Carbonic anhydrase ix ligands for targeted delivery applications

EP4612144A1Pending Publication Date: 2025-09-10PHILOCHEM AG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023800833
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-06-30
Filing Date
2023-11-02
Publication Date
2025-09-10

AI Technical Summary

Technical Problem

Current CAIX-targeting agents face challenges in achieving high specificity and selectivity, leading to off-target accumulation in healthy tissues, which limits the efficacy of diagnostic and therapeutic delivery to tumor sites.

Method used

Development of potent, stereospecific CAIX ligands with a low dissociation constant, exhibiting high selectivity for CAIX-expressing tumors while sparing healthy organs, allowing for targeted delivery of therapeutic and diagnostic agents.

Benefits of technology

The CAIX ligands demonstrate significant target specificity, enabling efficient and selective accumulation in tumors with minimal accumulation in healthy tissues, thereby enhancing the delivery of therapeutic and diagnostic agents to disease-relevant sites.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 1.1
    Figure 1.1
Patent Text Reader

Abstract

The present invention relates to protein ligands against Carbonic Anhydrase IX (CAIX) as target of biomedical relevance. In particular, the highly specific ligands may be able to exclusively interact with antigens expressed on the surface of tumor cells, namely, CAIX, sparing anti-target expressing healthy organs, thus enabling efficient in vivo pharmaco-delivery applications. The ligands may exhibit a particularly low dissociation constant and / or enzyme isoform specificity, and may be suitable for targeted delivery of a payload, such as a therapeutic and / or diagnostic agent, to a site afflicted by or at risk of disease or disorder characterized by expression of CAIX.
Need to check novelty before this filing date? Find Prior Art

Description

CARBONIC ANHYDRASE IX LIGANDS FORTARGETED DELIVERY APPLICATIONSFIELD OF THE INVENTIONThe present invention relates to protein ligands against Carbonic Anhydrase IX (CAIX) as target of biomedical relevance. In particular, the highly specific ligands may be able to exclusively interact with antigens expressed on the surface of tumor cells, namely, CAIX, sparing anti-target expressing healthy organs, thus enabling efficient in vivo pharmaco-delivery applications. The ligands may exhibit a particularly low dissociation constant and / or enzyme isoform specificity, and may be suitable for targeted delivery of a payload, such as a therapeutic and / or diagnostic agent, to a site afflicted by or at risk of disease or disorder characterized by expression of CAIX.BACKGROUND OF THE INVENTIONCarbonic anhydrase IX (CAIX) is a zinc metalloenzyme for which 15 isozymes have been reported in humans, mostly involved in the maintenance of cell homeostasis and carbon dioxide transport[1-2]CAIX is expressed at a low level in healthy tissues (Gl tract, liver and gall bladder), while higher expression has been observed in several solid tumors[2-5]in particular, CAIX is the most validated marker of Renal Cell Carcinoma (RCC) and of hypoxia, providing an attractive target for diagnostic and therapeutic approaches[4-5]Within several clinical trials, the use of CAIX-targeting antibodies (i.e., Girentuximab) armed with radionuclides have been investigated for diagnosis of breast cancer (www.clinicaltrials.gov Identifier: NCT04758780), urothelial cancer (NCT05046665), renal cell carcinoma (NCT02883153, NCT02497599, NCT03849118) and in combination with nivolumab for the treatment of kidney cancer (NCT05239533).Poor penetration of solid tumors remains a major limitation of antibody-diagnostics and therapeutics.[6]Cazzamalli and colleagues have shown fast extravasation of small organic ligands in contrast to antibodies, highlighting the suitability of small molecules for targeted inhibition or delivery approaches.[7]Several small molecule CAIX ligands undergo clinical development as imaging or therapeutic agents (monotherapy or in combination with other therapeutic modalities) against various types of malignancies. Acetazolamide, for example, has been tested in combination with platinum against localized small cell lung cancer (NCT03467360) and with temozolomide against malignant glioma (NCT03011671). SLC-0111, is investigated as monotherapy against solid tumors (NCT02215850) or in combination with gemicitabine for metastatic pancreatic ductal cancer (NCT03450018). DTP348 has been tested as radiosensitizer for solid tumors (NCT02216669). E7070 has been investigated for the treatment of gastric cancer (NCTO0165594), metastatic breast cancer (NCT00080197), solid tumors (NCT00003976, NCT00003981), renal cell carcinoma (NCT00059735), stage IV melanoma (NCT00014625) and as combination treatment for metastatic breast cancer (NCT00165880) and metastatic colorectal ccaanncceerr (NCT00165867, NCT00165854). [F-18JVM4-037 was applied as imaging agent for different cancers (NCT00884520). The COX-2 inhibitor celecoxib has also been investigated in the background of CAIX inhibition to treat cervicalintraepithelial neoplasia (NCT00081263), alongside radiation and surgery for advanced head and neck cancer (NCT04162873) and in combination with immunomodulators or chemotherapy against colorectal cancer (NCT01729923), colorectal cancer metastatic to the liver (NCT03403634) and early stage triple negative breast cancer (NCT04081389).Most Carbonic Anhydrases (CA) ligands and inhibitors in clinical development have a sulfonamide as common functional group. Sulfonamides are a well-known class of carbonic anhydrase inhibitors.[8-9]Sulfonamides with high affinity towards CAIX (e.g., acetazolamide) have been exploited as targeting moiety within Small Molecule-Drug Conjugates (SMDCs) to enable the delivery of radionuclides and cytotoxics for imaging and therapeutic applications, as disclosed in WO2015 / 114171 and WO2018 / 154517.[1 0-14]Sulfonamides typically coordinate to the zinc ion within the highly conserved active site of CAs.

[0015] Sulfonamide-based CA-binders are therefore pan-isotype CA ligands and inhibitors, with only few selective candidates all of which remain cross-reactive with one or more isotypes.[4, 9, 15]Due to expression of CAs in healthy tissues, there is a need to identify specific CAIX ligands to further improve targeted delivery of diagnostic or therapeutic agents to the site of disease, e.g., by providing high-affinity ligands allowing low dosage, and / or by reducing off-target toxicity.SUMMARY OF THE INVENTIONThe present invention aims at the problem of providing improved binders (ligands) of a target enzyme, namely, CAIX, suitable for targeting applications. The binders should be suitable for binding to or inhibition of the target enzyme, and / or targeted delivery of a payload, such as a therapeutic and / or diagnostic agent, to a site afflicted by or at risk of disease or disorder characterized by expression of CAIX.BRIEF DESCRIPTION OF THE DRAWINGSFIG. 1 shows LC-MS chromatogram and mass spectrum of intermediate 11. m / z calculated for C31H39CI3N7O1 1S2[M+H]+: 854.1209.FIG. 2 shows LC-MS chromatogram and mass spectrum of intermediate 12. m / z calculated for C31H39CI3N7O1 1S2[M+H]+: 854.1209.FIG. 3 shows LC-MS chromatogram and mass spectrum of intermediate I3. m / z calculated for C31H39CI3N7O1 1S2[M+H]+: 854.1209.FIG. 4 shows LC-MS chromatogram and mass spectrum of intermediate I4, also referred to as compound C9. m / z calculated for C31H39CI3N7O1 1S2[M+H]+: 854.1209.FIG. 5 shows LC-MS chromatogram and mass spectrum of intermediate 15. m / z calculated forC19H31N8O10S2 [M+H]+: 595.1599.FIG. 6 shows LC-MS chromatogram and mass spectrum of intermediate 16. m / z calculated forC10H1 1CINO6S2[M-H]-: 339.9722.FIG. 7 shows LC-MS chromatogram and mass spectrum of intermediate I7. m / z calculated for C18H17CI3N3O6S2[M+H]+: 539.9619.FIG. 8 shows LC-MS chromatogram and mass spectrum of intermediate I8. m / z calculated forC12H15CIN3O6S2 [M+H]+: 396.0085.FIG. 9 shows LC-MS chromatogram and mass spectrum of intermediate I9. m / z calculated forC15H17CI2N2O4 [M+H]+: 359.0560.FIG. 10 shows LC-MS chromatogram and mass spectrum of intermediate 110. m / z calculated for C27H28N3O7S [M+H]+: 538.1642.FIG. 11 shows LC-MS chromatogram and mass spectrum of compound 01. m / z calculated for C52H49CI3N7O17S2[M+H]+: 1212.1686.FIG. 12 shows LC-MS chromatogram and mass spectrum of compound 03. m / z calculated forC52H49CI3N7O17S2 [M+H]+: 1212.1686.FIG. 13 shows LC-MS chromatogram and mass spectrum of compound C5. m / z calculated forC52H49CI3N7O17S2 [M+H]+: 1212.1686.FIG. 14 shows LC-MS chromatogram and mass spectrum of compound 07. m / z calculated forC52H49CI3N7O17S2 [M+H]+: 1212.1686.FIG. 15 shows mass spectrum of compound C2. m / z calculated for C80H97CI3N9O24S6[M+H]+:1864.4031.FIG. 16 shows mass spectrum of compound C4. m / z calculated for C80H97CI3N9O24S6[M+H]+:1864.4031.FIG. 17 shows mass spectrum of compound C6. m / z calculated for C80H97CI3N9O24S6[M+H]+:1864.4031.FIG. 18 shows mass spectrum of C10. m / z calculated for C80H97CI3N9O24S6[M+H]+: 1864.4031 .FIG. 19 shows LC-MS chromatogram and mass spectrum of compound 08. m / z calculated forC45H42CI3N6O12S3 [M+H]+: 1059.1083.FIG. 20 shows LC-MS chromatogram and mass spectrum of compound C12. m / z calculated forC39H40CIN6O12S3 [M+H]+: 915.1549.FIG. 21 shows LC-MS chromatogram and mass spectrum of compound C13. m / z calculated for C42H42Cl2N5O10S [M+H]+: 878.2024.FIG. 22 shows LC-MS chromatogram and mass spectrum of compound C11. m / z calculated forc50H69Cl3N11°20s2 [M+H]+: 1312.3222.FIG. 23 shows HPLC chromatogram of [177Lu]LuCl3(A) and [177Lu]Lu- C11 (B). The signal was recorded with a radio-detector.FIG. 24 shows LC-MS chromatogram and mass spectrum of compound C14. m / z calculated forC32H30CIN4O10S3 [M+H]+: 761.0807.FIG. 25 shows LC-MS chromatogram and mass spectrum of compound C15. m / z calculated forc40H42N9O15S3 [M+H]+: 984.1957.FIG. 26 shows affinity measurement of compounds C1, C3, C5, C7, C8, C12, C13 and C14 by fluorescence polarization (FP) against CAIX. Error bars indicate the standard deviation of three replicates.FIG. 27 shows affinity measurements of compound C7 and AAZ* by fluorescence polarization against CAIX and respective isozymes. Error bars indicate the standard deviation of three replicates.FIG. 28 shows I VIS imaging of SKRC-52 tumor bearing Balb / c nude mice 4 hours post intravenous injection with compound C10, 02, C4 and 06 (left to right). The SKRC-52 tumor area is indicated with a white circle. Selective targeting was observed for compound 010 while no preferential accumulation at the tumor sites was observed for the other stereoisomers.FIG. 29 shows quantitative biodistribution values of SKRC-52 tumor bearing Balb / c nude mice six hours after intravenous injection of [177Lu]Lu- C11 (150 nmol / Kg). Values of %ID / g are given as mean of four replicates (n = 4), with the error bars indicating the standard deviation.FIG. 30 shows binder selections against Carbonic Anhydrase IX (CAIX), a marker of hypoxia and of renal cell carcinoma. A: Chemical structures of compounds C1 to C14. B: Chemical structures of L1 to L10. C: Evaluation of compound C9 binding capacity by surface plasmon resonance (SPR) against CAIX (left panel) and CAI I (right panel). Compound C9 was immobilized on a CM5 chip (at 963 RUs) and subjected to a serial dilution of the respective protein (16.6 μM to 1.1 μM). D: FP affinity constant values (KD) of compound C7 (red / filled bars) and a fluorescent derivative of acetazolamide (AAZ*, blue / empty bars) against carbonic anhydrase isozymes. KDvalues are given as mean, with error bars indicating standard deviations of the replicates (n = 3). E: Flow cytometry analysis of SK-RC-52 tumor cells treated with compounds C1, C3, C5, C7 in comparison to the non-stained control (cells alone).FIG. 31 shows FP affinity constant values of compound C7 (2R , 4R ) against a panel of serum proteins, immune-targets and non-related protein targets. KDvalues are given as mean and error bars indicate standard deviation of the replicates (n = 3). N.D. = not defined; hCAIX = human carbonic anhydrase IX; RSA = rat serum albumin; HSA = human serum albumin; CSA = cynomolgus monkey serum albumin; MSA = mouse serum albumin; Rabbit SA = rabbit serum albumin; BSA = bovine serum albumin; OVA = ovalbumin; Hgb = haemoglobin; AGP = alpha(1)-acid glycoprotein; hlgG4 = human immunoglobulin G4; CD = cluster of differentiation; NKp46 = natural killer cell p46-related protein; NKG2D = natural killer group 2D; IL-9 / -15Z-23 = interleukin 9 / 15 / 23; LZM = lysozyme; WDR5 = WD repeat-containing protein 5; CREBBP = CREB-binding protein; TEAD = TEA domain family member 1 ; CTSB = cathepsin B; TCPTP = T-cell protein tyrosine phosphatase; TNAP = tissue non-specific alkaline phosphatase; SEAP = secreted alkaline phosphatase; PSMA = prostate-specific membrane antigen; h / mFAP = human / mouse fibroblast-activation protein; uPA = urokinase; MMP-3 = matrix metalloproteinase-3; CHYM = chymotrypsin.FIG. 32 shows Fluorescence polarization measurements of compound C7 against serum proteins (A), immune-targets (B) and non-related protein targets (C) for selectivity profiling. Measurements were performed in triplicates.FIG. 33 shows affinity measurements of compounds C16, C17 and C18 by fluorescence polarization against hCAIX (A) and the isozymes bCAII (B), showing that similar affinity towards CAIX and selectivity over CAI I is achieved with these compounds (C).FIG. 34 shows FP measurements of C19-C23 against CAIX. Error bars indicate the standard deviation of three replicates.FIG. 35 shows FP measurements of I-387, C8, C19 and I-383. The assay was performed at 5 nM final ligand concentration. Error bars indicate the standard deviation of three replicates.DETAILED DESCRIPTIONThe present invention relates to potent, stereospecific ligands of, inter alia, CAIX, with a particularly low dissociation constant (e.g., in the nanomolar range).Since the expression of carbonic anhydrases IX isozymes in healthy tissues can result in the accumulation of non-specific binders not only at the site of disease but also in healthy organs, we performed quantitative biodistribution experiments in mice with a CAIX ligand derivative according to the invention which revealed high selectivity for CAIX-expressing tumors, with kidney as the only healthy organ with detectable compound accumulation. Thus, the present invention provides CAIX ligands with surprisingly high target specificity.The ligands of the invention can be applied as selective inhibitor or targeting agents to disease-relevant tissue, e.g., associated with CAIX expression. The ligands of the invention can be suitably conjugated with various therapeutic and / or diagnostic payloads, including, e.g., fluorophores, radiometal chelators, cytotoxic agents, immunomodulatory agents and therapeutic proteins.The binders provided herein can have pharmaceutical potential. For instance, selective CAIX binders are provided herein which do not react with other carbonic anhydrases. Traditionally, it has been difficult to isolate sulfonamides with high isoform-selectivity against carbonic anhydrases. Surprisingly, derivatives provided herein can display more than 100-fold selectivity for CAIX over other carbonic anhydrases, selectively localized to tumors in vivo, as confirmed by the results, e.g. in FIG. 27 and FIG. 28. Unlike the CAIX ligands of the invention, AAZ* bound to all tested carbonic anhydrases with high affinity (bovine CAII, human CAIV, human CAXII and human CAXIV). Thus, the present invention provides CAIX ligands with surprisingly high isozyme selectivity.Such derivatives may serve as particularly suitable specific agents to image CAIX at sites of hypoxia and in kidney tumors. In addition to imaging applications, CAIX-specific targeting agents may facilitate the delivery of cytotoxic agents, and may be used as adaptor for universal CAR-T cell conditioning therapy.Derivatives described herein can exhibit surprising synergistic affinity enhancement. This is confirmed by the results presented herein, e.g., in FIG. 26. To analyze which parts of the molecule are important for the binding of CAIX, the sulfonamide bearing thiophene (compound C12) and the respective proline derivative (compound C14) were identified as micromolar CAIX binders (KD= 1.0 ± 0.1 μM and 1.1 ± 0.2 μM). The 2-(2,4-dichlorophenyl)acetic acid proline derivative (compound C13) did not bind to CAIX. In contrast, the combination with the sulfonamide resulted in the highly potent CAIX ligand (compound C8) with a dissociation constant in the nanomolar range (KD= 6 ± 1 nM).Derivatives described therein can also exhibit highly stereoselective binding. Only one of the four possible stereoisomers revealed strong binding of the ligand to CAIX. Thus, herein provided are well-defined, potent ligands with surprisingly high binding affinity. The high stereospecificity translated to high isozyme selectivity to CAIX over other carbonic anhydrases (bovine CAII, human CAIV, human CAXII and human CAXIV). We compared the CAIX ligand of the invention to a fluorescent acetazolamide derivative (AAZ*), which is one of the most prominent CAIX binders applied for targeted therapy. This is confirmed by the results presented herein. Affinity against recombinantly expressed human CAIX via fluorescence polarization was measured for four stereoisomers (compound C1 , C3, C5 and C7). Stereoselective binding of compound C7 (2R,4R; KD= 16 ± 2 nM) was observed, while no binding was detected for the other isomers (compound C1, C3 and C5, see FIG. 26). FIG. 34 shows that incorporation of a 5-amino-1,3,4- thiadiazole-2-sulfonamide derivative in the ligands led to further increase of affinity towards CAIX. FIG. 35 shows that the CAIX binding affinity of the ligands is substantially maintained irrespective of variations in the linker B.Exemplary compounds according to the present invention are listed in Table 1.6Further compounds are listed in Table 2.Table 2. Further compoundsFurther exemplary compounds (conjugates) according to the present invention are listed in Tables 3.1 and3.2. The numbering of these conjugates is independent from the numbering of the remaining compounds in the present specification.Table 3.1. Exemplary conjugates1 O Oh / / O. / < d Zk9kNH =^> V HOOD o oID kZLVAs used herein,denotes an antibody (e.g., a therapeutically and / or diagnostically useful protein); denotes a protein (e.g., a therapeutically and / or diagnostically useful protein); and C’-S-denotes a thiolyl group on a side chain of an amino acid forming part of the protein.Further preferred conjugates of the present invention are shown in Table 3.2. The below abbreviations for preferred moieties A, B and C will be used throughout the present specification.CAATCompound No. / A _ B C M@CMoiety AWithout wishing to be bound by any theory, it is contemplated that the surprising technical effects related to target binding to are associated with the particular structure of the small binding moieties A. That is, an improvement for compounds comprising moiety A over a corresponding compound not having such moiety is expected to be observed.The compounds of the present invention can have an increased affinity, slower dissociation rate with respect to the target(s) as compared to prior art compounds, and therefore are also considered to as having a prolonged residence at the disease site at a therapeutically or diagnostically relevant level, preferably beyond 1 h, more preferably beyond 6 h post injection. Preferably, the highest enrichment is achieved after5 min, 10 min, 20 min, 30 min, 45 min, 1 h, 2 h, 3 h, 4 h, 5 h or 6 h; and / or enrichment in the disease site is maintained at a therapeutically or diagnostically relevant level, over a period of or at least for 5 min, 10 min, 20 min, 30 min, 45 min, 1 h, 2 h, 3 h, 4 h, 5 h or 6 h, more preferably beyond 6 h post injection.Moiety A is represented by the following structure:wherein R1, R2, R, a and b are as defined elsewhere herein. Groups particularly suitable as R1and / or R2are provided in the below Table 4.Table 4. Overview of building blocks suitable as R1and / or R2and the respective codes (A... / B...) as used in the Examples section.A particularly preferred structure of moiety A exhibiting very high target selectivity, stereospecificity and binding affinity for CAIX is:Further particularly preferred structures of moiety A exhibiting very high target selectivity, stereospecificity and binding affinity for CAIX are:Further particularly preferred structures of moiety A are:Moiety BMoiety B is a covalent bond or a moiety comprising a chain of atoms that covalently attaches A to the payload C, e.g., through one or more covalent bond(s). The moiety B may be cleavable or non-cleavable, multifunctional moiety which can be used to link one or more payload and / or binder moieties to form the targeted conjugate of the invention.Specifically, moiety B is a multifunctional moiety linking one or more moieties C and / or moieties A. B can be a single bond, or an optionally substituted C1 -50aliphatic group, In which optionally one or more carbon atoms can be replaced by a heteroatom, a C3-12carbocyclic or a C1- 12heterocyclic group, and which can be saturated optionally contain one or more double or triple bonds. The structure of the compound comprises more than one, preferably 2 or 3 moieties A per molecule. The structure of the compound may comprise more than one moieties C, preferably 2 or 3 moieties C per molecule. Preferably, the structure of the compound comprises 2 moleties A and 1 moiety C, or 2 moieties A and 1 moiety C per molecule.When cleavable linker units are present within moiety B, release mechanisms can be identical to those specific to antibodies linked to cytotoxic payloads. Indeed, the nature of the binding moieties is independent in that respect. Therefore, there is envisaged pH-dependent [Leamon, C.P. et al (2006) Bioconjugate Chem., 17, 1226; Casi, G. et al (2012) J. Am. Chem. Soc., 134, 5887], reductive [Bernardes, G.J. et al (2012) Angew. Chem. Int. Ed. Engl., 51. 941 ; Yang, J. et al (2006) Proc. Natl. Acad. Sci. USA, 103, 13872] and enzymatic release [Doronina S.O. et al (2008) Bioconjugate Chem, 19, 1960; Sutherland, M.S.K. (2006) J. Biol. Chem, 281, 10540]. In a specific setting, when functional groups are present on either the binding moiety or payloads (e.g. thiols, alcohols) a linkerless connection can be established thus releasing intact payloads, which simplifies substantially pharmacokinetic analysis.Moiety B can comprise or consist of a unit shown in Table 5 below wherein the substituents R and Rnshown in the formulae may suitably be independently selected from H, halogen, substituted or unsubstituted (hetero)alkyl, (hetero)alkenyl, (hetero)alkynyl, (hetero)aryl, (hetero)arylalkyl, (hetero)cycloalkyl, (hetero)cycloalkylaryl, heterocyclylalkyl, a peptide, an oligosaccharide or a steroid group. Preferably, each of R, R1, R2and R3is independently selected from H, OH, SH, NH2, halogen, cyano, carboxy, alkyl, cycloalkyl, aryl and heteroaryl, each of which is substituted or unsubstituted. Suitably R and Rnare independently selected from H, or C1-C7 alkyl or heteroalkyl. More suitably, R and Rnare independently selected from H, methyl or ethyl.Table 5Moiety B, unit(s) BLand / or unit(s) BSmay suitably comprise as a cleavable bond a disulfide linkage since these linkages are stable to hydrolysis, while giving suitable drug release kinetics at the target in vivo, and can provide traceless cleavage of drug moieties including a thiol group.Moiety B, unit(s) BLand / or unit(s) BSmay be polar or charged in order to improve water solubility of the conjugate. For example, the linker may comprise from about 1 to about 20, suitably from about 2 to about 10, residues of one or more known water-soluble oligomers such as peptides, oligosaccharides, glycosaminoglycans, polyacrylic acid or salts thereof, polyethylene glycol, polyhydroxyethyl (meth) acrylates, polysulfonates, etc. Suitably, the linker may comprise a polar or charged peptide moiety comprising e.g. from 2 to 10 amino acid residues. Amino acids may refer to any natural or non-natural amino acid. The peptide linker suitably includes a free thiol group, preferably a N-terminal cysteine, for forming the said cleavable disulfide linkage with a thiol group on the drug moiety. Any peptide containing L- or D-aminoacids can be suitable; particularly suitable peptide linkers of this type are Asp-Arg-Asp-Cys and / or Asp-Lys-Asp-Cys.In these and other embodiments, moiety B, unit(s) BLand / or unit(s) BSmay comprise a cleavable or non- cleavable peptide unit that is specifically tailored so that it will be selectively enzymatically cleaved from the drug moiety by one or more proteases on the cell surface or the extracellular regions of the target tissue. The amino acid residue chain length of the peptide unit suitably ranges from that of a single amino acid to about eight amino acid residues. Numerous specific cleavable peptide sequences suitable for use in the present invention can be designed and optimized in their selectivity for enzymatic cleavage by a particular tumor-associated enzyme e.g. a protease. Cleavable peptides for use in the present invention include those which are optimized toward the proteases MMP-1 , 2 or 3, or cathepsin B, C or D. Especially suitable are peptides cleavable by Cathepsin B. Cathepsin B is a ubiquitous cysteine protease. It is an intracellular enzyme, except in pathological conditions, such as metastatic tumors or rheumatoid arthritis. An example for a peptide cleavable by Cathepsin B is containing the sequence Val-Cit.In any of the above embodiments, the moiety B and in particular, unit(s) BLsuitably further comprise(s) self-immolative moiety can or cannot be present after the linker. The self-immolative linkers are also known as electronic cascade linkers. These linkers undergo elimination and fragmentation upon enzymatic cleavage of the peptide to release the drug in active, preferably free form. The conjugate is stable extracellularly in the absence of an enzyme capable of cleaving the linker. However, upon exposure to a suitable enzyme, the linker is cleaved initiating a spontaneous self-immolative reaction resulting in the cleavage of the bond covalently linking the self-immolative moiety to the drug, to thereby effect release of the drug in its underivatized or pharmacologically active form. In these embodiments, the self-immolative linker is coupled to the binding moiety through an enzymatically cleavable peptide sequence that provides a substrate for an enzyme to cleave the amide bond to initiate the self-immolative reaction. Suitably, the drug moiety is connected to the self-immolative moiety of the linker via a chemically reactive functional group pending from the drug such as a primary or secondary amine, hydroxyl, sulfhydryl or carboxyl group.Examples of self-immolative linkers are PABC or PAB (para-aminobenzyloxycarbonyl), attaching the drug moiety to the binding moiety in the conjugate (Carl et al (1981) J. Med. Chem. 24: 479-480; Chakravarty et al (1983) J. Med. Chem. 26: 638-644). The amide bond linking the carboxy terminus of a peptide unit and the para-aminobenzyl of PAB may be a substrate and cleavable by certain proteases. The aromatic amine becomes electron-donating and initiates an electronic cascade that leads to the expulsion of the leaving group, which releases the free drug after elimination of carbon dioxide (de Groot, et al (2001) Journal of Organic Chemistry 66 (26): 8815-8830). Further self-immolating linkers are described in W02005 / 082023.In yet other embodiments, the linker comprises a glucuronyl group that is cleavable by glucoronidase present on the cell surface or the extracellular region of the target tissue. It has been shown that lysosomal beta-glucuronidase is liberated extracellularly in high local concentrations in necrotic areas in human cancers, and that this provides a route to targeted chemotherapy (Bosslet, K. et al. Cancer Res. 58, 1195- 1201 (1998)).In any of the above embodiments, the moiety B suitably further comprises a spacer unit. A spacer unit can be the unit BS, which may be linked to the binding moiety A, for example via an amide, amine or thioether bond. The spacer unit is of a length that enables e.g. the cleavable peptide sequence to be contacted by the cleaving enzyme (e. g. cathepsin B) and suitably also the hydrolysis of the amide bond coupling thecleavable peptide to the self-immolative moiety X. Spacer units may for example comprise a divalent radical such as alkylene, arylene, a heteroarylene, repeating units of alkyloxy (e.g. polyethylenoxy, PEG, polymethyleneoxy) and alkylamino (e.g. polyethyleneamino), or diacid ester and amides including succinate, succinamide, diglycolate, malonate, and caproamide.In any of the embodiments described therein, * represents a point of attachment to moiety A or a point of attachment for which the shortest path to moiety A comprises less atoms than that for •, as the case may be; and • represents a point of attachment a point of attachment to moiety C or a point of attachment to moiety C for which the shortest path to moiety C comprises less atoms than that for *, as the case may be. The same applies also for cases where a reactive moiety L is present rather than payload moiety C. The following notations and all have the meaning of a point of attachment of a certain group or atom (e.g., R) to a further moiety:As used herein, and unless specified otherwise the groups and fragments described herein may be combined in either orientation, but it is preferred that they are combined in the orientation as drawn herein, reading from left to right, for example:Fragment (a):; fragment (b): ; preferred combination of fragments (a) + (b):If the structure of relevance is a peptide mono- or oligomer, each * represents a point of attachment for which the shortest path to moiety A comprises less atoms than that for •; and each • represents a point of attachment for which the shortest path to moiety C comprises less atoms than that for *, with the proviso that when n is > 1 and a respective point of attachment is indicated on any one of Ra, Rband Rc, then it can be independently present in one or more of the peptide monomeric units, preferably in one peptide monomeric unit most distant from the other point of attachment indicated in the respective structure.In any of the embodiments described herein, the terms “peptide”, “dipeptide”, “tripeptide”, “tetrapeptide” etc. refer to peptide mono- or oligomers having a backbone formed by proteinogenic and / or a non- proteinogenic amino acids. As used herein, the terms “aminoacyl” or “aminoacid” generally refer to any proteinogenic or a non-proteinogenic amino acid. Preferably, in any of the embodiments disclosed therein, the side-chain residues of a proteinogenic or a non-proteinogenic amino acid are represented by any of Ra, Rband Rc, each of which is selected from the following list:wherein each of R, R1R2and R3is independently selected from H, OH, SH, NH2, halogen, cyano, carboxy, alkyl, cycloalkyl, aryl and heteroaryl, each of which is substituted or unsubstituted; each X is independently selected from NH, NR, S, O and CH2, preferably NH; and each n and m is independently an integer preferably selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, W and 20.Preferably, in any of the embodiments disclosed therein, side-chain residues of a proteinogenic or a non- proteinogenic amino acid are represented by any of Ra, Rb, Rc, Rdand Re, each of which may be part of a 3-, 4-, 5-, 6- or 7-membered ring. For instance, the side chain alpha, beta and / or gamma position of said proteinogenic or non-proteinogenic amino acid can be part of a cyclic structure selected from an azetidine ring, pyrrolidine ring and a piperidine ring, such as in the following aminoacids (proline and hydroxyproline):each of which may independently be part of an unsaturated structure (i.e. wherein the H atom geminal to the respective group Ra, Rband Rcis absent), e.g.:As used herein, the following notation of peptide sequences refers to a sequence from N to C terminus, and attachment of group through a horizontal bond (here: moiety C) means covalent attachment to the peptide backbone via amide bond to the respective terminal amino acid (here: AA3):Is used herein, the following notation of peptide sequences refers to a sequence from N to C terminus, and attachment of group through a vertical bond (here: moiety C) means covalent attachment via the sidechain of the respective amino acid (here: AA3):Further preferable non-proteinogenic amino acids can be selected from the following list:Particularly preferred embodiments for the moiety B as well as the compound according to the present invention are shown in the appended claims.Moiety CMoiety C in the present invention represents a payload, which can be generally any atom (including H), molecule or particle. Preferably, moiety C is not a hydrogen atom.The payload may be a chelator for radiolabeling. Suitably the radionuclide is not released. Chelators are well known to those skilled in the art, and for example, include chelators such as sulfur colloid, diethylenetriaminepentaacetic acid (DTPA), ethylenediaminetetraacetic acid (EDTA), 1,4,7,10- tetraazacyclododecane-N,N',N",N",-tetraacetic acid (DOTA), 1 ,4,7,10-tetraazacyclododececane,N- (glutaric acid)-N',N",N"'-triacetic acid (DOTAGA), 1,4,7-triazacyclononane-N,N',N"-triacetic acid (NOTA), 1 ,4,8,11-tetraazacyclotetradecane-N,N',N",N",-tetraacetic acid (TETA), or any of the preferred chelator structures recited in the appended claims or elsewhere herein.The payload may be a radioactive group comprising or consisting of radioisotope including isotopes such as, preferably, positron emitters, such as18F and124I or gamma emitters, such asare usec| fordiagnostic applications (e.g. for PET), while beta- emitters, such asarepreferably used for therapeutic applications. Alpha-emitters, such as may also be used for therapy. In one preferred embodiment theradioisotope isIn a further preferred embodiment the radioisotope is68Ga.The payload may be a chelate of a radioactive isotope, preferably of an isotope listed under above, with a chelating agent, preferably a chelating agent listed herein.The payload may be a fluorophore group, preferably selected from a xanthene dye, acridine dye, oxazine dye, cyanine dye, styryl dye, coumarine dye, porphine dye, fluorescent metal-ligand-complex, fluorescent protein, nanocrystals, perylene dye, boron-dipyrromethene dye and phtalocyanine dye, more preferably selected from the structures listed herein.The payload may be a cytotoxic and / or cytostatic agent. Such agents can inhibit or prevent the function of cells and / or cause destruction of cells. Examples of cytotoxic agents include radioactive isotopes, chemotherapeutic agents, and toxins such as small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin, including synthetic analogues and derivatives thereof. The cytotoxic agent may be selected from the group consisting of an auristatin, a DNA minor groove binding agent, a DNA minor groove alkylating agent, an enediyne, a lexitropsin, a duocarmycin, a taxane, a puromycin, a dolastatin, a maytansinoid and a vinca alkaloid or a combination of two or more thereof. Preferred cytotoxic and / or cytostatic payload moieties are listed herein.In one embodiment the payload is a chemotherapeutic agent selected from the group consisting of a topoisomerase inhibitor, an alkylating agent (e.g., nitrogen mustards; ethylenimes; alkylsulfonates; triazenes; piperazines; and nitrosureas), an antimetabolite (e.g., mercaptopurine, thioguanine, 5- fluorouracil), an antibiotics (e.g., anthracyclines, dactinomycin, bleomycin, adriamycin, mithramycin. dactinomycin) a mitotic disrupter (e.g., plant alkaloids - such as vincristine and / or microtubule antagonists -such as paclitaxel), a DNA methylating agent, a DNA intercalating agent (e.g., carboplatin and / or cisplatin, daunomycin and / or doxorubicin and / or bleomycin and / or thalidomide), a DNA synthesis inhibitor, a DNA- RNA transcription regulator, an enzyme inhibitor, a gene regulator, a hormone response modifier, a hypoxia-selective cytotoxin (e.g., tirapazamine), an epidermal growth factor inhibitor, an anti-vascular agent (e.g., xanthenone 5,6-dimethylxanthenone-4-acetic acid), a radiation-activated prodrug (e.g., nitroarylmethyl quaternary (NMQ) salts) or a bioreductive drug or a combination of two or more thereof. In some embodiments, the payload (i.e., moiety C) is not derived from an anthracycline, preferably not derived from PNU 159682.The chemotherapeutic agent may selected from the group consisting of Erlotinib (TARCEVA®), Bortezomib (VELCADE®), Fulvestrant (FASLODEX®), Sutent (SU11248), Letrozole (FEMARA®), Imatinib mesylate (GLEEVEC®), PTK787 / ZK 222584, Oxaliplatin (Eloxatin®.), 5-FU (5-fluorouracil), Leucovorin, Rapamycin (Sirolimus, RAPAMUNE®.), Lapatinib (GSK572016), Lonafarnib (SCH 66336), Sorafenib (BAY43-9006), and Gefitinib (IRESSA®.), AG1478, AG1571 (SU 5271 ; Sugen) or a combination of two or more thereof.The chemotherapeutic agent may be an alkylating agent - such as thiotepa, CYTOXAN® and / or cyclosphosphamide; an alkyl sulfonate - such as busulfan, improsulfan and / or piposulfan; an aziridine - such as benzodopa, carboquone, meturedopa and / or uredopa; ethylenimines and / or methylamelamines - such as altretamine, triethylenemelamine, triethylenepbosphoramide, triethylenethiophosphoramide and / or trimethylomelamine; acetogenin - such as bullatacin and / or bullatacinone; camptothecin; bryostatin; callystatin; cryptophycins; dolastatin; duocarmycin; eleutherobin; pancratistatin; sarcodictyin; spongistatin; nitrogen mustards - such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide and / or uracil mustard; nitrosureas - such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and / or ranimnustine; dynemicin; bisphosphonates - such as clodronate;an esperamicin; a neocarzinostatin chromophore; aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN®. doxorubicin - such as morpholinodoxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and / or deoxydoxorubicin, epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins - such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites - such as methotrexate and 5-fluorouracil (5- FU); folic acid analogues - such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogues - such as fludarablne, 6-mercaptopurine, thiamlprine, thioguanine; pyrimidine analogues - such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens - such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals - such as aminoglutethimide, mitotane, trilostane; folic acid replenisher - such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; macrocyclic depsipeptides such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"-trichlorotriethylamine; trichothecenes - such as verracurin A, roridin A and / or anguidine; urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside; cyclophosphamide; thiotepa; taxoids - such as TAXOL®. paclitaxel, abraxane, and / or TAXOTERE®, doxetaxel; chloranbucil; GEMZAR®. gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogues - such as cisplatin and carboplatin; vinblastine; platinum; etoposide; ifosfamide; mitoxantrone; vincristine; NAVELBINE®, vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; topoisomerase inhibitor RFS 2000; difluoromethylomithine (DMFO); retinoids - such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids, derivatives or combinations of two or more of any of the above.The payload may be a tubulin disruptor including but are not limited to: taxanes - such as paclitaxel and docetaxel, vinca alkaloids, dlscodermolide, epothilones A and B, desoxyepothilone, cryptophycins, curacin A, combretastatin A-4-phosphate, BMS 247550, BMS 184476, BMS 188791 ; LEP, RPR 109881 A, EPO 906, TXD 258, ZD 6126, vinflunine, LU 103793, dolastatin 10, E7010, T138067 and T900607, colchicine, phenstatin, chaicones, indanocine, T138067, oncocidin, vincristine, vinblastine, vinorelbine, vinflunine, halichondrin B, isohomohalichondrin B, ER-86526, pironetin, spongistatin 1 , spiket P, cryptophycin 1 , LU103793 (cematodin or cemadotin), rhizoxin, sarcodictyin, eleutherobin, laulilamide, VP-16 and D-24851 and pharmaceutically acceptable salts, acids, derivatives or combinations of two or more of any of the above.The payload may be a DNA intercalator including but are not limited to: acridines, actinomycins, anthracyclines, benzothiopyranoindazoles, pixantrone, crisnatol, brostallicin, CI-958, doxorubicin (adriamycin), actinomycin D, daunorubicin (daunomycin), bleomycin, idarubicin, mitoxantrone, cyclophosphamide, melphalan, mitomycin C, bizelesin, etoposide, mitoxantrone, SN-38, carboplatin, cis-acceptable salts, acids, derivatives or combinations of two or more of any of the above.The payload may be an anti-hormonal agent that acts to regulate or inhibit hormone action on tumors - such as anti-estrogens and selective estrogen receptor modulators, Including, but not limited to, tamoxifen, raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and / or fareston toremifene and pharmaceutically acceptable salts, acids, derivatives or combinations of two or more of any of the above. The payload may be an aromatase inhibitor that inhibits the enzyme aromatase, which regulates estrogen production in the adrenal glands - such as, for example, 4(5)-imidazoles, aminoglutethimide, megestrol acetate, AROMASIN®. exemestane, formestanie, fadrozole, RIVISOR®. vorozole, FEMARA®. letrozole, and ARIMIDEX® and / or anastrozole and pharmaceutically acceptable salts, acids, derivatives or combinations of two or more of any of the above.The payload may be an anti-androgen such as flutamide, nilutamide, bicalutamide, leuprolide, goserelin and / or troxacitabine and pharmaceutically acceptable salts, acids, derivatives or combinations of two or more of any of the above.The payload may be a protein or an antibody. Preferably, the payload is a cytokine (e.g., an interleukin such as IL2, IL10, IL12, IL15; a member of the TNF superfamily; or an interferon such as interferon gamma.).Any payload may be used in unmodified or modified form. Combinations of payloads in which some are unmodified and some are modified may be used. For example, the payload may be chemically modified. One form of chemical modification is the derivatisation of a carbonyl group - such as an aldehyde.In a preferred embodiment, the payload moiety C is a topoisomerase inhibitor; preferably camptothecin (CPT) or a derivative thereof; more preferably derived (e.g., by replacing a hydrogen atom) from topotecan, irinotecan, silatecan, cositecan, exatecan, lurtotecan, gimatecan, belotecan, rubitecan; even more preferably exatecan; even more preferablywherein each n is 0, 1 , 2, 3, 4, 5 or 6; and most preferablyIn a preferred embodiment, moiety C is an auristatin (i.e., having a structure derived from an auristatin compound family member) or an auristatin derivative. More preferably, moiety C has a structure according to the following formula:wherein:Rd1is independently H or C1-C6alkyl; preferably H or CH3; is independently C1-C6alkyl; preferably CH3 or iPr;Rd3is independently H or C1-C6alkyl; preferably H or CH3;Rd4is independently H, C1-C6alkyl, COO(C1-C6alkyl), CON(H or C1-C6alkyl), C3-C10aryl or C3-C10heteroaryl; preferably H, CH3, COOH, COOCH3or thiazolyl;Rd5is independently H, OH, C1-C6alkyl; preferably H or OH; andRd6is independently C3-C10 aryl or C3-C10 heteroaryl; preferably optionally substituted phenyl or pyridyl.More preferably, moiety C is derived from MMAE or MMAF.In a preferred embodiment, moiety C has a structure according to the following formula:wherein: n is 0, 1 , 2, 3, 4 or 5; preferably 1 ;R1eis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH;R2eis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH; each R3eis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH;R4eis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH; andX is O, NH or S; preferably O.In a preferred embodiment, moiety C has a structure according to the following formula:wherein: n is 0, 1 , 2, 3, 4 or 5; preferably 1 R1fis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH;R2fis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH;R3fis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH; and X is O, NH or S; preferably OParticularly preferred embodiments for the moiety C as well as the compound according to the present invention are shown in the appended claims or elsewhere herein.Preferred compounds according to the present invention may be represented by:wherein BS, BL, x, y and n and the remaining groups are as defined elsewhere herein; more preferablymost preferablyPreferred compounds are those having a structure according to Table 1 or 3, or FIG. 30 or FIG. 31, their individual diastereoisomers, hydrates, solvates, crystal forms, individual tautomers or pharmaceutically acceptable salts thereof. In all structures, unless otherwise specified, all groups and variables are defined as further above in the present disclosure.Also disclosed is a pharmaceutical composition comprising the compound according to any of the preceding aspects, and a pharmaceutically acceptable excipient. Such pharmaceutical composition is also disclosed for use in: (a) a method for treatment of the human or animal body by surgery or therapy or a diagnostic method practiced on the human or animal body; or (b) a method for therapy or prophylaxis of a subject suffering from or having risk for a disease or disorder; or (c) a method for guided surgery practiced on a subject suffering from or having risk for a disease or disorder; or (d) a method for diagnosis of a disease or disorder, the method being practiced on the human or animal body and involving a nuclear medicine imaging technique, such as Positron Emission Tomography (PET) or Single Photon Emission Computed T omography (SPECT); or (e) a method for targeted delivery of a therapeutic or diagnostic agent to a subject suffering from or having risk for a disease or disorder, wherein in each of the preceding (b)— (e), said disease or disorder is independently selected from hypoxia-related diseases such as cancer, preferably wherein the cancer is selected from the group consisting of breast cancer, pancreatic cancer, colon cancer, multidrug resistant colon cancer, rectal cancer, colorectal cancer, metastatic colorectal cancer, lung cancer, non-small cell lung cancer, head and neck cancer, ovarian cancer, hypopharynx cancer, nasopharynx cancer, larynx cancer, bladder cancer, cholangiocarcinoma, clear cell renal carcinoma, glioma, astrocytoma, cervix cancer and kidney cancerTreatmentThe compounds described herein may be used to treat disease. The treatment may be therapeutic and / or prophylactic treatment, with the aim being to prevent, reduce or stop an undesired physiological change or disorder. The treatment may prolong survival as compared to expected survival if not receiving treatment. The disease that is treated by the compound may be any disease that might benefit from treatment. This includes chronic and acute disorders or diseases including those pathological conditions which predispose to the disorder.The term "cancer" and "cancerous" is used in its broadest sense as meaning the physiological condition in mammals that is typically characterized by unregulated cell growth. A tumor comprises one or more cancerous cells. When treating cancer, the therapeutically effect that is observed may be a reduction in the number of cancer cells; a reduction in tumor size; inhibition or retardation of cancer cell infiltration into peripheral organs; inhibition of tumor growth; and / or relief of one or more of the symptoms associated with the cancer.In animal models, efficacy may be assessed by physical measurements of the tumor during the treatment, and / or by determining partial and complete remission of the cancer. For cancer therapy, efficacy can, for example, be measured by assessing the time to disease progression (TTP) and / or determining the response rate (RR).Particularly preferred embodiments for the methods of treatment related to the present invention are shown in the appended claims.Herein disclosed are also methods for treatment of the human or animal body, e.g., by surgery or therapy, or diagnostic method practiced on the human or animal body, the methods involving a step of administering a therapeutically or diagnostically effective amount of a compound or a pharmaceutical composition asdescribed herein to a subject in need thereof. More specifically, herein disclosed are methods for treatment, e.g., by therapy or prophylaxis, of a subject suffering from or having risk for a disease or disorder; or by guided surgery practiced on a subject suffering from or having risk for a disease or disorder; method for diagnosis of a disease or disorder, e.g., diagnostic method practiced on the human or animal body and / or involving a nuclear medicine imaging technique, such as Positron Emission Tomography (PET) or Single Photon Emission Computed Tomography (SPECT); method for targeted delivery of a therapeutic or diagnostic agent to a subject suffering from or having risk for a disease or disorder. In the aforementioned methods, said disease or disorder may be independently selected from hypoxia-related diseases such as cancer, preferably wherein the cancer is selected from the group consisting of breast cancer, pancreatic cancer, colon cancer, multi-drug resistant colon cancer, rectal cancer, colorectal cancer, metastatic colorectal cancer, lung cancer, non-small cell lung cancer, head and neck cancer, ovarian cancer, hypopharynx cancer, nasopharynx cancer, larynx cancer, bladder cancer, cholangiocarcinoma, clear cell renal carcinoma, glioma, astrocytoma, cervix cancer and kidney cancer.Pharmaceutical compositionsThe compounds described herein may be in the form of pharmaceutical compositions which may be for human or animal usage in human and veterinary medicine (e.g., as therapeutic or diagnostic compositions) and will typically comprise any one or more of a pharmaceutically acceptable diluent, carrier, or excipient. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985). The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s).Preservatives, stabilisers, dyes and even flavouring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid and esters of p- hydroxy benzoic acid. Antioxidants and suspending agents may be also used.There may be different composition / formulation requirements dependent on the different delivery systems. By way of example, the pharmaceutical composition may be formulated to be administered using a minipump or by a mucosal route, for example, as a nasal spray or aerosol for inhalation or ingestable solution, or parenterally in which the composition is formulated by an injectable form, for delivery, by, for example, an intravenous, intramuscular or subcutaneous route. Alternatively, the formulation may be designed to be administered by a number of routes.If the agent is to be administered mucosally through the gastrointestinal mucosa, it should be able to remain stable during transit though the gastrointestinal tract; for example, it should be resistant to proteolytic degradation, stable at acid pH and resistant to the detergent effects of bile.Where appropriate, the pharmaceutical compositions may be administered by inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or in capsulesor ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or the pharmaceutical compositions can be injected parenterally, for example, intravenously, intramuscularly or subcutaneously. For parenteral administration, the compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or monosaccharides to make the solution isotonic with blood. For buccal or sublingual administration, the compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner.The compound of the present invention may be administered in the form of a pharmaceutically acceptable or active salt. Pharmaceutical ly-acceptable salts are well known to those skilled In the art, and for example, include those mentioned by Berge et al, in J.Pharm.Sci., 66, 1-19 (1977). Salts include, but are not limited, to sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentislnate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1 ,1 '-methylene-bis-(2-hydroxy-3-naphthoate)) salts.The routes for administration (delivery) may include, but are not limited to, one or more of oral (e.g. as a tablet, capsule, or as an ingestable solution), topical, mucosal (e.g. as a nasal spray or aerosol for inhalation), nasal, parenteral (e.g. by an injectable form), gastrointestinal, intraspinal, intraperitoneal, intramuscular, intravenous, intrauterine, intraocular, intradermal, intracranial, intratracheal, intravaginal, intracerebroventricular, intracerebral, subcutaneous, ophthalmic (including intravitreal or intracameral), transdermal, rectal, buccal, vaginal, epidural, sublingual.Typically, a physician will determine the actual dosage which will be most suitable for an individual subject. The specific dose level and frequency of dosage for any particular patient may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the individual undergoing therapy.The formulations may be packaged in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water, for administration. Extemporaneous injection solutions and suspensions are prepared from sterile powders, granules and tablets of the kind previously described. Exemplary unit dosage formulations contain a daily dose or unit daily sub-dose, or an appropriate fraction thereof, of the active ingredient.General techniquesThe practice of the present invention employs, unless otherwise indicated, conventional methods of chemistry, biochemistry, molecular biology, cell biology, genetics, immunology and pharmacology, known to those of skill of the art. Such techniques are explained fully in the literature. See, e. g. , Gennaro, A. R., ed. (1990) Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing Co.; Hardman, J. G., Limbird,L. E., and Gilman, A. G., eds. (2001) The Pharmacological Basis of Therapeutics, 10th ed., McGraw-Hill Co.; CoIowick, S. et al., eds., Methods In Enzymology, Academic Press, Inc.; Weir, D. M. , and Blackwell, C. C., eds. (1986) Handbook of Experimental Immunology, Vols. I-IV, Blackwell Scientific Publications; Maniatis, T. et al., eds. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition, Vols. I-III, Cold Spring Harbor Laboratory Press; Ausubel, F. M. etal., eds. (1999) Short Protocols in Molecular Biology, 4th edition, John Wiley & Sons; Ream et al., eds. (1998) Molecular Biology Techniques: An Intensive Laboratory Course, Academic Press; Newton, C. R., and Graham, A., eds. (1997) PCR (Introduction to Biotechniques Series), 2nd ed., Springer Verlag.Chemical synthesisThe compounds described herein may be prepared by chemical synthesis techniques. It will be apparent to those skilled in the art that sensitive functional groups may need to be protected and deprotected during synthesis of a compound. This may be achieved by conventional techniques, for example as described in "Protective Groups in Organic Synthesis" by T W Greene and P G M Wuts, John Wiley and Sons Inc. (1991), and by P.J.Kocienski, in "Protecting Groups", Georg Thieme Verlag (1994). It is possible during some of the reactions that any stereocentres present could, under certain conditions, be epimerised, for example if a base is used in a reaction with a substrate having an optical centre comprising a base-sensitive group. It should be possible to circumvent potential problems such as this by choice of reaction sequence, conditions, reagents, protection / deprotection regimes, etc. as is well-known in the art.DefinitionsAntibody. The term "antibody" is used in its broadest sense and covers monoclonal antibodies, polyclonal antibodies, dimers, multimers, multispecific antibodies (e.g., bispecific antibodies), veneered antibodies, antibody fragments and small immune proteins (SIPs) (see Int. J. Cancer (2002) 102, 75-85). An antibody is a protein generated by the immune system that is capable of recognizing and binding to a specific antigen. A target antigen generally has numerous binding sites, also called epitopes, recognized by CDRs on multiple antibodies. Each antibody that specifically binds to a different epitope has a different structure. Thus, one antigen may have more than one corresponding antibody. An antibody includes a full-length immunoglobulin molecule or an immunologically active portion of a full-length immunoglobulin molecule, i.e. a molecule that contains an antigen binding site that immunospecifically binds an antigen of a target of interest or part thereof. The antibodies may be of any type - such as IgG, IgE, IgM, IgD, and IgA) - any class - such as IgG 1 , lgG2, lgG3, lgG4, lgA1 and lgA2 - or subclass thereof. The antibody may be or may be derived from murine, human, rabbit or from other species.Antibody fragments. The term "antibody fragment" refers to a portion of a full length antibody, generally the antigen binding or variable region thereof. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single domain antibodies, including dAbs, camelid VHHantibodies and the IgNAR antibodies of cartilaginous fish. Antibodies and their fragments may be replaced by binding molecules based on alternative non-immunoglobulin scaffolds, peptide aptamers, nucleic acid aptamers, structured polypeptides comprising polypeptide loops subtended on a non-peptide backbone, natural receptors or domains thereof.Derivative. A derivative includes the chemical modification of a compound. Examples of such modifications include the replacement of a hydrogen by a halo group, an alkyl group, an acyl group or an amino group and the like. The modification may increase or decrease one or more hydrogen bonding interactions, charge interactions, hydrophobic interactions, van der Waals interactions and / or dipole interactions.Analog. This term encompasses any enantiomers, racemates and stereoisomers, as well as all pharmaceutically acceptable salts and hydrates of such compounds.Unless otherwise stated, the following definitions apply to chemical terms used in connection of compounds of the invention and compositions containing such compounds.Alkyl refers to a branched or unbranched saturated hydrocarbyl radical. Suitably, the alkyl group comprises from 1 to 100, preferably 3 to 30, carbon atoms, more preferably from 5 to 25 carbon atoms. Preferably, alkyl refers to methyl, ethyl, propyl, butyl, pentyl, or hexyl.Alkenyl refers to a branched or unbranched hydrocarbyl radical containing one or more carbon-carbon double bonds. Suitably, the alkenyl group comprises from 2 to 30 carbon atoms, preferably from 5 to about 25 carbon atoms.Alkynyl refers to a branched or unbranched hydrocarbyl radical containing one or more carbon-carbon triple bonds. Suitably, the alkynyl group comprises from about 3 to about 30 carbon atoms, for example from about 5 to about 25 carbon atoms.Halogen refers to fluorine, chlorine, bromine or iodine, preferably fluorine or chlorine.Cycloalkyl refers to an alicyclic moiety, suitably having 3, 4, 5, 6, 7 or 8 carbon atoms. The group may be a bridged or polycyclic ring system. More often cycloalkyl groups are monocyclic. This term includes reference to groups such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, norbornyl, bicyclo[2.2.2]octyl and the like.Aryl refers to an aromatic carbocyclic ring system, suitably comprising 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 ring carbon atoms. Aryl may be a polycyclic ring system, having two or more rings, at least one of which is aromatic. This term includes reference to groups such as phenyl, naphthyl fluorenyl, azulenyl, indenyl, anthryl and the like.Diastereomers or diastereoisomers, unless specified otherwise, refer to stereoisomers of a compound having different configurations at one or more stereocenters in parts of the molecule other than moiety A. That is, unless specified otherwise, the stereochemical of moiety A configuration is always as represented in the respective structure, and the individual diastereomers differ in their stereochemical configuration in the in parts of the molecule other than moiety A.The prefix (hetero) herein signifies that one or more of the carbon atoms of the group may be substituted by nitrogen, oxygen, phosphorus, silicon or sulfur. Heteroalkyl groups include for example, alkyloxy groups and alkythio groups. Heterocycloalkyl or heteroaryl groups herein may have from 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 or 16 ring atoms, at least one of which is selected from nitrogen, oxygen, phosphorus, silicon and sulfur. In particular, a 3- to 10-membered ring or ring system and more particularly a 5- or 6-memberedring, which may be saturated or unsaturated. For example, selected from oxiranyl, azirinyl, 1 ,2-oxathiolanyl, imidazolyl, thienyl, furyl, tetrahydrofuryl, pyranyl, thiopyranyl, thianthrenyl, isobenzofuranyl, benzofuranyl, chromenyl, 2H-pyrrolyl, pyrrolyl, pyrrolinyl, pyrrolidinyl, imidazolyl, imidazolidinyl, benzimidazolyl, pyrazolyl, pyrazinyl, pyrazolidinyl, thiazolyl, isothiazolyl, dithiazolyl, oxazolyl, isoxazolyl, pyridyl, pyrazinyl, pyrimidinyl, piperidyl, piperazinyl, pyridazinyl, morpholinyl, thiomorphollnyl, especially thiomorpholino, indolizinyl, 1 ,3- Dioxo-1 ,3-dihydro-isoindolyl, 3H-indolyl, indolyl, benzimidazolyl, cumaryl, indazolyl, triazolyl, tetrazolyl, purinyl, 4H-quinolizinyl, isoquinolyl, quinolyl, tetrahydroquinolyl, tetrahydroisoquinolyl, decahydroquinolyl, octahydroisoquinolyl, benzofuranyl, dibenzofuranyl, benzothiophenyl, dibenzothiophenyl, phthalazinyl, naphthyridinyl, quinoxalyl, quinazolinyl, quinazolinyl, cinnolinyl, pteridinyl, carbazolyl, [beta]-carbolinyl, phenanthridinyl, acridinyl, perimidinyl, phenanthrolinyl, furazanyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromenyl, isochromanyl, chromanyl, 3,4-dihydro-2H-isoquinolin-1-one, 3,4-dihydro-2H- isoquinolinyl, and the like.“Substituted” signifies that one or more, especially up to 5, more especially 1 , 2 or 3, of the hydrogen atoms in said moiety are replaced independently of each other by the corresponding number of substituents. The term "optionally substituted" as used herein includes substituted or unsubstituted. It will, of course, be understood that substituents are only at positions where they are chemically possible, the person skilled in the art being able to decide (either experimentally or theoretically) without inappropriate effort whether a particular substitution is possible. For example, amino or hydroxy groups with free hydrogen may be unstable if bound to carbon atoms with unsaturated (e.g. olefinic) bonds. Preferably, the term “substituted” signifies one or more, especially up to 5, more especially 1 , 2 or 3, of the hydrogen atoms in said moiety are replaced independently of each other by the corresponding number of substituents selected from OH, SH, NH2, halogen, cyano, carboxy, alkyl, cycloalkyl, aryl and heteroaryl. Additionally, the substituents described herein may themselves be substituted by any substituent, subject to the aforementioned restriction to appropriate substitutions as recognised by the skilled person. Preferably, any of the aforementioned substituents may be further substituted by any of the aforementioned substituents, each of which may be further substituted by any of the aforementioned substituents.Substituents may suitably include halogen atoms and halomethyl groups such as CF3and CCI3; oxygen containing groups such as oxo, hydroxy, carboxy, carboxyalkyl, alkoxy, alkoyl, alkoyloxy, aryloxy, aryloyl and aryloyloxy; nitrogen containing groups such as amino, alkylamino, dialkylamino, cyano, azide and nitro; sulfur containing groups such as thiol, alkylthiol, sulfonyl and sulfoxide; heterocyclic groups which may themselves be substituted; alkyl groups, which may themselves be substituted; and aryl groups, which may themselves be substituted, such as phenyl and substituted phenyl. Alkyl includes substituted and unsubstituted benzyl.Where two or more moieties are described as being "each independently" selected from a list of atoms or groups, this means that the moieties may be the same or different. The identity of each moiety is therefore independent of the identities of the one or more other moieties.AspectsIn view of the above, the present disclosure further provides the following specific aspects.A compound, its individual diastereoisomers, its hydrates, its solvates, its crystal forms, its individual tautomers or a pharmaceutically acceptable salt thereof, wherein the compound structure comprises at least one group A independently represented by the following structure:wherein: a and b are each 0 or 1 , wherein a + b is at least 1 , preferably wherein a and b are each 1 ;R1 is represented byR^ais independently a 6- to 10-membered aromatic group, a 5- to 10-membered heteroaromatic group having up to 5, preferably up to 3, heteroatoms independently selected from N, O and S, or a group represented by -C((CR(R’))nSO2NR(R’))(CR(R’))nSO2NR(R’), wherein R1 ais optionally substituted, in addition to SO2NR(R’), by one or more substituents preferably represented by R3, wherein:G1is independently selected from C(Y), SO, SO2, CR(R'), triazolyl, and CR(R')triazolyl;G2is independently selected from C(Y), C(Y)NR, SONR, SO2NR, CR(R')NR, NRC(Y), NRSO, NR SO2, NRCR(R'), triazolyl, triazolyl-NR, triazolyl-CR(R'), NR-triazolyl, and CR(R')-triazolyl; each of q and s is independently selected from 0 and 1 ; r is independently selected from 0, 1 , 2, 3 and 4, preferably 2; preferably with the proviso that at least one of q and s is 1 , more preferably both q and s are 1; preferably with the proviso that q + r + s ≥ 1, more preferably ≥ 2, most preferably ≥ 3; n is independently selected from 0, 1 , 2, 3, and 4, preferably 3;R2is represented by R2a-(CR(R’))p-C(Y)-, or R2and the group RN- form together a residue represented by R2a-(G4)v-(CR(R’))u-(G3)t-;R2ais a 6- to 10-membered aromatic group, 5- to 10-membered heteroaromatic group having up to 5, preferably up to 3, heteroatoms independently selected from N, O and S and optionally substituted by C1 -4alkyl, or a group represented by C6-10aryl-NR-C(Y)-N(R)- C6-10aryl-, wherein R2ais optionally substituted with one or more substituents preferably represented by R4wherein;G3is independently selected from C(Y)NR, SONR, SO2NR, CR(R')NR, triazolyl, triazolylCR(R'), and CR(R')triazolyl;G4is independently selected from C(Y), NRC(Y), NRSO, NRSO2, NRCR(R'), C(Y)NR, SONR, SO2NR, CR(R')NR, triazolyl, NRtriazolyl, triazolylNR, CR(R')triazolyl, and triazolyl CR(R'), each of t and v is independently 0 or 1 ; u is independently selected from 0, 1 , 2, 3 and 4, preferably 3 preferably with the proviso that at least one of t and v is 1 , more preferably both t and v are 1; preferably with the proviso that t + u + v ≥ 1 , more preferably ≥ 2, most preferably ≥ 3; and p is independently 1 , 2, 3 or 4, preferably 1 or 2, more preferably 1 ; wherein one or more occurrence of CR(R’) may be optionally replaced by a group independently selected from O, S, C(Y) and NR, with the proviso that no two O atoms are adjacent to each other; each occurrence of Y is independently selected from O, S, NR and CR(R’); each R3and R4is independently selected from: NH2, OH, COOH, COOR, C1- 6alkyl, C1 -6haloalkyl, O(C1- 6alkyl), O(C1- 6haloalkyl), O(C2-6alkenyl), C1- 6heteroalkyl, NO2, C(O)NH2, C(O)NR(R’), CN, OXO and halogen, wherein R3and R4each independently may optionally form together with any CR(R’) a 4- to 7- membered carbocyclic or heterocyclic ring; and each occurrence of R and R’ is independently H or selected from C1- 6alkyl , O( C1- 6alkyl ), C3-10cycloalkyl, O(C3-10cycloalkyl), S(C3-10cycloalkyl), C2-6alkenyl, C2-6alkynyl, C1 -6heteroalkenyl, C1 -6heteroal kynyl, C3-10cycloalkenyl, C1 -10cycloheteroalkenyl, C6-10aryl, C1-10heteroaryl, (C6-10aryl)C1 -6alkyl and (C1 -10heteroaryl)C1 -6alkyl, each of which can be optionally substituted with from 1 to 3 substituents selected from C1- 6-alkyl, OH, oxo and halogen, or R and R’ together represent oxo. The compound of aspect 1 , represented by the following formula:wherein RBrepresents R2a-(CR(R’))p-C(Y)-N(R)- or R2a-(G4)v-(CR(R’))u-(G3).,v-A compound, its individual diastereoisomers, its hydrates, its solvates, its crystal forms, its individual tautomers or a pharmaceutically acceptable salt thereof, wherein the compound structure comprises at least one group A independently represented by the following structure:wherein: a and b are each 0 or 1 , wherein a + b is at least 1 , preferably wherein a and b are each 1 ;R1is represented by -C(Y)-R1 a-SO2NR(R’);R1 ais independently a 5-membered heteroaromatic group having up to 3 heteroatoms independently selected from N, O and S, and wherein the heteroaromatic group is substituted, in addition to SO2NR(R’), by one or more substituents R^;R2is represented by R2a-(CR(R’))p-C(Y)-;R2ais a 6- to 10-membered aromatic group, and is optionally substituted with one or more substituents R4; and p is independently 1 , 2, 3 or 4, preferably 1 or 2, more preferably 1 ; wherein one or more occurrence of CR(R’) may be optionally replaced by a group independently selected from O, S and NR, with the proviso that no two O atoms are adjacent to each other; each occurrence of Y is independently selected from O, S, NR and CR(R’); each R3and R4is independently selected from: NH2, OH, COOH, COOR, C1- 6alkyl, C1- 6haloalkyl, O(C1- 6alkyl ), O(C1- 6haloalkyl), O(C2-6alkenyl), C1- 6heteroalkyl, NO2, C(O)NH2, C(O)NR(R’), CN, OXO and halogen, wherein R^ and R^ each independently may optionally form together with any CR(R’) a 4- to 7- membered carbocyclic or heterocyclic ring; and each occurrence of R and R’ is independently H or selected from C1- 6-alkyl, O(C1- 6alkyl ), C3-10cycloalkyl, O( C3-10cycloalkyl), S(C3-10cycloalkyl), C2-6alkenyl, C2-6alkynyl, C1- 6heteroalkenyl, C1- 6heteroal kynyl, C3-10cycloalkenyl, C1 -10cycloheteroalkenyl, C6-10aryl, C1-10heteroaryl, (C6-10aryl)C1- 6alkyl and (C1 -10heteroaryl)C1- 6alkyl, each of which can be optionally substituted with from 1 to 3 substituents selected from C1- 6-alkyl, OH, oxo and halogen.4. A compound, its individual diastereoisomers, its hydrates, its solvates, its crystal forms, its individual tautomers or a pharmaceutically acceptable salt thereof, wherein the compound structure comprises at least one group A independently represented by the following structure:wherein: a and b are each 0 or 1 , wherein a + b is at least 1 , preferably wherein a and b are each 1 ;R1is represented by -C(Y)-R1 a-SO2NR(R’);R1 ais independently a 5-membered heteroaromatic group having up to 3 heteroatoms independently selected from N, O and S, and wherein the heteroaromatic group is substituted, in addition to SO2NR(R’), by one or more substituents R3;R2is represented by R2a-(CR(R’))p-C(Y)-;R2a is a 6- to 10-membered aromatic group, and is optionally substituted with one or more substituents R4; and p is independently 1 or 2, preferably 1 ; each occurrence of Y is independently selected from O, S, NR and CR(R’); each R3and R4is independently selected from: NH2, OH, COOH, COOR, C1- 6alkyl, C1- 6haloalkyl, oxo and halogen; and each occurrence of R and R’ is independently H or selected from C1- 6-alkyl, O(C1- 6alkyl ), C3-10cycloalkyl, O( C3-10cycloalkyl), S(C3-10cycloalkyl), C2-6alkenyl, C2-6alkynyl, C1- 6heteroalkenyl, C1- 6heteroal kynyl, C3-10cycloalkenyl, C1 -10cycloheteroalkenyl, C6-10aryl, C1-10heteroaryl, (C6-10aryl)C1- 6alkyl and (C1-10heteroaryl)C1- 6alkyl, each of which can be optionally substituted with from 1 to 3 substituents selected from C1- 6-alkyl, OH, oxo and halogen.5. The compound of any of the preceding aspects, wherein group A is represented by the following formula:6. The compound of any of the preceding aspects, wherein group A is represented by the following formula:7. The compound of any of the preceding aspects, wherein: a and b are each 1 ;R1 ais independently a 5-membered heteroaromatic group having up to 3 heteroatoms independently selected from N, O and S, preferably thiophene, and wherein the heteroaromatic group is substituted, in addition to SO2NR(R’), by 1 or 2 substituents R3;R2a is a 6- to 10-membered aromatic group, preferably phenyl, substituted by 0, 1, 2 or 3 substituents R4; p is 1; each occurrence of Y is O; and / or each R3and R4is independently selected from OCH3, OCH2CH3, OCH2CH2CH3, OCH2(CH3)2, O-cyclopropyl, OCF3, OCF2CF3, COOH, COOCH3, NO2, CN, F, Cl, Br and I.8. The compound of aspect 7, wherein each R^ and R^ is independently selected from F, Cl, Br and I.9. The compound of any of the preceding aspects, wherein A is represented by the following structure A1A2, or A3:wherein: c is independently 1 or 2, preferably 1 ; d is independently 0, 1 , 2, 3, 4 or 5, preferably 2;W is independently selected from NR, O, S, S(O) and SO2, and is preferably S;R3ais independently selected from F, Cl, Br and I, and is preferably Cl;R3bis independently selected from F, Cl, Br, I and H, and is preferably H; andR4aand R4b are each independently selected from OCH3, OCH2CH3, OCH2CH2CH3, OCH2(CH3)2, O-cyclopropyl, OCF3, OCF2CF3, COOH, COOCH3, NO2, CN, F, Cl, Br and I, and are each preferably Cl or OCH3. The compound of any of the preceding aspects, wherein A is represented by the following structure A4The compound of aspect 9 or 10, wherein each R3and R4is independently selected from F, Cl, Br and I. The compound of any of the preceding aspects, wherein A is represented by the following structure A-1:The compound of any of the preceding aspects, wherein A is represented by the following structure A-5:The compound of any of aspects 1 to 8, wherein A is represented by the following structure A11,A12, A13or A14.wherein: c is independently 1 or 2, preferably 1 ; d is independently 0, 1 , 2, 3, 4 or 5, preferably 1 ;W is independently selected from NR, O, S, S(O) and SO2, and is preferably S;R3ais independently selected from F, Cl, Br and I; R3bis independently selected from F, Cl, Br, I and H, and is preferably H; andR4Cis independently selected from OCH3, OCH2CH3, OCH2CH2CH3, OCH2(CH3)2, O- cyclopropyl, OCF3, OCF2CF3, COOH, COOCH3, NO2, CN, F, Cl, Br and I, and is preferably NO2; andR4dis independently selected from H, OCH3, OCH2CH3, OCH2CH2CH3, OCH2(CH3)2, O- cyclopropyl, OCF3, OCF2CF3, COOH, COOCH3, NO2, CN, F, Cl, Br and I, and is preferably H. The compound of any of the preceding aspects, wherein A is represented by the following structure A-4:16. The compound of any of the preceding aspects, wherein A is represented by any of the following structures:17. The compound of any of the preceding aspects, wherein A is represented by the following structure:18. The compound of any of the preceding aspects, wherein A is represented by the following structure:wherein each of W1, W3, W4is independently selected from CH, S, O, and N, wherein at least one is S or O, preferably wherein W1is S or O, more preferably wherein W1is S and each of and is N. 19. The compound of any of the preceding aspects, wherein A is represented by the following structure:20. The compound of any of the preceding aspects, wherein A is represented by the following structure A-3:21. The compound of any of the preceding aspects, wherein A is represented by the following structure:22. The compound of any of the preceding aspects, wherein A is represented by the following structure:wherein each of W1,W3, W4is independently selected from CH, S, O, and N, wherein at least one is S or O, preferably wherein W1is S or O, more preferably wherein W1is S and each of and W4is N.23. The compound of any of the preceding aspects, wherein A is represented by any of the following structures:24. The compound of any of the preceding aspects, wherein A is represented by the following structureA-2:25. The compound of any of the preceding aspects, wherein each R3is halogen, and each R4is independently selected from O(C1- 6alkyl ), NO2and halogen.26. The compound of any of the preceding aspects, wherein R1 ais substituted, in addition to SO2NR(R’), by one group R3, and R2ais substituted by one or two groups R4.27. The compound of any of the preceding aspects, wherein R2ais phenyl substituted by two groups R4at positions 4 and 2 on the phenyl ring or wherein R4aand R4bare, respectively, at positions 4 and 2 of the phenyl ring, each relative to the attachment point to CR(R’).28. The compound of any of the preceding aspects, wherein R1 ais substituted by one group R3which is halogen, and R2ais substituted by one or two groups R4each independently selected from O(C1- 6alkyl), NO2and halogen.29. The compound of any of the preceding aspects, wherein R3is Cl, and R4is selected from OCH3, NO2, and Cl.30. The compound of any of the preceding aspect, wherein R3ais Cl, R3bis H, R4ais Cl or OCH3, and R4bis Cl.31. The compound of any of the preceding aspects, wherein R3ais Cl, R3bis H, R4cis NO2, and R4dis Cl.32. The compound of any of the preceding aspects, wherein R1is represented by any one of the structures33. The compound of any of the preceding aspects, wherein R1is represented by the structure34. The compound of any of aspects 1 to 31 , wherein R1is represented by any one of the structures:35. The compound of any of aspects 1 to 31, wherein R1is represented by the structure36. The compound of any of the preceding aspects, wherein R2is represented by a structure selected from:37. The compound of any of the preceding aspects, wherein R2is represented by38. The compound of any of aspects 1 to 36, wherein R2is represented by39. The compound of any of aspects 1 to 36, wherein R2is represented by40. The compound of any of the preceding aspects, wherein R2and the group RN- form together a residue RBrepresented by any of the following structures:41. The compound of any of the preceding aspects, wherein R2and the group RN- form together a residue RBrepresented by the following structure:42. The compound of any of the preceding aspects, wherein one or more occurrence of the group -SO2NH2is replaced by a group represented by -OSO2NH2- 43. The compound of any one of the preceding aspects, wherein the compound is represented by the following Formula I, la, or lb,wherein each A is independently defined as in any one of the preceding aspects;B is a single bond or an optionally substituted C1- 50aliphatic group, in which optionally one or more carbon atoms can be replaced by heteroatom, a C3-12carbocyclic or a C1- 12heterocyclic group, and which can be saturated or optionally contain one or more double or triple bonds; and each C is an atom, a molecule or a particle, and / or is a therapeutic or diagnostic agent. 44. The compound of aspect 43, wherein B is a single bond or is represented by any of the following general Formulae II— V, lla-Va or Ilb-Vb:wherein each x is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; each y is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; each z is 0, 1 , 2, 3 or 4, preferably 1 ; with the proviso that in Formulae lla-Va and lIb— Vb, z and at least one of x and y is not 0;* represents a point of attachment to a moiety A; • represents a point of attachment to a moiety C; and each of BSand BLis independently selected from alkylene, cycloalkylene, arylalkylene, heteroarylalkylene, heteroalkylene, heterocycloalkylene, alkenylene, cycloalkenylene, arylalkenylene, heteroarylalkenylene, heteroalkenylene, heterocycloalenkylene, alkynylene, heteroalkynylene, arylene, heteroarylene, aminoacyl, oxyalkylene, aminoalkylene, diacid ester, dialkylsiloxane, amide, thioamide, thioether, thioester, ester, carbamate, hydrazone, thiazolidine, methylene alkoxy carbamate, disulfide, vinylene, imine, imidamide, phosphoramide, saccharide, phosphate ester, phosphoramide, carbamate, dipeptide, tripeptide, tetrapeptide, each of which is optionally substituted. 45. The compound of any one of aspects 43 and 44, wherein B is represented by (Bs)xwherein:each x is selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; each BSis independently selected from the group consisting of alkylene, cycloalkylene, arylalkylene, heteroarylalkylene, heteroalkylene, heterocycloalkylene, alkenylene, cycloalkenylene, arylalkenylene, heteroarylalkenylene, heteroalkenylene, heterocycloalenkylene, alkynylene, heteroalkynylene, arylene, heteroarylene, aminoacyl, oxyalkylene, aminoalkylene, dlacld ester, dialkylsiloxane, amide, thioamlde, thioether, thioester, ester, carbamate, hydrazone, thiazolidine, methylene alkoxy carbamate, disulfide, vinylene, imine, imidamide, phosphoramide, saccharide, phosphate ester, phosphoramide, carbamate, dipeptide, tripeptide, tetrapeptide. 46. The compound of any one of aspects 43 to 45, wherein each BSand BL is independently selected from:wherein in each of the above structures: each n is independently 0, 1 , 2, 3, 4, 5, 6, 7, or 8; each m is independently 0, 1 , 2, 3, or 4; each Rc, Rd, and Reis independently is selected from H, optionally substituted C1- 6alkyl , (C3- C10carbocyclyl)C1- 6alkyl , (C6-C10aryl)C1- 6alkyl , (C1-C10heterocyclyl)C1- 6alkyl , C2-6alkenyl, C2-6alkynyl, and C6-C10aryl, in each of which optionally one or more of the carbon atoms can be replaced by heteroatoms; preferably selected from side-chain residues of proteinogenic or a non-proteinogenic amino acids; each occurrence of R and R’ is independently H or selected from C1- 6-alkyl, O(C1- 6alkyl ), S(C1-. 6-alkyl), C3-10cycloalkyl, O(C3-10cycloalkyl), S(C3-10cycloalkyl), C2-6alkenyl, C2-6alkynyl, C1- 6heteroalkenyl, C1- 6heteroal kynyl, C3-10cycloalkenyl, C1 -10cycloheteroalkenyl, C6-10aryl, C1 -10heteroaryl, (C6-10aryl)C1- 6alkyl and ( C1 -10heteroaryl)C1- 6alkyl, each of which can be optionally substituted with from 1 to 3 substituents selected from C1- 6-alkyl, OH, oxo and halogen. each * represents a point of attachment for which the shortest path to a moiety A comprises less atoms than that for •; and each • represents a point of attachment for which the shortest path to a moiety C comprises less atoms than that for *, with the proviso that when n is > 1 and a respective point of attachment is indicated on any one of Rc, Rdand Re, then it can be independently present in one or more of the peptide monomeric units, preferably in one peptide monomeric unit most distant from the other point of attachment indicated in the respective structure, wherein each of the above structures optionally comprises a further attachment point to a moiety A or C.47. The compound according to any one of the preceding aspects, wherein moiety B has one of the following structures:(a) single bond, (BS)x,wherein each of AA3, AA4, AA5, AA6, AA7, and AA8represents a proteinogenic or non- proteinogenic amino acid, or is absent; wherein preferably: each proteinogenic or non-proteinogenic amino acid is preferably independently represented by one of the following structures:and / or AA4is an amino acid with a charged sidechain, and AA7is an amino acid with an aliphatic sidechain; wherein more preferably: AA3is selected from Asp, Glu, and Lys, or is absent; preferably Asp;AA4is selected from Arg, HomoArg, Lys, Asp, and Glu, or is absent; preferably Lys or Arg;AA5is selected from Asp, Glu, and Lys; preferably Asp;AA6is selected from Cys, Lys, Gly and Vai; preferably Cys or Lys;AA7is selected from Gly, Ala, Vai, Arg, lie, Pro; ; and AA8is selected from Pro and citrulline (Cit); even more preferably according to one of the sequences shown in the below table:or(b) single bond,48. The compound according to any one of the preceding aspects, which has one of the following structures, wherein -D represents -B-C as defined in any one of the preceding aspects:wherein, unless otherwise specified, all groups and variables are defined as in any one of the preceding aspects. 49. The compound according to any one of the preceding aspects, each -D or -B-C is independently represented by any one of the following structures:50. The compound according to any one of the preceding aspects, each -D or -B-C is independently represented by any one of the following structures:51. The compound according to any one of the preceding aspects, wherein the moiety C is a chelating agent group suitable for radiolabeling; a radioactive group comprising a radioisotope; a chelate of a radioactive isotope with a chelating agent; a fluorophore group; a cytotoxic and / or cytostatic agent; immunomodulator agent; or a protein, wherein preferably:(a) the chelating agent group suitable for radiolabeling is selected from sulfur colloid, diethylenetriaminepentaacetic acid (DTPA), ethylenediaminetetraacetic acid (EDTA), 1,4,7,10- tetraazacyclododecane-N,N',N",N",-tetraacetic acid (DOTA), 1,4,7-triazacyclononane-N,N',N"- triacetic acid (NOTA), 1,4,8,11-tetraazacyclotetradecane-N,N',N",N",-tetraacetic acid (TETA), iminodiacetic acid, bis(carboxymethylimidazole)glycine, 6-Hydrazinopyridine-3-carboxylic acid (HYNIC),has a structure according to the following formula:wherein: n is 0, 1 , 2, 3, 4 or 5; preferably 1 ;R1eis independently H, COOH, aryl COOH or heteroaryl COOH; preferably COOH;R2eis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH; each R3eis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH; R4eis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH; and X is O, NH or S; preferably O; or has a structure according to the following formula:wherein: n is 0, 1 , 2, 3, 4 or 5; preferably 1R1fis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH;R2fis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH;R3fis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH; and X is O, NH or S; preferably O;(b)(c) the chelate of a radioactive isotope is a chelate of an isotope listed under (b) above and / or with a chelating agent listed under (a) above; or moiety C is a group selected from any of the following structures:wherein X is CH, O, N or S, preferably CH;wherein M is a radioactive isotope, preferably selected among the list underr (b) above; more preferably:(d) the fluorophore group is selected from a xanthene dye, acridine dye, oxazine dye, cyanine dye, styryl dye, coumarine dye, porphine dye, fluorescent metal-ligand-complex, fluorescent protein, nanocrystals, perylene dye, boron-dipyrromethene dye and phtalocyanine dye, preferably selected from the following structures:(e) the cytotoxic and / or cytostatic agent is selected from chemotherapeutic agent selected from the group consisting of topoisomerase inhibitors, alkylating agents, antimetabolites, antibiotics, mitotic disrupters, DNA intercalating agents, DNA synthesis inhibitors, DNA-RNA transcription regulator, enzyme inhibitors, gene regulators, hormone response modifiers, hypoxia-selective cytotoxins, epidermal growth factor inhibitors, anti-vascular agents and a combination of two or more thereof, preferably selected from the following structures:moiety C is an auristatin derivative, preferably having a structure according to the following formula:wherein:R1dis independently H or C1-C6alkyl; preferably H or CH3;R2dis independently C1-C6alkyl; preferably CH3 or IPr;R3dis independently H or C1-C6alkyl; preferably H or CH3; R4dis independently H, C1-C6alkyl, COO(C1-C6alkyl), CON(H or C1-C6alkyl), C3-C10aryl orC3-C10heteroaryl; preferably H, CH3, COOH, COOCH3or thiazolyl;R5dis independently H, OH, C1-C6alkyl; preferably H or OH; andR6dis independently C3-C10aryl or C3-C10heteroaryl; preferably optionally substituted phenyl or pyridyl, wherein preferably, moiety C is derived from MMAE or MMAF; ora topoisomerase inhibitor; preferably camptothecin (CPT) or a derivative thereof; more preferably derived (e.g., by replacing a hydrogen atom) from topotecan, irinotecan, silatecan, cositecan, exatecan, lurtotecan, gimatecan, belotecan, rubitecan, deruxtecan, DXd; even more preferably exatecan; even more preferably(f) the immunomodulator agent is selected from molecules known to be able to modulate the immune system, such as ligands of CD3, CD25, TLRs, STING, 4-1 BBL, 4-1 BB, PD-1, mTor,PDL-1, NKG-2D IMiDs, wherein ligands can be agonists and / or antagonist; or(g) the protein is selected from cytokines, such as IL2, IL10, IL12, IL15, TNF, Interferon Gamma, or is an antibody.52. The compound according to any one of the preceding aspects, wherein: (a) A-B is represented by a structure selected from:(b) C is represented by a structure selected from:5wherein the combination of A-B and C is preferably selected such that the covalent bond — connecting B with C is represented by S— S, S— C, C— S, C(O)— Ra, C(O)— N, C(O)— O, C(O)— N, N— C(O), N— C(O)O, N— C(S) or OC(O)— N. The compound of any of the preceding aspects, wherein moiety A is selected from A-1 to A-5. The compound of an of the preceding aspects, wherein moiety B is selected from B-1 to B-21. The compound of an of the preceding aspects, wherein moiety C is selected from C-1 to C-31. A compound having a structure selected from those listed in Table 1, Table 3.1, Table 3.2, FIG. 30, FIG. 31, FIG. 33, or FIG. 34, its individual diastereoisomers, its hydrates, its solvates, its crystal forms, its individual tautomers or a pharmaceutically acceptable salt thereof. A pharmaceutical composition comprising the compound according to any one of the preceding aspects, and a pharmaceutically acceptable excipient. The compound or the pharmaceutical composition according to any one of the preceding aspects for use in:(a) a method for treatment of the human or animal body by surgery or therapy or a diagnostic method practiced on the human or animal body; or(b) a method for therapy or prophylaxis of a subject suffering from or having risk for a disease or disorder; or(c) a method for guided surgery practiced on a subject suffering from or having risk for a disease or disorder; or(d) a method for diagnosis of a disease or disorder, the method being practiced on the human or animal body and involving a nuclear medicine imaging technique, such as Positron Emission Tomography (PET) or Single Photon Emission Computed Tomography (SPECT); or(e) a method for targeted delivery of a therapeutic or diagnostic agent to a subject suffering from or having risk for a disease or disorder,59. The compound or the pharmaceutical composition for use according to aspect 58, wherein the disease or disorder is independently selected from hypoxia-related diseases such as cancer, preferably wherein the cancer is selected from the group consisting of breast cancer, pancreatic cancer, colon cancer, multi-drug resistant colon cancer, rectal cancer, colorectal cancer, metastatic colorectal cancer, lung cancer, non-small cell lung cancer, head and neck cancer, ovarian cancer, hypopharynx cancer, nasopharynx cancer, larynx cancer, bladder cancer, cholangiocarcinoma, clear cell renal carcinoma, glioma, astrocytoma, cervix cancer and kidney cancer.EXAMPLESExample 1 - Synthesis of derivatives1.1 General RemarksLiquid-Chromatography / Mass-Spectrometry (LC / MS) spectra were recorded on a Waters Acquity UPLC H- Class system coupled to an ESI-ToF-MS (Waters Xevo G2XS Qtof) which was equipped with a Waters Acquity BEH C18 column (2.1 x 50 mm, 130 A, 1.7 pm). A gradient of eluent A (MilliQ water with 0.1% formic acid) and eluent B (acetonitrile with 0.1% formic acid) was applied at 40 °C column temperature and a flow rate of 0.6 mL / min (5% to 80% B in 6 min).Reversed-phase medium-pressure liquid chromatography (MPLC)Small organic molecules that could be produced at higher quantities (>10 mg) were purified by reversed- phase medium-pressure liquid chromatography (BUCHI) on a C18 40 μM irregular 12 g column (BUCHI, #145152103) using mQ millipore water 0.1% formic acid (FA) (eluent A) and acetonitrile 0.1% FA (eluent B) as mobile phase at following gradient: 0-5 min 98% A, 5-45 min 98% to 0% A, 45-50 min 0% A, 50-50.1 min 0% to 98% A and 50.1-55 min 98% A. The flow rate was set to 30 mL / min.Reversed-phase high-pressure liquid chromatography (HPLC)Final products and conjugates were purified with a semi preparative reversed-phase high-pressure liquid chromatography (RP-HPLC) on an Agilent 1200 Series RP-HPLC with a PDA UV detector. The system was equipped with a Synergi 4 pm, Polar-RP 80 A 10 x 150 mm C18 column using flow rate of 5 mL / min with the following gradient of eluent A (mQ millipore water 0.1% TFA) and eluent B (acetonitrile with 0.1% TFA): 0-15 min 90% to 0% A, 15-16 min 0% A, 16-17 min 0% to 90% A, 17-18 min 90% A.1.2 Solid phase synthesisGeneral solid-phase synthesis proceduresSolid-phase synthesis was performed with preloaded Fmoc-Lys(Boc)-Wang resin (200-400 mesh, 0.5 mmol / g; Bachem, #4003241.0005). In general, resin was swollen for 30 min in dimethylformamide (DMF)previous to any reaction steps. Incubations were performed in 10 mL reaction columns (CEM Corporation, #32.276) on a rotator mixer (Reax 2, Heidolph Instruments GmbH & Co. KG) at room temperature.Fmoc deprotectionResin was incubated for 2 x 15 min with 20% piperidine in DMF. After the deprotection, the resin was washed 5-10 times with DMF to remove residual piperidine.Mini cleavage for LC-MS analysisA small portion of resin was transferred to an Eppendorf tube and incubated with 20 μL trifluoracetic acid (TFA) for 15 min at room temperature. The cleavage was quenched by addition of 100 μL DMF to centrifuge the suspension (1 min at 10’000 ref) previous to LC-MS analysis.Azide reductionAfter swelling in DMF, the resin was incubated with a solution of trimethyl phosphine (5 eq.) in THF:water (10% water in THF). The reaction proceeded for 2 h at room temperature to subsequently wash the beads 10 times with DMF.Amide couplingTypically, the acid (2 eq.), O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU, 1.9 eq.) and diisopropylethylamine (DIPEA, 4 eq.) were dissolved in DMF and added to the resin bearing chemical moieties with a free amino group. After incubation for 4 h, the resin was subsequently washed five times with DMF. Coupling efficiency could be monitored by LC-MS analysis (mini cleavage).Resin cleavage and purificationCleavage solution was prepared as following: 95% trifluoracetic acid (TFA), 2.5% water and 2.5% triisopropylsilane (TIPS). Where specified, 2.5% thioanisol and 2.5% m-cresol were added as scavengers. Highest yields were obtained when performing three consecutive cleavages (1 h at room temperature each). Cleavage fractions were combined and either directly purified via RP HPLC or precipitated in diethyl ether for subsequent purification (see below).Peptide precipitationFor peptide structures, products could be precipitated from the cleavage solution by adding 5-10 volumes ice-cold diethyl ether. Precipitation proceeded for 30 min at -20 °C to obtain the peptide as pellet by centrifugation (3200 ref, 5 min, 4 °C). The crude was dissolved in watenacetonitrile (1 :1) to be purified by reversed-phase chromatography.1 .2.1 Synthesis of intermediates 11-14 (intermediate 14 = compound C9)Preloaded Fmoc-Lys(Boc)-Wang resin (1 g scale) was swollen for subsequent Fmoc deprotection. The tripeptide Lys-Asp-βAla-NH2was generated by iterative amide coupling and Fmoc deprotection following the general procedure, however, doubling the equivalents for amide couplings (4 eq. acid, 3.9 eq. HATU,8 eq. DIPEA). The order of loading was: N-(fluorenylmethoxycarbonyl)-N6-(tert-butoxycarbonyl)-L-lysine (preloaded), N-(fluorenylmethoxycarbonyl)-L-aspartic acid tert-butyl ester, N-(fluorenylmethoxycarbonyl)- beta-alanine. The tripeptide linker synthesized on resin was split into four 250 mg batches (corresponding to 0.125 mmol loading capacity each). Each batch was coupled with one isomer of the proline derivative (RR, SS, RS, SR) following the standard protocol for amide couplings. After Fmoc deprotection, I6 was coupled at lower equivalents (47 mg, 0.138 mmol, 1.1 eq. acid; 47.5 mg, 0.125 mmol, 1 eq. HATU and 174 μL DIPEA, 1 mmol, 8 eq. DIPEA), leaving the reaction overnight. Subsequent azide reduction was followed by coupling of 2-(2,4-dichlorophenyl)acetic acid, using 6 equivalents of the acid (154 mg, 0.75 mmol), 5 equivalents HATU (238 mg, 0.625 mmol) and 8 equivalents DIPEA (174 μL, 1 mmol). The reaction proceeded overnight at room temperature. Finally, 11 , 12, 13 and I4 were cleaved from the resin, precipitated with ice-cold diethyl ether and purified via RP-HPLC, yielding the products as white solids: 11 (SS, 5.3 mg, 5% yield), I2 (SR, 4.1 mg, 4% yield), I3 (RS, 6.2 mg, 6% yield), I4 = C9 (RR, 7.8 mg, 7% yield), m / zcalculated for C31H39Cl3N7O1 1S2[M+H]+: 854.1209, detected (TOF MS ES+): 854.0676, 855.1398 (11);854.0635, 859.1329 (I2); 854.1383, 856.1353 (I3); 854.1379 (I4 = C9).1 .2.2 Synthesis of intermediate I5The tripeptide linker Lys-Asp-βAla-NH2 was synthesized on resin (125 mg, 0.06 mmol) as reported above and reacted with an acetazolamide derivative (4-oxo-4-[(5-sulfamoyl-1 ,3,4-thiadiazol-2-yl)amino]butanoic acid, 73 mg, 0.21 mmol, 4 eq.) in the presence of HATU (81 mg, 0.21 mmol, 4 eq.) and DIPEA (300 μL, 1 .72 mmol, 8 eq.) in DMF. After 4 h at room temperature, the resin was washed with DMF for subsequent cleavage of I5 from the resin to allow purification by RP-HPLC yielding I5 as white solid (2.7 mg, 7.6% yield), m / z calculated for C19H31N8O10S2[M+H]+: 595.1599, detected (TOF MS ES+): 595.1688.1.3 Solution phase synthesis1 .3.1 Synthesis of intermediate I6Fisher esterification, Boc-protection and ester hydrolysis were performed without purification of reaction intermediates. 500 mg (2.07 mmol, 1 eq.) of 5-chloro-2-sulfamoylthiophene-3-carboxylic acid was dissolved in 25 mL methanol and 2.6 mL 4 M HCI in dioxane (10.4 mmol, 5 eq.). The solution was refluxed overnight to receive the crude after evaporating the solvent under reduced pressure. The residue was dissolved in 20 mL dichloromethane (DCM) to which 569 μL bis(2-methyl-2-propanyl)dicarbonate (540 mg, 2.47 mmol, 1.2 eq.), 101 mg N,N-dimethylpyridin-4-amine (DMAP; 0.83 mmol, 0.4 eq.) and 342 μL triethylamine (TEA, 2.47 mmol, 1.2 eq.) were added. After 3 h at room temperature, LC-MS analysis revealed completion of the reaction. The solvent was evaporated under reduced pressure and the crude was taken up in 20 mLwaterTHF (1 :1). Addition of 1.3 mL of 8 M NaOHaq(10.4 mmol, 5 eq.) initiated the ester hydrolysis which proceeded for 3 h at room temperature. The solution was neutralized with 1 M HCIaqand the solvent was evaporated. The crude was dissolved in acetonitrile:water (1 :1) and purified by RP-MPLC to obtain I6 as white solid (320 mg, 45% yield), m / z calculated for C10H11CINO6S2[M-H]-: 339.9722, detected (TOF MS ES-): 339.9702.1 .3.2 Synthesis of intermediate I72-(2,4-Dichlorophenyl)acetic acid (5 mg, 23 μmol, 1 eq.) was dissolved in DMF and pre-activated for 10 min by the addition of EDC (4 μL, 23 μmol, 1 eq.), HOBt (3 mg, 23 μmol, 1 eq.) and DIPEA (15.9 μL, 91 μmol, 4 eq.). 1-Tert-butyl 2-methyl (2R,4R)-4-amino-1 ,2-pyrrolidinedicarboxylate hydrochloride (6.4 mg, 23 μmol, 1 eq.) was added to the pre-activation solution and incubated for 4 h at room temperature. The solvent was evaporated and the residue taken up in 200 μL TFA. After 1 h at room temperature, TFA was evaporated under reduced pressure, the residue taken up in water and lyophilized to continue with the coupling to I6 (7.7 mg, 23 μmol, 1 eq.) under the same conditions as described for the first coupling step. Boc deprotection in TFA (200 μL) for 1 h at room temperature was followed by evaporation of TFA and neutralization with 1 M NaOHaq. Subsequently, ester hydrolysis was performed for 2 h at room temperature with NaOH (230 μL 1 M NaOHaq, 230 μmol, 10 eq.) in 500 μL water:THF (1 :1). After neutralization with 1 M HCIaq, the solvent was evaporated under reduced pressure to purify the crude by RP-HPLC. The product was lyophilized resulting in I7 as a white solid: RR (3.9 mg, 32% yield), m / z calculated for C18H17CI3N3O6S2 [M+H]+: 539.9619, detected (TOF MS ES+): 539.9050, 540.9713.1 .3.3 Synthesis of intermediate I81 -tert-butyl 2-methyl (2R,4R)-4-amino-1 ,2-pyrrolidinedicarboxylate hydrochloride (5.5 mg, 19.6 μmol, 1 eq.) was dissolved in 500 μL DCM to perform the acetylation reaction by adding acetic acid anhydride (18.5 μL, 196 μmol, 10 eq.) and TEA (13.7 μL, 98.3 μmol, 5 eq.). After 1 h at room temperature, the solvent was evaporated and the dry residue taken up in 200 μL TFA to proceed with Boc deprotection for 1 h at room temperature. TFA was evaporated under reduced pressure and the residue taken up in 10 mLwater:acetonitrile (1 : 1 ) to lyophilize the crude overnight. I6 (6.7 mg, 19.6 μmol, 1 eq.) was pre-activated for 10 min at room temperature with EDC (3.5 μL, 19.8 μmol, 1 eq.), HOBt (2.6 mg, 19.2 μmol, 1 eq.) and DIPEA (13.7 μL, 78.6 μmol, 4 eq.) in DMF before adding the solution to the acetylated intermediate. The coupling was left for 4 h at room temperature which was followed by Boc deprotection in TFA and saponification with NaOH (200 μL 1 M NaOHaq, 200 μmol, 10 eq.) in 400 μL water:THF (1 :1). The hydrolysis mixture was neutralized with 1 M HCIaqto evaporate the solvent and purify the product via RP- HPLC, yielding I8 as white solid (2.4 mg, 31% yield), m / z calculated for C12H15CIN3O6S2[M+H]+: 396.0085, detected (TOF MS ES+): 396.0050.1 .3.4 Synthesis of intermediate I9Pre-activation of 2-(2,4-dichlorophenyl)acetic acid (3.9 mg, 17.6 μmol, 1 eq.) was performed using EDC (3.1 μL, 17.6 μmol, 1 eq.), HOBt (2.4 mg, 17.8 μmol, 1 eq.) and DIPEA (12.2 μL, 70 μmol, 4 eq.) in DMF for 10 min at room temperature, to initiate coupling by the addition of 1 -tert-butyl 2-methyl (2R,4R)-4-amino- 1 ,2-pyrrolidinedicarboxylate hydrochloride (4.9 mg, 17.5 μmol, 1 eq.). After 4 h at room temperature, the solvent was evaporated and the residue dissolved in water:THF (1 :1) comprising NaOH (180 μL 1 M NaOHaq, 180 μmol, 10 eq.). The esterification proceeded for 2 h at room temperature and was stopped by neutralization of the solution with 1 M HCIaqand evaporation of the solvent. The crude was purified by RP- HPLC resulting in I9 as white solid (2.7 mg, 39% yield), m / z calculated for C15H17CI2N2O4[M+H]+: 359.0560, detected (TOF MS ES+): 359.0451 .1 .3.5 Synthesis of intermediate 110Tert-butyl N-[2-[2-(2-aminoethoxy)ethoxy]ethyl]carbamate (50 mg, 0.20 mmol, 1 eq.) was dissolved in 5 mL DMF and mixed with FITC (78 mg, 0.20 mmol, 1 eq.) and DIPEA (140 μL, 0.80 mmol, 4 eq.) in DMF for 1 h at room temperature. The solvent was evaporated under reduced pressure and the residue taken up in 2 mL TFA. After 30 min at room temperature, TFA was evaporated and the crude purified by RP-MPLC. The product 110 was obtained as yellow solid (36.8 mg, 34% yield), m / z calculated for C27H28N3O7S [M+H]+: 538.1642, detected (TOF MS ES+): 538.1675.1 .3.6 Synthesis of compounds C1, C3, C5 and C711 , 12, 13 and I4 (2 mg, 2.3 μmol, 1 eq.) were dissolved separately in 200 μL DMSO. After addition of 1 .1 mg NHS-Fluorescein (2.3 μmol, 1 eq.) and 1 μL DIPEA (5.7 μmol, 2.5 eq.) the mixtures were incubated in a shaker incubator for 1 h at room temperature. The crudes were purified by RP-HPLC and the product fractions lyophilized, resulting in a yellow powder: C1 (SS, 1.2 mg, 43% yield), C3 (SR, 0.71 mg, 29% yield), C5 (RS, 0.70 mg, 29% yield), C7 (RR, 0.90 mg, 32% yield), m / z calculated for C52H49Cl3N7O17S2[M+H]+: 1212.1686, detected (TOF MS ES+): 1212.1664, 1213.2268 (C1); 1212.2241 , 1214.2233 (C3), 1212.2245, 1214.2238 (C5); 1212.2231 , 1214.2224 (07). 1 .3.7 Synthesis of compounds C2, C4, C6 and C10Eppendorf tubes were charged separately with 11, 12, 13 and I4 (72 pg in 72 μL DMSO, 0.084 μmol, 1 eq.) to add 0.3 μL DIPEA (1.7 μmol, 20 eq.). Upon addition of 50 μL IRDye® 750 NHS ester (LI-COR Biosciences) pre-dissolved in DMSO (100 pg, 0.084 μmol, 1 eq.), the reaction proceeded overnight at room temperature in a shaker incubator. The product was isolated by RP-HPLC, lyophilized (green solid) and dissolved in 100 μL sterile PBS to measure the concentration by Nandrop (absorption at 4 = 756 nm, extinction coefficient = 260’000 M-1cm-1): C2 (SS, 0.035 μmol, 42% yield), C4 (SR, 0.040 μmol, 48% yield), C6 (RS, 0.028 μmol, 33% yield), C10 (RR, 0.033 μmol, 39% yield), m / z calculated forC80H97CI3N9O24S6 [M+H]+: 1864.4031 , detected (MALDI-TOF MS +): 1864.40, 1866.41 (C2); 1864.39, 1866.39 (C4); 1864.40, 1866.40 (C6); 1864.41 , 1866.41 (C10).1 .3.8 Synthesis of compounds C8, C12 and C13C8, C12 and C13 were synthesized according to the general procedure of acid pre-activation with EDC (1 eq.), HOBt (1 eq.) and DIPEA (4 eq.) in DMF for 10 min at room temperature, followed by addition of 110 (1 eq.). After 1 h at room temperature, the mixtures were purified by RP-HPLC, resulting in the products as yellow solids: C8 (1.1 mg, 53% yield), C12 (0.6 mg, 21% yield), C13 (0.8 mg, 38% yield).C8 m / z calculated for C45H42CI3N6O12S3[M+H]+: 1059.1083, detected (TOF MS ES+): 1059.1521 , 1063.1473.C12 m / z calculated for C39H40CIN6O12S3[M+H]+: 915.1549, detected (TOF MS ES+): 915.1887, 917.1851.C13 m / z calculated for C42H42Cl2N5O10S [M+H]+: 878.2024, detected (TOF MS ES+): 878.2299, 880.2289. 1 .3.9 Synthesis of compound C11An Eppendorf tube was charged with 14 (0.5 mg, 0.58 μmol, 1 eq.), DOTA-GA anhydride (0.27 mg, 0.58 μmol, 1 eq.), DIPEA (1 μL, 5.8 μmol, 10 eq.), DMAP (2.9 μL 100 mM in DMSO, 0.29 μmol, 0.5 eq.) and 95 μL DMSO. The mixture was incubated for 3 h at room temperature and the crude purified by RP-HPLC to receive the product C11 as white solid (0.30 mg, 39% yield), m / z calculated for C50H69Cl3N11O20S2[M+H]+: 1312.3222, detected (TOF MS ES+): 1312.3872, 1314.3866.C11 was dissolved in MilliQ water with 4% DMSO to reach a 1 mM concentration of which 39 μL (39 nmol,1 eq.) were diluted with 74 μL 1 M acetate buffer pH 4.5. After addition of 4.2 μL [177Lu]LuCl3(11 MBq, ITM Radio Pharma) the mixture was heated at 95 °C for 10 min and passively cooled down to room temperature to allow complexation. [177Lu]Lu-C11 was diluted with 663 μL PBS. Labelling efficiency was monitored by RP-HPLC (see FIG. 23).1.3.11 Synthesis of compound C14I6 (1.2 mg, 3.5 μmol, 1 eq.) was dissolved in 100 μL DMF to perform pre-activation with EDC (0.6 μL, 3.4 μmol, 1 eq.), HOBt (0.5 mg, 3.7 μmol, 1 eq.) and DIPEA (2.5 μL, 14 μmol, 4 eq.). After 10 min at roomtemperature, I10 (1.9 mg, 3.5 μmol, 1 eq.) was added to proceed with the coupling for 1 h at room temperature in the dark. The solvent was evaporated under reduced pressure and the residue dissolved in TFA to perform Boc deprotection for 15 min at room temperature before direct purification by RP-HPLC affording C14 as yellow solid (1.1 mg, 43% yield), m / z calculated for C32H30CIN4O10S3[M+H]+: 761.0807, detected (TOF MS ES+): 761.1006.1 .3.12 Synthesis of compound C15 (AAZ*)15 (1.2 mg, 2.0 μmol, 1 eq.) was taken up in 100 μL DMF to which FITC (3',6'-dihydroxy-6- isothiocyanatospiro[2-benzofuran-3,9'-xanthene]-1-one, 0.8 mg, 2.1 μmol, 1 eq.) and DIPEA (1.4 μL, 8.0 μmol, 4 eq.) were added. After 1 h at room temperature, the crude was purified via RP-HPLC to lyophilize merged product fractions overnight. The final product C15 (AAZ*) was obtained as a yellow solid (0.51 mg, 26% yield), m / z calculated for C40H42N9O15S3[M+H]+: 984.1957, detected (TOF MS ES+): 984.2300.1 .3.13 Synthesis of intermediate 1111 -(tert-butyl) 2-methyl (2R,4R)-4-aminopyrrolidine-1 ,2-dicarboxylate (50 mg, 205 μmol, 1 eq.) was treated with 4-nitrophenyl carbonochloridate (41 mg, 205 μmol, 1 eq.) and DIPEA (71 μL, 409 μmol, 2 eq.) in dry DCM for 10 min at 0 °C. 5-amino-1 ,3,4-thiadiazole-2-sulfonamide (41 mg, 225 μmol, 1.1 eq.) was added and the reaction mixture stirred for 1 h at room temperature. The solvent was evaporated and the residue taken up in 1 mL TFA. After 1 h at room temperature, TFA was evaporated and the crude purified by RP- HPLC to give I11 as a colorless oil (59 mg, 82%).1 .3.14 Synthesis of intermediate 112I6 (20.4 mg, 50.7 μmol, 1.1 equiv.) was dissolved in DMF and pre-activated for 1 min by the addition of benzotriazol-1-yloxy(tripyrrolidin-1-yl)phosphanium;hexafluorophosphate (PyBOP, 36.7 mg, 70.5 μmol, 1.3 eq.) and DIPEA (28.3 μL, 162.7 μmol, 3 eq.). 111 (19 mg, 54.2 μmol, 1 eq.) was added to the pre-activation solution and incubated for 16 h at room temperature. The solvent was evaporated and the residue taken up in 500 μL TFA. After 1 h at room temperature, evaporation of TFA was followed by neutralization with 1 M NaOHaq. Subsequently, ester hydrolysis was performed for 3 h at room temperature with NaOH (540 μL 1 M NaOHaq, 540 μmol, 10 eq.) in 1 mL water:THF (1 :1). After neutralization with 1 M HCIaq, the solvent was evaporated under reduced pressure and the crude purified by RP-HPLC to give 112 as a white solid (5 mg, 17%).1 .3.15 Synthesis of intermediate 1132-(2,4-Dichlorophenyl)acetic acid (3 mg, 15 μmol, 1 eq.) was dissolved in DMF and pre-activated for 10 min by the addition of EDC (2.6 μL, 15 μmol, 1 eq.), HOBt (1.8 mg, 15 μmol, 1 eq.) and DIPEA (10.5 μL, 60 μmol, 4 eq.). 1-Tert-butyl 2-methyl (2R,4R)-4-amino-1,2-pyrrolidinedicarboxylate hydrochloride (4.2 mg, 15 μmol, 1 eq.) was added to the pre-activation solution and incubated for 4 h at room temperature. The solvent was evaporated and the residue taken up in 200 μL TFA. After 1 h at room temperature, TFA was evaporated under reduced pressure, the residue taken up in water and lyophilized to continue with the coupling to 4-oxo-4-[(5-sulfamoyl-1 ,3,4-thiadiazol-2-yl)amino]butanoic acid (4.65 mg, 16.6 μmol, 1.1 eq.) which was preactivated with PyBOP (10.2 mg, 19.6 μmol, 1.3 eq.) and DIPEA (7.9 μL, 45.3 μmol, 3 eq.) beforehand. After incubation for 16 h at room temperature, the solvent was evaporated. Subsequently, ester hydrolysis was performed for 3 h at room temperature with NaOH (150 μL 1 M NaOHaq, 150 μmol, 10 eq.) in 300 μL water:THF (1 :1). After neutralization with 1 M HCIaq, the solvent was evaporated under reduced pressure and the crude purified by RP-HPLC to give 113 as a white solid (2.3 mg, 26%).1 .3.16 Synthesis of intermediate 114(2R,4R)-1-(((9 / - / -fluoren-9-yl)methoxy)carbonyl)-4-azidopyrrolidine-2-carboxylic acid (25 mg, 66 μmol, 1 eq.) was dissolved in 10 mL methanol and 83 μL 4 M HCI in dioxane (330 μmol, 5 eq.). The solution was refluxed for 16 h to receive the crude after evaporating the solvent under reduced pressure. The residue was dissolved in DMF containing 20% piperidine. After stirring for 1 h, the solvent was evaporated. A pre- activation solution with I6 (22.6 mg, 66 μmol, 1 eq.), HATU (22.6 mg, 59 μmol, 0.9 eq.) and DIPEA (23 μL, 132 μmol, 2 eq.) was stirred for 10 min before adding to the dried intermediate. After 3 h at room temperature, the crude was purified by RP-HPLC to give 114 (21 .5 mg, 73%) as a white solid.1 .3.17 Synthesis of intermediate 115114 (5 mg, 10.1 μmol, 1 eq.) was taken up in tBuOH:water (1 :1) together with A / -(5-sulfamoyl-1,3,4- thiadiazol-2-yl)hex-5-ynamide (2.8 mg, 10.1 μmol, 1 eq.), CuSO4(H2O)5 (2 mg, 10.1 μmol, 1 eq.) and sodium ascorbate (2.5 mg, 10.1 μmol, 1 eq.). The reaction mixture was stirred for 16 h at 60 °C before evaporating the solvent. Subsequently, ester hydrolysis was performed for 3 h at room temperature with NaOH (100 μL 1 M NaOHaq, 100 μmol, 10 eq.) in 200 μL water:THF (1 :1). After neutralization with 1 M HCIaq, the solvent was evaporated under reduced pressure and the crude purified by RP-HPLC to give 115 as a white solid (5.3 mg, 80%).1 .3.18 Synthesis of intermediate 1162-(2,4-Dichlorophenyl)acetic acid (3 mg, 15 μmol, 1 eq.) was dissolved in DMF and pre-activated for 10 min by the addition of EDC (2.6 μL, 15 μmol, 1 eq.), HOBt (1.8 mg, 15 μmol, 1 eq.) and DIPEA (10.5 μL, 60 μmol, 4 eq.). 1-Tert-butyl 2-methyl (2R,4R)-4-amino-1,2-pyrrolidinedicarboxylate hydrochloride (4.2 mg,15 μmol, 1 eq.) was added to the pre-activation solution and incubated for 4 h at room temperature. The solvent was evaporated and the residue taken up in 200 μL TFA. After 1 h at room temperature, TFA was evaporated under reduced pressure, the residue taken up in water and lyophilized. In a separate flask, 5- amino-1 ,3,4-thiadiazole-2-sulfonamide (2.7 mg, 15 μmol, 1 eq.) was treated with 4-nitrophenyl carbonochloridate (3 mg, 15 μmol, 1 eq.) and DIPEA (5.3 μL, 30 μmol, 2 eq.) in dry ACN for 30 min at 0 °C. Then, the lyophilized crude was added and after incubation for 1 h at room temperature, the solvent was evaporated. Subsequently, ester hydrolysis was performed for 3 h at room temperature with NaOH (150 μL 1 M NaOHaq, 150 μmol, 10 eq.) in 300 μL water:THF (1:1). After neutralization with 1 M HCIaq, the solvent was evaporated under reduced pressure and the crude purified by RP-HPLC to give 116 as a white solid (1 .6 mg, 20%).1 .3.19 Synthesis of intermediates 117, 118, 119, 120 and 121117, 118, 119, 120 and 121 were synthesized by acid (I7, 112, 113, 115 or 116) pre-activation with EDC (1 eq.), HOBt (1 eq.) and DIPEA (3 eq.) in DMF for 15 min at room temperature, followed by addition of tert-butyl N6-(tert-butoxycarbonyl)-L-lysinate hydrochloride (1 eq.). After 20 h at room temperature, the solvent was evaporated and TFA added. Stirring for 1 h at room temperature was followed by TFA removal and the mixtures were purified by RP-HPLC, resulting in the products as white solids: I17 (0.25 mg, 89% yield), 118 (0.9 mg, 37% yield), I19 (1.4 mg, 57% yield) ), I20 (0.8 mg, 32% yield), I21 (1.15 mg, 58% yield).1 .3.20 Synthesis of compounds C19, C20, C21, C22 and C23C19, C20, C21, C22 and C23 were synthesized by mixing amines (117, 118, 119, 120 or 121) with FITC (0.8 eq.) and DIPEA (3.5 eq.) in DMF for 45 min at room temperature. The mixtures were purified by RP-HPLC, resulting in the products as yellow solids: C19 (0.19 mg, 60% yield), C20 (0.1 mg, 80% yield), C21 (0.08 mg, 52% yield), C22 (0.09 mg, 60% yield), C23 (0.07 mg, 55% yield).Example 2 - Affinity and selectivity measurements of compounds by fluorescence polarization2.1 General RemarksFluorescence polarization was measured in black 384-well microplates on a Tecan Spark® Multimode Microplate Reader (λExcitation= 485 ± 20 nm, λEmission= 535 ± 25 nm). In general, a dilution series of the protein in the respective buffer (typically 1 :1) was prepared to reach a volume of 5 μL per well. The fluorophore-conjugated compound was diluted in the protein buffer to reach a concentration of 20 nM, 10 nM (FIG. 35) or 2 nM (FIG. 34) to add 5 μL to each well. The plate was centrifuged (400 ref, 1 min) and incubated in the dark for 15 min previous to the measurements.2.2 Affinity measurementWe synthesized the fluoresceinated conjugates of four stereoisomers (compound C1, C3, C5 and C7) to measure the affinity against recombinantly expressed human CAIX via fluorescence polarization. We observed stereoselective binding of compound C7 (2R,4R; KD= 15 ± 2 nM), while no binding was detected for the other isomers (compound C1, C3 and C5, see FIG. 26, top).To analyze which parts of the molecule are important for the binding of CAIX, we performed a fragment screening and identified the sulfonamide bearing thiophene (compound C12) and the respective proline derivative (compound C14) as micromolar CAIX binders (KD= 1.0 ± 0.1 μM and 1.1 ± 0.2 μM).The 2-(2,4-dichlorophenyl)acetic acid proline derivative (compound C13) did not bind CAIX while the combination with the sulfonamide resulted in the highly potent CAIX ligand (compound C8) with a dissociation constant in the nanomolar range (KD= 6 ± 1 nM, see FIG. 26, bottom).2.3 Selectivity measurementCompound C7 and acetazolamide (AAZ*) were screened against human CAIX and CAIX isozymes (bovine CAI I, human CAIV, human CAXII and human CAXIV). Compound C7 was identified as highly selective CAIX ligand with low affinity to human CAXII (no fitting applicable) and no detectable binding to the other isozymes (see FIG. 27 and Table 6). In contrast, AAZ* tightly bound to all screened carbonic anhydrases with no distinct selectivity for CAIX (see FIG. 27 and Table 6).The selectivity was confirmed expanding the analysis to a set of other protein targets (see FIG. 31 and 32).Table 6. Dissociation constants (KD) of compound C7 and AAZ* for CAIX and respective isozymes. Each value is given as mean ± standard deviation (n = 3). h = human, b = bovine, N.D. = not detected.The selectivity was also confirmed by expanding the analysis to a set of further binders using the same fluorescent polarization fluorescent polarization (see FIG. 33 and Table 7), namely, to compounds C16, C17 and C18, wherein R is L6, i.e., a DNAZLNA(bodipy) multiplex. Exemplary DNA has a 74-mer sequence attached via 5’ C6 amino modification:5’ Modif.-GGAGCTTCTGAATTCTGTGTGCTGXXXXXXCGAGTCCCATGGCGCCGGATCGACGXXXXXXXGCGTCAGGCAGC, wherein each X may independently be any of A, C, T and G; and the LNA (bodipy) is a 3’-amino modified 8-mer LNA (5’ GGCTACTA-C6-amino 3’) which has been conjugated to BODIPY-TMR-X (Thermo Fisher Scientific, #D6117), wherein the DNA have been annealed to the complementary BODIPY-modified 8-mer LNA in a 1 :1 molar ratio by mixing 25 μL of 2 μM solutions each (in PBS), to subsequently heat the mixture to 70 °C for 5 min and let the solution passively cool down to room temperature for 30 min.Table 7. Dissociation constants (KD) of compounds C16, C17 and C18 for CAIX and isozyme CAII (h = human, b = bovine).The results suggest that similar affinity towards CAIX and selectivity over CAII is achieved across the scope of the present invention.Example 3 - Qualitative and quantitative biodistribution studies3.1 Cell cultureHuman renal cell carcinoma cell line SKRC-52 were grown in RPMI-1640 supplemented with 10% FBS and 1x antibiotic-antimycoticum at 37 °C, 5% CO2. Cell passaging was performed every second day, using Trypsin-EDTA 0.25% to detach the cells. Cells were used to grow tumors in mice.3.2 In vivo IVIS imaging for qualitative biodistribution analysisTo test if stereoselective CAIX binding could translate to stereoselective in vivo targeting of CAIX- expressing tumors we synthesized the respective IRDye conjugates (compound C2, C4, C6 and C10).Balb / c nude mice bearing subcutaneous SKRC-52 tumors (150 - 300 mm3) were injected intravenously with 3 nmol of each compound dissolved in 150 μL sterile PBS to acquire fluorescence images 4 h postinjection.Mice were anaesthetized with Attane™ isoflurane to acquire fluorescence images on an IVIS spectrum imaging system (Xenogen; 1 sec exposure; binning factor = 8; λExcitation=745 nm; λEmission=800 nm; f number 2; field of view 13.1). Images were taken 10 min, 1 h, 2 h, 4 h and 6 h post-injection.Only compound C10 (2R,4R) revealed accumulation in the tumor site (see FIG. 28).3.3 Quantitative biodistribution analysis with radiolabeled compound C11The CAIX ligand was synthesized as DOTAGA conjugate (compound C11) to allow radiolabeling with177Lu.Balb / c nude mice bearing subcutaneous SKRC-52 tumors (200 - 300 mm3) were injected intravenously with 3 nmol (0.85 MBq) [177Lu]Lu-C11. The mice were sacrificed 6 hours post-injection to isolate and measure radioactivity of the following organs: tumor, liver, kidneys, spleen, stomach, intestine, lungs, heart, tail, muscle and blood. Radioactivity was measured with a Packard Cobra Gamma Counter and plotted as % ID / g ± SEM (n = 4). The values were normalized to the normal radioactive decay of [177Lu]Lu-C11 (normalized to the batch used for injection).The radiolabeled compound was detected in the tumor and kidneys. Other healthy organs only revealed [177L u]Lu-C11 traces, highlighting the selectivity of the novel CAIX ligand (see FIG. 29).References[1] M. Aggarwal, C. D. Boone, B. Kondeti, R. McKenna, Structural annotation of human carbonic anhydrases, J. Enzyme Inhib. Med. Chem. 2013, 28, 267-277.[2] P. Swietach, A. Hulikova, R. D. Vaughan-Jones, A. L. Harris, New insights into the physiological role of carbonic anhydrase IX in tumour pH regulation, Oncogene 2010, 29, 6509-6521.[3] https: / / www.proteinatlas.org / ENSG00000107159-CA9, accessed on the 20th of August 2021.[4] C. T. Supuran, Carbonic anhydrases: novel therapeutic applications for inhibitors and activators, Nat. Rev. Drug Discov. 2008, 7, 168-181.[5] N. K. Tafreshi, M. C. Lloyd, M. M. Bui, R. J. Gillies, D. L. Morse, Carbonic anhydrase IX as an imaging and therapeutic target for tumors and metastases, Subcell. Biochem. 2014, 75, 221-254.[6] G. M. Thurber, M. M. Schmidt, K. D. Wittrup, Antibody tumor penetration: transport opposed by systemic and antigen-mediated clearance, Advanced drug delivery reviews 2008, 60, 1421-1434.[7] S. Cazzamalli, A. Dal Corso, F. Widmayer, D. Neri, Chemically Defined Antibody- and Small Molecule-Drug Conjugates for in Vivo Tumor Targeting Applications: A Comparative Analysis, J. Am. Chem. Soc. 2018, 140, 1617-1621.[8] S. Parkkila, H. Rajaniemi, A.-K. Parkkila, J. Kivela, A. Waheed, S. Pastorekova, J. Pastorek, W. S. Sly, Carbonic anhydrase inhibitor suppresses invasion of renal cancer cells in vitro, Proc. Natl. Acad. Sci. U. S. A. 2000, 97, 2220.[9] C. T. Supuran, F. Briganti, S. Tilli, W. R. Chegwidden, A. Scozzafava, Carbonic anhydrase inhibitors: Sulfonamides as antitumor agents?, Bioorg. Med. Chem. 2001, 9, 703-714.

[0010] O. C. Kulterer, S. Pfaff, W. Wadsak, N. Garstka, M. Remzi, C. Vraka, L. Nies, M. Mitterhauser, F. Bootz, S. Cazzamalli, eta!., A Microdosing Study with 99mTc-PHC-102 forthe SPECT / CT Imaging of Primary and Metastatic Lesions in Renal Cell Carcinoma Patients, J. Nucl. Med. 2021, 62, 360.

[0011] S. Cazzamalli, A. Dal Corso, D. Neri, Acetazolamide Serves as Selective Delivery Vehicle for Dipeptide-Linked Drugs to Renal Cell Carcinoma, Mol. Cancer Ther. 2016, 15, 2926-2935.

[0012] S. Cazzamalli, A. D. Corso, D. Neri, Linker stability influences the anti-tumor activity of acetazolamide-drug conjugates for the therapy of renal cell carcinoma, J Control Release 2017, 246, 39-45.

[0013] S. Cazzamalli, E. Figueras, L. Petho, A. Borbely, C. Steinkuhler, D. Neri, N. Sewald, In Vivo Antitumor Activity of a Novel Acetazolamide-Cryptophycin Conjugate for the Treatment of Renal Cell Carcinomas, ACS Omega 2018, 3, 14726-14731.

[0014] S. Cazzamalli, B. Ziffels, F. Widmayer, P. Murer, G. Pellegrini, F. Pretto, S. Wulhfard, D. Neri, Enhanced Therapeutic Activity of Non-Internalizing Small Molecule-Drug Conjugates Targeting Carbonic Anhydrase IX in Combination With Targeted lnterleukin-2, Clin. Cancer Res. 2018, 24, 3656-3667.

[0015] M. Ferraroni, B. Cornelio, J. Sapi, C. T. Supuran, A. Scozzafava, Sulfonamide carbonic anhydrase inhibitors: Zinc coordination and tail effects influence inhibitory efficacy and selectivity for different isoforms, Inorg. Chim. Acta 2018, 470, 128-132.

Claims

CLAIMS1. A compound, its individual diastereoisomers, its hydrates, its solvates, its crystal forms, its individual tautomers or a pharmaceutically acceptable salt thereof, wherein the compound structure comprises at least one group A independently represented by the following structure: wherein:R1is represented by -C(Y)-R1 a-SO2NR(R’), or -(G1)q-(CR(R’))r(G2)s-R1 a-SO2NR(R’);R1 ais independently a 6- to 10-membered aromatic group or a 5- to 10-membered heteroaromatic group having up to 3 heteroatoms independently selected from N, O and S, and wherein R1 ais substituted, in addition to SO2NR(R’), by one or more substituents R3, wherein:G1 is independently selected from C(Y), SO, SO2CR(R'), triazolyl, and CR(R')triazolyl;G2is independently selected from C(Y), C(Y)NR, SONR, SO2NR, CR(R')NR, NRC(Y), NRSO, NR SO2, NRCR(R'), triazolyl, triazolyl-NR, triazolyl-CR(R'), NR-triazolyl, and CR(R')-triazolyl; each of q and s is independently selected from 0 and 1 ; r is independently selected from 0, 1 , 2, 3 and 4, preferably 2; with the proviso that at least one of q and s is 1 ; with the proviso that q + r + s ≥ 1 ;R2is represented by R2a-(CR(R’))p-C(Y)-, or R2and the group RN- form together a residue represented by R2a-(G4)v-(CR(R’))u-(G3)t-;R2ais a 6- to 10-membered aromatic group or a 5- to 10-membered heteroaromatic group having up to 5, preferably up to 3, heteroatoms independently selected from N, O and S and optionally substituted by C1 -4alkyl, wherein R2ais optionally substituted with one or more substituents R4, wherein:G3is independently selected from C(Y)NR, SONR, SO2NR, CR(R')NR, triazolyl, triazolylCR(R'), and CR(R')triazolyl;G4is independently selected from C(Y), NRC(Y), NRSO, NRSO2, NRCR(R'), C(Y)NR, SONR, SO2NR, CR(R')NR, triazolyl, NRtriazolyl, triazolylNR, CR(R')triazolyl, and triazolyl CR(R'),each of t and v is independently 0 or 1 ; u is independently selected from 0, 1 , 2, 3 and 4, preferably 3 preferably with the proviso that at least one of t and v is 1 , more preferably both t and v are 1 ; preferably with the proviso that t + u + v ≥ 1 , more preferably ≥ 2, most preferably ≥ 3; and p is independently 1 , 2, 3 or 4, preferably 1 or 2, more preferably 1 ; wherein one or more occurrence of CR(R’) may be optionally replaced by a group independently selected from O, S and NR, with the proviso that no two O atoms are adjacent to each other; each occurrence of Y is independently selected from O, S, NR and CR(R’); each R3and R4is independently selected from: NH2, OH, COOH, COOR, C1- 6alkyl, C1- 6haloalkyl, O(C1- 6alkyl), O(C1- 6haloalkyl), O(C2-6alkenyl), C1- 6heteroalkyl, NO2, C(O)NH2, C(O)NR(R’), CN, oxo and halogen, wherein R3and R4each independently may optionally form together with any CR(R’) a 4- to 7- membered carbocyclic or heterocyclic ring; and each occurrence of R and R’ is independently H or selected from C1- 6-alkyl, O( C1- 6alkyl), C3-10cycloalkyl, O(C3-10cycloalkyl), S(C3-10cycloalkyl), C2-6alkenyl, C2-6alkynyl, C1- 6heteroalkenyl, C1- 6heteroal kynyl, C3-10cycloalkenyl, C1 -10cycloheteroalkenyl, C6-10aryl, C1-10 heteroaryl, (C6-10aryl)C1- 6alkyl and (C1- 10heteroaryl)C1- 6alkyl, each of which can be optionally substituted with from 1 to 3 substituents selected from C1- 6-alkyl, OH, oxo and halogen; wherein the term “diastereoisomers”, unless specified otherwise, refers to stereoisomers of a compound having different configurations at one or more stereocenters in parts of the molecule other than moiety A, such that the the stereochemical configuration of moiety A is as represented in the respective structure, and the individual diastereomers differ in their stereochemical configuration in the in parts of the molecule other than moiety A.

2. The compound of claim 1, wherein:R1ais independently a 5-membered heteroaromatic group having up to 3 heteroatoms independently selected from N, O and S, and wherein the heteroaromatic group is substituted, in addition to SO2NR(R’), by 1 or 2 substituents R3;R2ais a 6- to 10-membered aromatic group substituted by 0, 1 , 2 or 3 substituents R4; p is 1 ; each occurrence of Y is O; and each R3and R4is independently selected from OCH3, OCH2CH3, OCH2CH2CH3,OCH2(CH3)2, O-cyclopropyl, OCF3, OCF2CF3, COOH, COOCH3, NO2, CN, F; Cl; Br; and I.

3. The compound of any of the preceding claims, wherein A is represented by any of the following structures: wherein:c is independently 1 or 2, preferably 1 ; d is independently 0, 1 , 2, 3, 4 or 5, preferably 2;W is independently selected from NR, O, S, S(O) and SO2.

4. The compound of any of the preceding claims, wherein A is represented by any of the following structures:wherein each of W1- W3, W4is independently selected from CH, S, O, and N, wherein at least one is S or O.

5. The compound of any of the preceding claims, wherein A is represented by any of the following structures:wherein W is independently selected from S and O;W1is S or O; and each of W3, W4is independently selected from CH, S, O, and N.

6. The compound of any of the preceding claims, wherein A is represented by any of the following structure A-1 to A-5:The compound of any one of the preceding claims, wherein the compound is represented by the following Formula I, la, or lb,wherein each A is independently defined as in any one of the preceding claims;B is a single bond or an optionally substituted C1- 50aliphatic group, in which optionally one or more carbon atoms can be replaced by heteroatom, a C3-12carbocyclic or a C1- 12heterocyclic group, and which can be saturated or optionally contain one or more double or triple bonds; and each C is an atom, a molecule or a particle, and / or is a therapeutic or diagnostic agent.

8. The compound of claim 7, wherein B is a single bond or is represented by any of the following general Formulae II— V, lla-Va or Ilb-Vb:wherein each x is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; each y is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; each z is 0, 1 , 2, 3 or 4, preferably 1 ; with the proviso that in Formulae lla-Va and lib— Vb, z and at least one of x and y is not 0;* represents a point of attachment to a moiety A;• represents a point of attachment to a moiety C; and each of BSand BL is independently selected from alkylene, cycloalkylene, arylalkylene, heteroarylalkylene, heteroalkylene, heterocycloalkylene, alkenylene, cycloalkenylene, arylalkenylene, heteroarylalkenylene, heteroalkenylene, heterocycloalenkylene, alkynylene, heteroalkynylene, arylene, heteroarylene, aminoacyl, oxyalkylene, aminoalkylene, diacid ester, dialkylsiloxane, amide, thioamide, thioether, thioester, ester, carbamate, hydrazone, thiazolidine, methylene alkoxy carbamate, disulfide, vinylene, imine, imidamide, phosphoramide, saccharide, phosphate ester, phosphoramide, carbamate, dipeptide, tripeptide, tetrapeptide, each of which is optionally substituted. The compound of any one of claims 7 and 8, wherein B is represented by (Bs)xwherein:each x is selected f r om 0, 1, 2, 3, 4, 5, 6,7 , 8, 9 an d 1 0; each BSis independently selected from the group consisting of alkylene, cycloalkylene, arylalkylene, heteroarylalkylene, heteroalkylene, heterocycloalkylene, alkenylene, cycloalkenylene, arylalkenylene, heteroarylalkenylene, heteroalkenylene, heterocycloalenkylene, alkynylene, heteroalkynylene, arylene, heteroarylene, aminoacyl, oxyalkylene, aminoalkylene, diacid ester, dialkylsiloxane, amide, thioamide, thioether, thioester, ester, carbamate, hydrazone, thiazolidlne, methylene alkoxy carbamate, disulfide, vinylene, imine, imidamide, phosphoramide, saccharide, phosphate ester, phosphoramide, carbamate, dipeptide, tripeptide and tetrapeptide. The compound according to any one of claims 7-9, wherein the moiety C is a chelating agent group suitable for radiolabeling; a radioactive group comprising a radioisotope; a chelate of a radioactive isotope with a chelating agent; a fluorophore group; a cytotoxic and / or cytostatic agent; immunomodulator agent; or a protein. The compound according to claim 10, wherein:(a) the chelating agent group suitable for radiolabeling is selected from sulfur colloid, diethylenetriaminepentaacetic acid (DTPA), ethylenediaminetetraacetic acid (EDTA), 1 ,4,7,10- tetraazacyclododecane-N,N',N",N",-tetraacetic acid (DOTA), 1 ,4,7-triazacyclononane-N,N',N"- triacetic acid (NOTA), 1 ,4,8,11-tetraazacyclotetradecane-N,N',N",N",-tetraacetic acid (TETA), iminodiacetic acid, bis(carboxymethylimidazole)glycine, 6-Hydrazinopyridine-3-carboxylic acid; or has a structure according to the following formula:wherein: n is 0, 1 , 2, 3, 4 or 5; preferably 1 ;R1eis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH;R2eis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH; each R3eis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH; R4eis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH; and X is O, NH or S; preferably O; or has a structure according to the following formula:156 wherein: n is 0, 1 , 2, 3, 4 or 5; preferably 1 is independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOK;R2fis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH;R3fis independently H, COOH, aryl-COOH or heteroaryl-COOH; preferably COOH; and X is O, NH or S; preferably O;(b) the radioactive group comprising a radioisotope is selected from(c) the chelate of a radioactive isotope is a chelate of an isotope listed under (b) above and / or with a chelating agent listed under (a) above; or(d) the fluorophore group is selected from a xanthene dye, acridine dye, oxazine dye, cyanine dye, styryl dye, coumarine dye, porphine dye, fluorescent metal-ligand-complex, fluorescent protein, nanocrystals, perylene dye, boron-dipyrromethene dye and phtalocyanine dye(e) the cytotoxic and / or cytostatic agent is selected from chemotherapeutic agent selected from the group consisting of topoisomerase inhibitors, alkylating agents, antimetabolites, antibiotics, mitotic disrupters, DMA intercalating agents, DNA synthesis inhibitors, DNA-RNA transcription regulator, enzyme inhibitors, gene regulators, hormone response modifiers, hypoxia- selective cytotoxins, epidermal growth factor inhibitors, anti-vascular agents and a combination of two or more thereof,(f) the immunomodulator agent is selected from molecules known to be able to modulate the immune system, such as ligands of CD3, CD25, TLRs, STING, 4-1 BBL, 4-1 BB, PD-1 , mTor, PDL- 1 , NKG-2D IMiDs, wherein ligands can be agonists and / or antagonist; or(g) the protein is selected from cytokines, such as IL2, IL10, IL12, IL15, TNF, Interferon Gamma, or is an antibody.

12. The compound according to any one of claims 7-11 , each -B-C is independently represented by any one of the following structures:wherein each of AA3, AA4, AA5, AA6, AA7, and AA8represents a proteinogenic or non- proteinogenic amino acid, or is absent; each BSis independently selected from the group consisting of alkylene, cycloalkylene, arylalkylene, heteroarylalkylene, heteroalkylene, heterocycloalkylene, alkenylene, cycloalkenylene, arylalkenylene, heteroarylalkenylene, heteroalkenylene, heterocycloalenkylene,alkynylene, heteroalkynylene, arylene, heteroarylene, aminoacyl, oxyalkylene, aminoalkylene, diacid ester, dialkylsiloxane, amide, thioamide, thioether, thioester, ester, carbamate, hydrazone, thiazolidine, methylene alkoxy carbamate, disulfide, vinylene, imine, imidamide, phosphoramide, saccharide, phosphate ester, phosphoramide, carbamate, dipeptide, tripeptide and tetrapeptide; each n is independently 0, 1 , 2, 3, 4, 5, 6, 7, or 8; each m is independently 0, 1 , 2, 3, or 4; each x is selected from 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9 and 10; each Rc, Rd, and Reis independently selected from H, optionally substituted C1- 6alkyl, (C3-C10carbocyclyl)C1- 6alkyl, (C6-C10aryl)C1- 6alkyl, (C1-C10heterocyclyl)C1- 6alkyl, C2-6alkenyl,C2-6alkynyl, and C6-C10aryl, in each of which optionally one or more of the carbon atoms can be replaced by heteroatoms; preferably selected from side-chain residues of proteinogenic or a non-proteinogenic amino acids; each occurrence of R and R’ is independently H or selected from C1- 6-alkyl, O(C1- 6alkyl), S(C1- 6-alkyl), C3-10cycloalkyl, O(C3-10cycloalkyl), S(C3-10cycloalkyl), C2-6alkenyl, C2-6alkynyl, C1- 6heteroalkenyl, C1- 6heteroal kynyl, C3-10cycloalkenyl, C1 -10cycloheteroalkenyl, C6-10aryl, C1- 10heteroaryl, (C6-10aryl)C1- 6alkyl and (C1- 10heteroaryl)C1- 6alkyl, each of which can be optionally substituted with from 1 to 3 substituents selected from C1- 6-alkyl, OH, oxo and halogen.

13. The compound according to any one of the claims 7-12, wherein:(a) A-B is represented by a structure selected from:(b) C is represented by a structure selected from:wherein the combination of A-B and C is preferably selected such that the covalent bond — connecting B with C is represented by S— S, S— C, C— S, C(O)— Ra, C(O)— N, C(O)— O, C(O)— N, N— C(O), N— C(O)O, N— C(S) or OC(O)— N.

14. The compound according to any one of claims 7-13, wherein -B-C is represented by any one of the following structures:

15. The compound of any of the preceding claims, wherein moiety A is selected from A-1 to A-5, as defined in the description.

16. The compound of an of the preceding claims, wherein moiety B is selected from B-1 to B-21, as defined in the description.

17. The compound of an of the preceding claims, wherein moiety C is selected from C-1 to C-31, as defined in the description.

18. A compound having a structure selected from those listed in Table 1, Table 3.1 and / or Table 3.2, its individual diastereoisomers, its hydrates, its solvates, its crystal forms, its individual tautomers or a pharmaceutically acceptable salt thereof, wherein the term “diastereoisomers”, unless specified otherwise, refers to stereoisomers of a compound having different configurations at one or more stereocenters in parts of the molecule other than moiety A, such that the the stereochemical configuration of moiety A is as represented in the respective structure, and the individual diastereomers differ in their stereochemical configuration in the in parts of the molecule other than moiety A.

19. A pharmaceutical composition comprising the compound according to any one of the preceding claims, and a pharmaceutically acceptable excipient.

20. The compound or the pharmaceutical composition according to any one of the preceding claimsfor use in:(a) a method for treatment of the human or animal body by surgery or therapy or a diagnostic method practiced on the human or animal body; or(b) a method for therapy or prophylaxis of a subject suffering from or having risk for a disease or disorder; or(c) a method for guided surgery practiced on a subject suffering from or having risk for a disease or disorder; or(d) a method for diagnosis of a disease or disorder, the method being practiced on the human or animal body and involving a nuclear medicine imaging technique, such as Positron Emission Tomography (PET) or Single Photon Emission Computed Tomography (SPECT); or(e) a method for targeted delivery of a therapeutic or diagnostic agent to a subject suffering from or having risk for a disease or disorder, 21. The compound or the pharmaceutical composition for use according to claim 20, wherein the disease or disorder is independently selected from hypoxia-related diseases such as cancer, preferably wherein the cancer is selected from the group consisting of breast cancer, pancreatic cancer, colon cancer, multi-drug resistant colon cancer, rectal cancer, colorectal cancer, metastatic colorectal cancer, lung cancer, non-small cell lung cancer, head and neck cancer, ovarian cancer, hypopharynx cancer, nasopharynx cancer, larynx cancer, bladder cancer, cholangiocarcinoma, clear cell renal carcinoma, glioma, astrocytoma, cervix cancer and kidney cancer.