Compositions and methods for treatment of friedreich's ataxia

EP4611766A1Pending Publication Date: 2025-09-10PREVAIL THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023886939
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-02-14
Filing Date
2023-11-01
Publication Date
2025-09-10

AI Technical Summary

Technical Problem

Current treatments for Friedreich's Ataxia (FA) fail to effectively restore functional levels of frataxin protein, leading to progressive neurodegeneration and cardiomyopathy, with overexpression of FXN being toxic and causing mitochondrial and cardiac toxicity.

Method used

Development of recombinant adeno-associated virus (AAV) constructs, specifically AAV7 vectors, that deliver nucleic acids encoding human FXN to affected tissues, using a tissue-restricted promoter and modified 5'UTR to modulate FXN expression, reducing toxicity and improving motor performance and cardiac function.

Benefits of technology

The AAV7 vectors safely and effectively restore near-physiological levels of frataxin in CNS and cardiac tissues, improving motor performance and cardiac function, while avoiding toxic overexpression, thus addressing the disease progression and cardiomyopathy associated with FA.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 1.1
    Figure 1.1
Patent Text Reader

Abstract

The present application provides compositions for treatment of Friedreich's Ataxia (FA). These include, but are not limited to, nucleic acid constructs and recombinant AAV7 vectors comprising a human frataxin 5' untranslated region (5'UTR FXN) and a human frataxin (FXN).
Need to check novelty before this filing date? Find Prior Art

Description

ATTORNEY DOCKET NO: 105740-1413992 COMPOSITIONS AND METHODS FOR TREATMENT OF FRIEDREICH’S ATAXIA PRIOR RELATED APPLICATION

[0001] This application claims the benefit of U.S. Provisional Application No.63 / 421,477 filed on November 1, 2022; U.S. Provisional Application No. 63 / 445,126, filed on February 13, 2023; and U.S. Provisional Application No.63 / 445,518, filed on February 14, 2023, all of which are hereby incorporated by reference in their entireties. FIELD

[0002] The present disclosure generally relates to compositions and methods for treatment of Friedreich’s Ataxia (FA). REFERENCE TO A SEQUENCE LISTING SUBMITTED AS XML VIA EFS-WEB

[0003] The instant application contains a Sequence Listing in XML format. The Sequence Listing, named 105740-1413992.xml was created on November 1, 2023, is 22 Kilobytes in size, and is hereby incorporated by reference in its entirety. BACKGROUND

[0004] Friedreich’s ataxia (FA) is an autosomal recessive disease in which the inheritance of a trinucleotide repeat expansion in the first intron of the human FXN (hFXN) gene results in deficient expression of the frataxin protein. FA is a progressive, neurodegenerative movement disorder with a typical age of onset between 10 and 15 years. FA is caused by a loss of function mutation in the frataxin gene (FXN). The prevalence of FA is approximately 1 in 40,000 people. FA is the most common inherited ataxia in Europe, the Middle East, South Asia, and North Africa. Characterized by unsteady posture, frequent falling, and progressive difficulty in walking due to impaired ability to coordinate voluntary movements. A form of heart disease (cardiomyopathy) may develop in over half of the people with FA. FA-related cardiomyopathy is the most common cause of death is patients with FA.ATTORNEY DOCKET NO: 105740-1413992 SUMMARY

[0005] Provided herein are adeno-associated virus (AAV) constructs (e.g., recombinant AAV7 vectors) for delivery of nucleic acids encoding hFXN to tissues affected in FA (e.g., CNS and heart). In some embodiments, the AAV constructs can be used to restore functional levels of frataxin, treat FA and / or prevent FA disease progression.

[0006] Provided herein is a recombinant viral AAV7 vector comprising, in the following order: (a) a nucleic acid sequence comprising an RNA polymerase II promoter; (b) a nucleic acid sequence comprising a 5’UTR FXN; (c) an intron; and (d) a nucleic acid sequence encoding human FXN, wherein the RNA polymerase II promoter is operably linked to the 5’UTR FXN and the nucleic acid sequence encoding a human FXN, and wherein the vector is flanked on each side by an AAV2 inverted terminal repeat.

[0007] In some embodiments, the RNA polymerase II promoter is a desmin promoter. In some embodiments, the human FXN comprises SEQ ID NO: 1. In some embodiments the human FXN is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 3. In some embodiments, the 5’UTR FXN comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 2 or SEQ ID NO: 4. In some embodiments, the intron comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 5. In some embodiments, the desmin promoter comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 6.

[0008] In some embodiments, the recombinant AAV7 vector further comprises (e) a nucleic acid sequence encoding a polyadenylation sequence. In some embodiments, the nucleic acid sequence encoding a polyadenylation sequence comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 7. In some embodiments, the recombinant AAV7 vector comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 14 or SEQ ID NO: 15. In some embodiments, the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising SEQ ID NO: 6; (b) a 5’UTR FXN comprising SEQ ID NO: 4; (c) an intron comprising SEQ ID NO: 5; and (d) a nucleic acid sequence comprising SEQ ID NO: 3. In some embodiments, the recombinant AAV7 vector comprises SEQ ID NO: 14 or SEQ ID NO: 15.

[0009] Also provided are recombinant AAV7 particles and populations of AAV7 particles comprising any of the recombinant AAV7 vectors described herein. In some embodiments, the AAV7 particle comprises an AAV7 capsid protein.

[0010] Also provided are pharmaceutical compositions comprising any of the recombinant AAV7 particles described herein.ATTORNEY DOCKET NO: 105740-1413992

[0011] Also provided are methods for treating a patient with Friedreich’s Ataxia (FA) comprising administering a therapeutically effective amount of any of the recombinant AAV7 particles or pharmaceutical compositions described herein. BRIEF DESCRIPTION OF THE FIGURES

[0012] The present application includes the following figures. The figures are intended to illustrate certain embodiments and / or features of the compositions and methods, and to supplement any description(s) of the compositions and methods. The figures do not limit the scope of the compositions and methods, unless the written description expressly indicates that such is the case.

[0013] FIGS. 1A and 1C are schematic diagrams showing that expression of a codon- optimized human FXN cDNA is under the control of a synthetic, unique regulatory element that incorporates sequences from the DES and FXN promoter regions. FIG. 1 B shows that AAV7 is a neuro-and myo-tropic capsid, that targets tissues and cell types affected in FA.

[0014] FIGS. 2A-2C show a schematic of an exemplary experiment. PV-Cre conditional mFXN KO (PV) mice were obtained at 5 weeks of age from Jax Labs. Mice were assigned to sex-balanced groups and underwent stereotactic injection of LTX401 or excipient unilaterally into the CSF and bilaterally into deep cerebellar nuclei (DCN) for a total of 3 injections per brain (FIG.2A). Motor performance was assessed via accelerating rotarod. Excipient injected aphenotypic litter mates were used as unaffected controls (FIG. 2B). Histological analysis included H&E and anti-hFXN staining (FIG. 2C). Biochemical analysis included hFXN- specific ELISA and qPCR for vector genomes.

[0015] FIG. 3A shows the performance of PV-mice on accelerating rotarod was significantly improved after injection of 1X or 0.5X dose of LTX401 at 5 weeks of age compared to injection of excipient alone. Black stars correspond to p-value versus excipient injected controls and red stars correspond to p-value versus excipient injected PV (Excip.-PV). *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

[0016] FIGS. 3B and 3C show dose-dependent expression of hFXN protein in thoracic DRG and cerebellum, respectively. FIG.3D shows dose dependent accumulation of LTX401 vector genomes in the cerebellum. All data are represented as mean + / -SEM.

[0017] FIG. 4A shows that performance of PV-mice on accelerating rotarod was significantly improved after injection of 1X dose of LTX401 at a late symptomatic age of 7.5 weeks compared to injection of excipient alone. Black stars correspond to p-value versusATTORNEY DOCKET NO: 105740-1413992 excipient injected controls and red stars correspond to p-value versus excipient injected PV (Excip.-PV). *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

[0018] FIGS. 4B and 4C show a growth curve and percent change in body weight, respectively, between 5 and 20 weeks of age for all experimental groups. FIGS. 4D and 4E show expression of hFXN protein in thoracic DRG and cerebellum, respectively. FIG. 4F shows quantification of LTX401 vector genomes in the cerebellum.

[0019] FIG.5A is a growth curve showing that injecting LTX401 via a combined CNS+IV route of administration in WT mice did not negatively affect weight gain when compared to excipient injected controls. FIG.5B shows expression of hFXN protein in cerebellum, heart, liver, and thoracic DRG. FIG. 5C shows quantification of LTX401 vector genomes in cerebellum, heart, and liver.

[0020] FIGS.6A and 6B show sagittal and coronal views of post-injection MRI showing gadolinium contrast in bilateral dentate nuclei and CSF following convection-enhanced delivery of LTX40.

[0021] FIG. 7A shows LTX401 vector design. The LTX401 FXN expression cassette features a tissue-restricted, modified, Desmin promoter and a FXN5’UTR region. The 5’ UTR includes transcription factor binding sites to regulate FXN and avoid toxic overexpression. The cassette was packaged in AAV7 capsid, which is myo-tropic and neuro-tropic, making it ideal for targeting cardiac and neuronal tissues in FA. FIG.7B shows the experimental design of an MCK mouse study. MCK-Cre conditional mFXNKO mice were administered LTX401 intravenously at approximately 5 weeks of age and maintained to 20 weeks of age (WOA). At 20 WOA, animals were assessed with cardiac MRI and subsequently necropsied for further assessment of tissues.

[0022] FIG. 8A shows that LTX401 treatment increases probability of survival of MCK mice at 20 weeks of age (WOA). FIGS. 8C and 8D show Cardiac MRI of LTX401-treated MCK mice.

[0023] FIG.9A shows histology of heart and liver of LTX401-treated MCK mice. of liver from LTX401-treated MCK mice, as compared to both un-injected C57BL / 6J (B6) and MCK mice (row A-III). FIG.9B provides an assessment of LTX401 vector genome copies and hFXN protein levels present in heart and liver tissues of LTX401-treated MCK.

[0024] FIG. 10A provides an assessment of LTX401 vector genome copies and FXN protein levels present in heart and liver tissues of LTX401-treated African green monkeys (AGM). Fig.10B shows histology of heart and liver of LTX401-dosed AGMs.ATTORNEY DOCKET NO: 105740-1413992

[0025] FIG.11 is a schematic of a vector (LP-1188 or LTX401) comprising SEQ ID NO: 14. DETAILED DESCRIPTION

[0026] The following description recites various aspects and embodiments of the present compositions and methods. No embodiment is intended to define the scope of the compositions and methods. Rather, the embodiments merely provide non-limiting examples of various compositions and methods that are at least included within the scope of the disclosed compositions and methods. The description is to be read from the perspective of one of ordinary skill in the art; therefore, information well known to the skilled artisan is not necessarily included.

[0027] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Vectors

[0028] Reports have shown that overexpression of FXN is toxic both in vitro (Vannocci et al., “Adding a temporal dimension to the study of Friedreich's ataxia: the effect of frataxin overexpression in a human cell model,” Dis Model Mech. 2018; 11(6):dmm032706) and in vivo (Belbellaa et al., “High levels of frataxin overexpression leads to mitochondrial and cardiac toxicity in mouse models,” April 2020. doi.org?10.1101 / 2020.03.31.015255; Belbella et al., “Correction of half the cardiomyocytes fully rescue Friedreich ataxia mitochondrial cardiomyopathy through cell-autonomous mechanisms,” Hum Mol Genet. 2019; 28(8):1274- 1285). Provided herein are recombinant vectors that can be administered to a subject to modulate expression of FXN, while reducing toxicity in the subject (e.g., neurotoxicity and / or cardiotoxicity).

[0029] Any of the vectors provided herein can be used to modulate physiological levels of FXN in a subject. For example, the vectors provided herein can be used to modulate physiological levels of FXN expression in muscle- or nerve-derived cells, including cells comprising homozygous GAA repeat expansion FXN alleles. Such modulated physiological levels of FXN expression can reduce negative effects on cellular mitochondria function in diseased cells lacking FXN, or in cells comprising an excess of FXN due to non-modulated expression of the FXN gene. The modulated physiological levels of FXN expression (e.g., at the protein level) can be at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, atATTORNEY DOCKET NO: 105740-1413992 least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 100%, at least 105%, at least 110%, at least 115%, at least 120%, at least 125%, at least 130%, at least 135%, at least 140%, at least 145%, at least 150%, at least 155%, at least 160%, at least 165%, at least 170%, at least 175%, at least 180%, at least 185%, at least 190%½ at least 195%, or at least 200% of the FXN protein level in wild-type cells.

[0030] Provided herein is a recombinant AAV vector, for example, an AAV7 vector comprising, in the following order: (a) a nucleic acid sequence comprising an RNA polymerase II promoter; (b) a nucleic acid sequence comprising a 5’UTR FXN; (c) an intron; and (d) a nucleic acid sequence encoding human FXN, wherein the RNA polymerase II promoter is operably linked to the 5’UTR FXN and the nucleic acid sequence encoding a human FXN. In some embodiments, the RNA polymerase II promoter is a desmin promoter. In some embodiments, the vector is flanked on each side by an AAV2 inverted terminal repeat. See, for example, Fig.1A.

[0031] In some embodiments, the human FXN comprises SEQ ID NO: 1 or an amino acid sequence having at least about 80%, 85%, 90%, 95%, 99% identity with SEQ ID NO: 1 .In some embodiments, human FXN comprises and amino acid sequence comprising SEQ ID NO: 1 with one or more conservative substitutions. In some embodiments, the human FXN is encoded by a codon-optimized nucleic acid sequence. In some embodiments, the human FXN is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 3.

[0032] In some embodiments, the 5’UTR FXN comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 2 or SEQ ID NO: 4. In some embodiments, the intron comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 5. In some embodiments, the desmin promoter comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 6. In some embodiments, the recombinant AAV7 vector further comprises (e) a nucleic acid sequence encoding a polyadenylation sequence. In some embodiments, the nucleic acid sequence encoding a polyadenylation sequence comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 7. In some embodiments, the recombinant AAV7 vector comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 14 or SEQ ID NO: 15.ATTORNEY DOCKET NO: 105740-1413992

[0033] In some embodiments, the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity with SEQ ID NO: 6; (b) a 5’UTR FXN comprising a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity with SEQ ID NO: 4; (c) an intron comprising a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity with SEQ ID NO: 5; and (d) a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity with SEQ ID NO: 3.

[0034] In some embodiments, the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity with SEQ ID NO: 6; (b) a 5’UTR FXN comprising a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity with SEQ ID NO: 4; (c) an intron comprising a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity with SEQ ID NO: 5; and (d) a nucleic acid sequence encoding SEQ ID NO: 1.

[0035] In some embodiments, the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising SEQ ID NO: 6; (b) a 5’UTR FXN comprising SEQ ID NO: 4; (c) an intron comprising SEQ ID NO: 5; and (d) a nucleic acid sequence comprising SEQ ID NO: 3.

[0036] In some embodiments, the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising SEQ ID NO: 6; (b) a 5’UTR FXN comprising SEQ ID NO: 4; (c) an intron comprising SEQ ID NO: 5; (d) a nucleic acid sequence comprising SEQ ID NO: 3; and (e) a nucleic acid comprising SEQ ID NO: 7. In some embodiments, the recombinant AAV7 vector comprises a nucleic acid sequence having at least 85%, 90%, 95%, 99% identity with SEQ ID NO: 14 or SEQ ID NO: 15. In some embodiments, the recombinant AAV7 vector comprises SEQ ID NO: 14 or SEQ ID NO: 15.In some embodiments, the nucleic acid sequence encoding human frataxin encodes an amino acid sequence comprising SEQ ID NO: 1, or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 1. Also see for example, GenBank Accession No. AAH48097.1 for amino acid sequence of human frataxin. mwtlgrrava gllaspspaq aqtltrvprp aelaplcgrr glrtdidatc tprrassnqr glnqiwnvkk qsvylmnlrk sgtlghpgsl dettyerlae etldslaeff edladkpytf edydvsfgsg vltvklggdl gtyvinkqtp nkqiwlssps sgpkrydwtg knwvyshdgv slhellaael tkalktkldl sslaysgkda (SEQ ID NO: 1)

[0037] In some embodiments, the nucleic acid sequence encoding human frataxin comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,ATTORNEY DOCKET NO: 105740-1413992 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3, as set forth below: ATGTGGACACTGGGCAGAAGGGCAGTGGCTGGCCTGCTGGCCTCCCCCAG CCCTGCCCAGGCCCAGACCCTGACCAGAGTTCCCAGGCCTGCTGAGCTGG CCCCCCTGTGTGGCAGAAGAGGCCTGAGAACAGACATTGATGCCACATGC ACCCCTAGGAGAGCCAGCAGCAACCAGAGAGGCCTGAACCAAATCTGGA ATGTGAAGAAACAGTCTGTGTACCTGATGAATCTGAGAAAGTCTGGCACC CTGGGCCACCCTGGCAGCCTGGATGAGACCACCTATGAGAGACTGGCTGA AGAAACCCTGGACAGCCTGGCTGAATTCTTTGAGGACCTGGCTGACAAGC CTTACACCTTTGAGGACTATGATGTGAGCTTTGGCAGTGGAGTGCTGACA GTGAAACTGGGAGGAGACCTGGGCACCTATGTGATCAACAAGCAGACAC CAAACAAACAGATCTGGCTGAGCAGCCCTAGCTCTGGCCCAAAGAGATAT GACTGGACAGGCAAGAACTGGGTCTACAGCCATGATGGAGTGTCCCTCCA TGAACTCCTGGCTGCAGAGCTGACCAAGGCCCTGAAGACCAAGCTGGACC TGAGCAGCCTGGCCTACTCTGGCAAGGATGCCTAG (SEQ ID NO: 3)

[0038] In some embodiments, the 5’UTR FXN includes a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 2 (as set forth below) or a fragment thereof. CAGTCTCCCTTGGGTCAGGGGTCCTGGTTGCACTCCGTGCTTTGCACAAAG CAGGCTCTCCATTTTTGTTAAATGCACGAATAGTGCTAAGCTGGGAAGTTC TTCCTGAGGTCTAACCTCTAGCTGCTCCCCCACAGAAGAGTGCCTGCGGCC AGTGGCCACCAGGGGTCGCCGCAGCACCCAGCGCTGGAGGGCGGAGCGG GCGGCAGACCCGGAGCAGC (SEQ ID NO: 2)

[0039] In some embodiments, the 5’UTR FXN includes a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4 (as set forth below) or a fragment thereof: CTGCAGTCTCCCTTGGGTCAGGGGTCCTGGTTGCACTCCGTGCTTTGCA CAAAGCAGGCTCTCCATTTTTGTTAAATGCACGAATAGTGCTAAGCTG GGAAGTTCTTCCTGAGGTCTAACCTCTAGCTGCTCCCCCACAGAAGAG TGCCTGCGCCAGTGGCCACCAGGGGTCGCCGCAGCACCCAGCGCTGGA GGGCGGAGCGGGCGGCAGACCCGGAGCAGC (SEQ ID NO: 4)

[0040] In some embodiments, the 5’UTR FXN includes a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 21 (as set forth below) or a fragment thereof:ATTORNEY DOCKET NO: 105740-1413992 CAGTCTCCCTTGGGTCAGGGGTCCTGGTTGCACTCCGTGCTTTGCACAA AGCAGGCTCTCCATTTTTGTTAAATGCACGAATAGTGCTAAGCTGGGA AGTTCTTCCTGAGGTCTAACCTCTAGCTGCTCCCCCACAGAAGAGTGC CTGCGCCAGTGGCCACCAGGGGTCGCCGCAGCACCCAGCGCTGGAGG GCGGAGCGGGCGGCAGACCCGGAGCAGC (SEQ ID NO: 21)

[0041] In some embodiments, one or more introns in the recombinant vector are chimeric introns, for example, a Huß-globin &Ig heavy chain acceptor. In some embodiments, the intron includes a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5 (as set forth below) or a fragment thereof: GTAAGTATCAAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAA TAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAG GCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCAC AG (SEQ ID NO: 5)

[0042] Numerous promoters can be used in the constructs described herein. A promoter is a region, or a sequence located upstream and / or downstream from the start of transcription that is involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. In some embodiments, the promoter is an RNA polymerase II promoter, for example, and not to be limiting, an RNA polymerase II CORE promoter. As used herein, an RNA polymerase II CORE promoter is the minimal sequence that allows the basal transcription apparatus to assemble. For example, this sequence can be at 40 base pairs in length and can include a TATA box, an initiator element (Inr) and / or a downstream promoter element (DPE). See, for example, Domenger and Grimm, “Next generation AAV vectors-do not judge a virus (only) by its cover,” Human Mol. Genetics 29(R1): R3-R14 (2019). In some embodiments, any of the constructs described herein do not include a human frataxin promoter (e.g., SEQ ID NO: 16 or SEQ ID NO: 17), for example, a full-length frataxin promoter, or a 3′ UTR of the frataxin gene (e.g., SEQ ID NO: 18 or SEQ ID NO: 19).

[0043] In some embodiments the promoter is an inducible promoter, for example, the promoter can be chemically or physically regulated. A chemically regulated promoter and / or enhancer can, for example, be regulated by the presence of alcohol, tetracycline, a steroid, or a metal. Examples include the tetracycline inducible promoter or a glucocorticoid inducible promoter. The nucleic acids of the present invention can also be under the control of a tissue- specific promoter to promote expression of the nucleic acid in specific cells, tissues or organs. Any regulatable promoter, such as a metallothionein promoter, a heat-shock promoter, andATTORNEY DOCKET NO: 105740-1413992 other regulatable promoters, of which many examples are well known in the art are also contemplated. Furthermore, a Cre-1oxP inducible system can also be used, as well as a Flp recombinase inducible promoter system, both of which are known in the art.

[0044] As used herein, the terms “operably linked,” “operably positioned,” and the like mean that a first nucleic acid sequence (e.g., a coding sequence for a protein or a non-coding RNA sequence) is covalently connected to at least a second nucleic acid sequence such that at least one of the two sequences can exert an effect on the other nucleic acid sequence. For example, a human FXN nucleotide sequence can be operably linked to a promoter sequence such that the promoter sequence can direct transcription of the human FXN nucleotide sequence, thereby contributing to expression of the human FXN nucleotide sequence. Similarly, a 5′ UTR FXN sequence can be operably positioned between the promoter sequence and the human FXN nucleotide sequence, such that the 5′ UTR FXN sequence can modulate expression of the human FXN nucleotide sequence.

[0045] In some embodiments, the promoter is a desmin promoter. In some embodiments, the desmin promoter comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 6 (as set forth below) or a fragment thereof: GATCTTACCCCCTGCCCCCCACAGCTCCTCTCCTGTGCCTTGTTTCCCA GCCATGCGTTCTCCTCTATAAATACCCGCTCTGGTATTTGGGGTTGGCA GCTGTTGCTGCCAGGGAGATGGTTGGGTTGACATGCGGCTCCTGACAA AACACAAACCCCTGGTGTGTGTGGGCGTGGGTGGTGTGAGTAGGGGG ATGAATCAGGGAGGGGGCGGGGGACCCAGGGGGCAGGAGCCACACA AAGTCTGTGCGGGGGTGGGAGCGCACATAGCAATTGGAAACTGAAAG CTTATCAGACCCTTTCTGGAAATCAGCCCACTGTTTATAAACTTGAGGC CCCACCCTCGAGATAACCAGGGCTGAAAGAGGCCCGCCTGGGGGCTG GAGACATGCTTGCTGCCTGCCCTGGCGAAGGATTGGCAGGCTTGCCCG TCACAGGACCCCCGCTGGCTGACTCAGGGGCGCAGGCCTCTTGCGGGG GAGCTGGCCTCCCCGCCCCCACGGCCACGGGCCGCCCTTTCCTGGCAG GACAGCGGGATCTTGCAGCTGTCAGGGGAGGGGAGGCGGGGGCTGAT GTCAGGAGGGATACAAATAGTGCCGACGGCTGGGGGC (SEQ ID NO: 6)

[0046] It is understood that fragments of the desmin promoter can also be used in the constructs described herein, as long as the fragment retains at least 75%, 80% 85%, 90%, 95%, 100% or more of at least one activity of the desmin promoter from which the fragment wasATTORNEY DOCKET NO: 105740-1413992 derived, for example, the promotion of transcription of a nucleic acid in a cell (e.g., a neuronal or muscle cell). The fragment can be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 300, 400, 500 or more nucleotides shorter than a wild-type promoter or a promoter sequence having at least 85% identity to a wild-type promoter sequence. For example, fragments that are at least 10, 20, 30, 40, 50, 100 or 200 base pairs shorter in length than SEQ ID NO: 6 can be used as a promoter.

[0047] In some embodiments, the nucleic acid construct comprises a bovine growth hormone polyadenylation sequence. In some embodiments, the nucleic acid sequence encoding the bovine growth hormone polyadenylation sequence comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 7 (as set forth below) or a fragment thereof: CTAGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCC TGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAA AATGAGGAAATTGCATGGCATTGTCTGAGTAGGTGTCATTCTATTCTGGG GGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAG CA GGCATGCTGG GGA (SEQ ID NO: 7)

[0048] In some embodiments, the 5’ UTR FXN comprises a nucleic acid sequence encoding one or more regulatory sequences selected from the group consisting of an L2 retrotransposable element, a serum response factor (SRF) and a specificity protein 1 (SP1). Exemplary nucleic acid sequences comprising an L2 retrotransposable element include, but are not limited to, SEQ ID NO: 9, and nucleotide sequences having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 9 (GTGCTTTGCACAAAGCAGGCTCTCCATTTTTGTTAAATGCACGAATA). Exemplary nucleic acid sequences comprising a SRF include, but are not limited to, SEQ ID NO: 10, and nucleotide sequences having least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 10 (GCTCTCCATTTTTGTTAAA). Exemplary nucleic acid sequences comprising a SP1 include, but are not limited to, SEQ ID NO: 11, and nucleotide sequences having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 11 (TGGAGGGCGGAGCGG).

[0049] In some embodiments, the recombinant AAV7 vector comprises a selectable marker gene for the selection of transformed cells. Marker genes include genes conferring antibiotic resistance, such as those conferring hygromycin resistance, kanamycin resistance, ampicillinATTORNEY DOCKET NO: 105740-1413992 resistance, gentamicin resistance, neomycin resistance, to name a few. Additional selectable markers are known and any can be used. Exemplary sequences for genes conferring ampicillin resistance and kanamycin resistance are provided herein as SEQ ID NO: 12 and SEQ ID NO: 13, respectively.

[0050] In some embodiments, the recombinant AAV7 vector comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 14 or SEQ ID NO: 15. SEQ ID NO: 14 and SEQ ID NO: 15 comprise an exemplary nucleic acid construct comprising, in the following order: (a) a nucleic acid sequence comprising an RNA polymerase II promoter (i.e., a desmin promoter comprising SEQ ID NO: 6) (b) a nucleic acid sequence comprising a 5’UTR FXN (SEQ ID NO: 4); (c) an intron (SEQ ID NO: 4); and (d) a nucleic acid sequence encoding human FXN (SEQ ID NO: 3), wherein the RNA polymerase II promoter is operably linked to the 5’UTR FXN and the nucleic acid sequence encoding a human FXN. The nucleic acid construct further comprises a nucleic acid sequence encoding polyadenylation (polyA) sequence, i.e., a polyA bovine growth hormone sequence (SEQ ID NO: 7), located downstream of SEQ ID NO: 3.

[0051] In SEQ ID NO: 14 and SEQ ID NO: 15, the nucleic acid construct is flanked on each side by an AAV2 inverted terminal repeat (SEQ ID NO: 8 or SEQ ID NO: 20). In SEQ ID NO: 14 and SEQ ID NO: 15, the 5’UTR FXN (SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 21) comprises SEQ ID NO: 8, SEQ ID NO: 10, and SEQ ID NO: 11.

[0052] SEQ ID NO: 14 and SEQ ID NO: 15 also comprise a kanamycin resistance gene (SEQ ID NO: 13). FIG.1C is a schematic of an expression cassette (SEQ ID NO: 15). FIG.11 is a schematic of a vector (LP-1188 or LTX401) comprising SEQ ID NO: 14. It is understood that LP-1188 and LTX401 are used interchangeably to refer to the recombinant AAV7 vector shown in FIG.11 and used in the experiments described herein.

[0053] The recombinant AAV7 vector can further include viral sequences for packaging. Any missing viral functions can be supplied in trans by a packaging cell. For example, recombinant AAV vectors used in gene therapy may only possess one or more inverted terminal repeat (ITR) sequences from the recombinant AAV genome and the balance of the vector can include sequences of interest (e.g., a 5’UTR FXN and a FXN nucleotide sequence). The ITR sequences, for example, AAV2 ITR sequences, can be included for packaging into AAV capsids. An exemplary ITR sequence can comprise, a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8 or SEQ ID NO: 20 (as set forth below):ATTORNEY DOCKET NO: 105740-1413992 AGGAATGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGC CCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCC (SEQ ID NO: 8) TGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGG CGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCC (SEQ ID NO: 20)

[0054] In some embodiments, the AAV vector comprises a nucleic acid construct comprising (a) a nucleic acid sequence comprising an RNA polymerase II promoter; (b) a nucleic acid sequence comprising a 5’UTR FXN; (c) an intron; and (d) a nucleic acid sequence encoding human FXN, wherein the nucleic acid construct is flanked on each said by an ITR. Exemplary ITR sequences include but are not limited to SEQ ID NO: 8 and its reverse complement, or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8, and its reverse complement.

[0055] The packaging cell can also contain a plasmid that encodes other AAV genes (e.g., rep and cap), but lacks ITR sequences. The plasmid that encodes rep and cap genes may not be packaged in significant amounts due to a lack of ITR sequences. The packaging cell can also be infected with adenovirus as a helper virus, which can promote replication of the AAV vector and expression of AAV genes from the plasmid that encodes rep and cap genes. The packaging cell can be transfected with a helper plasmid encoding gene products of helper viruses, such as adenovirus, which promotes replication of the AAV vector and expression of AAV genes from the plasmid that encodes rep and cap genes.

[0056] It is understood that nucleic acid sequences comprising, consisting of, or consisting essentially of a nucleic acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity, or any percentage identity in between these percentages to any one of SEQ ID NOs.1-21 are provided herein. Also provided is any one of SEQ ID Nos: 1-21 comprising a deletion of one, two, three, four, five, six, seven or more nucleotides on the 3’ or 5’ end, as well as nucleic acid sequences having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity, or any percentage identity in between these percentages to any one of these sequences comprising a deletion.

[0057] The term “identity” or “substantial identity,” as used in the context of a polynucleotide or polypeptide sequence described herein, refers to a sequence that has at least 60% sequence identity to a reference sequence. Alternatively, percent identity can be anyATTORNEY DOCKET NO: 105740-1413992 integer from 60% to 100%. Exemplary embodiments include at least: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, as compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described below. One of skill in the art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like.

[0058] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.

[0059] A “comparison window,” as used herein, includes reference to a segment of any one of the numbers of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Add. APL. Math.2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch J. Mol. Biol.48:443 (1970), by the search for similarity method of Pearson and Lipman Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444 (1988), by computerized implementations of these algorithms (e.g., BLAST), or by manual alignment and visual inspection.

[0060] Algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1990) J. Mol. Biol.215: 403-410 and Altschul et al. (1977) Nucleic Acids Res.25: 3389-3402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI) web site. The algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood wordATTORNEY DOCKET NO: 105740-1413992 hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word size (W) of 28, an expectation (E) of 10, M=1, N=-2, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word size (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).

[0061] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.01, more preferably less than about 10-5, and most preferably less than about 10-20. Viral particles

[0062] Also provided is a recombinant AAV particle, for example, an AAV7 particle comprising any of the recombinant AAV7 vectors described herein. In some embodiments, the AAV7 particle comprises an AAV7 capsid protein. Also provided is a pharmaceutical composition comprising any of the recombinant AAV7 particles, including a plurality of recombinant AAV7 particles, described herein.

[0063] Any of the AAV7 constructs described herein can be packaged into a virion. As used herein, a recombinant AAV particle or virion is a viral particle including at least one AAV capsid protein and an encapsidated recombinant AAV vector. As used herein, a recombinant AAV particle is a viral particle including at least one AAV capsid protein and an encapsidated recombinant AAV vector. An “AAV virus,” AAV virion,” “AAV viral particle,” or “ATTORNEY DOCKET NO: 105740-1413992 recombinant AAV vector particle” refers to a viral particle composed of at least one AAV capsid protein and an encapsidated polynucleotide recombinant AAV vector. If the particle includes a heterologous nucleic acid sequence (i.e., a nucleic acid sequence other than a wild- type AAV genome such as a transgene to be delivered to a mammalian cell), it can be referred to as a recombinant AAV vector. Thus, production of recombinant AAV particles or virion necessarily includes production of a recombinant AAV vector, as such a vector is contained within a recombinant AAV particle. Methods for producing AAV vectors and virions are known in the art. See, for example, Shin et al., “Recombinant Adeno-Associated Viral Vector Production and Purification,” Methods Mol. Biol. 798: 267-284 (2012)). The AAV capsid protein can be from any natural or recombinant AAV serotype, for example, from AAV1, 2, 3, 4, 5, 6, 7, 8.9, 10, 11, 12, or 13 to name a few.

[0064] Also provided is a cell including any of the vectors described herein. The host cell can be an in vitro, ex vivo, or in vivo host cell. Populations of any of the host cells described herein are also provided. A cell culture including one or more host cells described herein is also provided. Methods for the culture and production of many cells, including cells of bacterial (for example E. coli and other bacterial strains), animal (especially mammalian), and archaebacterial origin are available in the art. See e.g., Sambrook. Ausubel, and Berger (all supra), as well as Freshney (1994) Culture of Animal Cells, a Manual of Basic Technique, 3rd Ed, Wiley-Liss, New York and the references cited therein; Doyle and Griffiths (1997) Mammalian Cell Culture: Essential Techniques John Wiley and Sons, NY; Humason (1979) Animal Tissue Techniques, 4th Ed. W. H. Freeman and Company; and Ricciardelli et al., (1989) In vitro Cell Dev. Biol.25:1016-1024.

[0065] The host cell can be a prokaryotic cell, including, for example, a bacterial cell. Alternatively, the cell can be a eukaryotic cell, for example, a mammalian cell. In some embodiments, the cell can be an HEK293T cell, a Chinese hamster ovary (CHO) cell, a COS- 7 cell, a HELA cell, an avian cell, a myeloma cell, a Pichia cell, an insect cell or a plant cell. A number of other suitable host cell lines have been developed and include myeloma cell lines, fibroblast cell lines, and a variety of tumor cell lines such as melanoma cell lines. The vectors containing the nucleic acid segments of interest can be transferred or introduced into the host cell by well-known methods, which vary depending on the type of cellular host.

[0066] Methods for introducing vectors into cells are known in the art. As used herein, the phrase “introducing” in the context of introducing a nucleic acid into a cell refers to the translocation of the nucleic acid sequence from outside a cell to inside the cell. In some cases, introducing refers to translocation of the nucleic acid from outside the cell to inside the nucleusATTORNEY DOCKET NO: 105740-1413992 of the cell. Various methods of such translocation are contemplated, including but not limited to, electroporation, nanoparticle delivery, viral delivery, contact with nanowires or nanotubes, receptor mediated internalization, translocation via cell penetrating peptides, liposome mediated translocation. DEAE dextran, lipofectamine, calcium phosphate or any method now known or identified in the future for introduction of nucleic acids into prokaryotic or eukaryotic cellular hosts. A targeted nuclease system (e.g., an RNA-guided nuclease (for example, a CRISPR / Cas9 system), a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), or a megaTAL (MT) (Li et al., Signal Transduction and Targeted Therapy 5. Article No.1 (2020)) can also be used to introduce a nucleic acid into a host cell. Pharmaceutical Compositions

[0067] Provided herein is a pharmaceutical composition including any of the recombinant viral vectors or viral particles described herein. The pharmaceutical compositions can include additional components suitable to, for example, increase delivery (e.g., increase infection of targeted cells and / or increase the range of cells that can be infected), increase stability of the recombinant vector, or decrease immunogenicity of the recombinant vector, for example, an AAV7 vector. For example, the pharmaceutical compositions can include a pharmaceutically acceptable carrier, excipient, and / or sail. The pharmaceutically acceptable carrier can exclude buffers, compounds, cryopreservation agents, preservatives, or other agents in amounts that can substantially interfere with the delivery or activity of the recombinant AAV vector to a patient. Exemplary liquid carriers are sterile aqueous solutions that contain no materials in addition to the recombinant AAV vector and water or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline. Still further, aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes. Liquid compositions can also contain liquid phases in addition to and to the exclusion of water. Examples of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsion.

[0068] The pharmaceutical compositions can be delivered to a subject, so as to allow production of an expression product in the cell(s) of the subject. Pharmaceutical compositions include sufficient genetic material that allows the recipient to produce an effective amount of an expression product that modulates FXN expression in a cell and / or treats FA in a subject.

[0069] In some embodiments, the pharmaceutical compositions also contain a pharmaceutically acceptable excipient. Such excipients include any pharmaceutical agent that does not itself induce an immune response harmful to the individual receiving the composition,ATTORNEY DOCKET NO: 105740-1413992 and which may be administered without undue toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, sugars and ethanol. Pharmaceutically acceptable salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. Additionally, auxiliary substances, such as wetting or emulsifying, agents, pH buffering substances, and the like, may be present in such vehicles. The preparation of pharmaceutically acceptable carriers, excipients and formulations containing these materials is described in, e.g., Remington: The Science and Practice of Pharmacy, 22nd edition, Loyd V. Allen et al., editors, Pharmaceutical Press (2012).

[0070] Pharmaceutical formulations suitable for parenteral administration may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks’s solution, Ringer’s solution, or physiologically buffered saline. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. Genetically Modified Cells

[0071] Also provided herein are genetically modified cells comprising any of the nucleic acid constructs or recombinant viral vectors described herein. As used herein, a “genetically modified cell” refers to a cell that has at least one genomic modification as a result of introducing any of the nucleic acid constructs or recombinant viral vectors described herein, into the cell. The genetically modified cells can be in vitro, ex vivo or in vivo genetically modified cells.

[0072] The genetically modified cells can be any suitable genetically modified cell, such as those selected from the group consisting of a human stem cell (for example, a multipotent stem cells, e.g., a mesenchymal stem cell that can differentiate into neurons and cardiomyocytes), a human neuron, a human cardiomyocyte, a human smooth muscle myocyte, a human skeletal myocyte, and a human hepatocyte.ATTORNEY DOCKET NO: 105740-1413992

[0073] In some embodiments, bone-marrow derived mesenchymal stem cells are isolated from a subject having FA, and genetically modified to insert any of the nucleic acid constructs described herein that comprise a 5′UTR and a nucleic acid sequence encoding human FX. The genetically modified cells are then autologously transplanted back into the subject. In some embodiments, the genetically modified cells can be systemically delivered to allow targeted delivery of the grafts to the brain and heart of FA patients. See, for example, Tajiri et al., “Autologous Stem Cell Transplant with Gene Therapy for Friedreich Ataxia” Med. Hypotheses 83(3): 296-298 (2014). Methods for introduction of nucleic acids and vectors for genetic modification of cells are described above.

[0074] The term “genetic modification” refers to any change in the DNA genome (or RNA genome in some cases) of a cell, organism, virus, viral vector, or other biological agent. Non- limiting examples of genetic modifications include an insertion, a deletion, a substitution, a procedure such as a transfection or transformation where an exogenous nucleic acid is added to a cell and / or organism, and cloning techniques.

[0075] The term “insertion” refers to an addition of one or more nucleotides in a nucleic acid sequence. Insertions can range from small insertions of a few nucleotides to insertions of large segments such as a cDNA or a gene.

[0076] The term “deletion” refers to a loss or removal of one or more nucleotides in a nucleic acid sequence or a loss or removal of the function of a gene. In some cases, a deletion can include, for example, a loss of a few nucleotides, an exon, an intron, a gene segment, or the entire sequence of a gene. In some cases, deletion of a gene refers to the elimination or reduction of the function or expression of a gene or its gene product. This can result from not only a deletion of sequences within or near the gene, but also other events (e.g., insertion, nonsense mutation) that disrupt the expression of the gene.

[0077] The term “substitution” refers to a replacement of one or more nucleotides in a nucleic acid sequence with an equal number of nucleotides.

[0078] Genetic modification of a nucleic acid sequence can result in a “recombinant” sequence. For example, the present disclosure provides “recombinant AAV vectors,” which have been genetically modified to include elements disclosed herein. Methods of Treatment

[0079] Further provided is a method of treating a patient with Friedreich’s Ataxia (FA) comprising administering a therapeutically effective amount of any of the pharmaceutical compositions or recombinant AAV7 particles described herein.ATTORNEY DOCKET NO: 105740-1413992

[0080] The term “effective amount,” as used throughout, is defined as any amount necessary to produce a desired physiologic response, for example, reducing or delaying one or more effects or symptoms (e.g., muscle loss, ataxia in arms and legs in a subject, diabetes, cardiomyopathy, etc.) of FA. Effective amounts and schedules for administering the recombinant AAV virions described herein can be determined empirically and making such determinations is within the skill in the art. The dosage ranges for administration are those large enough to produce the desired effect in which one or more symptoms of the disease or disorder are affected (e.g., reduced or delayed). The dosage should not be so large as to cause substantial adverse side effects, such as unwanted cross-reactions, unwanted cell death, and the like. Generally, the dosage will vary with the species, age, body weight, general health, sex and diet of the subject, the mode and time of administration and severity of the particular condition and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosages can vary and can be administered in one or more doses.

[0081] An effective amount of any of the recombinant AAV virions described herein will vary and can be determined by one of skill in the art through experimentation and / or clinical trials. For example, for in vivo injection, for example, injection directly into the inner ear of a subject, an effective dose can be from about 106to about 1015recombinant rAAV virions, or any values in between this range, for example, about 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014, or 1015recombinant AAV particles.

[0082] In some embodiments, the number of rAAV particles administered to a subject may be on the order ranging from about 106to 1015vector genomes(vg) / ml, such as for example, about 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014, or 1015vg / ml. In some embodiments, the number of rAAV particles administered to a subject can be from about 106to 1015vg / kg, or any values in between these amounts, such as for example, about 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014, or 1015vg / kg. Other effective dosages can be readily established by one of ordinary skill in the art through routine trials establishing dose response curves.

[0083] Any of the methods provided herein can further include administering a second therapeutic agent to the subject having FA, for example, a beta blocker, an ACE inhibitor, an antioxidant, a diuretic, an anti-diabetic agent, or a combination thereof.

[0084] The compositions described herein are administered in several ways depending on whether local or systemic treatment is desired. The compositions are administered via any of several routes of administration, intraparenchymal injection, intravenously, intrathecally, intramuscularly, intracisternally, intracoronary injection, intramyocardium injection,ATTORNEY DOCKET NO: 105740-1413992 intradermally, endomyocardiac injection, or a combination thereof. In some embodiments, one or more routes can be used to administer treatment. These routes can be simultaneous or sequential. Effective doses for any of the administration methods described herein can be extrapolated from dose-response curves derived from in vitro or animal model test systems. It is understood that combinations, for example, recombinant AAV7 particles described herein and a second therapeutic agent described herein can be administered separately but simultaneously (e.g., via separate intravenous lines into the same subject), or sequentially (e.g., one of the agents is given first followed by the second).

[0085] As used throughout, “patient” is used interchangeably with “subject.” By subject is meant an individual. The subject can be an adult subject or a pediatric subject. Pediatric subjects include subjects ranging in age from birth to eighteen years of age. Preferably, the subject is an animal, for example, a mammal such as a primate, and, more preferably, a human. Non-human primates are subjects as well. The term subject includes domesticated animals, such as cats, dogs, etc., livestock (for example, cattle, horses, pigs, sheep, goats, etc.) and laboratory animals (for example, ferret, chinchilla, mouse, rabbit, rat, gerbil, guinea pig, etc.). Thus, veterinary uses and medical formulations are contemplated herein.

[0086] As used throughout, “treat,” “treating,” and “treatment” refer to a method of reducing or delaying one or more effects or symptoms of FA. The subject can be diagnosed with FA. Treatment can also refer to a method of reducing the underlying pathology rather than just the symptoms. The effect of the administration to the subject can have the effect of, but is not limited to, reducing one or more symptoms of the disease, a reduction in the severity of the disease, the complete ablation of the disease, a delay in relapse, or a delay in the onset or worsening of one or more symptoms. For example, a disclosed method is considered to be a treatment if there is about a 10% reduction in one or more symptoms of the disease (e.g., muscle loss, ataxia in arms and legs in a subject, diabetes, cardiomyopathy, etc.) when compared to the subject prior to treatment or when compared to a control subject or control value. Thus, the reduction can be about a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between, as compared to a control (e.g., a subject that has not been treated with a recombinant AAV vector described herein). Any of the methods of treatment provided herein can result in decreased or reduced neurotoxicity and / or cardiotoxicity as compared to a control. The methods provided herein can also be used to target expression of frataxin in disease relevant tissues (cerebellum, dorsal root ganglia (DRG), spinal cord, and heart), while reducing off target effects in other cells or tissues (e.g., as compared to a control).ATTORNEY DOCKET NO: 105740-1413992

[0087] Also provided are methods of modulating expression of FXN in a human cell in vivo, ex vivo or in vitro. In some embodiments, the methods include introducing into the human cell, any of the recombinant AAV vectors provided herein. In some embodiments the cell is in a subject.

[0088] Also provided are methods for increasing adenosine triphosphate (ATP) concentration in a human cell of a subject with FA. The methods include administering to the subject a therapeutically effective amount of any of the recombinant AAV particles provided herein. In some methods, the human cell is selected from the group consisting of a neuron, a cardiomyocyte, a smooth muscle myocyte, a skeletal myocyte, and a hepatocyte.

[0089] As used throughout, an increase can be an increase of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400% or greater as compared to a control. Increases in the levels of ATP expressed in cells of FA patients can be beneficial for ameliorating one or more symptoms of the disease, increasing long-term survival, and / or reducing side effects associated with other treatments. Upon administration of the recombinant AAV vectors disclosed herein to human FA patients, the recombinant AAV vectors can express increased, yet modulated, levels of FXN, and ATP production by mitochondria can be increased, relative to the disease state.

[0090] In some embodiments, 100,000 to 500,000 cells; 500,000 to 1,000,000 cells; 1,000.000 cells to 2,500,000 cells; 2,500,000 to 5,000,000 cells; 5,000,000 to 10,000.000 cells: 10,000,000 to 50,000,000 cells; 50,000,000 to 100,000,000; 100,000,000 to 250,000,000 cells: 150,000,000 to 300,00,000 cells: 250,000,000 to 500,000,000 cells; 500,000,000 to 1,000,000,000 cells: 1,000,000.000 to 5,000,00,000 cells; 5,000,000,000 to 10,000,000,000 cells; 10,000,000,000 to 20,000,00000 cells: 15,000,000,000 to 30,000,000,000 cells; 30,000,000,000 to 50,000,000,000 cells: 50,000,000,000 to 75,000,000,000 cells: or 75,000,000,000 to 100,00000,000 cells in FA patients to whom any of the recombinant AAV vectors described herein are administered can express increased, yet modulated levels of FXN. In some methods, ATP production by mitochondria can be increased, relative to ATP production in the disease state. EXAMPLES EXAMPLE 1 Biodistribution and Efficacy of an AAV-hFXN Expression Vector in Rodent CNS

[0091] The LTX401 gene expression cassette, comprised of a human FXN (hFXN) sequence under the control of a synthetic Desmin promoter and a modified hFXN5’UTR, wasATTORNEY DOCKET NO: 105740-1413992 engineered (Fig.1) using standed molecular biology techniques. See, for example, Sambrook et al., Molecular Cloning : a Laboratory Manual. Cold Spring Harbor, N.Y. :Cold Spring Harbor Laboratory Press, 2001. Figs. 1 and 11 are schematic drawings of the LTX401 expression construct or vector comprising SEQ ID NO: 14 or SEQ ID NO: 15. SEQ ID NO: 14 and SEQ ID NO: 15 comprise an exemplary nucleic acid construct comprising, in the following order: (a) a nucleic acid sequence comprising an RNA polymerase II promoter (i.e., a desmin promoter comprising SEQ ID NO: 6) (b) a nucleic acid sequence comprising a 5’UTR FXN (SEQ ID NO: 4); (c) an intron (SEQ ID NO: 5); and (d) a nucleic acid sequence encoding human FXN (SEQ ID NO: 3), wherein the RNA polymerase II promoter is operably linked to the 5’UTR FXN and the nucleic acid sequence encoding a human FXN.

[0092] This construct was packaged in AAV serotype 7 for injection into the CNS of parvalbumin-Cre conditional frataxin knockout (PV) mice which recapitulate features of FA neuropathophysiology. See, for example, Zolotukhin et al., “Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors,” Methods 2002 Oct;28(2):158- 67. Mice were assigned to sex-balanced groups and underwent stereotactic injection of LTX401 or excipient unilaterally into the CSF and bilaterally into deep cerebellar nuclei (DCN) for a total of 3 injections per brain. DCN (1e10vg / site), 4th ventricle (7.5e10 viral genomes (vg)) dosing occurred in a single surgical session. Group sizes were approximate 10-16 animals per cohort and were sex-balanced.

[0093] Cohorts of PV mice were injected with either LTX401 or excipient via a combined intraventricular (4thventricle) and intraparenchymal route (deep cerebellar nuclei DCN). Motor performance was assessed using the accelerating rotarod until 17 or 19 weeks of age. Tissues from all cohorts were harvested at endpoint for biochemical and histological examination. Delivery of LTX401 via this novel route of administration resulted in broad biodistribution across multiple CNS and PNS resident cells. Biochemical analyses revealed near-physiological human frataxin expression within tissues critically affected in FA including cerebellum and dorsal root ganglia. There were no gross histopathological findings and no evidence of neurotoxicity, following long term CNS expression of LTX401. In addition to its safety profile, LTX401 was effective at significantly improving and stabilizing the motor performance of the PV-Cre mouse model of FA. LTX401 can be used for the treatment of myocardial and CNS- related pathologies in FA.

[0094] Figs.1A and 1C show that expression of a codon-optimized human FXN cDNA is under the control of a synthetic, unique regulatory element that incorporates sequences from the DES and FXN promoter regions. This construct efficiently drives levels of expression inATTORNEY DOCKET NO: 105740-1413992 disease relevant tissues (cerebellum, dorsal root ganglia (DRG), spinal cord, and heart) and displays limited expression in off-target tissues. Fig.1 B shows that AAV7 is a neuro-and myo- tropic capsid, that targets tissues and cell types affected in FA. The AAV7 capsid structure is closely related to AAV13 and belongs to the structurally unique AAV clade D.

[0095] FIGS. 2A-2C show a schematic of an exemplary experiment. PV-Cre conditional mFXN KO (PV) mice were obtained at 5 weeks of age from Jax Labs. Mice were assigned to sex-balanced groups and underwent stereotactic injection of LTX401 or excipient unilaterally into the CSF and bilaterally into deep cerebellar nuclei (DCN) for a total of 3 injections per brain (FIG. 2A). Motor performance was assessed via accelerating rotarod (acceleration of speed from 5 to 40rpm; total duration 300 seconds). Excipient injected aphenotypic litter mates were used as unaffected controls (Fig.2B). Histological analysis included H&E and anti-hFXN staining (Fig.2C). Biochemical analysis included hFXN-specific ELISA (Abcam (Cambridge, UK); according to manufacture’s instructions) and qPCR for vector genomes using standard molecular biology techniques and primers targeting the human frataxin (hFXN) sequence.

[0096] As shown in Fig. 3A, performance of PV-mice on accelerating rotarod was significantly improved after injection of 1X (DCN 1e10vg / site, 4thventricle 7.5e10 vg) or 0.5X (DCN 5e9 vg / site, 4th ventricle 3.75e10) dose of LTX401 at 5 weeks of age compared to injection of excipient alone. Black stars correspond to p-value versus excipient injected controls and red stars correspond to p-value versus excipient injected PV (Excip.-PV). *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

[0097] Figs.3B and 3C show dose-dependent expression of hFXN protein in thoracic DRG and cerebellum, respectively. Fig.3D shows dose dependent accumulation of LTX401 vector genomes in the cerebellum. All data are represented as mean + / -SEM.

[0098] Fig. 4A shows that performance of PV-mice on accelerating rotarod was significantly improved after injection of 1X dose of LTX401 at a late symptomatic age of 7.5 weeks compared to injection of excipient alone. Black stars correspond to p-value versus excipient injected controls and red stars correspond to p-value versus excipient injected PV (Excip.-PV). *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

[0099] Figs. 4B and 4C show a growth curve and Percent change in body weight, respectively, between 5 and 20 weeks of age for all experimental groups. Injection of LTX401 prevented weight loss observed in excipient injected PV mice. Data are represented as mean + / -SEM, *p<0.05; **p<0.01. Figs. 4D and 4E show expression of hFXN protein in thoracic DRG and cerebellum, respectively. Fig. 4F shows quantification of LTX401 vector genomes in the cerebellum. All data are represented as mean + / -SEM. Fig.4G provides representativeATTORNEY DOCKET NO: 105740-1413992 images of hFXN expression and H&E staining in deep cerebellar nuclei of LTX401 injected PV mice at 20 weeks of age compared to excipient injected controls.

[0100] Fig.5A is a growth curve showing that injecting LTX401 via a combined CNS+IV route of administration in WT mice did not negatively affect weight gain when compared to excipient injected controls. Fig. 5B shows expression of hFXN protein in cerebellum, heart, liver, and thoracic DRG. Fig. 5C shows quantification of LTX401 vector genomes in cerebellum, heart, and liver. All data are represented as mean + / -SEM. Fig. 5D provides representative images of hFXN expression and H&E staining in heart and deep cerebellar nuclei and liver of LTX401 injected WT mice at 30 weeks of age compared to excipient injected controls. *No hFXN staining was detected in liver.

[0101] Figs. 6A and 6B show Sagittal and coronal views of post-injection MRI showing gadolinium contrast in bilateral dentate nuclei and CSF following convection-enhanced delivery of LTX40.

[0102] In summary, LTX401 displays desirable biodistribution, safety, and efficacy profiles in the adult CNS following delivery into the posterior fossa. LTX401 is also safe and effective following systemic delivery across a broad range of doses in the MCK mouse model of FA-related cardiomyopathy (see below). Combined CNS and intravenous delivery of LTX401 is safe in WT mice and provides robust and durable expression of hFXN in target tissues for at least 24 weeks or 6 months post-injection. These results show that LTX401 could be used for the treatment of myocardial and CNS-related pathologies in FA. EXAMPLE 2 Biodistribution and Activity of an AAV-hFXN Expression Vector in an MCK Mouse Model of FA

[0103] An expression cassette containing the human FXN sequence under the control of a synthetic Desmin promoter and a modified FXN5’ UTR was engineered. This construct was packaged in AAV serotype 7, herein referred to as LTX401. LTX401 was intravenously administered into 5-week-old MCK mice, which lack frataxin in cardiac and skeletal muscle (Strain #029720 (Fxnflox / null::MCK-Cre), The Jackson Laboratory, Bar Harbor ME). At 15 weeks post-administration, cardiac function in treated and untreated animals was assessed via MRI. Subsequently, animals were harvested for biochemical and histological examination. As described in more detail below, intravenous delivery of LTX401 resulted in broad biodistribution to cardiac tissue, recovery of cardiac function, and tolerability in the MCK mouse. Administration of the target dose resulted in near-physiological frataxin expression inATTORNEY DOCKET NO: 105740-1413992 the heart, and this correlated with marked improvements in cardiac ejection fraction. Furthermore, LTX401 was well-tolerated up to 5-fold our target dose in MCK and non- transgenic mice. No gross histopathological findings were observed in heart or off-target tissues.

[0104] Fig. 7A shows LTX401 vector design. The LTX401 FXN expression cassette features a tissue-restricted, modified, Desminpromoter and a FXN5’UTR region. The 5’ UTR includes transcription factor binding sites to regulate FXN and avoid toxic overexpression. The cassette was packaged in AAV7 capsid, which is myo-tropic and neuro-tropic, making it ideal for targeting cardiac and neuronal tissues in FA. Fig.7B shows the experimental design of an MCK mouse study. MCK-Cre conditional mFXNKO mice (approximate n = 6-10 / cohort) were administered LTX401 intravenously (5e13 vg / kg) at approximately 5 weeks of age and maintained to 20 weeks of age (WOA). At 20 WOA, animals were assessed with cardiac MRI and subsequently necropsied for further assessment of tissues.

[0105] Fig. 8A shows that LTX401 treatment increases probability of survival of MCK mice at 20 weeks of age (WOA). LTX401 treated and untreated MCKs are plotted against untreated C57BL / 6J (B6) mice.100% of untreated MCK mice reached a moribund status by 10 WOA, while 100% of treated MCKs and untreated B6 mice survived to the study end point of 20 WOA. Fig.8B shows that LTX401 treatment significantly alters heart / body weight ratio of MCK mice. This correction is notable as MCKs experience cardiac enlargement and longitudinal body weight loss. Figs.8C and 8D show Cardiac MRI of LTX401-treated MCK mice. MRI-generated images of MCK hearts in the transverse plane show reduced contractile activity of the left ventricle (LV) at end-systole, with visible improvement at 20 WOA in LTX401-treated mice (C). MRI-based calculation of cardiac ejection fraction further demonstrates significant recovery of MCK cardiac activity towards that of healthy B6 mice (D). One-way ANOVA performed in B and C. *, p<0.05; ***, p<0.001; ****, p<0.0001

[0106] Fig. 9A shows histology of heart and liver of LTX401-treated MCK mice. Hemotoxylin-eosin (H&E) staining of heart tissue in rows A-I reveals fibrotic accumulation of extracellular matrix (arrow) in heart tissue of un-injected MCK mice at 9 weeks of age (WOA). This fibrosis is greatly reduced at 20 WOA in MCK mice given an IV dose of 5E13 vg / Kg LTX401 at 5 WOA. Immunohistochemical labeling of human frataxin protein in row A-II demonstrates LTX401-driven expression of hFXN in MCK heart at 20 WOA. Human FXN signal was not detected in untreated animals. No perivascular immune infiltration was detectable in H&E stains of liver from LTX401-treated MCK mice, as compared to both un- injected C57BL / 6J (B6) and MCK mice (row A-III).ATTORNEY DOCKET NO: 105740-1413992

[0107] Fig.9B provides an assessment of LTX401 vector genome copies and hFXN protein levels present in heart and liver tissues of LTX401-treated MCK. Vector genomes were detected by qPCR in heart (I.) and liver (II.) tissues. Quantitation of human frataxin protein (hFXN) present in heart (III.) and liver (IV.) tissue of LTX401-treated MCK mice was performed by ELISA. Mean levels of endogenous mouse frataxin (End. mFXN) detected in c57BL / 6J mice with an analogous ELISA are also represented. Despite the appearance of higher vector genome deposition in liver as compared to heart (I.-II.), hFXN protein overexpression is markedly lower in liver at all doses tested (III.-IV).

[0108] Biodistribution and tolerability of LTX401 was assessed in non-human primate heart and liver tissues 90 days after intravenous administration. Fig. 10A provides an assessment of LTX401 vector genome copies and FXN protein levels present in heart and liver tissues of LTX401-treated African green monkeys (AGM). Vector genomes were assessed by qPCR for the left ventricle (LV) of the heart as well as pooled tissue from the various lobes of the liver (A-I). For both the 1.5E13 and 3E13 IV doses, vector genomes were detected in the LV at < 1 copy per diploid AGM genome. Within the liver, vector genomes were detected between 2 and 36 copies per diploid genome. Quantitation of total frataxin protein present in the same tissues was performed by ELISA (A-II). As compared to endogenous AGM levels, mean FXN over-expression in LV was detected at 41.8% and 75.8% for the 1.5E13 and 3E3 vg / Kg doses, respectively. In contrast, no meaningful overexpression of FXN was detected in the liver at either dose.

[0109] Fig. 10B shows histology of heart and liver of LTX401-dosed AGMs. No test article-related lesions were detected in Hematoxylin-eosin-stained heart (B-I) or liver (B-II) of AGMs 90 days after IV administration of LTX401 at either 1.5E13 or 3E13 vg / Kg doses. Human FXN RNA was detected in a dose-dependent manner in the heart of LTX-401-dosed AGMs (B-III). Green-hFXN in situ hybridization, Red-Wheat Germ Agglutinin, Blue-DAPI.

[0110] In summary, the studies in the MCK mouse model showed that LTX401 demonstrates robust yet safe cardiac biodistribution and efficacy when administered intravenously into the MCK mouse model of Friedreich’s ataxia. LTX401 also displays tolerability and cardiac biodistribution following systemic delivery into non-human primates. General Terminology

[0111] The grammatical articles “a”, “an”, and “the”, as used herein, are intended to include “at least one” or “one or more”, unless otherwise indicated, even if “at least one” or “one or more” is expressly used in certain instances. Thus, the articles are used herein to refer to oneATTORNEY DOCKET NO: 105740-1413992 or more than one (i.e., to “at least one”) of the grammatical objects of the article. Further, the use of a singular noun includes the plural, and the use of a plural noun includes the singular, unless the context of the usage requires otherwise.

[0112] The use herein of the terms “comprising,” “including,” or “having,” and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof as well as additional elements. Embodiments recited as “comprising,” "including,” or “having” certain elements are also contemplated as “consisting essentially of” and “consisting of” those certain elements.

[0113] As used herein, the transitional phrase “consisting essentially of” (and grammatical variants) is to be interpreted as encompassing the recited materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed invention. See In re Herz, 537 F.2d 549, 551-52, 190 U.S.P.Q.461, 463 (CCPA 1976) (emphasis in the original); see also MPEP §2111.03. Thus, the term "consisting essentially of" as used herein should not be interpreted as equivalent to “including.”

[0114] The use of any and all examples or exemplary language (e.g., “such as”) provided herein, is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed.

[0115] The terms “may,” “may be,” “can,” and “can be,” and related terms are intended to convey that the subject matter involved is optional (that is, the subject matter is present in some examples and is not present in other examples), not a reference to a capability of the subject matter or to a probability, unless the context clearly indicates otherwise.

[0116] “About” is used to provide flexibility to a numerical range endpoint by providing that a given value may be “slightly above” or “slightly below” the endpoint without affecting the desired result.

[0117] Any numerical range recited in this specification describes all sub-ranges of the same numerical precision (i.e., having the same number of specified digits) subsumed within the recited range. For example, a recited range of “1.0 to 10.0” describes all sub-ranges between (and including) the recited minimum value of 1.0 and the recited maximum value of 10.0, such as, for example, “2.4 to 7.6,” even if the range of “2.4 to 7.6” is not expressly recited in the text of the specification. Also, unless expressly specified or otherwise required by context, all numerical parameters described in this specification (such as those expressing values, ranges, amounts, percentages, and the like) may be read as if prefaced by the word “about,” even if the word “about” does not expressly appear before a number. “About” is used to provide flexibilityATTORNEY DOCKET NO: 105740-1413992 to a numerical range endpoint by providing that a given value may be “slightly above” or “slightly below” the endpoint without affecting the desired result.

[0118] Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutations of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a method is disclosed and discussed and a number of modifications that can be made to a number of molecules including in the method are discussed, each and every combination and permutation of the method, and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of this disclosure including, but not limited to, steps in methods using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific method steps or combination of method steps of the disclosed methods, and that each such combination or subset of combinations is specifically contemplated and should be considered disclosed.

[0119] Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference in their entireties. Additional Sequences SEQ ID NO: 12 (Ampicllin resistance gene) atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctacATTORNEY DOCKET NO: 105740-1413992 acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc SEQ ID NO: 13 (Kanamycin resistance gene) at gagccatatt caacgggaaa cgtcgaggcc gcgattaaat tccaacatgg atgctgattt atatgggtat aaatgggctc gcgataatgt cgggcaatca ggtgcgacaa tctatcgctt gtatgggaag cccgatgcgc cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa tgatgttaca gatgagatgg tcagactaaa ctggctgacg gaatttatgc ctcttccgac catcaagcat tttatccgta ctcctgatga tgcatggtta ctcaccactg cgatccccgg aaaaacagca ttccaggtat tagaagaata tcctgattca ggtgaaaata ttgttgatgc gctggcagtg ttcctgcgcc ggttgcattc gattcctgtt tgtaattgtc cttttaacag cgatcgcgta tttcgtctcg ctcaggcgca atcacgaatg aataacggtt tggttgatgc gagtgatttt gatgacgagc gtaatggctg gcctgttgaa caagtctgga aagaaatgca taaacttttg ccattctcac cggattcagt cgtcactcat ggtgatttct cacttgataa ccttattttt gacgagggga aattaatagg ttgtattgat gttggacgag tcggaatcgc agaccgatac caggatcttg ccatcctatg gaactgcctc ggtgagtttt ctccttcatt acagaaacgg ctttttcaaa aatatggtat tgataatcct gatatgaata aattgcagtt tcatttgatg ctcgatgagt ttttctaa SEQ ID NO: 14 (LTX401) ttacgattac cgttcatcgc cctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag 60 cccgggcgtc gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag 120 ggagtggaat tcacgcgtgg taccgatctt accccctgcc ccccacagct cctctcctgt 180 gccttgtttc ccagccatgc gttctcctct ataaataccc gctctggtat ttggggttgg 240 cagctgttgc tgccagggag atggttgggt tgacatgcgg ctcctgacaa aacacaaacc 300 cctggtgtgt gtgggcgtgg gtggtgtgag tagggggatg aatcagggag ggggcggggg 360 acccaggggg caggagccac acaaagtctg tgcgggggtg ggagcgcaca tagcaattgg 420 aaactgaaag cttatcagac cctttctgga aatcagccca ctgtttataa acttgaggcc 480 ccaccctcga gataaccagg gctgaaagag gcccgcctgg gggctggaga catgcttgct 540 gcctgccctg gcgaaggatt ggcaggcttg cccgtcacag gacccccgct ggctgactca 600 ggggcgcagg cctcttgcgg gggagctggc ctccccgccc ccacggccac gggccgccct 660 ttcctggcag gacagcggga tcttgcagct gtcaggggag gggaggcggg ggctgatgtc 720 aggagggata caaatagtgc cgacggctgg gggccctgca gtctcccttg ggtcaggggt 780 cctggttgca ctccgtgctt tgcacaaagc aggctctcca tttttgttaa atgcacgaat 840 agtgctaagc tgggaagttc ttcctgaggt ctaacctcta gctgctcccc cacagaagag 900 tgcctgcgcc agtggccacc aggggtcgcc gcagcaccca gcgctggagg gcggagcggg 960 cggcagaccc ggagcagcca ggtaagtatc aaagtatcaa ggttacaaga caggtttaag 1020 gagaccaata gaaactgggc ttgtcgagac agagaagact cttgcgtttc tgataggcac 1080 ctattggtct tactgacatc cactttgcct ttctctccac aggctagcct tatcactagt 1140 gccaccatgt ggacactggg cagaagggca gtggctggcc tgctggcctc ccccagccct 1200 gcccaggccc agaccctgac cagagttccc aggcctgctg agctggcccc cctgtgtggc 1260 agaagaggcc tgagaacaga cattgatgcc acatgcaccc ctaggagagc cagcagcaac 1320 cagagaggcc tgaaccaaat ctggaatgtg aagaaacagt ctgtgtacct gatgaatctg 1380 agaaagtctg gcaccctggg ccaccctggc agcctggatg agaccaccta tgagagactg 1440 gctgaagaaa ccctggacag cctggctgaa ttctttgagg acctggctga caagccttac 1500 acctttgagg actatgatgt gagctttggc agtggagtgc tgacagtgaa actgggagga 1560 gacctgggca cctatgtgat caacaagcag acaccaaaca aacagatctg gctgagcagc 1620 cctagctctg gcccaaagag atatgactgg acaggcaaga actgggtcta cagccatgat 1680 ggagtgtccc tccatgaact cctggctgca gagctgacca aggccctgaa gaccaagctg 1740 gacctgagca gcctggccta ctctggcaag gatgcctagt ctagactgtg ccttctagtt 1800 gccagccatc tgttgtttgc ccctcccccc tgccttcctt gaccctggaa ggtgccactc 1860 ccactgtcct ttcctaataa aatgaggaaa ttgcatggca ttgtctgagt aggtgtcatt 1920 ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa gacaatagca 1980 ggcatgctgg ggagagatcg atctgaggaa cccctagtga tggagttggc cactccctct 2040 ctgcgcgctc gctcgctcac tgaggccggg cgaccaaagg tcgcccgacg cccgggcttt 2100ATTORNEY DOCKET NO: 105740-1413992 gcccgggcgg cctcagtgag cgagcgagcg cgcagagagg gagtggcccc cccccccccc 2160 cccccggcga ttctcttgtt tgctccagac tctcaggcaa tgacctgata gcctttgtag 2220 agacctctca aaaatagcta ccctctccgg catgaattta tcagctagaa cggttgaata 2280 tcatattgat ggtgatttga ctgtctccgg cctttctcac ccgtttgaat ctttacctac 2340 acattactca ggcattgcat ttaaaatata tgagggttct aaaaattttt atccttgcgt 2400 tgaaataaag gcttctcccg caaaagtatt acagggtcat aatgtttttg gtacaaccga 2460 tttagcttta tgctctgagg ctttattgct taattttgct aattctttgc cttgcctgta 2520 tgatttattg gatgttggaa tcgcctgatg cggtattttc tccttacgca tctgtgcggt 2580 atttcacacc gcatatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc 2640 cagccccgac acccgccaac actatggtgc actctcagta caatctgctc tgatgccgca 2700 tagttaagcc agccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg 2760 ctcccggcat ccgcttacag acaagctgtg accgtctccg ggagctgcat gtgtcagagg 2820 ttttcaccgt catcaccgaa acgcgcgaga cgaaagggcc tcgtgatacg cctattttta 2880 taggttaatg tcatgataat aatggtttct tagacgtcag gtggcacttt tcggggaaat 2940 gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg 3000 agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagccatatt 3060 caacgggaaa cgtcgaggcc gcgattaaat tccaacatgg atgctgattt atatgggtat 3120 aaatgggctc gcgataatgt cgggcaatca ggtgcgacaa tctatcgctt gtatgggaag 3180 cccgatgcgc cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa tgatgttaca 3240 gatgagatgg tcagactaaa ctggctgacg gaatttatgc ctcttccgac catcaagcat 3300 tttatccgta ctcctgatga tgcatggtta ctcaccactg cgatccccgg aaaaacagca 3360 ttccaggtat tagaagaata tcctgattca ggtgaaaata ttgttgatgc gctggcagtg 3420 ttcctgcgcc ggttgcattc gattcctgtt tgtaattgtc cttttaacag cgatcgcgta 3480 tttcgtctcg ctcaggcgca atcacgaatg aataacggtt tggttgatgc gagtgatttt 3540 gatgacgagc gtaatggctg gcctgttgaa caagtctgga aagaaatgca taaacttttg 3600 ccattctcac cggattcagt cgtcactcat ggtgatttct cacttgataa ccttattttt 3660 gacgagggga aattaatagg ttgtattgat gttggacgag tcggaatcgc agaccgatac 3720 caggatcttg ccatcctatg gaactgcctc ggtgagtttt ctccttcatt acagaaacgg 3780 ctttttcaaa aatatggtat tgataatcct gatatgaata aattgcagtt tcatttgatg 3840 ctcgatgagt ttttctaatc agaattggtt aattggttgt aacattattc agattgggct 3900 tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct 3960 catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa 4020 gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa 4080 aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc 4140 gaaggtaact ggcttcagca gagcgcagat accaaatact gttcttctag tgtagccgta 4200 gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct 4260 gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg 4320 atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag 4380 cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc 4440 cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg 4500 agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt 4560 tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg 4620 gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca 4680 catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg 4740 agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc 4800 ggaagagcgc ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag 4860 ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa 4920 tggcgaatgg cgattccgtt gcaatggctg gcggtaatat tgttctggat attaccagca 4980 aggccgatag tttgagttct tctactcagg caagtgatgt tattactaat caaagaagta 5040 ttgcgacaac ggttaatttg cgtgatggac agactctttt actcggtggc ctcactgatt 5100 ataaaaacac ttctcaggat tctggcgtac cgttcctgtc taaaatccct ttaatcggcc 5160 tcctgtttag ctcccgctct gattctaacg aggaaagcac gttatacgtg ctcgtcaaag 5220 caaccatagt acgcgccctg tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc 5280 agcgtgaccg ctacacttgc cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc 5340 tttctcgcca cgttcgccgg ctttccccgt caagctctaa atcgggggct ccctttaggg 5400 ttccgattta gtgctttacg gcacctcgac cccaaaaaac ttgattaggg tgatggttca 5460 cgtagtgggc catcgccctg atagacggtt tttcgccctt tgacgttgga gtccacgttc 5520 tttaatagtg gactcttgtt ccaaactgga acaacactca accctatctc ggtctattct 5580 tttgatttat aagggatttt gccgatttcg gcctattggt taaaaaatga gctgatttaa 5640 caaaaattta acgcgaattt taacaaaata ttaacgctta caatttaaat atttgcttat 5700 acaatcttcc tgtttttggg gcttttctga ttatcaaccg gggtacatat gattgacatg 5760ATTORNEY DOCKET NO: 105740-1413992 ctagtt SEQ ID NO: 15 (LTX401) CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCA GTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGAATTCACGCGTGGTACCGATCTTACCCCCTGCCCCCCACAGCTC CTCTCCTGTGCCTTGTTTCCCAGCCATGCGTTCTCCTCTATAAATACCCGCTCTGGTATTTGGGGTTGGCAGCTG TTGCTGCCAGGGAGATGGTTGGGTTGACATGCGGCTCCTGACAAAACACAAACCCCTGGTGTGTGTGGGCGTGGG TGGTGTGAGTAGGGGGATGAATCAGGGAGGGGGCGGGGGACCCAGGGGGCAGGAGCCACACAAAGTCTGTGCGGG GGTGGGAGCGCACATAGCAATTGGAAACTGAAAGCTTATCAGACCCTTTCTGGAAATCAGCCCACTGTTTATAAA CTTGAGGCCCCACCCTCGAGATAACCAGGGCTGAAAGAGGCCCGCCTGGGGGCTGgAGACATGCTTGCTGCCTGC CCTGGCGAAGGATTGGCAGGCTTGCCCGTCACAGGACCCCCGCTGGCTGACTCAGGGGCGCAGGCCTCTTGCGGG GGAGCTGGCCTCCCCGCCCCCACGGCCACGGGCCGCCCTTTCCTGGCAGGACAGCGGGATCTTGCAGCTGTCAGG GGAGGGGAGGCGGGGGCTGATGTCAGGAGGGATACAAATAGTGCCGACGGCTGGGGGCCCTGCAGTCTCCCTTGG GTCAGGGGTCCTGGTTGCACTCCGTGCTTTGCACAAAGCAGGCTCTCCATTTTTGTTAAATGCACGAATAGTGCT AAGCTGGGAAGTTCTTCCTGAGGTCTAACCTCTAGCTGCTCCCCCACAGAAGAGTGCCTGCGgCCAGTGGCCACC AGGGGTCGCCGCAGCACCCAGCGCTGGAGGGCGGAGCGGGCGGCAGACCCGGAGCAGCCAGGTAAGTATCAAAGT ATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTC TGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGCTAGCCTTATCACTAGTGCCAC CATGTGGACACTGGGCAGAAGGGCAGTGGCTGGCCTGCTGGCCTCCCCCAGCCCTGCCCAGGCCCAGACCCTGAC CAGAGTTCCCAGGCCTGCTGAGCTGGCCCCCCTGTGTGGCAGAAGAGGCCTGAGAACAGACATTGATGCCACATG CACCCCTAGGAGAGCCAGCAGCAACCAGAGAGGCCTGAACCAAATCTGGAATGTGAAGAAACAGTCTGTGTACCT GATGAATCTGAGAAAGTCTGGCACCCTGGGCCACCCTGGCAGCCTGGATGAGACCACCTATGAGAGACTGGCTGA AGAAACCCTGGACAGCCTGGCTGAATTCTTTGAGGACCTGGCTGACAAGCCTTACACCTTTGAGGACTATGATGT GAGCTTTGGCAGTGGAGTGCTGACAGTGAAACTGGGAGGAGACCTGGGCACCTATGTGATCAACAAGCAGACACC AAACAAACAGATCTGGCTGAGCAGCCCTAGCTCTGGCCCAAAGAGATATGACTGGACAGGCAAGAACTGGGTCTA CAGCCATGATGGAGTGTCCCTCCATGAACTCCTGGCTGCAGAGCTGACCAAGGCCCTGAAGACCAAGCTGGACCT GAGCAGCCTGGCCTACTCTGGCAAGGATGCCTAGTCTAGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGC CCCTCCCCCCTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCA TGGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAA GACAATAGCAGGCATGCTGGGGAGAGATCGATCTGAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCG CGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAG CGAGCGAGCGCGCAGAGAGGGAGTGGCC SEQ ID NO: 16 (human frataxin promoter) aagaaaactt tcacaatttg catccctttg taatatgtaa cagaaataaa attctctttt 60 aaaatctatc aacaataggc aaggcacggt ggctcacgcc tgtcgtctca gcactttgtg 120 aggcccaggc gggcagatcg tttgagccta gaagttcaag accaccctgg gcaacatagc 180 gaaaccccct ttctacaaaa aatacaaaaa ctagctgggt gtggtggtgc acacctgtag 240 tcccagctac ttggaaggct gaaatgggaa gactgcttga gcccgggagg gagaagttgc 300 agtaagccag gaccacacca ctgcactcca gcctgggcaa cagagtgaga ctctgtctca 360 aacaaacaaa taaatgaggc gggtggatca cgaggtcagt agatcgagac catcctggct 420 aacacggtga aacccgtctc tactaaaaaa aaaaaaaaat acaaaaaatt agccaggcat 480 ggtggcgggc gcctgtagtc ccagttactc gggaggctga ggcaggagaa tggcgtgaaa 540 ccgggaggca gagcttgcag tgagccgaga tcgcaccact gccctccagc ctgggcgaca 600 gagcgagact ccgtctcaat caatcaatca atcaataaaa tctattaaca atatttattg 660 tgcacttaac aggaacatgc cctgtccaaa aaaaacttta cagggcttaa ctcattttat 720 ccttaccaca atcctatgaa gtaggaactt ttataaaacg cattttataa acaaggcaca 780 gagaggttaa ttaacttgcc ctctggtcac acagctagga agtgggcaga gtacagattt 840 acacaaggca tccgtctcct ggccccacat acccaactgc tgtaaaccca taccggcggc 900 caagcagcct caatttgtgc atgcacccac ttcccagcaa gacagcagct cccaagttcc 960 tcctgtttag aattttagaa gcggcgggcc accaggctgc agtctccctt gggtcagggg 1020 tcctggttgc actccgtgct ttgcacaaag caggctctcc atttttgtta aatgcacgaa 1080 tagtgctaag ctgggaagtt cttcctgagg tctaacctct agctgctccc ccacagaaga 1140 gtgcctgcgg ccagtggcca ccaggggtcg ccgcagcacc cagcgctgga gggcggagcg 1200 ggcggcagac ccggagcagc 1220ATTORNEY DOCKET NO: 105740-1413992 SEQ ID NO: 17 (human frataxin promoter) aagaaaactt tcacaatttg catccctttg taatatgtaa cagaaataaa attctctttt 60 aaaatctatc aacaataggc aaggcacggt ggctcacgcc tgtcgtctca gcactttgtg 120 aggcccaggc gggcagatcg tttgagccta gaagttcaag accaccctgg gcaacatagc 180 gaaaccccct ttctacaaaa aatacaaaaa ctagctgggt gtggtggtgc acacctgtag 240 tcccagctac ttggaaggct gaaatgggaa gactgcttga gcccgggagg gagaagttgc 300 agtaagccag gaccacacca ctgcactcca gcctgggcaa cagagtgaga ctctgtctca 360 aacaaacaaa taaatgaggc gggtggatca cgaggtcagt agatcgagac catcctggct 420 aacacggtga aacccgtctc tactaaaaaa aaaaaaaaat acaaaaaatt agccaggcat 480 ggtggcgggc gcctgtagtc ccagttactc gggaggctga ggcaggagaa tggcgtgaaa 540 ccgggaggca gagcttgcag tgagccgaga tcgcaccact gccctccagc ctgggcgaca 600 gagcgagact ccgtctcaat caatcaatca atcaataaaa tctattaaca atatttattg 660 tgcacttaac aggaacatgc cctgtccaaa aaaaacttta cagggcttaa ctcattttat 720 ccttaccaca atcctatgaa gtaggaactt ttataaaacg cattttataa acaaggcaca 780 gagaggttaa ttaacttgcc ctctggtcac acagctagga agtgggcaga gtacagattt 840 acacaaggca tccgtctcct ggccccacat acccaactgc tgtaaaccca taccggcggc 900 caagcagcct caatttgtgc atgcacccac ttcccagcaa gacagcagct cccaagttcc 960 tcctgtttag aattttagaa gcggcgggcc accaggctg 999 SEQ ID NO: 18 (3’UTR frataxin promoter) actagtgcca ccatgtggac actggggaga agggccgtgg ctggactgct ggcttctcca 60 tctccagccc aggcccagac cctgaccaga gtgcctagac ctgccgaact ggcccctctg 120 tgtggcagaa gaggcctgag aaccgacatc gacgccacct gtacccccag aagggccagc 180 agcaatcagc ggggcctgaa tcagatctgg aacgtgaaga aacagagcgt gtacctgatg 240 aacctgagaa agagcggcac cctgggccac cctggaagcc tggatgagac aacctacgag 300 cggctggccg aggaaaccct ggattccctg gccgagttct tcgaggacct ggccgacaag 360 ccctacacct tcgaggatta cgacgtgtcc ttcggcagcg gcgtgctgac agtgaagctg 420 ggcggagatc tgggcaccta cgtgatcaac aagcagaccc ccaacaaaca gatctggctg 480 agcagcccca gcagcggccc caagagatac gattggaccg gcaagaactg ggtgttcagc 540 cacgacggcg tgtccctgca tgagctgctg gctgccgagc tgaccaaggc cctgaaaaca 600 aagctggacc tgagctggct ggcctacagc ggcaaagatg ccatcgatat ccccagcccc 660 gttttaagga cattaaaagc tatcaggcca agaccccagc ttcattatgc agctgaggtc 720 tgttttttgt tgttgttgtt gtttattttt tttattcctg cttttgagga cagttgggct 780 atgtgtcaca gctctgtaga aagaatgtgt tgcctcctac cttgccccca agttctgatt 840 tttaatttct atggaagatt ttttggattg tcggatttcc tccctcacat gatacccctt 900 atcttttata atgtcttatg cctatacctg aatataacaa cctttaaaaa agcaaaataa 960 taagaaggaa aaattccagg agggaaaatg aattgtcttc actcttcatt ctttgaagga 1020 tttactgcaa gaagtacatg aagagcagct ggtcaacctg ctcactgttc tatctccaaa 1080 tgagacacat taaagggtag cctacaaatg ttttcaggct tctttcaaag tgtaagcact 1140 tctgagctct ttagcattga agtgtcgaaa gcaactcaca cgggaagatc atttcttatt 1200 tgtgctctgt gactgccaag gtgtggcctg cactgggttg tccagggaga catgcatcta 1260 gtgctgtttc tcccacatat tcacatacgt gtctgtgtgt atatatattt tttcaattta 1320 aaggttagta tggaatcagc tgctacaaga atgcaaaaaa tcttccaaag acaagaaaag 1380 aggaaaaaaa gccgttttca tgagctgagt gatgtagcgt aacaaacaaa atcatggagc 1440 tgaggaggtg ccttgtaaac atgaaggggc agataaagga aggagatact catgttgata 1500 aagagagccc tggtcctaga catagttcag ccacaaagta gttgtccctt tgtggacaag 1560 tttcccaaat tccctggacc tctgcttccc catctgttaa atgagagaat agagtatggt 1620 tgattcccag cattcagtgg tcctgtcaag caacctaaca ggctagttct aattccctat 1680 tgggtagatg aggggatgac aaagaacagt ttttaagcta tataggaaac attgttattg 1740 gtgttgccct atcgtgattt cagttgaatt catgtgaaaa taatagccat ccttggcctg 1800 gcgcggtggc tcacacctgt aatcccagca cttttggagg ccaaggtggg tggatcacct 1860 gaggtcagga gttcaagacc agcctggcca acatgatgaa accccgtctc tactaaaaat 1920 acaaaaaatt agccgggcat gatggcaggt gcctgtaatc ccagctactt gggaggctga 1980 agcggaagaa tcgcttgaac ccagaggtgg aggttgcagt gagccgagat cgtgccattg 2040 cactgtaacc tgggtgactg agcaaaactc tgtctcaaaa taataataac aatataataa 2100ATTORNEY DOCKET NO: 105740-1413992 taataatagc catcctttat tgtaccctta ctgggttaat cgtattatac cacattacct 2160 cattttaatt tttactgacc tgcactttat acaaagcaac aagcctccag gacattaaaa 2220 ttcatgcaaa gttatgctca tgttatatta ttttcttact taaagaagga tttattagtg 2280 gctgggcatg gtggcgtgca cctgtaatcc caggtactca ggaggctgag acgggagaat 2340 tgcttgaccc caggcggagg aggttacagt gagtcgagat cgtacctgag cgacagagcg 2400 agactccgtc tcaaaaaaaa aaaaaaggag ggtttattaa tgagaagttt ggtcgac 2457 SEQ ID NO: 19 (3’UTR frataxin promoter) aagaaggaaa aattccagga gggaaaatga attgtcttca ctcttcattc tttgaaggat 60 ttactgcaag aagtacatga agagcagctg gtcaacctgc tcactgttct atctccaaat 120 gagacacatt aaagggtagc ctacaaatgt tttcaggctt ctttcaaagt gtaagcactt 180 ctgagctctt tagcattgaa gtgtcgaaag caactcacac gggaagatca tttcttattt 240 gtgctctgtg actgccaagg tgtggcctgc actgggttgt ccagggagac atgcatctag 300 tgctgtttct cccacatatt cacatacgtg tctgtgtgta tatatatttt ttcaatttaa 360 aggttagtat ggaatcagct gctacaagaa tgcaaaaaat cttccaaaga caagaaaaga 420 ggaaaaaaag ccgttttcat gagctgagtg atgtagcgta acaaacaaaa tcatggagct 480 gaggaggtgc cttgtaaaca tgaaggggca gataaaggaa ggagatactc atgttgataa 540 agagagccct ggtcctagac atagttcagc cacaaagtag ttgtcccttt gtggacaagt 600 ttcccaaatt ccctggacct ctgcttcccc atctgttaaa tgagagaata gagtatggtt 660 gattcccagc attcagtggt cctgtcaagc aacctaacag gctagttcta attccctatt 720 gggtagatga ggggatgaca aagaacagtt tttaagctat ataggaaaca ttgttattgg 780 tgttgcccta tcgtgatttc agttgaattc atgtgaaaat aatagccatc cttggcctgg 840 cgcggtggct cacacctgta atcccagcac ttttggaggc caaggtgggt ggatcacctg 900 aggtcaggag ttcaagacca gcctggccaa catgatgaaa ccccgtctct actaaaaata 960 caaaaaatta gccgggcatg atggcaggtg cctgtaatcc cagctacttg ggaggctgaa 1020 gcggaagaat cgcttgaacc cagaggtgga ggttgcagtg agccgagatc gtgccattgc 1080 actgtaacct gggtgactga gcaaaactct gtctcaaaat aataataaca atataataat 1140 aataatagcc atcctttatt gtacccttac tgggttaatc gtattatacc acattacctc 1200 attttaattt ttactgacct gcactttata caaagcaaca agcctccagg acattaaaat 1260 tcatgcaaag ttatgctcat gttatattat tttcttactt aaagaaggat ttattagtgg 1320 ctgggcatgg tggcgtgcac ctgtaatccc aggtactcag gaggctgaga cgggagaatt 1380 gcttgacccc aggcggagga ggttacagtg agtcgagatc gtacctgagc gacagagcga 1440 gactccgtct caaaaaaaaa aaaaaggagg gtttattaat gagaagtttg 1490 SEQ ID NO: 20 (AAV2 ITR) TGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTC AGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCC SEQ ID NO: 21 (alternative 5’ UTR frataxin) TGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTC AGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCC

Claims

ATTORNEY DOCKET NO: 105740-1413992 What is claimed is:

1. A recombinant viral AAV7 vector comprising, in the following order: (a) a nucleic acid sequence comprising an RNA polymerase II promoter; (b) a nucleic acid sequence comprising a 5’UTR FXN; (c) an intron; and (d) a nucleic acid sequence encoding human FXN, wherein the RNA polymerase II promoter is operably linked to the 5’UTR FXN and the nucleic acid sequence encoding a human FXN, wherein the vector is flanked on each side by an AAV2 inverted terminal repeat.

2. The recombinant AAV7 vector of claim 1, wherein the RNA polymerase II promoter is a desmin promoter.

3. The recombinant AAV7 vector of claim 1 or 2, wherein the human FXN comprises SEQ ID NO:

1.

4. The recombinant AAV7 vector of claim 3, wherein the human FXN is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:

3.

5. The recombinant AAV7 vector of any one of claims 1-4, wherein the 5’UTR FXN comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 2 or SEQ ID NO:

4.

6. The recombinant AAV7 vector of any one of claims 1-5, wherein the intron comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:

5.

7. The recombinant AAV7 vector of any one of claims 2-6, wherein the desmin promoter comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:

6.

8. The recombinant AAV7 vector of any one of claims 1-7, wherein the recombinant AAV7 vector further comprises (e) a nucleic acid sequence encoding a polyadenylation sequence.

9. The recombinant AAV7 vector of claim 8, wherein the nucleic acid sequence encoding a polyadenylation sequence comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:

7.

10. The recombinant AAV7 vector of any one of claims 1-9, wherein the recombinant AAV7 vector comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO: 14 or SEQ ID NO: 15.ATTORNEY DOCKET NO: 105740-1413992 11. The recombinant AAV7 vector of any one of claims 1-10, wherein the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO: 6; (b) a 5’UTR FXN comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO; 2 or SEQ ID NO: 4; (c) an intron comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO: 5; and (d) a nucleic acid sequence comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO:

3.

12. The recombinant AAV7 vector of any one of claims 1-11, wherein the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising SEQ ID NO: 6; (b) a 5’UTR FXN comprising SEQ ID NO: 2 or SEQ ID NO: 4; (c) an intron comprising SEQ ID NO: 5; and (d) a nucleic acid sequence comprising SEQ ID NO:

3.

13. The recombinant AAV7 vector of any one of claims 1-12, wherein the vector further comprises (e) a nucleic acid sequence encoding a polyadenylation sequence.

14. The recombinant AAV7 vector of claim 13, wherein the nucleic acid sequence encoding a polyadenylation sequence comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:

7.

15. The recombinant AAV7 vector of any one of claims 1-14, wherein the recombinant AAV7 vector comprises SEQ ID NO: 14 or SEQ ID NO:

15.

16. The recombinant AAV7 vector of any one of claims 1-15, wherein the vector is flanked on each side by an AAV2 inverted terminal repeat comprising a nucleic acid sequence having at least 85% identity with SEQ ID NO: 8 or SEQ ID NO: 20, or the reverse complement of an AAV2 inverted terminal repeat comprising a nucleic acid sequence having at least 85% identity with SEQ ID NO: 8 or SEQ ID NO:

20.

17. A recombinant AAV7 particle comprising the recombinant AAV7 vector of any one of claims 1-16.

18. The recombinant AAV7 particle of claim 17, wherein the AAV7 particle comprises an AAV7 capsid protein.

19. A pharmaceutical composition comprising the recombinant AAV7 particle of claim 17 or 18.

20. A method for modulating frataxin expression in a cell comprising introducing: (a) the recombinant AAV7 vector of any one of claims 1-16; (b) the recombinant AAV7 particle of claim 17 or 18; or (c) the pharmaceutical composition of claim 19 intoATTORNEY DOCKET NO: 105740-1413992 the cell.

21. The method of claim 20, wherein the cell is an in vitro, in vivo, or ex vivo cell.

22. The method of claim 20 or 21, wherein the cell comprises a mutated frataxin gene comprising GAA repeats.

23. The method of claim 22, wherein the cell is in a subject.

24. A method of treating a patient with Friedreich’s Ataxia (FA) comprising administering a therapeutically effective amount of the recombinant AAV7 particle of claim 17 or 18 to the patient.

25. The method of claim 24, wherein the recombinant AAV7 particle is administered intravenously, intraventricularly or intraparenchymally.

26. The method of claim 25, wherein the recombinant AAV7 particle is administered intraventricularly and intraparenchymally.