2 (SEQ ID NO: 59 and 133 of US8734809), AAV CKd-3 (SEQ ID NO: 60 and 134 of US8734809), AAV CKd-4 (SEQ ID NO: 61 and 135 of US8734809), AAV CKd-6 (SEQ ID NO: 62 and 136 of US8734809), AAV CKd-7 (SEQ ID NO: 63 and 137 of US8734809), AAV CKd-8 (SEQ ID NO: 64 and 138 of US8734809), AAV CLv-1 (SEQ ID NO: 35 and 139 of US8734809), AAV CLv-12 (SEQ ID NO: 66 and 140 of US8734809), AAV CLv-13 (SEQ ID NO: 67 and 141 of US8734809), AAV CLv-2 (SEQ ID NO: 68 and 142 of US8734809), AAV CLv-3 (SEQ ID NO: 69 and 143 of US8734809), AAV CLv-4 (SEQ ID NO: 70 and 144 of US8734809), AAV CLv-6 (SEQ ID NO: 71 and 145 of US8734809), AAV CLv-8 (SEQ ID NO: 72 and 146 of US8734809), AAV CKd-B1 (SEQ ID NO: 73 and 147 of US8734809), AAV CKd-B2 (SEQ ID NO: 74 and 148 of US8734809), AAV CKd-B3 (SEQ ID NO: 75 and 149 of US8734809), AAV CKd-B4 (SEQ ID NO: 76 and 150 of US8734809), AAV CKd-B5 (SEQ ID NO: 77 and 151 of US8734809), AAV CKd-B6 (SEQ ID NO: 78 and 152 of US8734809), AAV CKd-B7 (SEQ ID NO: 79 and 153 of US8734809), AAV CKd-B8 (SEQ ID NO: 80 and 154 of US8734809), AAV CKd-H1 (SEQ ID NO: 81 and 155 of US8734809), AAV CKd-H2 (SEQ ID NO: 82 and 156 of US8734809), AAV CKd-H3 (SEQ ID NO: 83 and 157 of US8734809), AAV CKd-H4 (SEQ ID NO: 84 and 158 of US8734809), AAV CKd-H5 (SEQ ID NO: 85 and 159 of US8734809), AAV CKd-H6 (SEQ ID NO: 77 and 151 of US8734809), AAV CHt-1 (SEQ ID NO: 86 and 160 of US8734809), AAV CLv1-1 (SEQ ID NO: 171 of US8734809), AAV CLv1-2 (SEQ ID NO: 172 of US8734809), AAV CLv1-3 (SEQ ID NO: 173 of US8734809), AAV CLv1-4 (SEQ ID NO: 174 of US8734809), AAV Clv1-7 (SEQ ID NO: 175 of US8734809), AAV Clv1-8 (SEQ ID NO: 176 of US8734809), AAV Clv1-9 (SEQ ID NO: 177 of US8734809), AAV Clv1-10 (SEQ ID NO: 178 of US8734809), AAV.VR-355 (SEQ ID NO: 181 of US8734809), AAV.hu.48R3 (SEQ ID NO: 183 of US8734809), or variants or derivatives thereof.

[0161] In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2016065001, such as, but not limited to AAV CHt-P2 (SEQ ID NO: 1 and 51 of WO2016065001), AAV CHt-P5 (SEQ ID NO: 2 and 52 of WO2016065001), AAV CHt-P9 (SEQ ID NO: 3 and 53 of WO2016065001), AAV CBr-7.1 (SEQ ID NO: 4 and 54 of WO2016065001), AAV CBr-7.2 (SEQ ID NO: 5 and 55 of WO2016065001), AAV CBr-7.3 (SEQ ID NO: 6 and 56 of WO2016065001), AAV CBr-7.4 (SEQ ID NO: 7 and 57 of WO2016065001), AAV CBr-7.5 (SEQ ID NO: 8 and 58 of WO2016065001), AAV CBr-7.7 (SEQ ID NO: 9 and 59 of WO2016065001), AAV CBr-7.8 (SEQ ID NO: 10 and 60 of WO2016065001), AAV CBr-7.10 (SEQ ID NO: 11 and 61 of WO2016065001), AAV CKd-N3 (SEQ ID NO: 12 and 62 of WO2016065001), AAV CKd-N4 (SEQ ID NO: 13 and 63 of WO2016065001), AAV CKd-N9 (SEQ ID NO: 14 and 64 of WO2016065001), AAV CLv-L4 (SEQ ID NO: 15 and 65 of WO2016065001), AAV CLv-L5 (SEQ ID NO: 16 and 66 of WO2016065001), AAV CLv-L6 (SEQ ID NO: 17 and 67 of WO2016065001), AAV CLv-K1 (SEQ ID NO: 18 and 68 of WO2016065001), AAV CLv-K3 (SEQ ID NO: 19 and 69 of WO2016065001), AAV CLv-K6 (SEQ ID NO: 20 and 70 of WO2016065001), AAV CLv-M1 (SEQ ID NO: 21 and 71 of WO2016065001), AAV CLv-M11 (SEQ ID NO: 22 and 72 of WO2016065001), AAV CLv-M2 (SEQ ID NO: 23 and 73 of WO2016065001), AAV CLv-M5 (SEQ ID NO: 24 and 74 of WO2016065001), AAV CLv-M6 (SEQ ID NO: 25 and 75 of WO2016065001), AAV CLv-M7 (SEQ ID NO: 26 and 76 of WO2016065001), AAV CLv-M8 (SEQ ID NO: 27 and 77 of WO2016065001), AAV CLv-M9 (SEQ ID NO: 28 and 78 of WO2016065001), AAV CHt-P1 (SEQ ID NO: 29 and 79 of WO2016065001), AAV CHt-P6 (SEQ ID NO: 30 and 80 of WO2016065001), AAV CHt-P8 (SEQ ID NO: 31 and 81 of WO2016065001), AAV CHt-6.1 (SEQ ID NO: 32 and 82 of WO2016065001), AAV CHt-6.10 (SEQ ID NO: 33 and 83 of WO2016065001), AAV CHt-6.5 (SEQ ID NO: 34 and 84 of WO2016065001), AAV CHt-6.6 (SEQ ID NO: 35 and 85 of WO2016065001), AAV CHt-6.7 (SEQ ID NO: 36 and 86 of WO2016065001), AAV CHt-6.8 (SEQ ID NO: 37 and 87 of WO2016065001), AAV CSp-8.10 (SEQ ID NO: 38 and 88 of WO2016065001), AAV CSp-8.2 (SEQ ID NO: 39 and 89 of WO2016065001), AAV CSp-8.4 (SEQ ID NO: 40 and 90 of WO2016065001), AAV CSp-8.5 (SEQ ID NO: 41 and 91 of WO2016065001), AAV CSp-8.6 (SEQ ID NO: 42 and 92 of WO2016065001), AAV CSp-8.7 (SEQ ID NO: 43 and 93 of WO2016065001), AAV CSp-8.8 (SEQ ID NO: 44 and 94 of WO2016065001), AAV CSp-8.9 (SEQ ID NO: 45 and 95 of WO2016065001), AAV CBr-B7.3 (SEQ ID NO: 46 and 96 of WO2016065001), AAV CBr-B7.4 (SEQ ID NO: 47 and 97 of WO2016065001), AAV3B (SEQ ID NO: 48 and 98 of WO2016065001), AAV4 (SEQ ID NO: 49 and 99 of WO2016065001), AAV5 (SEQ ID NO: 50 and 100 of WO2016065001), or variants or derivatives thereof.

[0162] In one embodiment, the AAV may be a serotype comprising at least one AAV capsid CD8+ T-cell epitope. As a non-limiting example, the serotype may be AAV1, AAV2 or AAV8.

[0163] In one embodiment, the AAV may be a serotype selected from any of those found in Table 4.

[0164] In one embodiment, the AAV may comprise a sequence, fragment or variant thereof, of the sequences in Table 4.

[0165] In one embodiment, the AAV may be encoded by a sequence, fragment or variant as described in Table 4. Table 4. AAV Serotypes Serotype SEQ ID NO Reference Information AAV128US20150159173 SEQ ID NO: 11, US20150315612 SEQ ID NO: 202AAV129US20160017295 SEQ ID NO: 1US20030138772 SEQ ID NO: 64, US20150159173 SEQ ID NO: 27, US20150315612 SEQ ID NO: 219, US7198951 SEQ ID NO: 5AAV130US20030138772 SEQ ID NO: 6AAV1.331US20030138772 SEQ ID NO: 14AAV1032US20030138772 SEQ ID NO: 117AAV1033WO2015121501 SEQ ID NO: 9AAV1034WO2015121501 SEQ ID NO: 8AAV1135US20030138772 SEQ ID NO: 118AAV1236US20030138772 SEQ ID NO: 119AAV237US20150159173 SEQ ID NO: 7, US20150315612 SEQ ID NO: 211AAV238US20030138772 SEQ ID NO: 70, US20150159173 SEQ ID NO: 23, US20150315612 SEQ ID NO: 221, US20160017295 SEQ ID NO: 2, US6156303 SEQ ID NO: 4, US7198951 SEQ ID NO: 4, WO2015121501 SEQ ID NO: 1AAV239US6156303 SEQ ID NO: 8AAV240US20030138772 SEQ ID NO: 7AAV241US6156303 SEQ ID NO: 3AAV2.5T42US9233131 SEQ ID NO: 42AAV223.1043US20030138772 SEQ ID NO: 75AAV223.244US20030138772 SEQ ID NO: 49AAV223.245US20030138772 SEQ ID NO: 76AAV223.446US20030138772 SEQ ID NO: 50AAV223.447US20030138772 SEQ ID NO: 73AAV223.548US20030138772 SEQ ID NO: 51AAV223.549US20030138772 SEQ ID NO: 74AAV223.650US20030138772 SEQ ID NO: 52AAV223.651US20030138772 SEQ ID NO: 78AAV223.752US20030138772 SEQ ID NO: 53AAV223.753US20030138772 SEQ ID NO: 77AAV29.354US20030138772 SEQ ID NO: 82AAV29.455US20030138772 SEQ ID NO: 12AAV29.556US20030138772 SEQ ID NO: 83AAV29.5 (AAVbb.2)57US20030138772 SEQ ID NO: 13AAV358US20150159173 SEQ ID NO: 12AAV359US20030138772 SEQ ID NO: 71, US20150159173 SEQ ID NO: 28, US20160017295 SEQ ID NO: 3, US7198951 SEQ ID NO: 6AAV360US20030138772 SEQ ID NO: 8AAV3.3b61US20030138772 SEQ ID NO: 72AAV3-362US20150315612 SEQ ID NO: 200AAV3-363US20150315612 SEQ ID NO: 217AAV3a64US6156303 SEQ ID NO: 5AAV3a65US6156303 SEQ ID NO: 9AAV3b66US6156303 SEQ ID NO: 6AAV3b67US6156303 SEQ ID NO: 10AAV3b68US6156303 SEQ ID NO: 1AAV469US20140348794 SEQ ID NO: 17AAV470US20140348794 SEQ ID NO: 5AAV471US20140348794 SEQ ID NO: 3AAV472US20140348794 SEQ ID NO: 14AAV473US20140348794 SEQ ID NO: 15AAV474US20140348794 SEQ ID NO: 19AAV475US20140348794 SEQ ID NO: 12AAV476US20140348794 SEQ ID NO: 13AAV477US20140348794 SEQ ID NO: 7AAV478US20140348794 SEQ ID NO: 8AAV479US20140348794 SEQ ID NO: 9AAV480US20140348794 SEQ ID NO: 2AAV481US20140348794 SEQ ID NO: 10AAV482US20140348794 SEQ ID NO: 11AAV483US20140348794 SEQ ID NO: 18AAV484US20030138772 SEQ ID NO: 63, US20160017295 SEQ ID NO: 4, US20140348794 SEQ ID NO: 4AAV485US20140348794 SEQ ID NO: 16AAV486US20140348794 SEQ ID NO: 20AAV487US20140348794 SEQ ID NO: 6AAV488US20140348794 SEQ ID NO: 1AAV42.289US20030138772 SEQ ID NO: 9AAV42.290US20030138772 SEQ ID NO: 102AAV42.3b91US20030138772 SEQ ID NO: 36AAV42.3B92US20030138772 SEQ ID NO: 107AAV42.493US20030138772 SEQ ID NO: 33AAV42.494US20030138772 SEQ ID NO: 88AAV42.895US20030138772 SEQ ID NO: 27AAV42.896US20030138772 SEQ ID NO: 85AAV43.197US20030138772 SEQ ID NO: 39AAV43.198US20030138772 SEQ ID NO: 92AAV43.1299US20030138772 SEQ ID NO: 41AAV43.12100US20030138772 SEQ ID NO: 93AAV43.20101US20030138772 SEQ ID NO: 42AAV43.20102US20030138772 SEQ ID NO: 99AAV43.21103US20030138772 SEQ ID NO: 43AAV43.21104US20030138772 SEQ ID NO: 96AAV43.23105US20030138772 SEQ ID NO: 44AAV43.23106US20030138772 SEQ ID NO: 98AAV43.25107US20030138772 SEQ ID NO: 45AAV43.25108US20030138772 SEQ ID NO: 97AAV43.5109US20030138772 SEQ ID NO: 40AAV43.5110US20030138772 SEQ ID NO: 94AAV4-4111US20150315612 SEQ ID NO: 201AAV4-4112US20150315612 SEQ ID NO: 218AAV44.1113US20030138772 SEQ ID NO: 46AAV44.1114US20030138772 SEQ ID NO: 79AAV44.5115US20030138772 SEQ ID NO: 47AAV44.5116US20030138772 SEQ ID NO: 80AAV4407117US20150315612 SEQ ID NO: 90AAV5118US7427396 SEQ ID NO: 1AAV5119US20030138772 SEQ ID NO: 114AAV5120US20160017295 SEQ ID NO: 5, US7427396 SEQ ID NO: 2, US20150315612 SEQ ID NO: 216AAV5121US20150315612 SEQ ID NO: 199AAV6122US20150159173 SEQ ID NO: 13AAV6123US20030138772 SEQ ID NO: 65, US20150159173 SEQ ID NO: 29, US20160017295 SEQ ID NO: 6, US6156303 SEQ ID NO: 7AAV6124US6156303 SEQ ID NO: 11AAV6125US6156303 SEQ ID NO: 2AAV6126US20150315612 SEQ ID NO: 203AAV6127US20150315612 SEQ ID NO: 220AAV6.1128US20150159173AAV6.12129US20150159173AAV6.2130US20150159173AAV7131US20150159173 SEQ ID NO: 14AAV7132US20150315612 SEQ ID NO: 183AAV7133US20030138772 SEQ ID NO: 2, US20150159173 SEQ ID NO: 30, US20150315612 SEQ ID NO: 181, US20160017295 SEQ ID NO: 7AAV7134US20030138772 SEQ ID NO: 3AAV7135US20030138772 SEQ ID NO: 1, US20150315612 SEQ ID NO: 180AAV7136US20150315612 SEQ ID NO: 213AAV7137US20150315612 SEQ ID NO: 222AAV8138US20150159173 SEQ ID NO: 15AAV8139US20150376240 SEQ ID NO: 7AAV8140US20030138772 SEQ ID NO: 4, US20150315612 SEQ ID NO: 182AAV8141US20030138772 SEQ ID NO: 95, US20140359799 SEQ ID NO: 1, US20150159173 SEQ ID NO: 31, US20160017295 SEQ ID NO: 8, US7198951 SEQ ID NO: 7, US20150315612 SEQ ID NO: 223AAV8142US20150376240 SEQ ID NO: 8AAV8143US20150315612 SEQ ID NO: 214AAV-8b144US20150376240 SEQ ID NO: 5AAV-8b145US20150376240 SEQ ID NO: 3AAV-8h146US20150376240 SEQ ID NO: 6AAV-8h147US20150376240 SEQ ID NO: 4AAV9148US20030138772 SEQ ID NO: 5AAV9149US7198951 SEQ ID NO: 1AAV9150US20160017295 SEQ ID NO: 9AAV9151US20030138772 SEQ ID NO: 100, US7198951 SEQ ID NO: 2AAV9152US7198951 SEQ ID NO: 3AAV9 (AAVhu.14)153US7906111 SEQ ID NO: 3; WO2015038958 SEQ ID NO: 11AAV9 (AAVhu.14)154US7906111 SEQ ID NO: 123; WO2015038958 SEQ ID NO: 2AAVA3.1155US20030138772 SEQ ID NO: 120AAVA3.3156US20030138772 SEQ ID NO: 57AAVA3.3157US20030138772 SEQ ID NO: 66AAVA3.4158US20030138772 SEQ ID NO: 54AAVA3.4159US20030138772 SEQ ID NO: 68AAVA3.5160US20030138772 SEQ ID NO: 55AAVA3.5161US20030138772 SEQ ID NO: 69AAVA3.7162US20030138772 SEQ ID NO: 56AAVA3.7163US20030138772 SEQ ID NO: 67AAV29.3 (AAVbb.1)164US20030138772 SEQ ID NO: 11AAVC2165US20030138772 SEQ ID NO: 61AAVCh.5166US20150159173 SEQ ID NO: 46, US20150315612 SEQ ID NO: 234AAVcy.2 (AAV13.3)167US20030138772 SEQ ID NO: 15AAV24.1168US20030138772 SEQ ID NO: 101AAVcy.3 (AAV24.1)169US20030138772 SEQ ID NO: 16AAV27.3170US20030138772 SEQ ID NO: 104AAVcy.4 (AAV27.3)171US20030138772 SEQ ID NO: 17AAVcy.5172US20150315612 SEQ ID NO: 227AAV7.2173US20030138772 SEQ ID NO: 103AAVcy.5 (AAV7.2)174US20030138772 SEQ ID NO: 18AAV16.3175US20030138772 SEQ ID NO: 105AAVcy.6 (AAV16.3)176US20030138772 SEQ ID NO: 10AAVcy.5177US20150159173 SEQ ID NO: 8AAVcy.5178US20150159173 SEQ ID NO: 24AAVCy.5R1179US20150159173AAVCy.5R2180US20150159173AAVCy.5R3181US20150159173AAVCy.5R4182US20150159173AAVDJ183US20140359799 SEQ ID NO: 3, US7588772 SEQ ID NO: 2AAVDJ184US20140359799 SEQ ID NO: 2, US7588772 SEQ ID NO: 1AAVDJ-8185US7588772; Grimm et al 2008AAVDJ-8186US7588772; Grimm et al 2008AAVF5187US20030138772 SEQ ID NO: 110AAVH2188US20030138772 SEQ ID NO: 26AAVH6189US20030138772 SEQ ID NO: 25AAVhE1.1190US9233131 SEQ ID NO: 44AAVhEr1.14191US9233131 SEQ ID NO: 46AAVhEr1.16192US9233131 SEQ ID NO: 48AAVhEr1.18193US9233131 SEQ ID NO: 49AAVhEr1.23 (AAVhEr2.29)194US9233131 SEQ ID NO: 53AAVhEr1.35195US9233131 SEQ ID NO: 50AAVhEr1.36196US9233131 SEQ ID NO: 52AAVhEr1.5197US9233131 SEQ ID NO: 45AAVhEr1.7198US9233131 SEQ ID NO: 51AAVhEr1.8199US9233131 SEQ ID NO: 47AAVhEr2.16200US9233131 SEQ ID NO: 55AAVhEr2.30201US9233131 SEQ ID NO: 56AAVhEr2.31202US9233131 SEQ ID NO: 58AAVhEr2.36203US9233131 SEQ ID NO: 57AAVhEr2.4204US9233131 SEQ ID NO: 54AAVhEr3.1205US9233131 SEQ ID NO: 59AAVhu.1206US20150315612 SEQ ID NO: 46AAVhu.1207US20150315612 SEQ ID NO: 144AAVhu.10 (AAV16.8)208US20150315612 SEQ ID NO: 56AAVhu.10 (AAV16.8)209US20150315612 SEQ ID NO: 156AAVhu.11 (AAV16.12)210US20150315612 SEQ ID NO: 57AAVhu.11 (AAV16.12)211US20150315612 SEQ ID NO: 153AAVhu.12212US20150315612 SEQ ID NO: 59AAVhu.12213US20150315612 SEQ ID NO: 154AAVhu.13214US20150159173 SEQ ID NO: 16, US20150315612 SEQ ID NO: 71AAVhu.13215US20150159173 SEQ ID NO: 32, US20150315612 SEQ ID NO: 129AAVhu.136.1216US20150315612 SEQ ID NO: 165AAVhu.140.1217US20150315612 SEQ ID NO: 166AA Vhu.140.2218US20150315612 SEQ ID NO: 167AA Vhu.145.6219US20150315612 SEQ ID No: 178AAVhu.15220US20150315612 SEQ ID NO: 147AAVhu.15 (AAV33.4)221US20150315612 SEQ ID NO: 50AAVhu.156.1222US20150315612 SEQ ID No: 179AAVhu.16223US20150315612 SEQ ID NO: 148AAVhu.16 (AAV33.8)224US20150315612 SEQ ID NO: 51AAVhu.17225US20150315612 SEQ ID NO: 83AAVhu.17 (AAV33.12)226US20150315612 SEQ ID NO: 4AAVhu.172.1227US20150315612 SEQ ID NO: 171AAVhu.172.2228US20150315612 SEQ ID NO: 172AA Vhu.173.4229US20150315612 SEQ ID NO: 173AAVhu.173.8230US20150315612 SEQ ID NO: 175AAVhu.18231US20150315612 SEQ ID NO: 52AAVhu.18232US20150315612 SEQ ID NO: 149AAVhu.19233US20150315612 SEQ ID NO: 62AAVhu.19234US20150315612 SEQ ID NO: 133AAVhu.2235US20150315612 SEQ ID NO: 48AAVhu.2236US20150315612 SEQ ID NO: 143AAVhu.20237US20150315612 SEQ ID NO: 63AAVhu.20238US20150315612 SEQ ID NO: 134AA Vhu.21239US20150315612 SEQ ID NO: 65AA Vhu.21240US20150315612 SEQ ID NO: 135AAVhu.22241US20150315612 SEQ ID NO: 67AAVhu.22242US20150315612 SEQ ID NO: 138AAVhu.23243US20150315612 SEQ ID NO: 60AAVhu.23.2244US20150315612 SEQ ID NO: 137AAVhu.24245US20150315612 SEQ ID NO: 66AAVhu.24246US20150315612 SEQ ID NO: 136AAVhu.25247US20150315612 SEQ ID NO: 49AAVhu.25248US20150315612 SEQ ID NO: 146AAVhu.26249US20150159173 SEQ ID NO: 17, US20150315612 SEQ ID NO: 61AAVhu.26250US20150159173 SEQ ID NO: 33, US20150315612 SEQ ID NO: 139AAVhu.27251US20150315612 SEQ ID NO: 64AAVhu.27252US20150315612 SEQ ID NO: 140AAVhu.28253US20150315612 SEQ ID NO: 68AAVhu.28254US20150315612 SEQ ID NO: 130AAVhu.29255US20150315612 SEQ ID NO: 69AAVhu.29256US20150159173 SEQ ID NO: 42, US20150315612 SEQ ID NO: 132AAVhu.29257US20150315612 SEQ ID NO: 225AAVhu.29R258US20150159173AAVhu.3259US20150315612 SEQ ID NO: 44AAVhu.3260US20150315612 SEQ ID NO: 145AAVhu.30261US20150315612 SEQ ID NO: 70AAVhu.30262US20150315612 SEQ ID NO: 131AAVhu.31263US20150315612 SEQ ID NO: 1AAVhu.31264US20150315612 SEQ ID NO: 121AAVhu.32265US20150315612 SEQ ID NO: 2AAVhu.32266US20150315612 SEQ ID NO: 122AAVhu.33267US20150315612 SEQ ID NO: 75AAVhu.33268US20150315612 SEQ ID NO: 124AAVhu.34269US20150315612 SEQ ID NO: 72AAVhu.34270US20150315612 SEQ ID NO: 125AAVhu.35271US20150315612 SEQ ID NO: 73AAVhu.35272US20150315612 SEQ ID NO: 164AAVhu.36273US20150315612 SEQ ID NO: 74AAVhu.36274US20150315612 SEQ ID NO: 126AAVhu.37275US20150159173 SEQ ID NO: 34, US20150315612 SEQ ID NO: 88AAVhu.37 (AAV106.1)276US20150315612 SEQ ID NO: 10, US20150159173 SEQ ID NO: 18AAVhu.38277US20150315612 SEQ ID NO: 161AAVhu.39278US20150315612 SEQ ID NO: 102AAVhu.39 (AAVLG-9)279US20150315612 SEQ ID NO: 24AAVhu.4280US20150315612 SEQ ID NO: 47AAVhu.4281US20150315612 SEQ ID NO: 141AAVhu.40282US20150315612 SEQ ID NO: 87AAVhu.40 (AAV114.3)283US20150315612 SEQ ID No: 11AA Vhu.41284US20150315612 SEQ ID NO: 91AAVhu.41 (AAV127.2)285US20150315612 SEQ ID NO: 6AAVhu.42286US20150315612 SEQ ID NO: 85AAVhu.42 (AAV127.5)287US20150315612 SEQ ID NO: 8AAVhu.43288US20150315612 SEQ ID NO: 160AAVhu.43289US20150315612 SEQ ID NO: 236AAVhu.43 (AAV128.1)290US20150315612 SEQ ID NO: 80AAVhu.44291US20150159173 SEQ ID NO: 45, US20150315612 SEQ ID NO: 158AAVhu.44 (AAV128.3)292US20150315612 SEQ ID NO: 81AAVhu.44R1293US20150159173AAVhu.44R2294US20150159173AAVhu.44R3295US20150159173AAVhu.45296US20150315612 SEQ ID NO: 76AAVhu.45297US20150315612 SEQ ID NO: 127AAVhu.46298US20150315612 SEQ ID NO: 82AAVhu.46299US20150315612 SEQ ID NO: 159AAVhu.46300US20150315612 SEQ ID NO: 224AAVhu.47301US20150315612 SEQ ID NO: 77AAVhu.47302US20150315612 SEQ ID NO: 128AAVhu.48303US20150159173 SEQ ID NO: 38AAVhu.48304US20150315612 SEQ ID NO: 157AAVhu.48 (AAV130.4)305US20150315612 SEQ ID NO: 78AAVhu.48R1306US20150159173AAVhu.48R2307US20150159173AAVhu.48R3308US20150159173AAVhu.49309US20150315612 SEQ ID NO: 209AAVhu.49310US20150315612 SEQ ID NO: 189AAVhu.5311US20150315612 SEQ ID NO: 45AAVhu.5312US20150315612 SEQ ID NO: 142AAVhu.51313US20150315612 SEQ ID NO: 208AAVhu.51314US20150315612 SEQ ID NO: 190AAVhu.52315US20150315612 SEQ ID NO: 210AAVhu.52316US20150315612 SEQ ID NO: 191AAVhu.53317US20150159173 SEQ ID NO: 19AAVhu.53318US20150159173 SEQ ID NO: 35AAVhu.53 (AAV145.1)319US20150315612 SEQ ID NO: 176AAVhu.54320US20150315612 SEQ ID NO: 188AAVhu.54 (AAV145.5)321US20150315612 SEQ ID No: 177AAVhu.55322US20150315612 SEQ ID NO: 187AAVhu.56323US20150315612 SEQ ID NO: 205AAVhu.56 (AAV145.6)324US20150315612 SEQ ID NO: 168AAVhu.56 (AAV145.6)325US20150315612 SEQ ID NO: 192AAVhu.57326US20150315612 SEQ ID NO: 206AAVhu.57327US20150315612 SEQ ID NO: 169AAVhu.57328US20150315612 SEQ ID NO: 193AAVhu.58329US20150315612 SEQ ID NO: 207AAVhu.58330US20150315612 SEQ ID NO: 194AAVhu.6 (AAV3.1)331US20150315612 SEQ ID NO: 5AAVhu.6 (AAV3.1)332US20150315612 SEQ ID NO: 84AAVhu.60333US20150315612 SEQ ID NO: 184AAVhu.60 (AAV161.10)334US20150315612 SEQ ID NO: 170AAVhu.61335US20150315612 SEQ ID NO: 185AAVhu.61 (AAV161.6)336US20150315612 SEQ ID NO: 174AAVhu.63337US20150315612 SEQ ID NO: 204AAVhu.63338US20150315612 SEQ ID NO: 195AAVhu.64339US20150315612 SEQ ID NO: 212AAVhu.64340US20150315612 SEQ ID NO: 196AAVhu.66341US20150315612 SEQ ID NO: 197AAVhu.67342US20150315612 SEQ ID NO: 215AAVhu.67343US20150315612 SEQ ID NO: 198AAVhu.7344US20150315612 SEQ ID NO: 226AAVhu.7345US20150315612 SEQ ID NO: 150AAVhu.7 (AAV7.3)346US20150315612 SEQ ID NO: 55AAVhu.71347US20150315612 SEQ ID NO: 79AAVhu.8348US20150315612 SEQ ID NO: 53AAVhu.8349US20150315612 SEQ ID NO: 12AAVhu.8350US20150315612 SEQ ID NO: 151AAVhu.9 (AAV3.1)351US20150315612 SEQ ID NO: 58AAVhu.9 (AAV3.1)352US20150315612 SEQ ID NO: 155AAV-LK01353US20150376607 SEQ ID NO: 2AAV-LK01354US20150376607 SEQ ID NO: 29AAV-LK02355US20150376607 SEQ ID NO: 3AAV-LK02356US20150376607 SEQ ID NO: 30AAV-LK03357US20150376607 SEQ ID NO: 4AAV-LK03358WO2015121501 SEQ ID NO: 12, US20150376607 SEQ ID NO: 31AAV-LK04359US20150376607 SEQ ID NO: 5AAV-LK04360US20150376607 SEQ ID NO: 32AAV-LK05361US20150376607 SEQ ID NO: 6AAV-LK05362US20150376607 SEQ ID NO: 33AAV-LK06363US20150376607 SEQ ID NO: 7AAV-LK06364US20150376607 SEQ ID NO: 34AAV-LK07365US20150376607 SEQ ID NO: 8AAV-LK07366US20150376607 SEQ ID NO: 35AAV-LK08367US20150376607 SEQ ID NO: 9AAV-LK08368US20150376607 SEQ ID NO: 36AAV-LK09369US20150376607 SEQ ID NO: 10AAV-LK09370US20150376607 SEQ ID NO: 37AAV-LK10371US20150376607 SEQ ID NO: 11AAV-LK10372US20150376607 SEQ ID NO: 38AAV-LK11373US20150376607 SEQ ID NO: 12AAV-LK11374US20150376607 SEQ ID NO: 39AAV-LK12375US20150376607 SEQ ID NO: 13AAV-LK12376US20150376607 SEQ ID NO: 40AAV-LK13377US20150376607 SEQ ID NO: 14AAV-LK13378US20150376607 SEQ ID NO: 41AAV-LK14379US20150376607 SEQ ID NO: 15AAV-LK14380US20150376607 SEQ ID NO: 42AAV-LK15381US20150376607 SEQ ID NO: 16AAV-LK15382US20150376607 SEQ ID NO: 43AAV-LK16383US20150376607 SEQ ID NO: 17AAV-LK16384US20150376607 SEQ ID NO: 44AAV-LK17385US20150376607 SEQ ID NO: 18AAV-LK17386US20150376607 SEQ ID NO: 45AAV-LK18387US20150376607 SEQ ID NO: 19AAV-LK18388US20150376607 SEQ ID NO: 46AAV-LK19389US20150376607 SEQ ID NO: 20AAV-LK19390US20150376607 SEQ ID NO: 47AAV-PAEC391US20150376607 SEQ ID NO: 1AAV-PAEC392US20150376607 SEQ ID NO: 48AAV-PAEC11393US20150376607 SEQ ID NO: 26AAV-PAEC11394US20150376607 SEQ ID NO: 54AAV-PAEC12395US20150376607 SEQ ID NO: 27AAV-PAEC12396US20150376607 SEQ ID NO: 51AAV-PAEC13397US20150376607 SEQ ID NO: 28AAV-PAEC13398US20150376607 SEQ ID NO: 49AAV-PAEC2399US20150376607 SEQ ID NO: 21AAV-PAEC2400US20150376607 SEQ ID NO: 56AAV-PAEC4401US20150376607 SEQ ID NO: 22AAV-PAEC4402US20150376607 SEQ ID NO: 55AAV-PAEC6403US20150376607 SEQ ID NO: 23AAV-PAEC6404US20150376607 SEQ ID NO: 52AAV-PAEC7405US20150376607 SEQ ID NO: 24AAV-PAEC7406US20150376607 SEQ ID NO: 53AAV-PAEC8407US20150376607 SEQ ID NO: 25AAV-PAEC8408US20150376607 SEQ ID NO: 50AAVpi.1409US20150315612 SEQ ID NO: 28AAVpi.1410US20150315612 SEQ ID NO: 93AAVpi.2411US20150315612 SEQ ID NO: 30AAVpi.2412US20150315612 SEQ ID NO: 95AAVpi.3413US20150315612 SEQ ID NO: 29AAVpi.3414US20150315612 SEQ ID NO: 94AAVrh.10415US20150159173 SEQ ID NO: 9AAVrh.10416US20150159173 SEQ ID NO: 25AAV44.2417US20030138772 SEQ ID NO: 59AAVrh.10 (AAV44.2)418US20030138772 SEQ ID NO: 81AAV42.1B419US20030138772 SEQ ID NO: 90AAVrh.12 (AAV42.1b)420US20030138772 SEQ ID NO: 30AAVrh.13421US20150159173 SEQ ID NO: 10AAVrh.13422US20150159173 SEQ ID NO: 26AAVrh.13423US20150315612 SEQ ID NO: 228AAVrh.13R424US20150159173AAV42.3A425US20030138772 SEQ ID NO: 87AAVrh.14 (AA V42.3a)426US20030138772 SEQ ID NO: 32AAV42.5A427US20030138772 SEQ ID NO: 89AAVrh.17 (AAV42.5a)428US20030138772 SEQ ID NO: 34AAV42.5B429US20030138772 SEQ ID NO: 91AAVrh.18 (AAV42.5b)430US20030138772 SEQ ID NO: 29AAV42.6B431US20030138772 SEQ ID NO: 112AAVrh.19 (AAV42.6b)432US20030138772 SEQ ID NO: 38AAVrh.2433US20150159173 SEQ ID NO: 39AAVrh.2434US20150315612 SEQ ID NO: 231AAVrh.20435US20150159173 SEQ ID NO: 1AAV42.10436US20030138772 SEQ ID NO: 106AAVrh.21 (AAV42.10)437US20030138772 SEQ ID NO: 35AAV42.11438US20030138772 SEQ ID NO: 108AAVrh.22 (AAV42.11)439US20030138772 SEQ ID NO: 37AAV42.12440US20030138772 SEQ ID NO: 113AAVrh.23 (AAV42.12)441US20030138772 SEQ ID NO: 58AAV42.13442US20030138772 SEQ ID NO: 86AAVrh.24 (AAV42.13)443US20030138772 SEQ ID NO: 31AAV42.15444US20030138772 SEQ ID NO: 84AAVrh.25 (AAV42.15)445US20030138772 SEQ ID NO: 28AAVrh.2R446US20150159173AAVrh.31 (AAV223.1)447US20030138772 SEQ ID NO: 48AAVC1448US20030138772 SEQ ID NO: 60AAVrh.32 (AAVC1)449US20030138772 SEQ ID NO: 19AAVrh.32 / 33450US20150159173 SEQ ID NO: 2AAVrh.33 (AAVC3)451US20030138772 SEQ ID NO: 20AAVC5452US20030138772 SEQ ID NO: 62AAVrh.34 (AAVC5)453US20030138772 SEQ ID NO: 21AAVF 1454US20030138772 SEQ ID NO: 109AAVrh.35 (AAVF1)455US20030138772 SEQ ID NO: 22AAVF3456US20030138772 SEQ ID NO: 111AAVrh.36 (AAVF3)457US20030138772 SEQ ID NO: 23AAVrh.37458US20030138772 SEQ ID NO: 24AAVrh.37459US20150159173 SEQ ID NO: 40AAVrh.37460US20150315612 SEQ ID NO: 229AAVrh.37R2461US20150159173AAVrh.38 (AAVLG-4)462US20150315612 SEQ ID NO: 7AAVrh.38 (AAVLG-4)463US20150315612 SEQ ID NO: 86AAVrh.39464US20150159173 SEQ ID NO: 20, US20150315612 SEQ ID NO: 13AAVrh.39465US20150159173 SEQ ID NO: 3, US20150159173 SEQ ID NO: 36, US20150315612 SEQ ID NO: 89AAVrh.40466US20150315612 SEQ ID NO: 92AAVrh.40 (AAVLG-10)467US20150315612 SEQ ID No: 14AAVrh.43 (AAVN721-8)468US20150315612 SEQ ID NO: 43, US20150159173 SEQ ID NO: 21AAVrh.43 (AAVN721-8)469US20150315612 SEQ ID NO: 163, US20150159173 SEQ ID NO: 37AAVrh.44470US20150315612 SEQ ID NO: 34AAVrh.44471US20150315612 SEQ ID NO: 111AAVrh.45472US20150315612 SEQ ID NO: 41AAVrh.45473US20150315612 SEQ ID NO: 109AAVrh.46474US20150159173 SEQ ID NO: 22, US20150315612 SEQ ID NO: 19AAVrh.46475US20150159173 SEQ ID NO: 4, US20150315612 SEQ ID NO: 101AAVrh.47476US20150315612 SEQ ID NO: 38AAVrh.47477US20150315612 SEQ ID NO: 118AAVrh.48478US20150159173 SEQ ID NO: 44, US20150315612 SEQ ID NO: 115AAVrh.48.1479US20150159173AAVrh.48.1.2480US20150159173AAVrh.48.2481US20150159173AAVrh.48 (AAV1-7)482US20150315612 SEQ ID NO: 32AAVrh.49 (AAV1-8)483US20150315612 SEQ ID NO: 25AAVrh.49 (AAV1-8)484US20150315612 SEQ ID NO: 103AAVrh.50 (AAV2-4)485US20150315612 SEQ ID NO: 23AAVrh.50 (AAV2-4)486US20150315612 SEQ ID NO: 108AAVrh.51 (AAV2-5)487US20150315612 SEQ ID No: 22AAVrh.51 (AAV2-5)488US20150315612 SEQ ID NO: 104AAVrh.52 (AAV3-9)489US20150315612 SEQ ID NO: 18AAVrh.52 (AAV3-9)490US20150315612 SEQ ID NO: 96AAVrh.53491US20150315612 SEQ ID NO: 97AAVrh.53 (AAV3-11)492US20150315612 SEQ ID NO: 17AAVrh.53 (AAV3-11)493US20150315612 SEQ ID NO: 186AAVrh.54494US20150315612 SEQ ID NO: 40AAVrh.54495US20150159173 SEQ ID NO: 49, US20150315612 SEQ ID NO: 116AAVrh.55496US20150315612 SEQ ID NO: 37AAVrh.55 (AAV4-19)497US20150315612 SEQ ID NO: 117AAVrh.56498US20150315612 SEQ ID NO: 54AAVrh.56499US20150315612 SEQ ID NO: 152AAVrh.57500US20150315612 SEQ ID NO: 26AAVrh.57501US20150315612 SEQ ID NO: 105AAVrh.58502US20150315612 SEQ ID NO: 27AAVrh.58503US20150159173 SEQ ID NO: 48, US20150315612 SEQ ID NO: 106AAVrh.58504US20150315612 SEQ ID NO: 232AAVrh.59505US20150315612 SEQ ID NO: 42AAVrh.59506US20150315612 SEQ ID NO: 110AAVrh.60507US20150315612 SEQ ID NO: 31AAVrh.60508US20150315612 SEQ ID NO: 120AAVrh.61509US20150315612 SEQ ID NO: 107AAVrh.61 (AAV2-3)510US20150315612 SEQ ID NO: 21AAVrh.62 (AAV2-15)511US20150315612 SEQ ID No: 33AAVrh.62 (AAV2-15)512US20150315612 SEQ ID NO: 114AAVrh.64513US20150315612 SEQ ID No: 15AAVrh.64514US20150159173 SEQ ID NO: 43, US20150315612 SEQ ID NO: 99AAVrh.64515US20150315612 SEQ ID NO: 233AAVRh.64R1516US20150159173AAVRh.64R2517US20150159173AAVrh.65518US20150315612 SEQ ID NO: 35AAVrh.65519US20150315612 SEQ ID NO: 112AAVrh.67520US20150315612 SEQ ID NO: 36AAVrh.67521US20150315612 SEQ ID NO: 230AAVrh.67522US20150159173 SEQ ID NO: 47, US20150315612 SEQ ID NO: 113AAVrh.68523US20150315612 SEQ ID NO: 16AAVrh.68524US20150315612 SEQ ID NO: 100AAVrh.69525US20150315612 SEQ ID NO: 39AAVrh.69526US20150315612 SEQ ID NO: 119AAVrh.70527US20150315612 SEQ ID NO: 20AAVrh.70528US20150315612 SEQ ID NO: 98AAVrh.71529US20150315612 SEQ ID NO: 162AAVrh.72530US20150315612 SEQ ID NO: 9AAVrh.73531US20150159173 SEQ ID NO: 5AAVrh.74532US20150159173 SEQ ID NO: 6AAVrh.8533US20150159173 SEQ ID NO: 41AAVrh.8534US20150315612 SEQ ID NO: 235AAVrh.8R535US20150159173, WO2015168666 SEQ ID NO: 9AAVrh.8R A586R mutant536WO2015168666 SEQ ID NO: 10AAVrh.8R R533A mutant537WO2015168666 SEQ ID NO: 11BAAV (bovine AAV)538US9193769 SEQ ID NO: 8BAAV (bovine AAV)539US9193769 SEQ ID NO: 10BAAV (bovine AAV)540US9193769 SEQ ID NO: 4BAAV (bovine AAV)541US9193769 SEQ ID NO: 2BAAV (bovine AAV)542US9193769 SEQ ID NO: 6BAAV (bovine AAV)543US9193769 SEQ ID NO: 1BAAV (bovine AAV)544US9193769 SEQ ID NO: 5BAAV (bovine AAV)545US9193769 SEQ ID NO: 3BAAV (bovine AAV)546US9193769 SEQ ID NO: 11BAAV (bovine AAV)547US7427396 SEQ ID NO: 5BAAV (bovine AAV)548US7427396 SEQ ID NO: 6BAAV (bovine AAV)549US9193769 SEQ ID NO: 7BAAV (bovine AAV)550US9193769 SEQ ID NO: 9BNP61 AAV551US20150238550 SEQ ID NO: 1BNP61 AAV552US20150238550 SEQ ID NO: 2BNP62 AAV553US20150238550 SEQ ID NO: 3BNP63 AAV554US20150238550 SEQ ID NO: 4caprine AAV555US7427396 SEQ ID NO: 3caprine AAV556US7427396 SEQ ID NO: 4true type AAV (ttAAV)557WO2015121501 SEQ ID NO: 2AAAV (Avian AAV)558US9238800 SEQ ID NO: 12AAAV (Avian AAV)559US9238800 SEQ ID NO: 2AAAV (Avian AAV)560US9238800 SEQ ID NO: 6AAAV (Avian AAV)561US9238800 SEQ ID NO: 4AAAV (Avian AAV)562US9238800 SEQ ID NO: 8AAAV (Avian AAV)563US9238800 SEQ ID NO: 14AAAV (Avian AAV)564US9238800 SEQ ID NO: 10AAAV (Avian AAV)565US9238800 SEQ ID NO: 15AAAV (Avian AAV)566US9238800 SEQ ID NO: 5AAAV (Avian AAV)567US9238800 SEQ ID NO: 9AAAV (Avian AAV)568US9238800 SEQ ID NO: 3AAAV (Avian AAV)569US9238800 SEQ ID NO: 7AAAV (Avian AAV)570US9238800 SEQ ID NO: 11AAAV (Avian AAV)571US9238800 SEQ ID NO: 13AAAV (Avian AAV)572US9238800 SEQ ID NO: 1AAV Shuffle 100-1573US20160017295 SEQ ID NO: 23AAV Shuffle 100-1574US20160017295 SEQ ID NO: 11AAV Shuffle 100-2575US20160017295 SEQ ID NO: 37AAV Shuffle 100-2576US20160017295 SEQ ID NO: 29AAV Shuffle 100-3577US20160017295 SEQ ID NO: 24AAV Shuffle 100-3578US20160017295 SEQ ID NO: 12AAV Shuffle 100-7579US20160017295 SEQ ID NO: 25AAV Shuffle 100-7580US20160017295 SEQ ID NO: 13AAV Shuffle 10-2581US20160017295 SEQ ID NO: 34AAV Shuffle 10-2582US20160017295 SEQ ID NO: 26AAV Shuffle 10-6583US20160017295 SEQ ID NO: 35AAV Shuffle 10-6584US20160017295 SEQ ID NO: 27AAV Shuffle 10-8585US20160017295 SEQ ID NO: 36AAV Shuffle 10-8586US20160017295 SEQ ID NO: 28AAV SM 100-10587US20160017295 SEQ ID NO: 41AAV SM 100-10588US20160017295 SEQ ID NO: 33AAV SM 100-3589US20160017295 SEQ ID NO: 40AAV SM 100-3590US20160017295 SEQ ID NO: 32AAV SM 10-1591US20160017295 SEQ ID NO: 38AAV SM 10-1592US20160017295 SEQ ID NO: 30AAV SM 10-2593US20160017295 SEQ ID NO: 10AAV SM 10-2594US20160017295 SEQ ID NO: 22AAV SM 10-8595US20160017295 SEQ ID NO: 39AAV SM 10-8596US20160017295 SEQ ID NO: 31AAV SM 100-10587US20160017295 SEQ ID NO: 41AAV SM 100-10588US20160017295 SEQ ID NO: 33AAV SM 100-3589US20160017295 SEQ ID NO: 40AAV SM 100-3590US20160017295 SEQ ID NO: 32AAV SM 10-1591US20160017295 SEQ ID NO: 38AAV SM 10-1592US20160017295 SEQ ID NO: 30AAV SM 10-2593US20160017295 SEQ ID NO: 10AAV SM 10-2594US20160017295 SEQ ID NO: 22AAV SM 10-8595US20160017295 SEQ ID NO: 39AAV SM 10-8596US20160017295 SEQ ID NO: 31AAVF1 / HSC1597WO2016049230 SEQ ID NO: 20AAVF2 / HSC2598WO2016049230 SEQ ID NO: 21AAVF3 / HSC3599WO2016049230 SEQ ID NO: 22AAVF4 / HSC4600WO2016049230 SEQ ID NO: 23AAVF5 / HSC5601WO2016049230 SEQ ID NO: 25AAVF6 / HSC6602WO2016049230 SEQ ID NO: 24AAVF7 / HSC7603WO2016049230 SEQ ID NO: 27AAVF8 / HSC8604WO2016049230 SEQ ID NO: 28AAVF9 / HSC9605WO2016049230 SEQ ID NO: 29AAVF11 / HSC11606WO2016049230 SEQ ID NO: 26AAVF12 / HSC12607WO2016049230 SEQ ID NO: 30AAVF13 / HSC13608WO2016049230 SEQ ID NO: 31AAVF14 / HSC14609WO2016049230 SEQ ID NO: 32AAVF15 / HSC15610WO2016049230 SEQ ID NO: 33AAVF16 / HSC16611WO2016049230 SEQ ID NO: 34AAVF17 / HSC17612WO2016049230 SEQ ID NO: 35AAVF1 / HSC1613WO2016049230 SEQ ID NO: 2AAVF2 / HSC2614WO2016049230 SEQ ID NO: 3AAVF3 / HSC3615WO2016049230 SEQ ID NO: 5AAVF4 / HSC4616WO2016049230 SEQ ID NO: 6AAVF5 / HSC5617WO2016049230 SEQ ID NO: 11AAVF6 / HSC6618WO2016049230 SEQ ID NO: 7AAVF7 / HSC7619WO2016049230 SEQ ID NO: 8AAVF8 / HSC8620WO2016049230 SEQ ID NO: 9AAVF9 / HSC9621WO2016049230 SEQ ID NO: 10AAVF11 / HSC11622WO2016049230 SEQ ID NO: 4AAVF12 / HSC12623WO2016049230 SEQ ID NO: 12AAVF13 / HSC13624WO2016049230 SEQ ID NO: 14AAVF14 / HSC14625WO2016049230 SEQ ID NO: 15AAVF15 / HSC15626WO2016049230 SEQ ID NO: 16AAVF16 / HSC16627WO2016049230 SEQ ID NO: 17AAVF17 / HSC17628WO2016049230 SEQ ID NO: 13AAV CBr-E1629US8734809 SEQ ID NO: 13AAV CBr-E2630US8734809 SEQ ID NO: 14AAV CBr-E3631US8734809 SEQ ID NO: 15AAV CBr-E4632US8734809 SEQ ID NO: 16AAV CBr-E5633US8734809 SEQ ID NO: 17AAV CBr-e5634US8734809 SEQ ID NO: 18AAV CBr-E6635US8734809 SEQ ID NO: 19AAV CBr-E7636US8734809 SEQ ID NO: 20AAV CBr-E8637US8734809 SEQ ID NO: 21AAV CLv-D1638US8734809 SEQ ID NO: 22AAV CLv-D2639US8734809 SEQ ID NO: 23AAV CLv-D3640US8734809 SEQ ID NO: 24AAV CLv-D4641US8734809 SEQ ID NO: 25AAV CLv-D5642US8734809 SEQ ID NO: 26AAV CLv-D6643US8734809 SEQ ID NO: 27AAV CLv-D7644US8734809 SEQ ID NO: 28AAV CLv-D8645US8734809 SEQ ID NO: 29AAV CLv-E1646US8734809 SEQ ID NO: 13AAV CLv-R1647US8734809 SEQ ID NO: 30AAV CLv-R2648US8734809 SEQ ID NO: 31AAV CLv-R3649US8734809 SEQ ID NO: 32AAV CLv-R4650US8734809 SEQ ID NO: 33AAV CLv-R5651US8734809 SEQ ID NO: 34AAV CLv-R6652US8734809 SEQ ID NO: 35AAV CLv-R7653US8734809 SEQ ID NO: 36AAV CLv-R8654US8734809 SEQ ID NO: 37AAV CLv-R9655US8734809 SEQ ID NO: 38AAV CLg-F1656US8734809 SEQ ID NO: 39AAV CLg-F2657US8734809 SEQ ID NO: 40AAV CLg-F3658US8734809 SEQ ID NO: 41AAV CLg-F4659US8734809 SEQ ID NO: 42AAV CLg-F5660US8734809 SEQ ID NO: 43AAV CLg-F6661US8734809 SEQ ID NO: 43AAV CLg-F7662US8734809 SEQ ID NO: 44AAV CLg-F8663US8734809 SEQ ID NO: 43AAV CSp-1664US8734809 SEQ ID NO: 45AAV CSp-10665US8734809 SEQ ID NO: 46AAV CSp-11666US8734809 SEQ ID NO: 47AAV CSp-2667US8734809 SEQ ID NO: 48AAV CSp-3668US8734809 SEQ ID NO: 49AAV CSp-4669US8734809 SEQ ID NO: 50AAV CSp-6670US8734809 SEQ ID NO: 51AAV CSp-7671US8734809 SEQ ID NO: 52AAV CSp-8672US8734809 SEQ ID NO: 53AAV CSp-9673US8734809 SEQ ID NO: 54AAV CHt-2674US8734809 SEQ ID NO: 55AAV CHt-3675US8734809 SEQ ID NO: 56AAV CKd-1676US8734809 SEQ ID NO: 57AAV CKd-10677US8734809 SEQ ID NO: 58AAV CKd-2678US8734809 SEQ ID NO: 59AAV CKd-3679US8734809 SEQ ID NO: 60AAV CKd-4680US8734809 SEQ ID NO: 61AAV CKd-6681US8734809 SEQ ID NO: 62AAV CKd-7682US8734809 SEQ ID NO: 63AAV CKd-8683US8734809 SEQ ID NO: 64AAV CLv-1684US8734809 SEQ ID NO: 65AAV CLv-12685US8734809 SEQ ID NO: 66AAV CLv-13686US8734809 SEQ ID NO: 67AAV CLv-2687US8734809 SEQ ID NO: 68AAV CLv-3688US8734809 SEQ ID NO: 69AAV CLv-4689US8734809 SEQ ID NO: 70AAV CLv-6690US8734809 SEQ ID NO: 71AAV CLv-8691US8734809 SEQ ID NO: 72AAV CKd-B1692US8734809 SEQ ID NO: 73AAV CKd-B2693US8734809 SEQ ID NO: 74AAV CKd-B3694US8734809 SEQ ID NO: 75AAV CKd-B4695US8734809 SEQ ID NO: 76AAV CKd-B5696US8734809 SEQ ID NO: 77AAV CKd-B6697US8734809 SEQ ID NO: 78AAV CKd-B7698US8734809 SEQ ID NO: 79AAV CKd-B8699US8734809 SEQ ID NO: 80AAV CKd-H1700US8734809 SEQ ID NO: 81AAV CKd-H2701US8734809 SEQ ID NO: 82AAV CKd-H3702US8734809 SEQ ID NO: 83AAV CKd-H4703US8734809 SEQ ID NO: 84AAV CKd-H5704US8734809 SEQ ID NO: 85AAV CKd-H6705US8734809 SEQ ID NO: 77AAV CHt-1706US8734809 SEQ ID NO: 86AAV CLv1-1707US8734809 SEQ ID NO: 171AAV CLv1-2708US8734809 SEQ ID NO: 172AAV CLv1-3709US8734809 SEQ ID NO: 173AAV CLv1-4710US8734809 SEQ ID NO: 174AAV Clv1-7711US8734809 SEQ ID NO: 175AAV Clv1-8712US8734809 SEQ ID NO: 176AAV Clv1-9713US8734809 SEQ ID NO: 177AAV Clv1-10714US8734809 SEQ ID NO: 178AAV.VR-355715US8734809 SEQ ID NO: 181AAV.hu.48R3716US8734809 SEQ ID NO: 183AAV CBr-E1717US8734809 SEQ ID NO: 87AAV CBr-E2718US8734809 SEQ ID NO: 88AAV CBr-E3719US8734809 SEQ ID NO: 89AAV CBr-E4720US8734809 SEQ ID NO: 90AAV CBr-E5721US8734809 SEQ ID NO: 91AAV CBr-e5722US8734809 SEQ ID NO: 92AAV CBr-E6723US8734809 SEQ ID NO: 93AAV CBr-E7724US8734809 SEQ ID NO: 94AAV CBr-E8725US8734809 SEQ ID NO: 95AAV CLv-D1726US8734809 SEQ ID NO: 96AAV CLv-D2727US8734809 SEQ ID NO: 97AAV CLv-D3728US8734809 SEQ ID NO: 98AAV CLv-D4729US8734809 SEQ ID NO: 99AAV CLv-D5730US8734809 SEQ ID NO: 100AAV CLv-D6731US8734809 SEQ ID NO: 101AAV CLv-D7732US8734809 SEQ ID NO: 102AAV CLv-D8733US8734809 SEQ ID NO: 103AAV CLv-E1734US8734809 SEQ ID NO: 87AAV CLv-R1735US8734809 SEQ ID NO: 104AAV CLv-R2736US8734809 SEQ ID NO: 105AAV CLv-R3737US8734809 SEQ ID NO: 106AAV CLv-R4738US8734809 SEQ ID NO: 107AAV CLv-R5739US8734809 SEQ ID NO: 108AAV CLv-R6740US8734809 SEQ ID NO: 109AAV CLv-R7741US8734809 SEQ ID NO: 110AAV CLv-R8742US8734809 SEQ ID NO: 111AAV CLv-R9743US8734809 SEQ ID NO: 112AAV CLg-F1744US8734809 SEQ ID NO: 113AAV CLg-F2745US8734809 SEQ ID NO: 114AAV CLg-F3746US8734809 SEQ ID NO: 115AAV CLg-F4747US8734809 SEQ ID NO: 116AAV CLg-F5748US8734809 SEQ ID NO: 117AAV CLg-F6749US8734809 SEQ ID NO: 117AAV CLg-F7750US8734809 SEQ ID NO: 118AAV CLg-F8751US8734809 SEQ ID NO: 117AAV CSp-1752US8734809 SEQ ID NO: 119AAV CSp-10753US8734809 SEQ ID NO: 120AAV CSp-11754US8734809 SEQ ID NO: 121AAV CSp-2755US8734809 SEQ ID NO: 122AAV CSp-3756US8734809 SEQ ID NO: 123AAV CSp-4757US8734809 SEQ ID NO: 124AAV CSp-6758US8734809 SEQ ID NO: 125AAV CSp-7759US8734809 SEQ ID NO: 126AAV CSp-8760US8734809 SEQ ID NO: 127AAV CSp-9761US8734809 SEQ ID NO: 128AAV CHt-2762US8734809 SEQ ID NO: 129AAV CHt-3763US8734809 SEQ ID NO: 130AAV CKd-1764US8734809 SEQ ID NO: 131AAV CKd-10765US8734809 SEQ ID NO: 132AAV CKd-2766US8734809 SEQ ID NO: 133AAV CKd-3767US8734809 SEQ ID NO: 134AAV CKd-4768US8734809 SEQ ID NO: 135AAV CKd-6769US8734809 SEQ ID NO: 136AAV CKd-7770US8734809 SEQ ID NO: 137AAV CKd-8771US8734809 SEQ ID NO: 138AAV CLv-1772US8734809 SEQ ID NO: 139AAV CLv-12773US8734809 SEQ ID NO: 140AAV CLv-13774US8734809 SEQ ID NO: 141AAV CLv-2775US8734809 SEQ ID NO: 142AAV CLv-3776US8734809 SEQ ID NO: 143AAV CLv-4777US8734809 SEQ ID NO: 144AAV CLv-6778US8734809 SEQ ID NO: 145AAV CLv-8779US8734809 SEQ ID NO: 146AAV CKd-B1780US8734809 SEQ ID NO: 147AAV CKd-B2781US8734809 SEQ ID NO: 148AAV CKd-B3782US8734809 SEQ ID NO: 149AAV CKd-B4783US8734809 SEQ ID NO: 150AAV CKd-B5784US8734809 SEQ ID NO: 151AAV CKd-B6785US8734809 SEQ ID NO: 152AAV CKd-B7786US8734809 SEQ ID NO: 153AAV CKd-B8787US8734809 SEQ ID NO: 154AAV CKd-H1788US8734809 SEQ ID NO: 155AAV CKd-H2789US8734809 SEQ ID NO: 156AAV CKd-H3790US8734809 SEQ ID NO: 157AAV CKd-H4791US8734809 SEQ ID NO: 158AAV CKd-H5792US8734809 SEQ ID NO: 159AAV CKd-H6793US8734809 SEQ ID NO: 151AAV CHt-1794US8734809 SEQ ID NO: 160AAV CHt-P2795WO2016065001 SEQ ID NO: 1AAV CHt-P5796WO2016065001 SEQ ID NO: 2AAV CHt-P9797WO2016065001 SEQ ID NO: 3AAV CBr-7.1798WO2016065001 SEQ ID NO: 4AAV CBr-7.2799WO2016065001 SEQ ID NO: 5AAV CBr-7.3800WO2016065001 SEQ ID NO: 6AAV CBr-7.4801WO2016065001 SEQ ID NO: 7AAV CBr-7.5802WO2016065001 SEQ ID NO: 8AAV CBr-7.7803WO2016065001 SEQ ID NO: 9AAV CBr-7.8804WO2016065001 SEQ ID NO: 10AAV CBr-7.10805WO2016065001 SEQ ID NO: 11AAV CKd-N3806WO2016065001 SEQ ID NO: 12AAV CKd-N4807WO2016065001 SEQ ID NO: 13AAV CKd-N9808WO2016065001 SEQ ID NO: 14AAV CLv-L4809WO2016065001 SEQ ID NO: 15AAV CLv-L5810WO2016065001 SEQ ID NO: 16AAV CLv-L6811WO2016065001 SEQ ID NO: 17AAV CLv-K1812WO2016065001 SEQ ID NO: 18AAV CLv-K3813WO2016065001 SEQ ID NO: 19AAV CLv-K6814WO2016065001 SEQ ID NO: 20AAV CLv-M1815WO2016065001 SEQ ID NO: 21AAV CLv-M11816WO2016065001 SEQ ID NO: 22AAV CLv-M2817WO2016065001 SEQ ID NO: 23AAV CLv-M5818WO2016065001 SEQ ID NO: 24AAV CLv-M6819WO2016065001 SEQ ID NO: 25AAV CLv-M7820WO2016065001 SEQ ID NO: 26AAV CLv-M8821WO2016065001 SEQ ID NO: 27AAV CLv-M9822WO2016065001 SEQ ID NO: 28AAV CHt-P1823WO2016065001 SEQ ID NO: 29AAV CHt-P6824WO2016065001 SEQ ID NO: 30AAV CHt-P8825WO2016065001 SEQ ID NO: 31AAV CHt-6.1826WO2016065001 SEQ ID NO: 32AAV CHt-6.10827WO2016065001 SEQ ID NO: 33AAV CHt-6.5828WO2016065001 SEQ ID NO: 34AAV CHt-6.6829WO2016065001 SEQ ID NO: 35AAV CHt-6.7830WO2016065001 SEQ ID NO: 36AAV CHt-6.8831WO2016065001 SEQ ID NO: 37AAV CSp-8.10832WO2016065001 SEQ ID NO: 38AAV CSp-8.2833WO2016065001 SEQ ID NO: 39AAV CSp-8.4834WO2016065001 SEQ ID NO: 40AAV CSp-8.5835WO2016065001 SEQ ID NO: 41AAV CSp-8.6836WO2016065001 SEQ ID NO: 42AAV CSp-8.7837WO2016065001 SEQ ID NO: 43AAV CSp-8.8838WO2016065001 SEQ ID NO: 44AAV CSp-8.9839WO2016065001 SEQ ID NO: 45AAV CBr-B7.3840WO2016065001 SEQ ID NO: 46AAV CBr-B7.4841WO2016065001 SEQ ID NO: 47AAV3B842WO2016065001 SEQ ID NO: 48AAV4843WO2016065001 SEQ ID NO: 49AAV5844WO2016065001 SEQ ID NO: 50AAV CHt-P2845WO2016065001 SEQ ID NO: 51AAV CHt-P5846WO2016065001 SEQ ID NO: 52AAV CHt-P9847WO2016065001 SEQ ID NO: 53AAV CBr-7.1848WO2016065001 SEQ ID NO: 54AAV CBr-7.2849WO2016065001 SEQ ID NO: 55AAV CBr-7.3850WO2016065001 SEQ ID NO: 56AAV CBr-7.4851WO2016065001 SEQ ID NO: 57AAV CBr-7.5852WO2016065001 SEQ ID NO: 58AAV CBr-7.7853WO2016065001 SEQ ID NO: 59AAV CBr-7.8854WO2016065001 SEQ ID NO: 60AAV CBr-7.10855WO2016065001 SEQ ID NO: 61AAV CKd-N3856WO2016065001 SEQ ID NO: 62AAV CKd-N4857WO2016065001 SEQ ID NO: 63AAV CKd-N9858WO2016065001 SEQ ID NO: 64AAV CLv-L4859WO2016065001 SEQ ID NO: 65AAV CLv-L5860WO2016065001 SEQ ID NO: 66AAV CLv-L6861WO2016065001 SEQ ID NO: 67AAV CLv-K1862WO2016065001 SEQ ID NO: 68AAV CLv-K3863WO2016065001 SEQ ID NO: 69AAV CLv-K6864WO2016065001 SEQ ID NO: 70AAV CLv-M1865WO2016065001 SEQ ID NO: 71AAV CLv-M11866WO2016065001 SEQ ID NO: 72AAV CLv-M2867WO2016065001 SEQ ID NO: 73AAV CLv-M5868WO2016065001 SEQ ID NO: 74AAV CLv-M6869WO2016065001 SEQ ID NO: 75AAV CLv-M7870WO2016065001 SEQ ID NO: 76AAV CLv-M8871WO2016065001 SEQ ID NO: 77AAV CLv-M9872WO2016065001 SEQ ID NO: 78AAV CHt-P1873WO2016065001 SEQ ID NO: 79AAV CHt-P6874WO2016065001 SEQ ID NO: 80AAV CHt-P8875WO2016065001 SEQ ID NO: 81AAV CHt-6.1876WO2016065001 SEQ ID NO: 82AAV CHt-6.10877WO2016065001 SEQ ID NO: 83AAV CHt-6.5878WO2016065001 SEQ ID NO: 84AAV CHt-6.6879WO2016065001 SEQ ID NO: 85AAV CHt-6.7880WO2016065001 SEQ ID NO: 86AAV CHt-6.8881WO2016065001 SEQ ID NO: 87AAV CSp-8.10882WO2016065001 SEQ ID NO: 88AAV CSp-8.2883WO2016065001 SEQ ID NO: 89AAV CSp-8.4884WO2016065001 SEQ ID NO: 90AAV CSp-8.5885WO2016065001 SEQ ID NO: 91AAV CSp-8.6886WO2016065001 SEQ ID NO: 92AAV CSp-8.7887WO2016065001 SEQ ID NO: 93AAV CSp-8.8888WO2016065001 SEQ ID NO: 94AAV CSp-8.9889WO2016065001 SEQ ID NO: 95AAV CBr-B7.3890WO2016065001 SEQ ID NO: 96AAV CBr-B7.4891WO2016065001 SEQ ID NO: 97AAV3B892WO2016065001 SEQ ID NO: 98AAV4893WO2016065001 SEQ ID NO: 99AAV5894WO2016065001 SEQ ID NO: 100AAVPHP.B or G2B-26895WO2015038958 SEQ ID NO: 8 and 13; GenBankALU85156.1AAVPHP.B896WO2015038958 SEQ ID NO: 9AAVG2B-13897WO2015038958 SEQ ID NO: 12AAVTH1.1-32898WO2015038958 SEQ ID NO: 14AAVTH1.1-35899WO2015038958 SEQ ID NO: 15

[0166] In one embodiment, the AAV serotype may be, or may have a sequence as described in International Patent Publication WO2015038958, such as, but not limited to, AAV9 (SEQ ID NO: 2 and 11 of WO2015038958 or SEQ ID NO: 153 and 154 respectively herein), PHP.B (SEQ ID NO: 8 and 9 of WO2015038958, herein SEQ ID NO: 895 and 896), G2B-13 (SEQ ID NO: 12 of WO2015038958, herein SEQ ID NO: 897), G2B-26 (SEQ ID NO: 13 of WO2015038958, herein SEQ ID NO: 895 and 896), TH1.1-32 (SEQ ID NO: 14 of WO2015038958, herein SEQ ID NO: 898), TH1.1-35 (SEQ ID NO: 15 of WO2015038958, herein SEQ ID NO: 899) or variants thereof. Further, any of the targeting peptides or amino acid inserts described in WO2015038958, may be inserted into any parent AAV serotype, such as, but not limited to, AAV9 (SEQ ID NO: 153 for the DNA sequence and SEQ ID NO: 154 for the amino acid sequence). In one embodiment, the amino acid insert is inserted between amino acids 586-592 of the parent AAV (e.g., AAV9). In another embodiment, the amino acid insert is inserted between amino acids 588-589 of the parent AAV sequence. The amino acid insert may be, but is not limited to, any of the following amino acid sequences, TLAVPFK (SEQ ID NO: 1 of WO2015038958; herein SEQ ID NO: 900), KFPVALT (SEQ ID NO: 3 of WO2015038958; herein SEQ ID NO: 901), LAVPFK (SEQ ID NO: 31 of WO2015038958; herein SEQ ID NO: 902), AVPFK (SEQ ID NO: 32 of WO2015038958; herein SEQ ID NO: 903), VPFK (SEQ ID NO: 33 of WO2015038958; herein SEQ ID NO: 904), TLAVPF (SEQ ID NO: 34 of WO2015038958; herein SEQ ID NO: 905), TLAVP (SEQ ID NO: 35 of WO2015038958; herein SEQ ID NO: 906), TLAV (SEQ ID NO: 36 of WO2015038958; herein SEQ ID NO: 907), SVSKPFL (SEQ ID NO: 28 of WO2015038958; herein SEQ ID NO: 908), FTLTTPK (SEQ ID NO: 29 of WO2015038958; herein SEQ ID NO: 909), MNATKNV (SEQ ID NO: 30 of WO2015038958; herein SEQ ID NO: 910), QSSQTPR (SEQ ID NO: 54 of WO2015038958; herein SEQ ID NO: 911), ILGTGTS (SEQ ID NO: 55 of WO2015038958; herein SEQ ID NO: 912), TRTNPEA (SEQ ID NO: 56 of WO2015038958; herein SEQ ID NO: 913), NGGTSSS (SEQ ID NO: 58 of WO2015038958; herein SEQ ID NO: 914), or YTLSQGW (SEQ ID NO: 60 of WO2015038958; herein SEQ ID NO: 915). Non-limiting examples of nucleotide sequences that may encode the amino acid inserts include the following, AAGTTTCCTGTGGCGTTGACT (for SEQ ID NO: 3 of WO2015038958; herein SEQ ID NO: 916), ACTTTGGCGGTGCCTTTTAAG (SEQ ID NO: 24 and 49 of WO2015038958; herein SEQ ID NO: 917), AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 25 of WO2015038958; herein SEQ ID NO: 918), TTTACGTTGACGACGCCTAAG (SEQ ID NO: 26 of WO2015038958; herein SEQ ID NO: 919), ATGAATGCTACGAAGAATGTG (SEQ ID NO: 27 of WO2015038958; herein SEQ ID NO: 920), CAGTCGTCGCAGACGCCTAGG (SEQ ID NO: 48 of WO2015038958; herein SEQ ID NO: 921), ATTCTGGGGACTGGTACTTCG (SEQ ID NO: 50 and 52 of WO2015038958; herein SEQ ID NO: 922), ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51 of WO2015038958; herein SEQ ID NO: 923), AATGGGGGGACTAGTAGTTCT (SEQ ID NO: 53 of WO2015038958; herein SEQ ID NO: 924), or TATACTTTGTCGCAGGGTTGG (SEQ ID NO: 59 of WO2015038958; herein SEQ ID NO: 925).

[0167] In one embodiment, the AAV serotype may be engineered to comprise at least one AAV capsid CD8+ T-cell epitope. Hui et al. (Molecular Therapy - Methods & Clinical Development (2015) 2, 15029 doi: 10.1038 / mtm.2015.29) identified AAV capsid-specific CD8+ T-cell epitopes for AAV1 and AAV2 (see e.g., Table 2 in the publication). As a non-limiting example, the capsid-specific CD8+ T-cell epitope may be for an AAV2 serotype. As a non-limiting example, the capsid-specific CD8+ T-cell epitope may be for an AAV1 serotype.

[0168] In one embodiment, the AAV serotype may be engineered to comprise at least one AAV capsid CD8+ T-cell epitope for AAV2 such as, but not limited to, SADNNNSEY (SEQ ID NO: 926), LIDQYLYYL (SEQ ID NO: 927), VPQYGYLTL (SEQ ID NO: 928), TTSTRTWAL (SEQ ID NO: 929), YHLNGRDSL (SEQ ID NO: 930), SQAVGRSSF (SEQ ID NO: 931), VPANPSTTF (SEQ ID NO: 932), FPQSGVLIF (SEQ ID NO: 933), YFDFNRFHCHFSPRD (SEQ ID NO: 934), VGNSSGNWHCDSTWM (SEQ ID NO: 935), QFSQAGASDIRDQSR (SEQ ID NO: 936), GASDIRQSRNWLP (SEQ ID NO: 937) and GNRQAATADVNTQGV (SEQ ID NO: 938).

[0169] In one embodiment, the AAV serotype may be engineered to comprise at least one AAV capsid CD8+ T-cell epitope for AAV1 such as, but not limited to, LDRLMNPLI (SEQ ID NO: 939), TTSTRTWAL (SEQ ID NO: 929), and QPAKKRLNF (SEQ ID NO: 940)).

[0170] In one embodiment, peptides for inclusion in an AAV serotype may be identified using the methods described by Hui et al. (Molecular Therapy - Methods & Clinical Development (2015) 2, 15029 doi:10.1038 / mtm.2015.29). As a non-limiting example, the procedure includes isolating human splenocytes, restimulating the splenocytes in vitro using individual peptides spanning the amino acid sequence of the AAV capsid protein, IFN-gamma ELISpot with the individual peptides used for the in vitro restimulation, bioinformatics analysis to determine the HLA restriction of 15-mers identified by IFN-gamma ELISpot, idenification of candidate reactive 9-mer epitopes for a given HLA allele, synthesis candidate 9-mers, second IFN-gamma ELISpot screening of splenocytes from subjects carrying the HLA alleles to which identified AAV epitopes are predicted to bind, determine the AAV capsid-reactive CD8+ T cell epitopes and determine the frequency of subjects reacting to a given AAV epitope.

[0171] In one embodiment, the AAV may be a serotype generated by Cre-recombination-based AAV targeted evolution (CREATE) as described by Deverman et al., (Nature Biotechnology 34(2):204-209 (2016)) In one embodiment, AAV serotypes generated in this manner have improved CNS transduction and / or neuronal and astrocytic tropism, as compared to other AAV serotypes. As non-limiting examples, the AAV serotype may be PHP.B, PHP.B2, PHP.B3, PHP.A, G2A12, G2A15. In one embodiment, these AAV serotypes may be AAV9 (SEQ ID NO: 153 and 154) derivatives with a 7-amino acid insert between amino acids 588-589. Non-limiting examples of these 7-amino acid inserts include TLAVPFK (SEQ ID NO: 900), SVSKPFL (SEQ ID NO: 908), FTLTTPK (SEQ ID NO: 909), YTLSQGW (SEQ ID NO: 915), QAVRTSL (SEQ ID NO: 941) and / or LAKERLS (SEQ ID NO: 942).

[0172] In one embodiment, the AAV serotype may be as described in Jackson et al (Frontiers in Molecular Neuroscience 9:154 (2016)) In some embodiments, the AAV serotype is PHP.B or AAV9. In some embodiments, the AAV serotype is paired with a synapsin promoter to enhance neuronal transduction, as compared to when more ubiquitous promoters are used (i.e., CBA or CMV).

[0173] Peptides for inclusion in an AAV serotype may be identified by isolating human splenocytes, restimulating the splenocytes in vitro using individual peptides spanning the amino acid sequence of the AAV capsid protein, IFN-gamma ELISpot with the individual peptides used for the in vitro restimulation, bioinformatics analysis to determine the given allele restriction of 15-mers identified by IFN-gamma ELISpot, idenification of candidate reactive 9-mer epitopes for a given allele, synthesis candidate 9-mers, second IFN-gamma ELISpot screening of splenocytes from subjects carrying the specific alleles to which identified AAV epitopes are predicted to bind, determine the AAV capsid-reactive CD8+ T cell epitopes and determine the frequency of subjects reacting to a given AAV epitope.

[0174] AAV vectors comprising the nucleic acid sequence for the siRNA molecules may be prepared or derived from various serotypes of AAVs, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, AAV-PHP.A, and / or AAV-PHP.B. In some cases, different serotypes of AAVs may be mixed together or with other types of viruses to produce chimeric AAV vectors. As a non-limiting example, the AAV vector is derived from the AAV9 serotype.Viral Genome Component: Inverted Terminal Repeats (ITRs)

[0175] The AAV particles of the present invention comprise a viral genome with at least one ITR region and a payload region. In one embodiment the viral genome has two ITRs. These two ITRs flank the payload region at the 5' and 3' ends. The ITRs function as origins of replication comprising recognition sites for replication. ITRs comprise sequence regions which can be complementary and symmetrically arranged. ITRs incorporated into viral genomes of the invention may be comprised of naturally occurring polynucleotide sequences or recombinantly derived polynucleotide sequences.

[0176] The ITRs may be derived from the same serotype as the capsid, selected from any of the serotypes listed in Table 6, or a derivative thereof. The ITR may be of a different serotype than the capsid. In one embodiment the AAV particle has more than one ITR. In a non-limiting example, the AAV particle has a viral genome comprising two ITRs. In one embodiment the ITRs are of the same serotype as one another. In another embodiment the ITRs are of different serotypes. Non-limiting examples include zero, one or both of the ITRs having the same serotype as the capsid. In one embodiment both ITRs of the viral genome of the AAV particle are AAV2 ITRs.

[0177] Independently, each ITR may be about 100 to about 150 nucleotides in length. An ITR may be about 100-105 nucleotides in length, 106-110 nucleotides in length, 111-115 nucleotides in length, 116-120 nucleotides in length, 121-125 nucleotides in length, 126-130 nucleotides in length, 131-135 nucleotides in length, 136-140 nucleotides in length, 141-145 nucleotides in length or 146-150 nucleotides in length. In one embodiment the ITRs are 140-142 nucleotides in length. Non limiting examples of ITR length are 102, 140, 141, 142, 145 nucleotides in length, and those having at least 95% identity thereto.

[0178] In one embodiment, the encoded siRNA molecule may be located near the 5' end of the flip ITR in an expression vector. In another embodiment, the encoded siRNA molecule may be located near the 3' end of the flip ITR in an expression vector. In yet another embodiment, the encoded siRNA molecule may be located near the 5' end of the flop ITR in an expression vector. In yet another embodiment, the encoded siRNA molecule may be located near the 3' end of the flop ITR in an expression vector. In one embodiment, the encoded siRNA molecule may be located between the 5' end of the flip ITR and the 3' end of the flop ITR in an expression vector. In one embodiment, the encoded siRNA molecule may be located between (e.g., half-way between the 5' end of the flip ITR and 3' end of the flop ITR or the 3' end of the flop ITR and the 5' end of the flip ITR), the 3' end of the flip ITR and the 5' end of the flip ITR in an expression vector. As a non-limiting example, the encoded siRNA molecule may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in an expression vector. As a non-limiting example, the encoded siRNA molecule may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in an expression vector. As another non-limiting example, the encoded siRNA molecule may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in an expression vector. As another non-limiting example, the encoded siRNA molecule may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in an expression vector. As a non-limiting example, the encoded siRNA molecule may be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in an expression vector. As another non-limiting example, the encoded siRNA molecule may be located with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in an expression vector.Viral Genome Component: Promoters

[0179] A person skilled in the art may recognize that a target cell may require a specific promoter including but not limited to a promoter that is species specific, inducible, tissue-specific, or cell cycle-specific (Parr et al., Nat. Med.3:1145-9 (1997)

[0180] In one embodiment, the promoter is a promoter deemed to be efficient to drive the expression of the modulatory polynucleotide.

[0181] In one embodiment, the promoter is a promoter having a tropism for the cell being targeted.

[0182] In one embodiment, the promoter is a weak promoter which provides expression of a payload e.g., a modulatory polynucleotide, e.g., siRNA or dsRNA, for a period of time in targeted tissues such as, but not limited to, nervous system tissues. Expression may be for a period of 1 hour, 2, hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or more than 10 years. Expression may be for 1-5 hours, 1-12 hours, 1-2 days, 1-5 days, 1-2 weeks, 1-3 weeks, 1-4 weeks, 1-2 months, 1-4 months, 1-6 months, 2-6 months, 3-6 months, 3-9 months, 4-8 months, 6-12 months, 1-2 years, 1-5 years, 2-5 years, 3-6 years, 3-8 years, 4-8 years or 5-10 years. As a non-limiting example, the promoter is a weak promoter for sustained expression of a payload in nervous tissues.

[0183] In one embodiment, the promoter may be a promoter which is less than 1 kb. The promoter may have a length of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 or more than 800. The promoter may have a length between 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800 or 700-800.

[0184] In one embodiment, the promoter may be a combination of two or more components such as, but not limited to, CMV and CBA. Each component may have a length of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 or more than 800. Each component may have a length between 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800 or 700-800. As a non-limiting example, the promoter is a combination of a 382 nucleotide CMV-enhancer sequence and a 260 nucleotide CBA-promoter sequence.

[0185] In one embodiment, the vector genome comprises at least one element to enhance the target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015 ). Non-limiting examples of elements to enhance the transgene target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (PolyA) signal sequences and upstream enhancers (USEs), CMV enhancers and introns.

[0186] In one embodiment, the vector genome comprises at least one element to enhance the target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015 ) such as promoters.

[0187] Promoters for which promote expression in most tissues include, but are not limited to, human elongation factor 1α-subunit (EF1α), immediate-early cytomegalovirus (CMV), chicken β-actin (CBA) and its derivative CAG, the β glucuronidase (GUSB), or ubiquitin C (UBC). Tissue-specific expression elements can be used to restrict expression to certain cell types such as, but not limited to, nervous system promoters which can be used to restrict expression to neurons, astrocytes, or oligodendrocytes. Non-limiting example of tissue-specific expression elements for neurons include neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B-chain (PDGF-β), the synapsin (Syn), the methyl-CpG binding protein 2 (MeCP2), CaMKII, mGluR2, NFL, NFH, nβ2, PPE, Enk and EAAT2 promoters. A non-limiting example of tissue-specific expression elements for astrocytes include the glial fibrillary acidic protein (GFAP) and EAAT2 promoters. A non-limiting example of a tissue-specific expression element for oligodendrocytes include the myelin basic protein (MBP) promoter.

[0188] In one embodiment, the vector genome comprises a ubiquitous promoter. Non-limiting examples of ubiquitous promoters include H1, U6, CMV, CBA (including derivatives CAG, CBh, etc.), EF-1α, PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B1-CBX3). Yu et al. (Molecular Pain 2011, 7:63 ) evaluated the expression of eGFP under the CAG, EFIα, PGK and UBC promoters in rat DRG cells and primary DRG cells using lentiviral vectors and found that UBC showed weaker expression than the other 3 promoters and there was only 10-12% glia expression seen for all promoters. Soderblom et al. (E. Neuro 2015 ) the expression of eGFP in AAV8 with CMV and UBC promoters and AAV2 with the CMV promoter after injection in the motor cortex. Intranasal administration of a plasmid containing a UBC or EFIα promoter showed a sustained airway expression greater than the expression with the CMV promoter (See e.g., Gill et al., Gene Therapy 2001, Vol. 8, 1539-1546; ). Husain et al. (Gene Therapy 2009 ) evaluated a HβH construct with a hGUSB promoter, a HSV-1LAT promoter and a NSE promoter and found that the HβH construct showed weaker expression than NSE in mice brain. Passini and Wolfe (J. Virol. 2001, 12382-12392 ) evaluated the long term effects of the HβH vector following an intraventricular injection in neonatal mice and found that there was sustained expression for at least 1 year. Low expression in all brain regions was found by Xu et al. (Gene Therapy 2001, 8, 1323-1332 ) when NF-L and NF-H promoters were used as compared to the CMV-lacZ, CMV-luc, EF, GFAP, hENK, nAChR, PPE, PPE + wpre, NSE (0.3 kb), NSE (1.8 kb) and NSE (1.8 kb + wpre). Xu et al. found that the promoter activity in descending order was NSE (1.8 kb), EF, NSE (0.3 kb), GFAP, CMV, hENK, PPE, NFL and NFH. NFL is a 650 nucleotide promoter and NFH is a 920 nucleotide promoter which are both absent in the liver but NFH is abundant in the sensory proprioceptive neurons, brain and spinal cord and NFH is present in the heart. Scn8a is a 470 nucleotide promoter which expresses throughout the DRG, spinal cord and brain with particularly high expression seen in the hippocampal neurons and cerebellar Purkinje cells, cortex, thalamus and hypothalamus (See e.g., Drews et al. 2007 and Raymond et al. 2004

[0189] In one embodiment, the vector genome comprises an UBC promoter. The UBC promoter may have a size of 300-350 nucleotides. As a non-limiting example, the UBC promoter is 332 nucleotides.

[0190] In one embodiment, the vector genome comprises a GUSB promoter. The GUSB promoter may have a size of 350-400 nucleotides. As a non-limiting example, the GUSB promoter is 378 nucleotides. As a non-limiting example, the construct may be AAV-promoter-CMV / globin intron-modulatory polynucleotide-RBG, where the AAV may be self-complementary and the AAV may be the DJ serotype.

[0191] In one embodiment, the vector genome comprises a NFL promoter. The NFL promoter may have a size of 600-700 nucleotides. As a non-limiting example, the NFL promoter is 650 nucleotides. As a non-limiting example, the construct may be AAV-promoter-CMV / globin intron-modulatory polynucleotide-RBG, where the AAV may be self-complementary and the AAV may be the DJ serotype.

[0192] In one embodiment, the vector genome comprises a NFH promoter. The NFH promoter may have a size of 900-950 nucleotides. As a non-limiting example, the NFH promoter is 920 nucleotides. As a non-limiting example, the construct may be AAV-promoter-CMV / globin intron-modulatory polynucleotide-RBG, where the AAV may be self-complementary and the AAV may be the DJ serotype.

[0193] In one embodiment, the vector genome comprises a scn8a promoter. The scn8a promoter may have a size of 450-500 nucleotides. As a non-limiting example, the scn8a promoter is 470 nucleotides. As a non-limiting example, the construct may be AAV-promoter-CMV / globin intron-modulatory polynucleotide-RBG, where the AAV may be self-complementary and the AAV may be the DJ serotype.

[0194] In one embodiment, the vector genome comprises a FXN promoter.

[0195] In one embodiment, the vector genome comprises a PGK promoter.

[0196] In one embodiment, the vector genome comprises a CBA promoter.

[0197] In one embodiment, the vector genome comprises a CMV promoter.

[0198] In one embodiment, the vector genome comprises a H1 promoter.

[0199] In one embodiment, the vector genome comprises a U6 promoter.

[0200] In one embodiment, the vector genome comprises a liver or a skeletal muscle promoter. Non-limiting examples of liver promoters include hAAT and TBG. Non-limiting examples of skeletal muscle promoters include Desmin, MCK and C5-12.

[0201] In one embodiment, the AAV vector comprises an enhancer element, a promoter and / or a 5'UTR intron. The enhancer may be, but is not limited to, a CMV enhancer, the promoter may be, but is not limited to, a CMV, CBA, UBC, GUSB, NSE, Synapsin, MeCP2, and GFAP promoter and the 5'UTR / intron may be, but is not limited to, SV40, and CBA-MVM. As a non-limiting example, the enhancer, promoter and / or intron used in combination may be: (1) CMV enhancer, CMV promoter, SV40 5'UTR intron; (2) CMV enhancer, CBA promoter, SV 40 5'UTR intron; (3) CMV enhancer, CBA promoter, CBA-MVM 5'UTR intron; (4) UBC promoter; (5) GUSB promoter; (6) NSE promoter; (7) Synapsin promoter; (8) MeCP2 promoter; (9) GFAP promoter, (10) H1 promoter; and (11) U6 promoter.

[0202] In one embodiment, the AAV vector has an engineered promoter.Viral Genome Component: Introns

[0203] In one embodiment, the vector genome comprises at least one element to enhance the transgene target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015 ) such as an intron. Non-limiting examples of introns include, MVM (67-97 bps), F.IX truncated intron 1 (300 bps), β-globin SD / immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice donor / immunoglobin splice acceptor (500 bps), SV40 late splice donor / splice acceptor (19S / 16S) (180 bps) and hybrid adenovirus splice donor / IgG splice acceptor (230 bps).

[0204] In one embodiment, the intron may be 100-500 nucleotides in length. The intron may have a length of 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 or 500. The promoter may have a length between 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250, 80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500, 300-400, 300-500, or 400-500.

[0205] In one embodiment, the AAV vector may comprise an SV40 intron or fragment or variant thereof. As a non-limiting example, the promoter may be CMV. As another non-limiting example, the promoter may be CBA. As yet another non-limiting example, the promoter may be H1.

[0206] In one embodiment, the AAV vector may comprise a beta-globin intron or a frament or variant thereof. As a non-limiting example, the promoter may be CMV. As another non-limiting example, the promoter may be CBA. As yet another non-limiting example, the promoter may be H1.

[0207] In one embodiment, the encoded siRNA molecule may be located downstream of an intron in an expression vector such as, but not limited to, SV40 intron or beta globin intron or others known in the art. Further, the encoded siRNA molecule may also be located upstream of the polyadenylation sequence in an expression vector. As a non-limiting example, the encoded siRNA molecule may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream from the promoter with an intron and / or upstream of the polyadenylation sequence in an expression vector. As another non-limiting example, the encoded siRNA molecule may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides downstream from the intron and / or upstream of the polyadenylation sequence in an expression vector. As a non-limiting example, the encoded siRNA molecule may be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides downstream from the intron and / or upstream of the polyadenylation sequence in an expression vector. As another non-limiting example, the encoded siRNA molecule may be located with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% of the sequence downstream from the intron and / or upstream of the polyadenylation sequence in an expression vector.Viral Genome Component: Polyadenylation Sequence

[0208] In one embodiment, the viral genome of the AAV particles of the present invention comprise at least one polyadenylation sequence. The viral genome of the AAV particle may comprise a polyadenylation sequence between the 3' end of the payload coding sequence and the 5' end of the 3'ITR.

[0209] In one embodiment, the polyadenylation sequence or "poly A sequence" may range from absent to about 500 nucleotides in length. The polyadenylation sequence may be, but is not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, and 500 nucleotides in length.

[0210] In one embodiment, the polyadenylation sequence is 50-100 nucleotides in length.

[0211] In one embodiment, the polyadenylation sequence is 50-150 nucleotides in length.

[0212] In one embodiment, the polyadenylation sequence is 50-160 nucleotides in length.

[0213] In one embodiment, the polyadenylation sequence is 50-200 nucleotides in length.

[0214] In one embodiment, the polyadenylation sequence is 60-100 nucleotides in length.

[0215] In one embodiment, the polyadenylation sequence is 60-150 nucleotides in length.

[0216] In one embodiment, the polyadenylation sequence is 60-160 nucleotides in length.

[0217] In one embodiment, the polyadenylation sequence is 60-200 nucleotides in length.

[0218] In one embodiment, the polyadenylation sequence is 70-100 nucleotides in length.

[0219] In one embodiment, the polyadenylation sequence is 70-150 nucleotides in length.

[0220] In one embodiment, the polyadenylation sequence is 70-160 nucleotides in length.

[0221] In one embodiment, the polyadenylation sequence is 70-200 nucleotides in length.

[0222] In one embodiment, the polyadenylation sequence is 80-100 nucleotides in length.

[0223] In one embodiment, the polyadenylation sequence is 80-150 nucleotides in length.

[0224] In one embodiment, the polyadenylation sequence is 80-160 nucleotides in length.

[0225] In one embodiment, the polyadenylation sequence is 80-200 nucleotides in length.

[0226] In one embodiment, the polyadenylation sequence is 90-100 nucleotides in length.

[0227] In one embodiment, the polyadenylation sequence is 90-150 nucleotides in length.

[0228] In one embodiment, the polyadenylation sequence is 90-160 nucleotides in length.

[0229] In one embodiment, the polyadenylation sequence is 90-200 nucleotides in length.

[0230] In one embodiment, the encoded siRNA molecule may be located upstream of the polyadenylation sequence in an expression vector. Further, the encoded siRNA molecule may be located downstream of a promoter such as, but not limited to, CMV, U6, H1, CBA or a CBA promoter with a SV40 or a human betaglobin intron in an expression vector. As a non-limiting example, the encoded siRNA molecule may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence in an expression vector. As another non-limiting example, the encoded siRNA molecule may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence in an expression vector. As a non-limiting example, the encoded siRNA molecule may be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides downstream from the promoter and / or upstream of the polyadenylation sequence in an expression vector. As another non-limiting example, the encoded siRNA molecule may be located with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% downstream from the promoter and / or upstream of the polyadenylation sequence in an expression vector.Expression Vector

[0231] An an expression vector (e.g., AAV vector) may comprise at least one of the modulatory polynucleotides encoding at least one of the siRNA sequences or duplexes as defined by the claims

[0232] In one embodiment, an expression vector may comprise, from ITR to ITR recited 5' to 3', an ITR, a promoter, an intron, a modulatory polynucleotide, a poly A sequence and an ITR.Genome Size

[0233] In one embodiment, the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides may be single stranded or double stranded vector genome. The size of the vector genome may be small, medium, large or the maximum size. Additionally, the vector genome may comprise a promoter and a poly A tail.

[0234] In one embodiment, the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides may be a small single stranded vector genome. A small single stranded vector genome may be 2.7 to 3.5 kb in size such as about 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, and 3.5 kb in size. As a non-limiting example, the small single stranded vector genome may be 3.2 kb in size. Additionally, the vector genome may comprise a promoter and a poly A tail.

[0235] In one embodiment, the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides may be a small double stranded vector genome. A small double stranded vector genome may be 1.3 to 1.7 kb in size such as about 1.3, 1.4, 1.5, 1.6, and 1.7 kb in size. As a non-limiting example, the small double stranded vector genome may be 1.6 kb in size. Additionally, the vector genome may comprise a promoter and a poly A tail.

[0236] In one embodiment, the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides e.g., siRNA or dsRNA, may be a medium single stranded vector genome. A medium single stranded vector genome may be 3.6 to 4.3 kb in size such as about 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2 and 4.3 kb in size. As a non-limiting example, the medium single stranded vector genome may be 4.0 kb in size. Additionally, the vector genome may comprise a promoter and a poly A tail.

[0237] In one embodiment, the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides may be a medium double stranded vector genome. A medium double stranded vector genome may be 1.8 to 2.1 kb in size such as about 1.8, 1.9, 2.0, and 2.1 kb in size. As a non-limiting example, the medium double stranded vector genome may be 2.0 kb in size. Additionally, the vector genome may comprise a promoter and a poly A tail.

[0238] In one embodiment, the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides may be a large single stranded vector genome. A large single stranded vector genome may be 4.4 to 6.0 kb in size such as about 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9 and 6.0 kb in size. As a non-limiting example, the large single stranded vector genome may be 4.7 kb in size. As another non-limiting example, the large single stranded vector genome may be 4.8 kb in size. As yet another non-limiting example, the large single stranded vector genome may be 6.0 kb in size. Additionally, the vector genome may comprise a promoter and a poly A tail.

[0239] In one embodiment, the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides may be a large double stranded vector genome. A large double stranded vector genome may be 2.2 to 3.0 kb in size such as about 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 and 3.0 kb in size. As a non-limiting example, the large double stranded vector genome may be 2.4 kb in size. Additionally, the vector genome may comprise a promoter and a poly A tail.Viral production

[0240] The present disclosure provides a method for the generation of parvoviral particles, e.g. AAV particles, by viral genome replication in a viral replication cell comprising contacting the viral replication cell with an AAV polynucleotide or AAV genome.

[0241] The present disclosure provides a method for producing an AAV particle having enhanced (increased, improved) transduction efficiency comprising the steps of: 1) co-transfecting competent bacterial cells with a bacmid vector and either a viral construct vector and / or AAV payload construct vector, 2) isolating the resultant viral construct expression vector and AAV payload construct expression vector and separately transfecting viral replication cells, 3) isolating and purifying resultant payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, 4) co-infecting a viral replication cell with both the AAV payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, 5) harvesting and purifying the viral particle comprising a parvoviral genome.

[0242] In one embodiment, the present invention provides a method for producing an AAV particle comprising the steps of 1) simultaneously co-transfecting mammalian cells, such as, but not limited to HEK293 cells, with a payload region, a construct expressing rep and cap genes and a helper construct, 2) harvesting and purifying the AAV particle comprising a viral genome.Cells

[0243] The present disclosure provides a cell comprising an AAV polynucleotide and / or AAV genome.

[0244] Viral production disclosed herein describes processes and methods for producing AAV particles that contact a target cell to deliver a payload construct, e.g. a recombinant viral construct, which comprises a nucleotide encoding a payload molecule.

[0245] In one embodiment, the AAV particles may be produced in a viral replication cell that comprises an insect cell.

[0246] Growing conditions for insect cells in culture, and production of heterologous products in insect cells in culture are well-known in the art, see U.S. Pat. No. 6,204,059

[0247] Any insect cell which allows for replication of parvovirus and which can be maintained in culture can be used in accordance with the present invention. Cell lines may be used from Spodoptera frugiperda, including, but not limited to the Sf9 or Sf21 cell lines, Drosophila cell lines, or mosquito cell lines, such as Aedes albopictus derived cell lines. Use of insect cells for expression of heterologous proteins is well documented, as are methods of introducing nucleic acids, such as vectors, e.g., insect-cell compatible vectors, into such cells and methods of maintaining such cells in culture. See, for example, Methods in Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J. Vir.63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88: 4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al., Vir.219:37-44 (1996); Zhao et al., Vir.272:382-93 (2000); and Samulski et al., U.S. Pat. No. 6,204,059.

[0248] The viral replication cell may be selected from any biological organism, including prokaryotic (e.g., bacterial) cells, and eukaryotic cells, including, insect cells, yeast cells and mammalian cells. Viral replication cells may comprise mammalian cells such as A549, WEH1, 3T3, 10T1 / 2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO. W138, HeLa, HEK293, Saos, C2C12, L cells, HT1080, HepG2 and primary fibroblast, hepatocyte and myoblast cells derived from mammals. Viral replication cells comprise cells derived from mammalian species including, but not limited to, human, monkey, mouse, rat, rabbit, and hamster or cell type, including but not limited to fibroblast, hepatocyte, tumor cell, cell line transformed cell, etc.Small scale production of AAV Particles

[0249] Viral production disclosed herein describes processes and methods for producing AAV particles that contact a target cell to deliver a payload, e.g. a recombinant viral construct, which comprises a nucleotide encoding a payload.

[0250] In one embodiment, the AAV particles may be produced in a viral replication cell that comprises a mammalian cell.

[0251] Viral replication cells commonly used for production of recombinant AAV particles include, but are not limited to 293 cells, COS cells, HeLa cells, KB cells, and other mammalian cell lines as described in U.S. Pat. Nos. 6,156,303, 5,387,484, 5,741,683, 5,691,176, and 5,688,676; U.S. patent application 2002 / 0081721, and International Patent Applications WO 00 / 47757, WO 00 / 24916, and WO 96 / 17947

[0252] In one embodiment, AAV particles are produced in mammalian-cells wherein all three VP proteins are expressed at a stoichiometry approaching 1:1:10 (VP1:VP2:VP3). The regulatory mechanisms that allow this controlled level of expression include the production of two mRNAs, one for VP1, and the other for VP2 and VP3, produced by differential splicing.

[0253] In another embodiment, AAV particles are produced in mammalian cells using a triple transfection method wherein a payload construct, parvoviral Rep and parvoviral Cap and a helper construct are comprised within three different constructs. The triple transfection method of the three components of AAV particle production may be utilized to produce small lots of virus for assays including transduction efficiency, target tissue (tropism) evaluation, and stability.Baculovirus

[0254] Particle production disclosed herein describes processes and methods for producing AAV particles that contact a target cell to deliver a payload construct which comprises a nucleotide encoding a payload.

[0255] Briefly, the viral construct vector and the AAV payload construct vector are each incorporated by a transposon donor / acceptor system into a bacmid, also known as a baculovirus plasmid, by standard molecular biology techniques known and performed by a person skilled in the art. Transfection of separate viral replication cell populations produces two baculoviruses, one that comprises the viral construct expression vector, and another that comprises the AAV payload construct expression vector. The two baculoviruses may be used to infect a single viral replication cell population for production of AAV particles.

[0256] Baculovirus expression vectors for producing viral particles in insect cells, including but not limited to Spodoptera frugiperda (Sf9) cells, provide high titers of viral particle product. Recombinant baculovirus encoding the viral construct expression vector and AAV payload construct expression vector initiates a productive infection of viral replicating cells. Infectious baculovirus particles released from the primary infection secondarily infect additional cells in the culture, exponentially infecting the entire cell culture population in a number of infection cycles that is a function of the initial multiplicity of infection, see Urabe, M. et al., J Virol. 2006 Feb; 80 (4):1874-85 .

[0257] Production of AAV particles with baculovirus in an insect cell system may address known baculovirus genetic and physical instability. In one embodiment, the production system addresses baculovirus instability over multiple passages by utilizing a titerless infected-cells preservation and scale-up system. Small scale seed cultures of viral producing cells are transfected with viral expression constructs encoding the structural, non-structural, components of the viral particle. Baculovirus-infected viral producing cells are harvested into aliquots that may be cryopreserved in liquid nitrogen; the aliquots retain viability and infectivity for infection of large scale viral producing cell culture Wasilko DJ et al., Protein Expr Purif. 2009 Jun; 65(2):122-3 .

[0258] A genetically stable baculovirus may be used to produce source of the one or more of the components for producing AAV particles in invertebrate cells. In one embodiment, defective baculovirus expression vectors may be maintained episomally in insect cells. In such an embodiment the bacmid vector is engineered with replication control elements, including but not limited to promoters, enhancers, and / or cell-cycle regulated replication elements.

[0259] In one embodiment, baculoviruses may be engineered with a (non-) selectable marker for recombination into the chitinase / cathepsin locus. The chialv-cath locus is non-essential for propagating baculovirus in tissue culture, and the V-cath (EC 3.4.22.50) is a cysteine endoprotease that is most active on Arg-Arg dipeptide containing substrates. The Arg-Arg dipeptide is present in densovirus and parvovirus capsid structural proteins but infrequently occurs in dependovirus VP1.

[0260] In one embodiment, stable viral replication cells permissive for baculovirus infection are engineered with at least one stable integrated copy of any of the elements necessary for AAV replication and viral particle production including, but not limited to, the entire AAV genome, Rep and Cap genes, Rep genes, Cap genes, each Rep protein as a separate transcription cassette, each VP protein as a separate transcription cassette, the AAP (assembly activation protein), or at least one of the baculovirus helper genes with native or non-native promoters.Large-scale production

[0261] In some embodiments, AAV particle production may be modified to increase the scale of production. Large scale viral production methods according to the present disclosure may include any of those taught in US Patent Nos. 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498 and 7,491,508 or International Publication Nos. WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353 and WO2001023597. Methods of increasing viral particle production scale typically comprise increasing the number of viral replication cells. In some embodiments, viral replication cells comprise adherent cells. To increase the scale of viral particle production by adherent viral replication cells, larger cell culture surfaces are required. In some cases, large-scale production methods comprise the use of roller bottles to increase cell culture surfaces. Other cell culture substrates with increased surface areas are known in the art. Examples of additional adherent cell culture products with increased surface areas include, but are not limited to CellSTACK ®< , CellCube ®< (Corning Corp., Corning, NY) and NuncTM Cell FactoryTM (Thermo Scientific, Waltham, MA.) In some cases, large-scale adherent cell surfaces may comprise from about 1,000 cm2 to about 100,000 cm2. In some cases, large-scale adherent cell cultures may comprise from about 107 to about 109 cells, from about 108 to about 1010 cells, from about 109 to about 1012 cells or at least 1012 cells. In some cases, large-scale adherent cultures may produce from about 109 to about 1012, from about 1010 to about 1013, from about 1011 to about 1014, from about 1012 to about 1015 or at least 1015 viral particles.

[0262] In some embodiments, large-scale viral production methods of the present disclosure may comprise the use of suspension cell cultures. Suspension cell culture allows for significantly increased numbers of cells. Typically, the number of adherent cells that can be grown on about 10-50 cm2 of surface area can be grown in about 1 cm3 volume in suspension.

[0263] Transfection of replication cells in large-scale culture formats may be carried out according to any methods known in the art. For large-scale adherent cell cultures, transfection methods may include, but are not limited to the use of inorganic compounds (e.g. calcium phosphate), organic compounds [e.g. polyethyleneimine (PEI)] or the use of non-chemical methods (e.g. electroporation.) With cells grown in suspension, transfection methods may include, but are not limited to the use of calcium phosphate and the use of PEI. In some cases, transfection of large scale suspension cultures may be carried out according to the section entitled "Transfection Procedure" described in Feng, L. et al., 2008. Biotechnol Appl. Biochem. 50:121-32. According to such embodiments, PEI-DNA complexes may be formed for introduction of plasmids to be transfected. In some cases, cells being transfected with PEI-DNA complexes may be 'shocked' prior to transfection. This comprises lowering cell culture temperatures to 4°C for a period of about 1 hour. In some cases, cell cultures may be shocked for a period of from about 10 minutes to about 5 hours. In some cases, cell cultures may be shocked at a temperature of from about 0°C to about 20°C.

[0264] In some cases, transfections may include one or more vectors for expression of an RNA effector molecule to reduce expression of nucleic acids from one or more AAV payload construct. Such methods may enhance the production of viral particles by reducing cellular resources wasted on expressing payload constructs. In some cases, such methods may be carried according to those taught in US Publication No. US2014 / 0099666Bioreactors

[0265] In some embodiments, cell culture bioreactors may be used for large scale viral production. In some cases, bioreactors comprise stirred tank reactors. Such reactors generally comprise a vessel, typically cylindrical in shape, with a stirrer (e.g. impeller.) In some embodiments, such bioreactor vessels may be placed within a water jacket to control vessel temperature and / or to minimize effects from ambient temperature changes. Bioreactor vessel volume may range in size from about 500 ml to about 2 L, from about 1 L to about 5 L, from about 2.5 L to about 20 L, from about 10 L to about 50 L, from about 25 L to about 100 L, from about 75 L to about 500 L, from about 250 L to about 2,000 L, from about 1,000 L to about 10,000 L, from about 5,000 L to about 50,000 L or at least 50,000 L. Vessel bottoms may be rounded or flat. In some cases, animal cell cultures may be maintained in bioreactors with rounded vessel bottoms.

[0266] In some cases, bioreactor vessels may be warmed through the use of a thermocirculator. Thermocirculators pump heated water around water jackets. In some cases, heated water may be pumped through pipes (e.g. coiled pipes) that are present within bioreactor vessels. In some cases, warm air may be circulated around bioreactors, including, but not limited to air space directly above culture medium. Additionally, pH and CO2 levels may be maintained to optimize cell viability.

[0267] In some cases, bioreactors may comprise hollow-fiber reactors. Hollow-fiber bioreactors may support the culture of both anchorage dependent and anchorage independent cells. Further bioreactors may include, but are not limited to packed-bed or fixed-bed bioreactors. Such bioreactors may comprise vessels with glass beads for adherent cell attachment. Further packed-bed reactors may comprise ceramic beads.

[0268] In some cases, viral particles are produced through the use of a disposable bioreactor. In some embodiments, such bioreactors may include WaveTM disposable bioreactors.

[0269] In some embodiments, AAV particle production in animal cell bioreactor cultures may be carried out according to the methods taught in US Patent Nos. 5,064764, 6,194,191, 6,566,118, 8,137,948 or US Patent Application No. US2011 / 0229971Cell Lysis

[0270] Cells used in of the invention, including, but not limited to viral production cells, may be subjected to cell lysis according to any methods known in the art. Cell lysis may be carried out to obtain one or more agents (e.g. viral particles) present within any cells used in the invention. In some embodiments, cell lysis may be carried out according to any of the methods listed in US Patent Nos. 7,326,555, 7,579,181, 7,048,920, 6,410,300, 6,436,394, 7,732,129, 7,510,875, 7,445,930, 6,726,907, 6,194,191, 7,125,706, 6,995,006, 6,676,935, 7,968,333, 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498 and 7,491,508 or International Publication Nos. WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353 and WO2001023597. Cell lysis methods may be chemical or mechanical. Chemical cell lysis typically comprises contacting one or more cells with one or more lysis agent. Mechanical lysis typically comprises subjecting one or more cells to one or more lysis condition and / or one or more lysis force.

[0271] In some embodiments, chemical lysis may be used to lyse cells. As used herein, the term "lysis agent" refers to any agent that may aid in the disruption of a cell. In some cases, lysis agents are introduced in solutions, termed lysis solutions or lysis buffers. As used herein, the term "lysis solution" refers to a solution (typically aqueous) comprising one or more lysis agent. In addition to lysis agents, lysis solutions may include one or more buffering agents, solubilizing agents, surfactants, preservatives, cryoprotectants, enzymes, enzyme inhibitors and / or chelators. Lysis buffers are lysis solutions comprising one or more buffering agent. Additional components of lysis solutions may include one or more solubilizing agent. As used herein, the term "solubilizing agent" refers to a compound that enhances the solubility of one or more components of a solution and / or the solubility of one or more entities to which solutions are applied. In some cases, solubilizing agents enhance protein solubility. In some cases, solubilizing agents are selected based on their ability to enhance protein solubility while maintaining protein conformation and / or activity.

[0272] Exemplary lysis agents may include any of those described in US Patent Nos. 8,685,734, 7,901,921, 7,732,129, 7,223,585, 7,125,706, 8,236,495, 8,110,351, 7,419,956, 7,300,797, 6,699,706 and 6,143,567. In some cases, lysis agents may be selected from lysis salts, amphoteric agents, cationic agents, ionic detergents and non-ionic detergents. Lysis salts may include, but are not limited to sodium chloride (NaCl) and potassium chloride (KCl.) Further lysis salts may include any of those described in US Patent Nos. 8,614,101, 7,326,555, 7,579,181, 7,048,920, 6,410,300, 6,436,394, 7,732,129, 7,510,875, 7,445,930, 6,726,907, 6,194,191, 7,125,706, 6,995,006, 6,676,935 and 7,968,333. Concentrations of salts may be increased or decreased to obtain an effective concentration for rupture of cell membranes. Amphoteric agents, as referred to herein, are compounds capable of reacting as an acid or a base. Amphoteric agents may include, but are not limited to lysophosphatidylcholine, 3-((3-Cholamidopropyl) dimethylammonium)-1-propanesulfonate (CHAPS), Zwittergent ®< and the like. Cationic agents may include, but are not limited to cetyltrimethylammonium bromide (C (16) TAB) and Benzalkonium chloride. Lysis agents comprising detergents may include ionic detergents or non-ionic detergents. Detergents may function to break apart or dissolve cell structures including, but not limited to cell membranes, cell walls, lipids, carbohydrates, lipoproteins and glycoproteins. Exemplary ionic detergents include any of those taught in US Patent Nos. 7,625,570 and 6,593,123 or US Publication No. US2014 / 0087361. Some ionic detergents may include, but are not limited to sodium dodecyl sulfate (SDS), cholate and deoxycholate. In some cases, ionic detergents may be included in lysis solutions as a solubilizing agent. Non-ionic detergents may include, but are not limited to octylglucoside, digitonin, lubrol, C12E8, TWEEN ®< -20, TWEEN ®< -80, Triton X-100 and Noniodet P-40. Non-ionic detergents are typically weaker lysis agents, but may be included as solubilizing agents for solubilizing cellular and / or viral proteins. Further lysis agents may include enzymes and urea. In some cases, one or more lysis agents may be combined in a lysis solution in order to enhance one or more of cell lysis and protein solubility. In some cases, enzyme inhibitors may be included in lysis solutions in order to prevent proteolysis that may be triggered by cell membrane disruption.

[0273] In some embodiments, mechanical cell lysis is carried out. Mechanical cell lysis methods may include the use of one or more lysis condition and / or one or more lysis force. As used herein, the term "lysis condition" refers to a state or circumstance that promotes cellular disruption. Lysis conditions may comprise certain temperatures, pressures, osmotic purity, salinity and the like. In some cases, lysis conditions comprise increased or decreased temperatures. According to some embodiments, lysis conditions comprise changes in temperature to promote cellular disruption. Cell lysis carried out according to such embodiments may include freeze-thaw lysis. As used herein, the term "freeze-thaw lysis" refers to cellular lysis in which a cell solution is subjected to one or more freeze-thaw cycle. According to freeze-thaw lysis methods, cells in solution are frozen to induce a mechanical disruption of cellular membranes caused by the formation and expansion of ice crystals. Cell solutions used according freeze-thaw lysis methods, may further comprise one or more lysis agents, solubilizing agents, buffering agents, cryoprotectants, surfactants, preservatives, enzymes, enzyme inhibitors and / or chelators. Once cell solutions subjected to freezing are thawed, such components may enhance the recovery of desired cellular products. In some cases, one or more cyroprotectants are included in cell solutions undergoing freeze-thaw lysis. As used herein, the term "cryoprotectant" refers to an agent used to protect one or more substance from damage due to freezing. Cryoprotectants may include any of those taught in US Publication No. US2013 / 0323302 or US Patent Nos. 6,503,888, 6,180,613, 7,888,096, 7,091,030. In some cases, cryoprotectants may include, but are not limited to dimethyl sulfoxide, 1,2-propanediol, 2,3-butanediol, formamide, glycerol, ethylene glycol, 1,3-propanediol and n-dimethyl formamide, polyvinylpyrrolidone, hydroxyethyl starch, agarose, dextrans, inositol, glucose, hydroxyethylstarch, lactose, sorbitol, methyl glucose, sucrose and urea. In some embodiments, freeze-thaw lysis may be carried out according to any of the methods described in US Patent No. 7,704,721.

[0274] As used herein, the term "lysis force" refers to a physical activity used to disrupt a cell. Lysis forces may include, but are not limited to mechanical forces, sonic forces, gravitational forces, optical forces, electrical forces and the like. Cell lysis carried out by mechanical force is referred to herein as "mechanical lysis." Mechanical forces that may be used according to mechanical lysis may include high shear fluid forces. According to such methods of mechanical lysis, a microfluidizer may be used. Microfluidizers typically comprise an inlet reservoir where cell solutions may be applied. Cell solutions may then be pumped into an interaction chamber via a pump (e.g. high-pressure pump) at high speed and / or pressure to produce shear fluid forces. Resulting lysates may then be collected in one or more output reservoir. Pump speed and / or pressure may be adjusted to modulate cell lysis and enhance recovery of products (e.g. viral particles.) Other mechanical lysis methods may include physical disruption of cells by scraping.

[0275] Cell lysis methods may be selected based on the cell culture format of cells to be lysed. For example, with adherent cell cultures, some chemical and mechanical lysis methods may be used. Such mechanical lysis methods may include freeze-thaw lysis or scraping. In another example, chemical lysis of adherent cell cultures may be carried out through incubation with lysis solutions comprising surfactant, such as Triton-X-100. In some cases, cell lysates generated from adherent cell cultures may be treated with one more nuclease to lower the viscosity of the lysates caused by liberated DNA.

[0276] In one embodiment, a method for harvesting AAV particles without lysis may be used for efficient and scalable AAV particle production. In a non-limiting example, AAV particles may be produced by culturing an AAV particle lacking a heparin binding site, thereby allowing the AAV particle to pass into the supernatant, in a cell culture, collecting supernatant from the culture; and isolating the AAV particle from the supernatant, as described in US Patent Application 20090275107.Clarification

[0277] Cell lysates comprising viral particles may be subjected to clarification. Clarification refers to initial steps taken in purification of viral particles from cell lysates. Clarification serves to prepare lysates for further purification by removing larger, insoluble debris. Clarification steps may include, but are not limited to centrifugation and filtration. During clarification, centrifugation may be carried out at low speeds to remove larger debris, only. Similarly, filtration may be carried out using filters with larger pore sizes so that only larger debris is removed. In some cases, tangential flow filtration may be used during clarification. Objectives of viral clarification include high throughput processing of cell lysates and to optimize ultimate viral recovery. Advantages of including a clarification step include scalability for processing of larger volumes of lysate. In some embodiments, clarification may be carried out according to any of the methods presented in US Patent Nos. 8,524,446, 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498, 7,491,508, US Publication Nos. US2013 / 0045186, US2011 / 0263027, US2011 / 0151434, US2003 / 0138772, and International Publication Nos. WO2002012455, WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353 and WO2001023597

[0278] Methods of cell lysate clarification by filtration are well understood in the art and may be carried out according to a variety of available methods including, but not limited to passive filtration and flow filtration. Filters used may comprise a variety of materials and pore sizes. For example, cell lysate filters may comprise pore sizes of from about 1 µM to about 5 µM, from about 0.5 µM to about 2 µM, from about 0.1 µM to about 1 µM, from about 0.05 µM to about 0.05 µM and from about 0.001 µM to about 0.1 µM. Exemplary pore sizes for cell lysate filters may include, but are not limited to, 2.0, 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.95, 0.9, 0.85, 0.8, 0.75, 0.7, 0.65, 0.6, 0.55, 0.5, 0.45, 0.4, 0.35, 0.3, 0.25, 0.2, 0.15, 0.1, 0.05, 0.22, 0.21, 0.20, 0.19, 0.18, 0.17, 0.16, 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06, 0.05, 0.04, 0.03, 0.02, 0.01, 0.02, 0.019, 0.018, 0.017, 0.016, 0.015, 0.014, 0.013, 0.012, 0.011, 0.01, 0.009, 0.008, 0.007, 0.006, 0.005, 0.004, 0.003, 0.002, 0.001 and 0.001 µM. In one embodiment, clarification may comprise filtration through a filter with 2.0 µM pore size to remove large debris, followed by passage through a filter with 0.45 µM pore size to remove intact cells.

[0279] Filter materials may be composed of a variety of materials. Such materials may include, but are not limited to polymeric materials and metal materials (e.g. sintered metal and pored aluminum.) Exemplary materials may include, but are not limited to nylon, cellulose materials (e.g. cellulose acetate), polyvinylidene fluoride (PVDF), polyethersulfone, polyamide, polysulfone, polypropylene, and polyethylene terephthalate. In some cases, filters useful for clarification of cell lysates may include, but are not limited to ULTIPLEAT PROFILE ™< filters (Pall Corporation, Port Washington, NY), SUPOR ™< membrane filters (Pall Corporation, Port Washington, NY)

[0280] In some cases, flow filtration may be carried out to increase filtration speed and / or effectiveness. In some cases, flow filtration may comprise vacuum filtration. According to such methods, a vacuum is created on the side of the filter opposite that of cell lysate to be filtered. In some cases, cell lysates may be passed through filters by centrifugal forces. In some cases, a pump is used to force cell lysate through clarification filters. Flow rate of cell lysate through one or more filters may be modulated by adjusting one of channel size and / or fluid pressure.

[0281] According to some embodiments, cell lysates may be clarified by centrifugation. Centrifugation may be used to pellet insoluble particles in the lysate. During clarification, centrifugation strength [expressed in terms of gravitational units (g), which represents multiples of standard gravitational force] may be lower than in subsequent purification steps. In some cases, centrifugation may be carried out on cell lysates at from about 200 g to about 800 g, from about 500 g to about 1500 g, from about 1000 g to about 5000 g, from about 1200 g to about 10000 g or from about 8000 g to about 15000 g. In some embodiments, cell lysate centrifugation is carried out at 8000 g for 15 minutes. In some cases, density gradient centrifugation may be carried out in order to partition particulates in the cell lysate by sedimentation rate. Gradients used according to methods of the present disclosure may include, but are not limited to cesium chloride gradients and iodixanol step gradients.Purification: Chromatography

[0282] In some cases, AAV particles may be purified from clarified cell lysates by one or more methods of chromatography. Chromatography refers to any number of methods known in the art for separating out one or more elements from a mixture. Such methods may include, but are not limited to ion exchange chromatography (e.g. cation exchange chromatography and anion exchange chromatography), immunoaffinity chromatography and size-exclusion chromatography. In some embodiments, methods of viral chromatography may include any of those taught in US Patent Nos. 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498 and 7,491,508 or International Publication Nos. WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353 and WO2001023597

[0283] In some embodiments, ion exchange chromatography may be used to isolate viral particles. Ion exchange chromatography is used to bind viral particles based on charge-charge interactions between capsid proteins and charged sites present on a stationary phase, typically a column through which viral preparations (e.g. clarified lysates) are passed. After application of viral preparations, bound viral particles may then be eluted by applying an elution solution to disrupt the charge-charge interactions. Elution solutions may be optimized by adjusting salt concentration and / or pH to enhance recovery of bound viral particles. Depending on the charge of viral capsids being isolated, cation or anion exchange chromatography methods may be selected. Methods of ion exchange chromatography may include, but are not limited to any of those taught in US Patent Nos. 7,419,817, 6,143,548, 7,094,604, 6,593,123, 7,015,026 and 8,137,948.

[0284] In some embodiments, immunoaffinity chromatography may be used. Immunoaffinity chromatography is a form of chromatography that utilizes one or more immune compounds (e.g. antibodies or antibody-related structures) to retain viral particles. Immune compounds may bind specifically to one or more structures on viral particle surfaces, including, but not limited to one or more viral coat protein. In some cases, immune compounds may be specific for a particular viral variant. In some cases, immune compounds may bind to multiple viral variants. In some embodiments, immune compounds may include recombinant single-chain antibodies. Such recombinant single chain antibodies may include those described in Smith, R.H. et al., 2009. Mol. Ther. 17(11):1888-96 entirety. Such immune compounds are capable of binding to several AAV capsid variants, including, but not limited to AAV1, AAV2, AAV6 and AAV8.

[0285] In some embodiments, size-exclusion chromatography (SEC) may be used. SEC may comprise the use of a gel to separate particles according to size. In viral particle purification, SEC filtration is sometimes referred to as "polishing." In some cases, SEC may be carried out to generate a final product that is near-homogenous. Such final products may in some cases be used in pre-clinical studies and / or clinical studies (Kotin, R.M. 2011. Human Molecular Genetics. 20(1):R2-R6.) In some cases, SEC may be carried out according to any of the methods taught in US Patent Nos. 6,143,548, 7,015,026, 8,476,418, 6,410,300, 8,476,418, 7,419,817, 7,094,604, 6,593,123, and 8,137,948.

[0286] In one embodiment, the compositions comprising at least one AAV particle may be isolated or purified using the methods described in US Patent No. US 6146874

[0287] In one embodiment, the compositions comprising at least one AAV particle may be isolated or purified using the methods described in US Patent No. US 6660514.

[0288] In one embodiment, the compositions comprising at least one AAV particle may be isolated or purified using the methods described in US Patent No. US 8283151.

[0289] In one embodiment, the compositions comprising at least one AAV particle may be isolated or purified using the methods described in US Patent No. US 8524446.II. FORMULATION AND DELIVERY Pharmaceutical Compositions and Formulation

[0290] Although the descriptions of pharmaceutical compositions, e.g., those modulatory polynucleotides (including the encoding plasmids or expression vectors, such as viruses, e.g., AAV) comprising a payload to be delivered, provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys.

[0291] Compositions may be administered to humans, human patients or subjects. For the purposes of the present disclosure, the phrase "active ingredient" generally refers either to the viral vector carrying the payload or to the modulatory polynucleotide payload molecule delivered by a viral vector as described herein.

[0292] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping and / or packaging the product into a desired single- or multi-dose unit.

[0293] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the invention will vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered.

[0294] The modulatory polynucleotides or viral vectors encoding them can be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection or transduction; (3) permit the sustained or delayed release; or (4) alter the biodistribution (e.g., target the viral vector to specific tissues or cell types).

[0295] Formulations of the present invention can include, without limitation, saline, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with viral vectors (e.g., for transplantation into a subject), nanoparticle mimics and combinations thereof. Further, the viral vectors of the present invention may be formulated using self-assembled nucleic acid nanoparticles.

[0296] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of associating the active ingredient with an excipient and / or one or more other accessory ingredients.

[0297] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a "unit dose" refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

[0298] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure may vary, depending upon the identity, size, and / or condition of the subject being treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise between 0.1% and 99% (w / w) of the active ingredient. By way of example, the composition may comprise between 0.1% and 100%, e.g., between .5 and 50%, between 1-30%, between 5-80%, at least 80% (w / w) active ingredient.

[0299] In some embodiments, the formulations described herein may contain at least one payload molecule. As a non-limiting example, the formulations may contain 1, 2, 3, 4 or 5 modulatory polynucleotide payload molecules. In one embodiment the formulation may contain a modulatory polynucleotide payload construct targeting proteins selected from categories such as, but not limited to, human proteins, veterinary proteins, bacterial proteins, biological proteins, antibodies, immunogenic proteins, therapeutic peptides and proteins, secreted proteins, plasma membrane proteins, cytoplasmic and cytoskeletal proteins, intracellular membrane bound proteins, nuclear proteins, proteins associated with human disease and / or proteins associated with non-human diseases. In one embodiment, the formulation contains at least three payload construct targeting proteins.

[0300] In some embodiments, a pharmaceutically acceptable excipient may be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, an excipient is approved for use for humans and for veterinary use. In some embodiments, an excipient may be approved by the United States Food and Drug Administration. In some embodiments, an excipient may be of pharmaceutical grade. In some embodiments, an excipient may meet the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.

[0301] Excipients, which, as used herein, includes, but is not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21 st< Edition, A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, MD, 2006). The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.

[0302] Exemplary diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch, powdered sugar, etc., and / or combinations thereof.Inactive Ingredients

[0303] In some embodiments, modulatory polynucleotide formulations may comprise at least one excipient which is an inactive ingredient. As used herein, the term "inactive ingredient" refers to one or more inactive agents included in formulations. In some embodiments, all, none or some of the inactive ingredients which may be used in the formulations of the present invention may be approved by the US Food and Drug Administration (FDA).

[0304] Formulations of viral vectors carrying modulatory polynucleotide disclosed herein may include cations or anions. In one embodiment, the formulations include metal cations such as, but not limited to, Zn2+, Ca2+, Cu2+, Mg+ and combinations thereof. As a non-limiting example, formulations may include polymers and modulatory polynucleotides complexed with a metal cation (See e.g., U.S. Pat. Nos. 6,265,389 and 6,555,525Delivery

[0305] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for the delivery of AAV virions described in European Patent Application No. EP1857552.

[0306] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering proteins using AAV vectors described in European Patent Application No. EP2678433

[0307] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering DNA molecules using AAV vectors described in US Patent No. US 5858351

[0308] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering DNA to the bloodstream described in US Patent No. US 6211163

[0309] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering AAV virions described in US Patent No. US 6325998.

[0310] viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering DNA to muscle cells described in US Patent No. US 6335011.

[0311] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering DNA to muscle cells and tissues described in US Patent No. US 6610290

[0312] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering DNA to muscle cells described in US Patent No. US 7704492.

[0313] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering a payload to skeletal muscles described in US Patent No. US 7112321.

[0314] A viral vector may be administered or delivered using the methods for delivering a payload to the central nervous system described in US Patent No. US 7588757.

[0315] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering a payload described in US Patent No. US 8283151.

[0316] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering a payload for the treatment of Alzheimer disease described in US Patent No. US 8318687.

[0317] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering a payload described in International Patent Publication No. WO2012144446.

[0318] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering a payload using a glutamic acid decarboxylase (GAD) delivery vector described in International Patent Publication No. WO2001089583.

[0319] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering a payload described in International Patent Publication No. WO2001096587.

[0320] A the viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering a payload to muscle tissue described in International Patent Publication No. WO2002014487.

[0321] A viral vector comprising a modulatory polynucleotide may be administered or delivered using the methods for delivering a payload to neural cells described in International Patent Publication No. WO2012057363.

[0322] The pharmaceutical compositions of viral vectors described herein may be characterized by one or more of bioavailability, therapeutic window and / or volume of distribution.

[0323] In one embodiment, the viral vectors comprising a modulatory polynucleotide may be formulated. As a non-limiting example the baricity and / or osmolality of the formulation may be optimized to ensure optimal drug distribution in the central nervous system or a region or component of the central nervous system.

[0324] Viral vectors comprising a modulatory polynucleotide may be delivered to a subject via a single route administration.

[0325] The viral vectors comprising a modulatory polynucleotide may be delivered to a subject via a multi-site route of administration. A subject may be administered the viral vectors comprising a modulatory polynucleotide at 2, 3, 4, 5 or more than 5 sites.

[0326] A subject may be administered a viral vectors comprising a modulatory polynucleotide using a bolus infusion.

[0327] A subject may be administered a viral vectors comprising a modulatory polynucleotide using sustained delivery over a period of minutes, hours or days. The infusion rate may be changed depending on the subject, distribution, formulation or another delivery parameter.

[0328] The catheter may be located at more than one site in the spine for multi-site delivery. Viral vectors comprising a modulatory polynucleotide may be delivered in a continuous and / or bolus infusion. Each site of delivery may be a different dosing regimen or the same dosing regimen may be used for each site of delivery. As a non-limiting example, the sites of delivery may be in the cervical and the lumbar region. As another non-limiting example, the sites of delivery may be in the cervical region. As another non-limiting example, the sites of delivery may be in the lumbar region.

[0329] A subject may be analyzed for spinal anatomy and pathology prior to delivery of the viral vectors comprising a modulatory polynucleotide described herein. As a non-limiting example, a subject with scoliosis may have a different dosing regimen and / or catheter location compared to a subject without scoliosis.

[0330] The orientation of the spine subject during delivery of the viral vectors comprising a modulatory polynucleotide may be vertical to the ground.

[0331] The orientation of the spine of the subject during delivery of the viral vectors comprising a modulatory polynucleotide may be horizontal to the ground.

[0332] The spine of the subject may be at an angle as compared to the ground during the delivery of the viral vectors comprising a modulatory polynucleotide subject. The angle of the spine of the subject as compared to the ground may be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 or 180 degrees.

[0333] The delivery method and duration may be chosen to provide broad transduction in the spinal cord. As a non-limiting example, intrathecal delivery is used to provide broad transduction along the rostral-caudal length of the spinal cord. As another non-limiting example, multi-site infusions provide a more uniform transduction along the rostral-caudal length of the spinal cord. As yet another non-limiting example, prolonged infusions provide a more uniform transduction along the rostral-caudal length of the spinal cord.Introduction into cells

[0334] The modulatory polynucleotides of the invention can be introduced into host cells using any of a variety of approaches. Infection with a viral vector comprising the modulatory polynucleotide can be affected. Examples of suitable viral vectors include replication defective retroviral vectors, adenoviral vectors, adeno-associated vectors and lentiviral vectors.

[0335] According to the present invention, viral vectors for use in therapeutics and / or diagnostics comprise a virus that has been distilled or reduced to the minimum components necessary for transduction of a nucleic acid payload or cargo of interest.

[0336] In this manner, viral vectors are engineered as vehicles for specific delivery while lacking the deleterious replication and / or integration features found in wild-type virus.

[0337] As used herein, a "vector" is any molecule or moiety which transports, transduces or otherwise acts as a carrier of a heterologous molecule such as the modulatory polynucleotides of the invention. A "viral vector" is a vector which comprises one or more polynucleotide regions encoding or comprising payload molecules of interest, e.g., a transgene, a polynucleotide encoding a polypeptide or multi-polypeptide or a modulatory nucleic acid. Viral vectors of the present invention may be produced recombinantly and may be based on adeno-associated virus (AAV) parent or reference sequences. Serotypes which may be useful in the present invention include any of those arising from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ, AAV-DJ8, AAV-PHP.A and / or AAV-PHP.B.

[0338] In one embodiment, the serotype which may be useful in the present invention may be AAV-DJ8. The amino acid sequence of AAV-DJ8 may comprise two or more mutations in order to remove the heparin binding domain (HBD). As a non-limiting example, the AAV-DJ sequence described as SEQ ID NO: 1 in US Patent No. 7,588,772. may comprise two mutations: (1) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (2) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr). As another non-limiting example, may comprise three mutations: (1) K406R where lysine (K; Lys) at amino acid 406 is changed to arginine (R; Arg), (2) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (3) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).

[0339] AAV vectors may also comprise self-complementary AAV vectors (scAAVs). scAAV vectors contain both DNA strands which anneal together to form double stranded DNA. By skipping second strand synthesis, scAAVs allow for rapid expression in the cell.

[0340] In one embodiment, the AAV vector used in the present invention is a scAAV.

[0341] Modulatory polynucleotides may be introduced into cells from any relevant species, such as, but not limited to, human, dog, mouse, rat or monkey.

[0342] Modulatory polynucleotides may be introduced into cells which are relevant to the disease to be treated. As a non-limiting example, the disease is ALS and the target cells are motor neurons and astrocytes.

[0343] Modulatory polynucleotides may be introduced into cells which have a high level of endogenous expression of the target sequence.

[0344] Modulatory polynucleotides may be introduced into cells which have a low level of endogenous expression of the target sequence.

[0345] The cells may be those which have a high efficiency of AAV transduction.

[0346] The cells which may be used for in vitro analysis of the modulatory polynucleotides include, but are not limited to, HEK293, HeLa, human primary astrocytes, human astrocyte cell line (U251MG), SH-SY5Y-neurons and human iPSC-derived motor neuron progenitors.III. ADMINISTRATION AND DOSING Administration

[0347] The viral vectors comprising modulatory polynucleotides of the present invention may be administered by any route which results in a therapeutically effective outcome. These include, but are not limited to enteral (into the intestine), gastroenteral, epidural (into the dura matter), oral (by way of the mouth), transdermal, peridural, intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into a vein), intravenous bolus, intravenous drip, intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), subpial (between the pia and the underlying tissue), intraperitoneal, (infusion or injection into the peritoneum), intravesical infusion, intravitreal, (through the eye), intracavernous injection (into a pathologic cavity) intracavitary (into the base of the penis), intravaginal administration, intrauterine, extra-amniotic administration, transdermal (diffusion through the intact skin for systemic distribution), transmucosal (diffusion through a mucous membrane), transvaginal, insufflation (snorting), sublingual, sublabial, enema, eye drops (onto the conjunctiva), in ear drops, auricular (in or by way of the ear), buccal (directed toward the cheek), conjunctival, cutaneous, dental (to a tooth or teeth), electro-osmosis, endocervical, endosinusial, endotracheal, extracorporeal, hemodialysis, infiltration, interstitial, intra-abdominal, intra-amniotic, intra-articular, intrabiliary, intrabronchial, intrabursal, intracartilaginous (within a cartilage), intracaudal (within the cauda equine), intracisternal (within the cisterna magna cerebellomedularis), intracorneal (within the cornea), dental intracomal, intracoronary (within the coronary arteries), intracorporus cavemosum (within the dilatable spaces of the corporus cavernosa of the penis), intradiscal (within a disc), intraductal (within a duct of a gland), intraduodenal (within the duodenum), intradural (within or beneath the dura), intraepidermal (to the epidermis), intraesophageal (to the esophagus), intragastric (within the stomach), intragingival (within the gingivae), intraileal (within the distal portion of the small intestine), intralesional (within or introduced directly to a localized lesion), intraluminal (within a lumen of a tube), intralymphatic (within the lymph), intramedullary (within the marrow cavity of a bone), intrameningeal (within the meninges), intraocular (within the eye), intraovarian (within the ovary), intrapericardial (within the pericardium), intrapleural (within the pleura), intraprostatic (within the prostate gland), intrapulmonary (within the lungs or its bronchi), intrasinal (within the nasal or periorbital sinuses), intraspinal (within the vertebral column), intrasynovial (within the synovial cavity of a joint), intratendinous (within a tendon), intratesticular (within the testicle), intrathecal (within the cerebrospinal fluid at any level of the cerebrospinal axis), intrathoracic (within the thorax), intratubular (within the tubules of an organ), intratumor (within a tumor), intratympanic (within the aurus media), intravascular (within a vessel or vessels), intraventricular (within a ventricle), iontophoresis (by means of electric current where ions of soluble salts migrate into the tissues of the body), irrigation (to bathe or flush open wounds or body cavities), laryngeal (directly upon the larynx), nasogastric (through the nose and into the stomach), occlusive dressing technique (topical route administration which is then covered by a dressing which occludes the area), ophthalmic (to the external eye), oropharyngeal (directly to the mouth and pharynx), parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, respiratory (within the respiratory tract by inhaling orally or nasally for local or systemic effect), retrobulbar (behind the pons or behind the eyeball), soft tissue, subarachnoid, subconjunctival, submucosal, topical, transplacental (through or across the placenta), transtracheal (through the wall of the trachea), transtympanic (across or through the tympanic cavity), ureteral (to the ureter), urethral (to the urethra), vaginal, caudal block, diagnostic, nerve block, biliary perfusion, cardiac perfusion, photopheresis or spinal. Compositions may be administered in a way which allows them to cross the blood-brain barrier, vascular barrier, or other epithelial barrier. A formulation for a route of administration may include at least one inactive ingredient.Dosing

[0348] The present invention provides modulatory polynucleotides, viral vectors or pharmaceutical compositions as claimed for use in methods comprising administering viral vectors and their modulatory polynucleotide payload or complexes to a subject in need thereof. Viral vector pharmaceutical, imaging, diagnostic, or prophylactic compositions thereof, may be administered to a subject using any amount and any route of administration effective for preventing, treating, diagnosing, or imaging a disease, disorder, and / or condition (e.g., a disease, disorder, and / or condition relating to working memory deficits). The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. Compositions in accordance with the invention are typically formulated in unit dosage form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present invention may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific modulatory polynucleotide payload employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts.

[0349] Viral vector pharmaceutical compositions in accordance with the present invention may be administered at modulatory polynucleotide dosage levels sufficient to deliver from about 0.0001 mg / kg to about 100 mg / kg, from about 0.001 mg / kg to about 0.05 mg / kg, from about 0.005 mg / kg to about 0.05 mg / kg, from about 0.001 mg / kg to about 0.005 mg / kg, from about 0.05 mg / kg to about 0.5 mg / kg, from about 0.01 mg / kg to about 50 mg / kg, from about 0.1 mg / kg to about 40 mg / kg, from about 0.5 mg / kg to about 30 mg / kg, from about 0.01 mg / kg to about 10 mg / kg, from about 0.1 mg / kg to about 10 mg / kg, or from about 1 mg / kg to about 25 mg / kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic, diagnostic, prophylactic, or imaging effect (see e.g., the range of unit doses described in International Publication No WO2013078199). The desired modulatory polynucleotide dosage may be delivered more than once (e.g., more than one administration in a day). The desired modulatory polynucleotide dosage may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). When multiple administrations are employed, split dosing regimens such as those described herein may be used. As used herein, a "split dose" is the division of single unit dose or total daily dose into two or more doses, e.g., two or more administrations of the single unit dose. As used herein, a "single unit dose" is a dose of any modulatory polynucleotide therapeutic administered in one dose / at one time / single route / single point of contact, i.e., single administration event. As used herein, a "total daily dose" is an amount given or prescribed in 24 hour period. It may be administered as a single unit dose. The viral vectors comprising the modulatory polynucleotides of the present invention may be administered to a subject in split doses. They may be formulated in buffer only or in a formulation described herein.

[0350] Delivery of the compositions to cells may comprise a rate of delivery defined by [VG / hour = mL / hour * VG / mL] wherein VG is viral genomes, VG / mL is composition concentration, and mL / hour is rate of prolonged delivery.

[0351] Delivery of compositions to cells may comprise a total concentration per subject between about 1x10 6< VG and about 1x10 16< VG. In some embodiments, delivery may comprise a composition concentration of about 1x10 6< , 2x10 6< , 3x10 6< , 4x10 6< , 5x10 6< , 6x10 6< , 7x10 6< , 8x10 6< , 9x10 6< , 1x10 7< , 2x10 7< , 3x10 7< , 4x10 7< , 5x10 7< , 6x10 7< , 7x10 7< , 8x10 7< , 9x10 7< , 1x10 8< , 2x10 8< , 3x10 8< , 4x10 8< , 5x10 8< , 6x10 8< , 7x10 8< , 8x10 8< , 9x10 8< , 1x10 9< , 2x10 9< , 3x10 9< , 4x10 9< , 5x10 9< , 6x10 9< , 7x10 9< , 8x10 9< , 9x10 9< , 1x10 10< , 2x10 10< , 3x10 10< , 4x10 10< , 5x10 10< , 6x10 10< , 7x10 10< , 8x10 10< , 9x10 10< , 1x10 11< , 1.1x10 11< , 1.2x10 11< , 1.3x10 11< , 1.4x10 11< , 1.5x10 11< , 1.6x10 11< , 1.7x10 11< , 1.8x10 11< , 1.9x10 11< , 2x10 11< , 2.1x10 11< , 2.2x10 11< , 2.3x10 11< , 2.4x10 11< , 2.5x10 11< , 2.6x10 11< , 2.7x10 11< , 2.8x10 11< , 2.9x10 11< , 3x10 11< , 4x10 11< , 5x10 11< , 6x10 11< , 7x10 11< , 7.1x10 11< , 7.2x10 11< , 7.3x10 11< , 7.4x10 11< , 7.5x10 11< , 7.6x10 11< , 7.7x10 11< , 7.8x10 11< , 7.9x10 11< , 8x10 11< , 9x10 11< , 1x10 12< , 1.1 x10 12< , 1.2x10 12< , 1.3x10 12< , 1.4x10 12< , 1.5x10 12< , 1.6x10 12< , 1.7x10 12< , 1.8x10 12< , 1.9x10 12< , 2x10 12< , 2.1x10 12< , 2.2x10 12< , 2.3x10 12< , 2.4x10 12< , 2.5x10 12< , 2.6x10 12< , 2.7x10 12< , 2.8x10 12< , 2.9x10 12< , 3x10 12< , 3.1x10 12< , 3.2x10 12< , 3.3x10 12< , 3.4x10 12< , 3.5x10 12< , 3.6x10 12< , 3.7x10 12< , 3.8x10 12< , 3.9x10 12< , 4x10 12< , 4.1x10 12< , 4.2x10 12< , 4.3x10 12< , 4.4x10 12< , 4.5x10 12< ,4.6x10 12< , 4.7x10 12< , 4.8x10 12< , 4.9x10 12< , 5x10 12< , 6x10 12< , 6.1x10 12< , 6.2x10 12< , 6.3x10 12< , 6.4x10 12< , 6.5x10 12< , 6.6x10 12< , 6.7x10 12< , 6.8x10 12< , 6.9x10 12< , 7x10 12< , 8x10 12< , 8.1x10 12< , 8.2x10 12< , 8.3x10 12< , 8.4x10 12< , 8.5x10 12< , 8.6x10 12< , 8.7x10 12< , 8.8 x10 12< , 8.9x10 12< , 9x10 12< , 1x10 13< , 1.1x10 13< , 1.2x10 13< , 1.3x10 13< , 1.4x10 13< , 1.5x10 13< , 1.6x10 13< , 1.7x10 13< , 1.8x10 13< , 1.9x10 13< , 2x10 13< , 3x10 13< , 4x10 13< , 5x10 13< , 6x10 13< , 6.7x10 13< , 7x10 13< , 8x10 13< , 9x10 13< , 1x10 14< , 2x10 14< , 3x10 14< , 4x10 14< , 5x10 14< , 6x10 14< , 7x10 14< , 8x10 14< , 9x10 14< , 1x10 15< , 2x10 15< , 3x10 15< , 4x10 15< , 5x10 15< , 6x10 15< , 7x10 15< , 8x10 15< , 9x10 15< , or 1x10 16< VG / subject.

[0352] Delivery of compositions to cells may comprise a total concentration per subject between about 1x10 6< VG / kg and about 1x10 16< VG / kg. In some embodiments, delivery may comprise a composition concentration of about 1x10 6< , 2x10 6< , 3x10 6< , 4x10 6< , 5x10 6< , 6x10 6< , 7x10 6< , 8x10 6< , 9x10 6< , 1x10 7< , 2x10 7< , 3x10 7< , 4x10 7< , 5x10 7< , 6x10 7< , 7x10 7< , 8x10 7< , 9x10 7< , 1x10 8< , 2x10 8< , 3x10 8< , 4x10 8< , 5x10 8< , 6x10 8< , 7x10 8< , 8x10 8< , 9x10 8< , 1x10 9< , 2x10 9< , 3x10 9< , 4x10 9< , 5x10 9< , 6x10 9< , 7x10 9< , 8x10 9< , 9x10 9< , 1x10 10< , 2x10 10< , 3x10 10< , 4x10 10< , 5x10 10< , 6x10 10< , 7x10 10< , 8x10 10< , 9x10 10< , 1x10 11< , 1.1x10 11< , 1.2x10 11< , 1.3x10 11< , 1.4x10 11< , 1.5x10 11< , 1.6x10 11< , 1.7x10 11< , 1.8x10 11< , 1.9x10 11< , 2x10 11< , 2.1x10 11< , 2.2x10 11< , 2.3x10 11< , 2.4x10 11< , 2.5x10 11< , 2.6x10 11< , 2.7x10 11< , 2.8x10 11< , 2.9x10 11< , 3x10 11< , 4x10 11< , 5x10 11< , 6x10 11< , 7x10 11< , 7.1x10 11< , 7.2x10 11< , 7.3x10 11< , 7.4x10 11< , 7.5x10 11< , 7.6x10 11< , 7.7x10 11< , 7.8x10 11< , 7.9x10 11< , 8x10 11< , 9x10 11< , 1x10 12< , 1.1 x10 12< , 1.2x10 12< , 1.3x10 12< , 1.4x10 12< , 1.5x10 12< , 1.6x10 12< , 1.7x10 12< , 1.8x10 12< , 1.9x10 12< , 2x10 12< , 2.1x10 12< , 2.2x10 12< , 2.3x10 12< , 2.4x10 12< , 2.5x10 12< , 2.6x10 12< , 2.7x10 12< , 2.8x10 12< , 2.9x10 12< , 3x10 12< , 3.1x10 12< , 3.2x10 12< , 3.3x10 12< , 3.4x10 12< , 3.5x10 12< , 3.6x10 12< , 3.7x10 12< , 3.8x10 12< , 3.9x10 12< , 4x10 12< , 4.1x10 12< , 4.2x10 12< , 4.3x10 12< , 4.4x10 12< , 4.5x10 12< ,4.6x10 12< , 4.7x10 12< , 4.8x10 12< , 4.9x10 12< , 5x10 12< , 6x10 12< , 6.1x10 12< , 6.2x10 12< , 6.3x10 12< , 6.4x10 12< , 6.5x10 12< , 6.6x10 12< , 6.7x10 12< , 6.8x10 12< , 6.9x10 12< , 7x10 12< , 8x10 12< , 8.1x10 12< , 8.2x10 12< , 8.3x10 12< , 8.4x10 12< , 8.5x10 12< , 8.6x10 12< , 8.7x10 12< , 8.8 x10 12< , 8.9x10 12< , 9x10 12< , 1x10 13< , 1.1x10 13< , 1.2x10 13< , 1.3x10 13< , 1.4x10 13< , 1.5x10 13< , 1.6x10 13< , 1.7x10 13< , 1.8x10 13< , 1.9x10 13< , 2x10 13< , 3x10 13< , 4x10 13< , 5x10 13< , 6x10 13< , 6.7x10 13< , 7x10 13< , 8x10 13< , 9x10 13< , 1x10 14< , 2x10 14< , 3x10 14< , 4x10 14< , 5x10 14< , 6x10 14< , 7x10 14< , 8x10 14< , 9x10 14< , 1x10 15< , 2x10 15< , 3x10 15< , 4x10 15< , 5x10 15< , 6x10 15< , 7x10 15< , 8x10 15< , 9x10 15< , or 1x10 16< VG / kg.

[0353] For example, about 10 5< to 10 6< viral genome (unit) may be administered per dose.

[0354] Delivery of the compositions to cells may comprise a total concentration between about 1x10 6< VG / mL and about 1x10 16< VG / mL. In some embodiments, delivery may comprise a composition concentration of about 1x10 6< , 2x10 6< , 3x10 6< , 4x10 6< , 5x10 6< , 6x10 6< , 7x10 6< , 8x10 6< , 9x10 6< , 1x10 7< , 2x10 7< , 3x10 7< , 4x10 7< , 5x10 7< , 6x10 7< , 7x10 7< , 8x10 7< , 9x10 7< , 1x10 8< , 2x10 8< , 3x10 8< , 4x10 8< , 5x10 8< , 6x10 8< , 7x10 8< , 8x10 8< , 9x10 8< , 1x10 9< , 2x10 9< , 3x10 9< , 4x10 9< , 5x10 9< , 6x10 9< , 7x10 9< , 8x10 9< , 9x10 9< , 1x10 10< , 2x10 10< , 3x10 10< , 4x10 10< , 5x10 10< , 6x10 10< , 7x10 10< , 8x10 10< , 9x10 10< , 1x10 11< , 1.1x10 11< , 1.2x10 11< , 1.3x10 11< , 1.4x10 11< , 1.5x10 11< , 1.6x10 11< , 1.7x10 11< , 1.8x10 11< , 1.9x10 11< , 2x10 11< , 3x10 11< , 4x10 11< , 5x10 11< , 6x10 11< , 7x10 11< , 8x10 11< , 9x10 11< , 1x10 12< , 1.1x10 12< , 1.2x10 12< , 1.3x10 12< , 1.4x10 12< , 1.5x10 12< , 1.6x10 12< , 1.7x10 12< , 1.8x10 12< , 1.9x10 12< , 2x10 12< , 2.1x10 12< , 2.2x10 12< , 2.3x10 12< , 2.4x10 12< , 2.5x10 12< , 2.6x10 12< , 2.7x10 12< , 2.8x10 12< , 2.9x10 12< , 3x10 12< , 3.1x10 12< , 3.2x10 12< , 3.3x10 12< , 3.4x10 12< , 3.5x10 12< , 3.6x10 12< , 3.7x10 12< , 3.8x10 12< , 3.9x10 12< , 4x10 12< , 4.1x10 12< , 4.2x10 12< , 4.3x10 12< , 4.4x10 12< , 4.5x10 12< , 4.6x10 12< , 4.7x10 12< , 4.8x10 12< , 4.9x10 12< , 5x10 12< , 6x10 12< , 6.1x10 12< , 6.2x10 12< , 6.3x10 12< , 6.4x10 12< , 6.5x10 12< , 6.6x10 12< , 6.7x10 12< , 6.8x10 12< , 6.9x10 12< , 7x10 12< , 8x10 12< , 9x10 12< , 1x10 13< , 1.1x10 13< , 1.2x10 13< , 1.3x10 13< , 1.4x10 13< , 1.5x10 13< , 1.6x10 13< , 1.7x10 13< , 1.8x10 13< , 1.9x10 13< , 2x10 13< , 3x10 13< , 4x10 13< , 5x10 13< , 6x10 13< , 6.7x10 13< , 7x10 13< , 8x10 13< , 9x10 13< , 1x10 14< , 2x10 14< , 3x10 14< , 4x10 14< , 5x10 14< , 6x10 14< , 7x10 14< , 8x10 14< , 9x10 14< , 1x10 15< , 2x10 15< , 3x10 15< , 4x10 15< , 5x10 15< , 6x10 15< , 7x10 15< , 8x10 15< , 9x10 15< , or 1x10 16< VG / mL.Bioavailability

[0355] Viral vectors comprising a modulatory polynucleotide of the present invention, when formulated into compositions with delivery / formulation agents or vehicles as described herein, may exhibit increased bioavailability as compared to compositions lacking delivery agents as described herein. As used herein, the term "bioavailability" refers to the systemic availability of a given amount of a particular agent administered to a subject. Bioavailability may be assessed by measuring the area under the curve (AUC) or the maximum serum or plasma concentration (C max ) of the unchanged form of a compound following administration of the compound to a mammal. AUC is a determination of the area under the curve plotting the serum or plasma concentration of a compound along the ordinate (Y-axis) against time along the abscissa (X-axis). Generally, the AUC for a particular compound may be calculated using methods known to those of ordinary skill in the art and as described in G. S. Banker, Modern Pharmaceutics, Drugs and the Pharmaceutical Sciences, v. 72, Marcel Dekker, New York, Inc., 1996

[0356] C max values are maximum concentrations of compounds achieved in serum or plasma of a subject following administration of compounds to the subject. C max values of particular compounds may be measured using methods known to those of ordinary skill in the art. As used herein, the phrases "increasing bioavailability" or "improving the pharmacokinetics," refer to actions that may increase the systemic availability of a viral vector of the present invention (as measured by AUC, C max , or C min ) in a subject. For example, such actions may comprise co-administration with one or more delivery agents as described herein. In some embodiments, the bioavailability of viral vectors may increase by at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100%.Therapeutic window

[0357] Viral vectors comprising a modulatory polynucleotide of the present invention, when formulated with one or more delivery agents as described herein, may exhibit increases in the therapeutic window of compound and / or composition administration as compared to the therapeutic window of viral vectors administered without one or more delivery agents as described herein. As used herein, the term "therapeutic window" refers to the range of plasma concentrations, or the range of levels of therapeutically active substance at the site of action, with a high probability of eliciting a therapeutic effect. For example, therapeutic windows of viral vectors when administered in a formulation may increase by at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100%.Volume of distribution

[0358] Viral vectors comprising a modulatory polynucleotide of the present invention, when formulated with one or more delivery agents as described herein, may exhibit an improved volume of distribution (V dist ), e.g., reduced or targeted, relative to formulations lacking one or more delivery agents as described herein. V dist relates the amount of an agent in the body to the concentration of the same agent in the blood or plasma. As used herein, the term "volume of distribution" refers to the fluid volume that would be required to contain the total amount of an agent in the body at the same concentration as in the blood or plasma: V dist equals the amount of an agent in the body / concentration of the agent in blood or plasma. For example, for a 10 mg dose of a given agent and a plasma concentration of 10 mg / L, the volume of distribution would be 1 liter. The volume of distribution reflects the extent to which an agent is present in the extravascular tissue. Large volumes of distribution reflect the tendency of agents to bind to the tissue components as compared with plasma proteins. In clinical settings, V dist may be used to determine loading doses to achieve steady state concentrations. For example, volumes of distribution of viral vector compositions of the present invention when co-administered with one or more delivery agents as described herein may decrease at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%.Combinations

[0359] The viral vectors comprising the modulatory polynucleotide may be used in combination with one or more other therapeutic, prophylactic, diagnostic, or imaging agents. By "in combination with," it is not intended to imply that the agents must be administered at the same time and / or formulated for delivery together, although these methods of delivery are within the scope of the present disclosure. Compositions can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and / or on a time schedule determined for that agent. In some embodiments, the present disclosure encompasses the delivery of pharmaceutical, prophylactic, diagnostic, or imaging compositions in combination with agents that may improve their bioavailability, reduce and / or modify their metabolism, inhibit their excretion, and / or modify their distribution within the body.IV. METHODS OF USE Reduce Expression of a Target Gene

[0360] In some embodiments, the present invention provides modulatory polynucleotides, viral vectors or pharmaceutical compositions as claimed for use in methods for inhibiting / silencing gene expression in a cell. Accordingly, the modulatory polynucleotides encoding siRNA duplexes or encoded dsRNA can be used to substantially inhibit gene expression in a cell, in particular in a neuron. In some aspects, the inhibition of gene expression refers to an inhibition by at least about 15%, such as by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%. Accordingly, the protein product of the targeted gene may be inhibited by at least about 15%, preferably by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%.

[0361] In some embodiments, the present invention provides modulatory polynucleotides, viral vectors or pharmaceutical compositions as claimed for use in methods for inhibiting / silencing gene expression in a cell, in particular in a medium spiny neuron. In some aspects, the inhibition of gene expression refers to an inhibition by at least about 15%, such as by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%. Accordingly, the protein product of the targeted gene may be inhibited by at least about 15%, preferably by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%.

[0362] In some embodiments, the present invention provides modulatory polynucleotides, viral vectors or pharmaceutical compositions as claimed for use in methods for inhibiting / silencing gene expression in a cell, in particular in a motor neuron. In some aspects, the inhibition of gene expression refers to an inhibition by at least about 15%, such as by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%. Accordingly, the protein product of the targeted gene may be inhibited by at least about 15%, preferably by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%.

[0363] In some embodiments, the present invention provides modulatory polynucleotides, viral vectors or pharmaceutical compositions as claimed for use in methods for inhibiting / silencing gene expression in a cell, in particular in an astrocyte. In some aspects, the inhibition of gene expression refers to an inhibition by at least about 15%, such as by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%. Accordingly, the protein product of the targeted gene may be inhibited by at least about 15%, preferably by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%.

[0364] A siRNA duplexes or encoded dsRNA may be used to reduce the expression of protein by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%. As a non-limiting example, the expression of protein expression may be reduced by 50-90%. As a non-limiting example, the expression of protein expression may be reduced by 30-70%. As a non-limiting example, the expression of protein expression may be reduced by 20-70%. As a nonlimting example, the expression of protein expression may be reduced by 15-30%.

[0365] Modulatory polynucleotides encoding siRNA duplexes or encoded dsRNA may be used to reduce the expression of mRNA by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%. As a non-limiting example, the expression of mRNA expression may be reduced by 50-90%. As a non-limiting example, the expression of mRNA expression may be reduced by30-70%. As a non-limiting example, the expression of mRNA expression may be reduced by20-70%. As a non-limiting example, the expression of mRNA expression may be reduced by 15-30%.

[0366] siRNA duplexes or encoded dsRNA may be used to reduce the expression of protein and / or mRNA in at least one region of the CNS such as, but not limited to the midbrain. The expression of protein and / or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100% in at least one region of the CNS. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 50-90%. As a non-limiting example, the expression of protein and mRNA in the striatum is reduced by 40-50%. As a non-limiting example, the expression of protein and mRNA in the striatum is reduced by 20-50%. As a non-limiting example, the expression of protein and mRNA in the striatum is reduced by 15-50%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 40-50%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 30-70%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 20-70%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 15-70%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 20-70%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 20-70%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 15-70%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 40-70%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 40-50%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 50-70%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 50-60%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 50%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 51%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 52%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 53%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 54%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 55%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 56%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 57%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 58%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 59%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 60%.

[0367] Modulatory polynucleotides encoding siRNA duplexes or encoded dsRNA may be used to reduce the expression of protein and / or mRNA in at least one region of the CNS such as, but not limited to the forebrain. The expression of protein and / or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100% in at least one region of the CNS. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 50-90%. As a non-limiting example, the expression of protein and mRNA in the striatum is reduced by 40-50%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 40-50%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 30-70%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 20-70%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 15-70%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 20-70%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 15-70%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 40-70%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 40-50%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 50-70%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 50-60%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 50%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 51%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 52%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 53%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 54%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 55%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 56%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 57%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 58%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 59%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 60%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 61%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 62%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 63%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 64%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 65%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 66%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 67%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 68%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 69%. As a non-limiting example, the expression of protein and mRNA in the striatum and / or cortex is reduced by 70%.

[0368] Modulatory polynucleotides encoding siRNA duplexes or encoded dsRNA may be used to reduce the expression of protein and / or mRNA in the putamen. The expression of protein and / or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100% in at least one region of the CNS. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 40-70%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 40-50%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 50-70%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 50-60%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 50%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 51%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 52%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 53%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 54%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 55%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 56%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 57%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 58%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 59%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 60%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 61%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 62%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 63%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 64%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 65%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 66%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 67%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 68%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 69%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 70%.

[0369] Modulatory polynucleotides encoding siRNA duplexes or encoded dsRNA may be used to reduce the expression of protein and / or mRNA in the cortex. The expression of protein and / or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 40-50%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 30-70%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by at least 30%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 40-70%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 40-50%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 50-70%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 50-60%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 50%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 51%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 52%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 53%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 54%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 55%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 56%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 57%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 58%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 59%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 60%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 61%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 62%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 63%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 64%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 65%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 66%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 67%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 68%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 69%. As a non-limiting example, the expression of protein and mRNA in the cortex is reduced by 70%.

[0370] Modulatory polynucleotides encoding siRNA duplexes or encoded dsRNA may be used to reduce the expression of protein and / or mRNA in the motor cortex. The expression of protein and / or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 40-50%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 30-70%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 20-70%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 15-70%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by at least 30%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 40-70%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 50-70%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 50-60%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 50%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 51%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 52%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 53%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 54%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 55%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 56%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 57%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 58%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 59%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 60%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 61%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 62%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 63%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 64%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 65%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 66%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 67%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 68%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 69%. As a non-limiting example, the expression of protein and mRNA in the motor cortex is reduced by 70%.

[0371] Modulatory polynucleotides encoding siRNA duplexes or encoded dsRNA may be used to reduce the expression of protein and / or mRNA in the somatosensory cortex. The expression of protein and / or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 40-50%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 30-70%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 20-70%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 15-70%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by at least 30%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 40-70%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 50-70%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 50-60%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 50%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 51%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 52%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 53%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 54%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 55%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 56%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 57%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 58%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 59%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 60%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 61%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 62%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 63%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 64%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 65%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 66%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 67%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 68%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 69%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 70%.

[0372] Modulatory polynucleotides encoding siRNA duplexes or encoded dsRNA may be used to reduce the expression of protein and / or mRNA in the temporal cortex. The expression of protein and / or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 40-50%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 30-70%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 20-70%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 15-70%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by at least 30%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 40-70%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 50-70%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 50-60%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 50%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 51%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 52%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 53%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 54%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 55%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 56%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 57%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 58%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 59%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 60%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 61%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 62%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 63%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 64%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 65%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 66%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 67%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 68%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 69%. As a non-limiting example, the expression of protein and mRNA in the temporal cortex is reduced by 70%.

[0373] In some embodiments, the present invention provides modulatory polynucleotides, viral vectors or pharmaceutical compositions as claimed for use in methods for treating, or ameliorating a disease and / or disorder of the central nervous system by inhibiting the expression of a gene and / or protein in a subject in need of treatment, the method comprising administering to the subject a pharmaceutically effective amount of at least one modulatory polynucleotides encoding siRNA duplex or a nucleic acid encoding an siRNA duplex targeting the gene, delivering the modulatory polynucleotides encoding siRNA duplex (or encoded duplex) into targeted cells, inhibiting gene expression and protein production, and ameliorating symptoms of the disease and / or disorder of the central nervous system in the subject.V. KITS AND DEVICES Kits

[0374] Typically kits will comprise sufficient amounts and / or numbers of components to allow a user to perform multiple treatments of a subject(s) and / or to perform multiple experiments.

[0375] Any of the vectors, or modulatory polynucleotides, of the present invention may be comprised in a kit. Kits may further include reagents and / or instructions for creating and / or synthesizing compounds and / or compositions of the present invention. Kits may also include one or more buffers. Kits may include components for making protein or nucleic acid arrays or libraries and thus, may include, for example, solid supports.

[0376] Kit components may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquotted. Where there are more than one kit component, (labeling reagent and label may be packaged together), kits may also generally contain second, third or other additional containers into which additional components may be separately placed. In some embodiments, kits may also comprise second container means for containing sterile, pharmaceutically acceptable buffers and / or other diluents. In some embodiments, various Kits combinations of components may be comprised in one or more vial. Kits may also typically include means for containing compounds and / or compositions e.g., proteins, nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which desired vials are retained.

[0377] Kit components provided in one and / or more liquid solutions. Liquid solutions are aqueous solutions, with sterile aqueous solutions being particularly preferred. Kit components may be provided as dried powder(s). When reagents and / or components are provided as dry powders, such powders may be reconstituted by the addition of suitable volumes of solvent. It is envisioned that solvents may also be provided in another container means. Labeling dyes are provided as dried powders. It is contemplated that 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 micrograms or at least or at most those amounts of dried dye are provided in kits. Dye may then be resuspended in any suitable solvent, such as DMSO.

[0378] Kits may include instructions for employing kit components as well the use of any other reagent not included in the kit. Instructions may include variations that may be implemented.Devices

[0379] Modulatory polynucleotides, vectors and / or compositions of the present invention may be combined with, coated onto or embedded in a device. Devices may include, but are not limited to, dental implants, stents, bone replacements, artificial joints, valves, pacemakers and / or other implantable therapeutic device.

[0380] Devices may incorporate viral vectors that encode one or more modulatory polynucleotide payload molecules. These devices contain in a stable formulation the viral vectors which may be immediately delivered to a subject in need thereof, such as a human patient.

[0381] Devices for administration may be employed to deliver the viral vectors comprising a modulatory polynucleotide of the present invention according to single, multi- or split-dosing regimens taught herein.

[0382] Method and devices known in the art for multi-administration to cells, organs and tissues are contemplated for use in conjunction with the methods and compositions disclosed herein. These include, for example, those methods and devices having multiple needles, hybrid devices employing for example lumens or catheters as well as devices utilizing heat, electric current or radiation driven mechanisms. suitable for use

[0383] The modulatory polynucleotides of the present invention may be used in the treatment, prophylaxis or amelioration of any disease or disorder characterized by aberrant or undesired target expression.VI. DEFINITIONS

[0384] At various places in the present specification, substituents of compounds of the present disclosure are disclosed in groups or in ranges. It is specifically intended that the present disclosure include each and every individual subcombination of the members of such groups and ranges.

[0385] About: As used herein, the term "about" means + / - 10% of the recited value.

[0386] Administered in combination: As used herein, the term "administered in combination" or "combined administration" means that two or more agents are administered to a subject at the same time or within an interval such that there may be an overlap of an effect of each agent on the patient. They may be administered within about 60, 30, 15, 10, 5, or 1 minute of one another. The administrations of the agents may be spaced sufficiently closely together such that a combinatorial (e.g., a synergistic) effect is achieved.

[0387] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. "Animal" may refer to humans at any stage of development. "Animal" may refer to non-human animals at any stage of development. The non-human animal may be a mammal (e.g., a rodent, a mouse, a rat, a rabbit, Animals may a monkey, a dog, a cat, a sheep, cattle, a primate, or a pig). Animals may include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and worms. The animals may be a transgenic animal, genetically-engineered animal, or a clone.

[0388] Approximately: As used herein, the term "approximately" or "about," as applied to one or more values of interest, refers to a value that is similar to a stated reference value. The term "approximately" or "about" may be to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0389] Associated with: As used herein, the terms "associated with," "conjugated," "linked," "attached," and "tethered," when used with respect to two or more moieties, means that the moieties are physically associated or connected with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions. An "association" need not be strictly through direct covalent chemical bonding. It may also suggest ionic or hydrogen bonding or a hybridization based connectivity sufficiently stable such that the "associated" entities remain physically associated.

[0390] Bifunctional: As used herein, the term "bifunctional" refers to any substance, molecule or moiety which is capable of or maintains at least two functions. The functions may affect the same outcome or a different outcome. The structure that produces the function may be the same or different.

[0391] Biocompatible: As used herein, the term "biocompatible" means compatible with living cells, tissues, organs or systems posing little to no risk of injury, toxicity or rejection by the immune system.

[0392] Biodegradable: As used herein, the term "biodegradable" means capable of being broken down into innocuous products by the action of living things.

[0393] Biologically active: As used herein, the phrase "biologically active" refers to a characteristic of any substance that has activity in a biological system and / or organism. For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active. In particular embodiments, a modulatory polynucleotide of the present invention may be considered biologically active if even a portion of the polynucleotides is biologically active or mimics an activity considered biologically relevant.

[0394] Induced pluripotent stem cells: As used herein, "induced pluripotent stem cells" are cells that may be induced to form any of several distinct cell types.

[0395] Compound: As used herein, the term "compound," is meant to include all stereoisomers, geometric isomers, tautomers, and isotopes of the structures depicted.

[0396] The compounds described herein can be asymmetric (e.g., having one or more stereocenters). All stereoisomers, such as enantiomers and diastereomers, are intended unless otherwise indicated. Compounds of the present disclosure that contain asymmetrically substituted carbon atoms can be isolated in optically active or racemic forms. Methods on how to prepare optically active forms from optically active starting materials are known in the art, such as by resolution of racemic mixtures or by stereoselective synthesis. Many geometric isomers of olefins, C=N double bonds, and the like can also be present in the compounds described herein, and all such stable isomers are contemplated in the present disclosure. Cis and trans geometric isomers of the compounds of the present disclosure are described and may be isolated as a mixture of isomers or as separated isomeric forms.

[0397] Compounds of the present disclosure also include tautomeric forms. Tautomeric forms result from the swapping of a single bond with an adjacent double bond and the concomitant migration of a proton. Tautomeric forms include prototropic tautomers which are isomeric protonation states having the same empirical formula and total charge.

[0398] Compounds of the present disclosure also include all of the isotopes of the atoms occurring in the intermediate or final compounds. "Isotopes" refers to atoms having the same atomic number but different mass numbers resulting from a different number of neutrons in the nuclei. For example, isotopes of hydrogen include tritium and deuterium.

[0399] The compounds and salts of the present disclosure can be prepared in combination with solvent or water molecules to form solvates and hydrates by routine methods.

[0400] Conserved: As used herein, the term "conserved" refers to nucleotides or amino acid residues of a polynucleotide sequence or polypeptide sequence, respectively, that are those that occur unaltered in the same position of two or more sequences being compared. Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences.

[0401] Two or more sequences may be said to be "completely conserved" if they are 100% identical to one another. Two or more sequences are said to be "highly conserved" if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. Two or more sequences may be said to be "highly conserved" if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to one another.

[0402] Two or more sequences may be said to be "conserved" if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another.

[0403] Two or more sequences are said to be "conserved" if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Conservation of sequence may apply to the entire length of a polynucleotide or polypeptide or may apply to a portion, region or feature thereof.

[0404] Controlled Release: As used herein, the term "controlled release" refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome.

[0405] Cyclic or Cyclized: As used herein, the term "cyclic" refers to the presence of a continuous loop. Cyclic molecules need not be circular, only joined to form an unbroken chain of subunits.

[0406] Cytostatic: As used herein, "cytostatic" refers to inhibiting, reducing, suppressing the growth, division, or multiplication of a cell (e.g., a mammalian cell (e.g., a human cell)), bacterium, virus, fungus, protozoan, parasite, prion, or a combination thereof.

[0407] Cytotoxic: As used herein, "cytotoxic" refers to killing or causing injurious, toxic, or deadly effect on a cell (e.g., a mammalian cell (e.g., a human cell)), bacterium, virus, fungus, protozoan, parasite, prion, or a combination thereof.

[0408] Delivery: As used herein, "delivery" refers to the act or manner of delivering a compound, substance, entity, moiety, cargo or payload.

[0409] Delivery Agent: As used herein, "delivery agent" refers to any substance which facilitates, at least in part, the in vivo delivery of a modulatory polynucleotide to targeted cells.

[0410] Destabilized: As used herein, the term "destable," "destabilize," or "destabilizing region" means a region or molecule that is less stable than a starting, wild-type or native form of the same region or molecule.

[0411] Detectable label: As used herein, "detectable label" refers to one or more markers, signals, or moieties which are attached, incorporated or associated with another entity that is readily detected by methods known in the art including radiography, fluorescence, chemiluminescence, enzymatic activity, absorbance and the like. Detectable labels include radioisotopes, fluorophores, chromophores, enzymes, dyes, metal ions, ligands such as biotin, avidin, streptavidin and haptens, quantum dots, and the like. Detectable labels may be located at any position in the peptides or proteins disclosed herein. They may be within the amino acids, the peptides, or proteins, or located at the N- or C- termini.

[0412] Diastereomer: As used herein, the term "diastereomer," means stereoisomers that are not mirror images of one another and are non-superimposable on one another.

[0413] Digest: As used herein, the term "digest" means to break apart into smaller pieces or components. When referring to polypeptides or proteins, digestion results in the production of peptides.

[0414] Distal: As used herein, the term "distal" means situated away from the center or away from a point or region of interest.

[0415] Dosing regimen: As used herein, a "dosing regimen" is a schedule of administration or physician determined regimen of treatment, prophylaxis, or palliative care.

[0416] Enantiomer: As used herein, the term "enantiomer" means each individual optically active form of a compound, having an optical purity or enantiomeric excess (as determined by methods standard in the art) of at least 80% (i.e., at least 90% of one enantiomer and at most 10% of the other enantiomer), preferably at least 90% and more preferably at least 98%.

[0417] Encapsulate: As used herein, the term "encapsulate" means to enclose, surround or encase.

[0418] Engineered: As used herein, embodiments are "engineered" when they are designed to have a feature or property, whether structural or chemical, that varies from a starting point, wild type or native molecule.

[0419] Effective Amount: As used herein, the term "effective amount" of an agentis that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an "effective amount" depends upon the context in which it is being applied. For example, in the context of administering an agent that treats cancer, an effective amount of an agent is, for example, an amount sufficient to achieve treatment, as defined herein, of cancer, as compared to the response obtained without administration of the agent.

[0420] Exosome: As used herein, "exosome" is a vesicle secreted by mammalian cells or a complex involved in RNA degradation.

[0421] Expression: As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing); (3) translation of an RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.

[0422] Feature: As used herein, a "feature" refers to a characteristic, a property, or a distinctive element.

[0423] Formulation: As used herein, a "formulation" includes at least one modulatory polynucleotide and a delivery agent.

[0424] Fragment: A "fragment," as used herein, refers to a portion. For example, fragments of proteins may comprise polypeptides obtained by digesting full-length protein isolated from cultured cells.

[0425] Functional: As used ...

Claims

1. A modulatory polynucleotide comprising (a) a stem and a loop which form a stem-loop structure, the sequence of said stem-loop structure comprising from 5' to 3': (i) a 5' stem arm comprising a passenger strand; (ii) a loop region, wherein the loop region comprises the nucleotide sequence of SEQ ID NO: 16, and optionally a UGUG motif at the 5' end of said loop region; (iii) a 3' stem arm comprising a guide strand, wherein a uridine is present at the 5' end of the guide strand; (b) a first flanking region located 5' to said passenger strand, said first flanking region comprising the nucleotide sequence of SEQ ID NO: 5; and (c) a second flanking region located 3' to said guide strand, said second flanking region comprising the nucleotide sequence of SEQ ID NO: 21; or a modulatory polynucleotide comprising (a) a stem and a loop which form a stem-loop structure, the sequence of said stem-loop structure comprising from 5' to 3': (i) a 5' stem arm comprising a guide strand, wherein a uridine is present at the 5' end of the guide strand; (ii) a loop region, wherein the loop region comprises the nucleotide sequence of SEQ ID NO: 16; (iii) a 3' stem arm comprising a passenger strand; (b) a first flanking region located 5' to said guide strand, said first flanking region comprising the nucleotide sequence of SEQ ID NO: 5; and (c) a second flanking region located 3' to said passenger strand, said second flanking region comprising the nucleotide sequence of SEQ ID NO: 21.

2. The modulatory polynucleotide of claim 1, wherein the loop region of said stem-loop structure is derived from a canonical microRNA.

3. The modulatory polynucleotide of claim 2, wherein the canonical microRNA is miR-22.

4. The modulatory polynucleotide of claim 3, wherein at least one of said first or second flanking regions are derived from let-7b.

5. The modulatory polynucleotide of claim 1, wherein the guide strand comprises a microRNA seed sequence comprising positions 2-9, positions 2-8 or positions 2-7.

6. The modulatory polynucleotide of claim 1, wherein the guide strand is between 15-30 nucleotides in length.

7. The modulatory polynucleotide of claim 6, wherein the guide strand is 19 nucleotides in length, or wherein the guide strand is 20 nucleotides in length.

8. The modulatory polynucleotide of claim 6, wherein the guide strand is 22 nucleotides in length, or wherein the guide strand is 21 nucleotides in length.

9. The modulatory polynucleotide of claim 6, wherein the passenger strand is at least 70% complementary to the guide strand, or wherein the guide strand is at least 60% complementary to a target RNA, and wherein the target RNA is a mammalian coding mRNA expressed in a neural cell.

10. An adeno-associated virus (AAV) viral genome which comprises a nucleotide sequence encoding the modulatory polynucleotide of any of claims 1-9.

11. A recombinant adeno-associated virus (rAAV) comprising the AAV viral genome of claim 10.

12. The rAAV of claim 11, comprising an AAV1 capsid.

13. A pharmaceutical composition comprising an rAAV of claim 11 or claim 12, and a pharmaceutically acceptable excipient.

14. The pharmaceutical composition of claim 13, for use in treating and / or preventing a disease of the central nervous system (CNS).

15. A method of producing a recombinant AAV, comprising contacting a viral replication cell with a polynucleotide comprising the viral genome of claim 10, at least one polynucleotide encoding AAV rep genes, and at least one polynucleotide encoding AAV cap genes; and harvesting the recombinant AAV, optionally wherein the viral replication cell is a bacterial cell, a mammalian cell or an insect cell.