Method for differentiating asfv infected from asfv vaccinated animals

EP4616196A1Pending Publication Date: 2025-09-17GOLD STANDARD DIAGNOSTICS MADRID SA +4
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023809586
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-11-22
Filing Date
2023-11-21
Publication Date
2025-09-17

AI Technical Summary

Technical Problem

Current methods lack an effective way to differentiate between African Swine Fever virus (ASFV) infected animals and those vaccinated with attenuated ASFV strains, which is crucial for disease control and international trade, as no vaccine is available for ASFV and existing vaccines do not provide a clear distinction between infected and vaccinated animals.

Method used

A DIVA (Differentiating Infected from Vaccinated Animals) method using an immunogenic composition with inactivated EP153R and EP402R genes, where these genes are replaced by a heterologous gene, allowing for the detection of specific markers to distinguish between infected and vaccinated animals through the presence of antibodies or gene fragments.

Benefits of technology

Enables accurate differentiation between ASFV infected and vaccinated animals, facilitating effective disease control and international trade by ensuring that vaccinated animals do not transmit the virus, thereby protecting susceptible populations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000025_0001
    Figure IMGF000025_0001
  • Figure IMGF000025_0002
    Figure IMGF000025_0002
  • Figure 00000041_0000
    Figure 00000041_0000
Patent Text Reader

Abstract

The present invention relates to an in vitro diagnostic method to differentiate African Swine Fever Virus (ASFV) infected animals from animals which have been vaccinated against ASFV using an immunogenic composition comprising an attenuated ASFV in which the EP153R gene and the EP402R gene have been inactivated and wherein the region of the ASFV genome comprising the EP402R and the EP153R genes is replaced by a heterologous gene.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHOD FOR DIFFERENTIATING ASFV INFECTED FROM ASFV VACCINATED ANIMALS

[0002] TECHNICAL FIELD OF THE INVENTION

[0003] The present invention relates to a method for the differentiation of African Swine Fever virus infected animals and African Swine Fever attenuated virus vaccinated animals.

[0004] BACKGROUND OF THE INVENTION

[0005] African swine fever is a devastating haemorrhagic disease affecting porcine species caused by a large double-stranded DNA virus, African swine fever virus (ASFV). ASFV is the only member of the Asfarviridae family and replicates predominantly in the cytoplasm of cells. Virulent strains of ASFV can kill domestic pigs within about 5-14 days of infection with a mortality rate approaching 100%.

[0006] ASFV can infect and replicate in warthogs (Phacochoerus sp.), bushpigs (Potamocherus sp.) and soft ticks of the Ornithodoros species (which are thought to be a vector), but in these species few if any clinical signs are observed and long term persistent infections can be established. ASFV was first described after European settlers brought pigs into areas endemic with ASFV and, as such, is an example of an “emerging infection”. The disease is currently endemic in many sub-Saharan countries, and in several European and Southeast Asian regions. Vaccination is considered the most efficient strategy and solution for disease control. However no vaccine is available for ASF so far. In the past, some countries reached eradication by using several strategies that included widespread culling and improvements of biosecurity in farms.

[0007] Despite this ASFV has seen a resurgence in the last few decades, most significantly in Georgia where in 2007 it spread from the Back Sea port of Poti to the Caucasus region into the Russian Federation and Eastern Europe, and as far west as Belgium and east the People’s Republic of China, spreading quickly to Southeast Asia and the Pacific. Several reappearances have been reported in China, the RF, Moldova, and Ukraine, and North Macedonia, Thailand and Italy main land as recently as January 2022. These recent events highlight an extremely disconcerting pattern of continuous spread of ASFV.

[0008] Pork meat is one of the primary sources of animal proteins, accounting for more than 35% of the global meat intake. Hence, this disease poses a serious problem for food security worldwide. This disease is also a concern for biodiversity and the balance of ecosystems, as it affects not only domestic farmed pigs, but also wild boars, including native breeds.

[0009] Several of the vaccines being developed are based on genetically modified attenuated ASFV viruses, which generally are obtained due to mutations in genes which affect the virus virulence. Nowadays the use of marker vaccines are mandatory. The use of such vaccines allow, after being administered to the population, to discriminate between infected and vaccinated animals, so that the strategic use of this type of vaccine, combined with a discriminatory test (where the marker detection is key) allow not only to protect to the population susceptible to infection but also to distinguish the vaccinated from the infected in a simple way, what is of great importance in terms of control eradication programmes as well as for international commercial trade..

[0010] Accordingly, for African swine fever there is a need for methods which allow Differentiating between Infected and Vaccinated Animals, the DIVA method.

[0011] SUMMARY OF THE INVENTION

[0012] The inventors have developed a DIVA method to determine if animals have been vaccinated with an attenuated strain of ASFV wherein the genes EP153R and EP402R have been inactivated.

[0013] Therefore, a first aspect of the present invention relates to in vitro diagnostic method to differentiate African Swine Fever Virus (ASFV) infected animals from animals which have been vaccinated against ASFV using an immunogenic composition comprising an attenuated ASFV in which the EP153R gene and the EP402R gene have been inactivated and wherein the region of the ASFV genome comprising the EP402R and the EP153R genes is replaced by a heterologous gene, the method comprising:

[0014] (i) testing a sample from said animal for the presence of a first marker and of second marker, wherein the first marker is selected from the group consisting: an antibody against an ASFV-specific antigen which is not the EP402R gene product or the EP153R gene product and an ASFV gene or fragment thereof which is not the EP402R gene or the EP153R gene, and wherein the second marker is a “first ASFV vaccine marker” and / or a “second ASFV vaccine marker” wherein the first ASFV vaccine marker is selected from the group consisting of an antibody against the EP402R gene product or against the EP153R gene product and the EP402R gene or a fragment thereof or the EP153R gene or a fragment thereof and wherein the second ASFV vaccine marker is selected from the group consisting of: an antibody specific for the heterologous gene product or the heterologous gene or a fragment thereof and and

[0015] (ii) identifying the animal as a) having been vaccinated if the at least one first marker and the second ASFV vaccine marker are detected or b) having been infected if the least one first marker is detected and, optionally, the first ASFV vaccine marker is detected or the second ASFV vaccine marker is not detected.

[0016] Another aspect of the present invention relates to kit comprising

[0017] (i) reagents suitable for the detection of a first marker, wherein the first marker is selected from the group consisting: an antibody against an ASFV-specific antigen which is not the EP402R gene product or the EP153R gene product and an ASFV gene or fragment thereof which is not the EP402R gene or the EP153R gene and

[0018] (ii) reagents suitable for the detection of a second marker, wherein the second marker is a “first ASFV vaccine marker” and / or a “second ASFV vaccine marker” wherein the first ASFV vaccine marker is selected from the group consisting of an antibody against the EP402R gene product or against the EP153R gene product and the EP402R gene or a fragment thereof or the EP153R gene or a fragment thereof and wherein the second ASFV vaccine marker is selected from the group consisting of: an antibody specific for an heterologous gene product or an heterologous gene or a fragment thereof.

[0019] Yet another aspect relates to the use of a kit according to the invention in an in vitro diagnostic method to differentiate African Swine Fever Virus (ASFV) infected animals from animals which have been vaccinated against ASFV using an immunogenic composition comprising an attenuated ASFV in which the EP153R gene and the EP402R gene have been inactivated and wherein the region of the ASFV genome comprising the EP402R and the EP153R genes is replaced by a heterologous gene.

[0020] BRIEF DESCRIPTION OF THE FIGURES

[0021] Figure 1. Analysis of the EP153R protein expression. A) Purified protein analyzed by SDS-PAGE-Silver staining, and B) western blot using an anti-mouse Fc monoclonal antibody conjugated to peroxidase.

[0022] Figure 2. Analysis of the eGFP protein expression. A) Purified protein analyzed by SDS- PAGE-Coomassie staining, and B) western blot using an anti-histidine monoclonal antibody and revealed with anti-mouse conjugated to alkaline phosphatase. Figure 3. Analysis of the immunogenicity of pEP153R; pEP153R and a no-related antigen expressed in the same conditions as pEP153R (“negative antigen”) were used as the coating antigens. The indirect ELISA was developed with two positive sera, and two negative sera, dpi: days post-infection.

[0023] Figure 4. Analysis of the immunogenicity of eGFP: eGFP and a no-related antigen expressed in the same conditions (“negative antigen”) were used as the coating antigens. The indirect ELISA was developed with two positive sera (16- and 35- dpi) and four negative sera (0 dpi and field sera), dpi: days post-infection.

[0024] Figure 5. Analysis of the potential of pEP153R and eGFP as DIVA antigens in domestic pigs (DP). Indirect ELISA against pEP153R, eGFP and p72 (INgezim® PPA Compac). A. Antibody response of DP C17 inoculated with the parental virus. B. Antibody response of DP C7 vaccinated with Lv17 / WB / Rie1AEP153RAEP402R. pEP153R cut-off: 0.3; eGFP cut-off: 0.6; INgezim® PPA Compac cut-off: 50 %. The arrow indicates the time of the challenge (Arm07).

[0025] Figure 6. Analysis of the potential of pEP153R and eGFP as DIVA antigens in wild boar (WB). Indirect ELISA against pEP153R, eGFP and p72 (INgezim® PPA Compac). A. Antibody response of WB RA1 inoculated with the parental virus. B. Antibody response of WB MU4 vaccinated with Lv17 / WB / Rie1AEP153RAEP402R. pEP153R cut-off: 0.3; eGFP cut-off: 0.6; INgezim® PPA Compac cut-off: 50 %. Red arrow indicates the time of the challenge (Arm07).

[0026] Figure 7. Indirect ELISA to study the antibody response against pEP153R in time. The assay was developed with sera from two animals: PW13 and PW14. INgezim® PPA Compac cut-off: 50 %; pEP153R cut-off: 0.3.

[0027] Figure 8. Immunogenicity of the mCherry protein (expressed in baculovirus system) by indirect ELISA. The graph illustrates the mean and standard deviation (error bars) of optical density (OD) values of two duplicates for each serum sample.

[0028] DETAILED DESCRIPTION OF THE INVENTION

[0029] The inventors have designed a DIVA (Differentiating Infected from Vaccinated Animals) test based on the detection in the animal of the presence or absence of field ASFV-specific antigens and / or genes and the presence or absence of the genetically modified live attenuated vaccine (LAV) ASFV-specific antigens and / or genes.

[0030] DIVA method and kit thereof

[0031] Therefore, a first aspect of the present invention relates to in vitro diagnostic method to differentiate African Swine Fever Virus (ASFV) infected animals from animals which have been vaccinated against ASFV, from here onwards the method of the invention, using an immunogenic composition comprising an attenuated ASFV in which the EP153R gene and the EP402R gene have been inactivated and wherein the region of the ASFV genome comprising the EP402R and the EP153R genes is replaced by a heterologous gene, the method comprising:

[0032] (i) testing a sample from said animal for the presence of a first marker and of a second marker, wherein the first marker is selected from the group consisting: an antibody against an ASFV-specific antigen which is not the EP402R gene product or the EP153R gene product and an ASFV gene or fragment thereof which is not the EP402R gene or the EP153R gene, and wherein the second marker is a “first ASFV vaccine marker” and / or a “second ASFV vaccine marker” wherein the first ASFV vaccine marker is selected from the group consisting of an antibody against the EP402R gene product or against the EP153R gene product and the EP402R gene or a fragment thereof or the EP153R gene or a fragment thereof and wherein the second ASFV vaccine marker is selected from the group consisting of: an antibody specific for the heterologous gene product or the heterologous gene or a fragment thereof and and

[0033] (ii) identifying the animal as a) having been vaccinated if the at least one first marker and the second ASFV vaccine marker are detected or b) having been infected if the least one first marker is detected and, optionally, the first ASFV vaccine marker is detected or the second ASFV vaccine marker is not detected.

[0034] The term “in vitro" as used herein refers to a biological processes or reactions that are conducted using components of an organism that have been isolated from their usual biological context in order to permit a more detailed or more convenient analysis than can be done with whole organisms, in an artificial environment, i.e. a laboratory.

[0035] The term “African swine fever virus” of its acronym “ASFV” as used herein refers to the causative agent of African swine fever (ASF). ASFV is a large, icosahedral, double-stranded DNA virus with a linear genome containing at least 150 genes. The number of genes differs slightly between different isolates of the virus. ASFV has similarities to the other large DNA viruses, e.g., poxvirus, iridovirus and mimivirus. In common with other viral haemorrhagic fevers, the main target cells for replication are those of monocyte, macrophage lineage. Based on sequence variation in the C-terminal region of the B646L gene encoding the major capsid protein p72, 24 ASFV genotypes (l-XXIV) have been identified. All ASFV p72 genotypes have been circulating in eastern and southern Africa. Genotype I has been circulating in western Africa and the island of Sardinia and in the past in Europe, South America, and the Caribbean. Genotype II is the responsible of the devastating panzootic situation started in Georgia in 2007 and affecting since then Europe, Asia (starting in China in 2018), and more recently Americas (2021 , Haiti and Dominican Republic) and Oceania (2022, Papua Nueva Guinea), while also produces outbreaks in East Africa. Genotype VIII is confined to four East African countries. In a particular embodiment of the method of the invention the ASFV is a genotype II ASFV.

[0036] The term “animal” as used herein refers to a mammal, preferably a swine or a wild board. In a particular embodiment of the method of the invention the animal is a swine or a wild boar. The term “swine” as used herein refers to a pig (Sus domesticus), also called hog, or domestic pig when distinguishing from other members of the genus Sus. Swine is an omnivorous, domesticated, even-toed, hoofed mammal.

[0037] The term “wild boar” as used herein refers to the species Sus scrofa, also known as the wild swine, common wild pig, Eurasian wild pig, or simply wild pig. Wild boar is a suid native to much of Eurasia and North Africa, and has been introduced to the Americas and Oceania.

[0038] In the context of the present invention, the term “immunogenic composition" refers to a composition that can elicit a cellular and / or humoral immune response but does not necessarily confer full or partial immune protection against African swine fever in mammals. For the avoidance of doubt, however, such immunogenic composition may confer full or partial protection against African swine fever in mammals and this is also preferred. In contrast, a “vaccine" in the context of the present invention does confer full or partial, but at least partial immune protection against African swine fever in mammals.

[0039] The terms "protection against African swine fever", "protective immunity", "functional immunity" and similar phrases as used herein refer to a response against African swine fever (virus) generated by administration of the recombinant ASFV of the invention, that results in fewer deleterious effects than would be expected in a non-immunized mammal that has been exposed to African swine fever (virus). That is, the severity of the deleterious effects of the ASFV infection is lessened in a vaccinated mammal. Infection may be reduced, slowed, or possibly fully prevented, in a vaccinated mammal. Herein, where complete prevention of infection is meant, it is specifically stated. If complete prevention is not stated, then the term includes partial prevention.

[0040] The term “attenuated” as used herein refers to a virus with compromised or abolished virulence in the intended recipient, e.g. the swine or wild boar. The goal of attenuated virus is to produce a virus that does not produce infection symptoms, or very light infection symptoms, as to when used as a vaccine it still is able to produce an immune response as to create immunogenic protection when the animal is infected with a wild type virus. The term “wildtype” indicates that the virus existed (at some point) in the field, and was isolated from a natural host, such as a domestic pig, tick or warthog.

[0041] The level of attenuation of a virus can be measured by the haemadsorption assay. The term “haemadsorption” as used herein refers to a phenomenon whereby cells infected with ASFV adsorb erythrocytes (red blood cells) on their surface. The degree of haemadsorption induced by an ASFV may be measured using a haemadsorption assay such as described in De Leon, P. et al. (2013, Virus Res. 173, 168-179). For example, cells may be transfected with a protein or infected with an ASFV, then red blood cells added and the degree of haemadsorption detected by imaging.

[0042] The attenuated ASFV referred to in the method of the invention has the EP153R gene and the EP402R genes inactivated.

[0043] The term “EP153R gene” as used herein refers to the ASFV gene, whose product down- regulates MHC-I expression by impairing the appropriate configuration or presentation into the plasma membrane of the latter (also known as Lectin-like protein EP153R). The EP153R protein (pEP153R) of ASFV is a type II transmembrane protein of 159 amino acids and multiple putative sites for posttranslational modifications: N-glycosylation, myristoylation and phosphorylation. The pEP153R is involved in hemadsorption of the virus and it is highly variable among genotypes. In a particular embodiment of the method of the invention the EP153R gene product has a sequence according to SEQ ID NO: 1. In another particular embodiment of the method of the invention the EP153R gene has a sequence according to SEQ ID NO: 2.

[0044] The term “EP402R gene” as used herein refers to the ASFV gene which encodes the CD2v protein, a glycoprotein with a relative molecular weight of about 105 kDa that is responsible for the haemadsorption phenotype of ASFV infected cells in vitro. This ASFV protein is the viral homolog (CD2v) of cellular T-lymphocyte surface adhesion receptor CD2 proteins. Based on sequence data and hydropathy profiles, ASFV CD2v protein resembles typical (CD2) class III transmembrane proteins. Generally, the full-length ASFV CD2v protein contains four different sections: (i) a hydrophobic leader at the N-terminal side of the protein, (ii) a hydrophilic, extracellular domain comprising a multitude of potential N-linked glycosylation sites, (iii) a hydrophobic stretch of amino acids that act as a transmembrane domain, and (iv) a C-terminal hydrophilic, cytoplasmic domain which contains a large number of typical, imperfect repeats of the hexa peptide (PPPKPC). In a particular embodiment of the method of the invention the EP402R gene product has a sequence according to SEQ ID NO: 3. In another particular embodiment of the method of the invention the EP402R gene has a sequence according to SEQ ID NO: 4. The term “inactivated” as used herein refers to a gene whose sequence or a sequence implicated in its expression or its regulation is modified as to not express a product or express a non-functional product. Gene inactivation can be accomplish by several methods well known to the skilled person in the art such as random mutagenesis by transposon insertion mutagenesis and UV irradiation, and targeted mutagenesis such as homologous recombination and CRISP / Cas9 technology (see Examples section). Both techniques allow for the inactivation of a gene by either inserting extra nucleotide sequence into the coding sequence of the gene or, on the contrary, by deleting fragments or the entirety of the gene. In both cases, the result may be a non-functional or non-existent transcription of the gene and therefore a lack of the gene product.

[0045] The inactivated genes of the ASFV strain of the method of the invention are replaced by a “heterologous gene”, the term referring to a gene which does not exist naturally in ASFV. Therefore, in a particular embodiment of the method of the invention the heterologous gene is a reporter gene.

[0046] The term “reporter gene” refers to a polynucleotide that encodes a molecule that can be detected readily, either directly or by its effect on the host cell (phenotype). Exemplary reporter genes encode enzymes, for example the ADE2 or ADE3 gene products, [beta]-galactosidase and LIRA3, luminescent or fluorescent proteins, such as Green Fluorescent Protein (GFP) and variants thereof, antigenic epitopes (for example Glu-tags), mRNA of distinct sequences, and the like.

[0047] In another particular embodiment of the method of the invention the heterologous gene is a fluorescence protein selected from a group consisting of: eGFP (enhanced-GFP), blue fluorescence protein (BFP), cyan fluorescence protein (CFP), yellow fluorescence protein (YFP), Venus, mOrange, dTomato, DsRed, Red fluorescence protein (RFP) and mCherry. In a more particular embodiment of the method of the invention the heterologous gene is eGFP.

[0048] Step (i)

[0049] The first step of the method of the invention relates to the testing a sample for the presence of genes or their products both derived from the ASFV as well as heterologous to ASFV.

[0050] The term “sample” as used herein refers to a small quantity of biological material isolated from an organism, preferably an animal, which is representative of the whole, i.e., whose characteristics are identical to the whole from which the sample is taken. In a particular embodiment of the method of the invention the sample is a biological fluid or a tissue sample. Methods for obtaining said samples are well known in the art and the skilled person in the field would be able to collect said samples without effort. The term “biological fluid” as used herein refers to any fluid that can be obtained from the animal, such as, blood, saliva, urine, milk, meat juice, feces, perspiration and chorionic fluid. In a particular embodiment of the method of the invention the biological fluid is selected from a group consisting of: urine, blood, plasma, serum, serum derivatives, bile, phlegm, saliva, sweat, amniotic fluid, milk, and cerebrospinal fluid (CSF). In a particular embodiment of the method of the invention, the sample is a product derived from blood. Examples of products derived from blood are serum, plasma, red blood cells, etc. In another particular embodiment the sample is serum or plasma.

[0051] The term “tissue sample” as used herein refers to any tissue sample that can be obtained from the animal, such as, without limitation, lung tissue, bone tissue, muscle tissue, cerebrum tissue and heart tissue. Tissue samples contain cells that are not disaggregated and appear in large clusters.

[0052] The term “marker” means a molecule that is associated quantitatively or qualitatively with the presence of a biological phenomenon. Examples of “markers” are proteins, metabolites, byproducts, whether related directly or indirectly to a mechanism underlying a condition.

[0053] Step (i) of the method of the invention relies on the detection of a first marker and a second marker.

[0054] The first marker of the method of the invention can be selected form a group consisting of an ASFV-specific antigen which is not the EP420R gene product or the EP153R gene product and an ASFV gene or fragment thereof which is not the EP402R gene or the EP153R gene.

[0055] The term “ASFV-specific antigen” as used herein refers to molecules or molecular structures, preferably proteins, which belong to the ASFV and can bind specifically to an antibody present in the host, which is infected by the ASFV. In a particular embodiment of the method of the invention, the ASFV-specific antigen which is not the EP402R gene product or the A238L gene product is a structural ASFV protein selected from pp220, pp62, p72, p54, p30 and CP312R.

[0056] The term “antibody”, as used herein, refers to a glycoprotein that exhibits specific binding activity for a particular protein, which is referred to as “antigen”. The term “antibody” comprises whole monoclonal antibodies or polyclonal antibodies, or fragments thereof, and includes human antibodies, humanised antibodies, chimeric antibodies and antibodies of a non-human origin. “Monoclonal antibodies” are homogenous, highly specific antibody populations directed against a single site or antigenic “determinant”. “Polyclonal antibodies” include heterogeneous antibody populations directed against different antigenic determinants.

[0057] As used herein, the antibodies suitable for the method of the invention encompass not only full length antibodies (e.g., IgG), but also antigen-binding fragments thereof, for example, Fab, Fab’, F(ab')2, Fv fragments, human antibodies, humanised antibodies, chimeric antibodies, antibodies of a non-human origin, recombinant antibodies, and polypeptides derived from immunoglobulins produced by means of genetic engineering techniques, for example, single chain Fv (scFv), diabodies, heavy chain or fragments thereof, light chain or fragment thereof, VH or dimers thereof, VL or dimers thereof, Fv fragments stabilized by means of disulfide bridges (dsFv), molecules with single chain variable region domains (Abs), minibodies, scFv-Fc, and fusion proteins comprising an antibody, or any other modified configuration of the immunoglobulin molecule that comprises an antigen recognition site of a desired specificity. An antibody fragment may refer to an antigen binding fragment. An antibody includes an antibody of any class, namely IgA, IgD, IgE, IgG (or sub-classes thereof), and IgM, and the antibody need not be of any particular class.

[0058] The term "gene" refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of an RNA, or a polypeptide or its precursor. A functional polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence as long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, etc.) of the polypeptide are retained. The term "fragment" when used in reference to a gene refers to fragments of that gene. The fragments may range in size from a few nucleotides to the entire gene sequence minus one nucleotide, as long as the sequence of said fragment allows the identification of the specific gene to which the fragment is referenced into.

[0059] In a particular embodiment of the method of the invention the antibody against an ASFV- specific antigen which is not the EP402R gene product or the EP153R gene product is an antibody against the p72, an antibody against the CP312R or an antibody against the p30 gene product or wherein the ASFV gene which is not the EP402R gene or the EP153R gene is the p72 gene, the CP312R gene or the p30 gene.

[0060] As used herein, the term “p72 gene” is interchangeable with the term “B646L gene”, since both of these terms are used to refer to the gene which encodes the p72 protein.

[0061] The second marker of step (i) of the method of the invention can be a “first ASFV vaccine marker” and / or a “second ASFV vaccine marker”.

[0062] The first vaccine marker is selected from a group consisting of an antibody against the EP402R gene product or against the EP153R gene product and the EP402R gene or a fragment thereof or the EP153R gene or a fragment thereof. In a particular embodiment of the method of the invention the first ASFV vaccine marker is an antibody against EP153R, an antibody against EP402R, the EP153R gene or a fragment thereof or the EP402R gene or fragment thereof.

[0063] In another particular embodiment of the method of the invention the antibody against EP153R is specific for the EP153R as defined in SEQ ID NO: 1 , wherein the EP153R gene is as defined in SEQ ID NO: 2, wherein the antibody against EP402R is specific for the EP402R as defined in SEQ ID NO: 3, wherein the EP402R gene is as defined in SEQ ID NO: 4.

[0064] The second ASFV vaccine marker is selected from the group consisting of an antibody specific for the heterologous gene product or the heterologous gene or a fragment therefor.

[0065] The method of the invention allows the combination of the different types of markers between the first and the second markers.

[0066] Therefore, in particular embodiment the first and the second marker are genes or gene fragments. The detection of genes is well established in the art and can be accomplished by several methods dealing with the detection of nucleotide sequences, mostly based on the polymerase chain reaction (PCR), such as Q-PCR, RT-PCR, sequencing, FISH, etc. In another particular embodiment of the method of the invention the detection of the first and second markers is carried out by a polymerase chain reaction (PCR), preferably a real time PCR.

[0067] The term "polymerase chain reaction (PCR)" as used herein refers to a biochemical technique used in molecular biology to amplify a single or several copies of a piece of DNA over several orders of magnitude, producing thousands to millions of copies of a specific DNA sequence. The protocol followed to carry out a PCR is widely known in the state of the art and commercial kits containing the materials necessary to carry out such amplification are currently available. Likewise, the conditions of temperature, time, reagent concentrations and number of PCR cycles will depend on the DNA polymerase used in the amplification reaction, the specificity of the primers, etc. The term “real time PCR” as used herein refers to a reaction which is basically a conventional PCR in which the amplification equipment (called thermal cyclers) incorporates a fluorescence detection system, the detection being based on the use of specific molecules. The fluorescence can be used to quantify the number of molecules being amplified or to quantify the level of amplification in relation to a reference curve (semi- quantitative). The quantification is performed by means of fluorescence measurements performed during a PCR cycle (whence the name “real time”). The fluorescence increases proportionally with the amount of PCR products. At the end of a run (which consists of several cycles), the quantification is effected in the exponential phase of PCR by means of obtained fluorescence signals. Only in the exponential phase of PCR (which takes a few cycles within a run), a correct quantification is possible, since optimum reaction conditions are prevailing during this phase. For detection, dyes such as ethidium bromide, SYBR Green I as well as FRET probes or so-called double-dye oligos (also referred to as TaqMan probes) may be used.

[0068] In another particular embodiment of the method of the invention, each PCR fragment is detected using a specific TaqMan probe. As used herein, the term "probe" refers to a nucleic acid which specifically binds to a molecule of interest. Probes are often associated with or capable of associating with a label. A label is a chemical moiety capable of detection. Typical labels comprise dyes, radioisotopes, luminescent and chemiluminescent moieties, fluorophores, enzymes, precipitating agents, amplification sequences, and the like. The specificity of hybridization is dependent on conditions such as the base pair composition of the nucleotides, and the temperature and salt concentration of the reaction. These conditions are readily discernable to one of ordinary skill in the art using routine experimentation.

[0069] As used herein, the term “TaqMan probe” refers to a modified oligonucleotide in which fluorescent materials (fluorophores) acting as a reporter and a quencher are attached to both ends. Specifically, FAM may be employed as the reporter and TAMRA may be employed as the quencher, without being limited thereto.

[0070] In a particular embodiment of the method of the invention the TaqMan probe comprises a fluorophore selected from the group consisting of:

[0071] - 3',6'-dihydroxy-1-oxospiro[2-benzofuran-3,9'-xanthene]-5-carboxylic acid (6-FAM);

[0072] - [2',4,4',5',7,7'-hexachloro-6-[6-[2-cyanoethoxy-[di(propan-2- yl)amino]phosphanyl]oxyhexylcarbamoyl]-6'-(2,2-dimethylpropanoyloxy)-3-oxospiro[2- benzofuran-1 ,9'-xanthene]-3'-yl] 2,2-dimethylpropanoate (HEX);

[0073] 4',5'-dichloro-2',7'-dimethoxy-6-carboxyfluorescein (JOE);

[0074] - (2Z)-2-[(3,6-dimethyl-2-phenylpyrimidin-3-ium-4-yl)methylidene]-1 -ethylquinoline, chloride (Cy3, Cy5);

[0075] - (3R,4S,5S,6R,7R,9R,11S,12R,13S,14R)-6-[(2S,3R,4S,6R)-4-(dimethylamino)-3- hydroxy-6-methyloxan-2-yl]oxy-14-ethyl-7,12,13-trihydroxy-4-[(2R,4R,5S,6S)-5-hydroxy-4- methoxy-4,6-dimethyloxan-2-yl]oxy-10-(2-methoxyethoxymethoxyamino)-3,5,7,9, 11 ,13- hexamethyl-oxacyclotetradecan-2-one (ROX);

[0076] - 5-chlorosulfonyl-2-(3-oxa-23-aza-9- azoniaheptacyclo[17.7.1.15,9.02, 17.04, 15.023,27.013,28]octacosa- 1 (27),2(17),4,9(28),13,15,18-heptaen-16-yl)benzenesulfonate (Texas Red);

[0077] - 2-(7-ethyl-3,3,8,8,10-pentamethyl-7-aza-21- azoniahexacyclo[15.7.1.02,15.04,13.06,11.021 ,25]pentacosa-1 ,4(13),5,11 ,14,16,18,21 (25)- octaen-14-yl)-N-methyl-N-(4-oxopentyl)benzamide (ATTON 647N);

[0078] - (2,5-dioxopyrrolidin-1-yl) 4',5'-dichloro-3',6'-dihydroxy-2',7'-dimethoxy-1-oxospiro[2- benzofuran-3,9'-xanthene]-5-carboxylate (6-JOE);

[0079] - (2S,4R)-N-[(1S)-2-methyl-1-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6- methylsulfanyloxan-2-yl]propyl]-4-propylpiperidine-2-carboxamide (VIC); and

[0080] - (tetrachlorofluorescein): 4,5,6,7-tetrachloro-3',6'-dihydroxyspiro[2-benzofuran-3,9'- xanthene]-1-one (TET). In a particular embodiment of the method of the invention the TaqMan probe comprises a quencher molecule selected from the group consisting of:

[0081] - N-[2-[[(E)-3-[1-[(2R,4S,5R)-5-[[bis(4-methoxyphenyl)-phenylmethoxy]methyl]-4-[2- cyanoethoxy-[di(propan-2-yl)amino]phosphanyl]oxyoxolan-2-yl]-2,4-dioxopyrimidin-5-yl]prop- 2-enoyl]amino]ethyl]-6-[[7-[[2,5-dimethoxy-4-[(4-nitrophenyl)diazenyl]phenyl]diazenyl]-1- azatricyclo[7.3.1.05,13]trideca-5(13),6,8-trien-6-yl]oxy]hexanamide (BBQ650);

[0082] - 2-[3-(dimethylamino)-6-dimethylazaniumylidenexanthen-9-yl]benzoate (TAMRA);

[0083] - (2S)-2-[4-(3,4-dimethylphenyl)-2-methylquinolin-3-yl]-2-[(2-methylpropan-2- yl)oxy]acetic acid (TQ2);

[0084] - 5-phenylsulfanylquinazoline-2,4-diamine (TQ3); and

[0085] - 2,5-Bis(2-methyl-2-propanyl)-1 ,4-benzenediol (BHQ-1 and 2).

[0086] PCR reactions can be used to detect one single sequence region (“loci”) or more than one single region, wherein primers and probes for two or more nucleic acid regions are used. As such, in a particular embodiment of the method of the invention, the PCR is a multiplex PCR wherein the first and the second markers are detected in the same reaction.

[0087] In the present invention the term “multiplex PCR” refers to a variant of the polymerase reaction chain where several loci are amplified in a single reaction.

[0088] In a particular embodiment of the method of the invention: the first marker is the ASFV p72 gene and the PCR is carried out with the forward primer of SEQ ID NO: 5 and the reverse primer of SEQ ID NO: 6.

[0089] The first ASFV vaccine marker is the EP153R gene and the PCR is carried out with the forward primer SEQ ID NO: 8 and the reverse primer of SEQ ID NO: 9 and / or

[0090] The second ASFV vaccine marker is the eGFP gene and the PCR is carried out with the forward primer SEQ ID NO: 11 and the reverse primer of SEQ ID NO: 12.

[0091] SEQ ID NO : 5 - CCCAGGRGATAAAATGACTG

[0092] SEQ ID NO : 6 - CACTRGTTCCCTCCACCGATA

[0093] SEQ ID NO : 8 - TTGGAACTAACATCTTAAGCCTT

[0094] SEQ ID NO : 9 - ATATCCAACCCAATCTTTAGGG

[0095] SEQ ID NO : 11 - CATCGACTTCAAGGAGGAC

[0096] SEQ ID NO : 12 - GCCATGATATAGACGTTGTGG

[0097] The term “primer”, as used herein, refers to a nucleic acid molecule comprising a 3 terminal -OH group that, upon hybridization to a complementary nucleic acid sequence, can be elongated, e.g., via an enzymatic nucleic acid replication reaction. Both the upper and lower limits of the length of the primer are empirically determined. The primer described herein can be a forward primer or a reverse primer. The term “reverse primer”, as used herein, refers to a primer priming the antisense strand of a DNA sequence to allow the polymerase to extend in one direction along the complementary strand of a DNA sequence. The term “forward primer”, as used herein, refers to a primer priming the sense strand of a DNA sequence to allow a polymerase to extend in one direction along one strand of a DNA sequence.

[0098] In a particular embodiment of the method of the invention the p72 gene PCR fragment is detected with a TaqMan probe comprising a sequence as defined in SEQ ID NO: 7, the EP153R gene PCR fragment is detected with a TaqMan probe comprising a sequence as defined in SEQ ID NO: 10 and / or the eGFP gene PCR fragment is detected with a TaqMan probe comprising a sequence as defined in SEQ ID NO: 13.

[0099] As mentioned previously TaqMan probes can be labelled to allow the direct detection during the PCR reaction. In a particular embodiment the TaqMan probe specific for p72 gene PCR fragment is labelled with 6-FAM, the TaqMan probe specific for the EP153R gene PCR fragment is labelled with JOE and / or the TaqMan probe specific for the eGFP gene PCR fragment is labelled with Cy5. In another particular embodiment the TaqMan probe specific for p72 gene PCR fragment contains BHQ1 as quencher, the TaqMan probe specific for the EP153R gene PCR fragment contains BHQ1 as quencher and / or the TaqMan probe specific for the eGFP gene PCR fragment contains BBQ as quencher.

[0100] In another particular embodiment the reagents used for the detection of the first marker comprise a primer pair having the sequences of SEQ ID NO:5 and 6 and a TaqMan probe having the sequence 6FAM-TCCTGGCCRACCAAGTGCTT-BHQ1 (SEQ ID NO: 7), the reagents used for the detection of first ASFV vaccine marker comprise a primer pair having the sequences of SEQ ID NO:8 and 9 and a TaqMan probe having the sequence JOE*- AGGAG+AGATTAATAAA+C+CAATA+T+GTTACC-BHQ1 (SEQ ID NO: 10) and the reagents used for the detection of second ASFV vaccine marker comprise a primer pair having the sequences of SEQ ID NO:11 and 12 and a TaqMan probe having the sequence Cy5- TGTAGTTGTACTCCAGCTTGTGCC-BBQ (SEQ ID NO: 13), wherein R indicates A or G and + indicates LNA nucleotides.

[0101] The term “LNA nucleotide” as used herein refers to a modified RNA nucleotide. A LNA nucleotide is a locked nucleic acid. The ribose moiety of an LNA nucleotide may be modified with an extra bridge connecting the 2' oxygen and 4' carbon. This bridge locks the ribose in the 3'-endo (North) conformation, which is often found in the A-form duplexes. LNA nucleotides can be mixed with DNA or RNA residues in an oligonucleotide. LNA nucleotides hybridize with DNA or RNA. Oligomers comprising LNA nucleotides are synthesized chemically and are commercially available. The locked ribose conformation enhances base stacking and backbone pre-organization. The presence of LNA nucleotides significantly increases the hybridization properties (melting temperature) of oligonucleotides. In a particular embodiment of the method of the invention the first and the second markers are antibodies.

[0102] Several methods in the art are known for the detection of antibodies, generally referred to as immunoassays. In a particular embodiment of the method of the invention the detection of the first and second markers is carried out by an immunoassay.

[0103] The term "immunoassay", as used herein, includes any immunoassay technique based on the formation or use of immune complexes, that is, resulting from the conjugation of antibodies and antigens, as quantification references of a determined analyte (substance under examination), which can be the antibody or the antigen, using for the measurement a molecule as a marker which produces a detectable signal in response to a specific binding.

[0104] Immunoassay techniques which can be used in the context of the present invention are Western-blot or Western transfer, ELISA (enzyme-linked immunosorbent assay), RIA (radioimmunoassay), competitive ELISA (competitive enzyme immunoassay), DAS-ELISA (double antibody sandwich ELISA), Chemiluminescence immunoassay (CLIA) which combines chemiluminescence technique with immunochemical reaction, lateral flow assays (also called Immunochromatographic assays, rapid tests or field tests) in double recognition (DR), indirect or competition formats, protein arrays in double recognition (DR), indirect or competition formats, immunocytochemical and immunohistochemical techniques, techniques based on the use of protein biochips or microarrays which include specific antibodies or assays based on colloidal precipitation in formats such as dipsticks. In a particular embodiment of the method of the invention the immunoassay involves the capture of the antibodies against the EP153R gene product and the capture is carried out using the EP153R gene product or a fragment thereof.

[0105] In another particular embodiment the immunoassay is an indirect ELISA (also called a sandwich immunoassay) wherein the antibodies are captured using the EP153R gene product or a fragment thereof and the captured antibodies are detected using antibodies specific for swine antibodies.

[0106] As used herein, the term “sandwich immunoassay” or “sandwich-assay” refers to an assay to detect antigen using a pair of antibodies (for example, antibody ‘A’ and antibody ‘B’) each directed against the antigen or a portion of the antigen. For the pair of antibodies as an example, antibody ‘A’ is labeled either covalently or non-covalently to a reporter molecule (e.g., a molecule that allows for electrochemiluminescence or a molecule that allows for fluorescence). An example of non-covalent labeling of an antibody ‘A’ would be to allow a secondary labeled antibody against the antibody ‘A’ to bind to antibody ‘A’. Antibody ‘B’ is attached directly (or allowed to attach indirectly) to a solid support phase like an assay plate, a bead, a magnet or an electrode. Detection techniques suitable for sandwich immunoassays include electrochemiluminescence, chemiluminescence, and fluorogenic chemiluminescence. In a particular embodiment of the method of the invention the immunoassay involves the capture of the antibodies using immobilized antigens which can be specifically bound by said antibodies. Examples of techniques which use immobilized antigens are ELISA based techniques such direct ELISA, sandwich ELISA, competitive ELISA and double recognition (DR) ELISA.

[0107] The term “enzyme-linked immunosorbent assay” or its acronym “ELISA” as used herein refers to a commonly used analytical biochemistry assay, that uses a solid-phase type of enzyme immunoassay (EIA) to detect the presence of a ligand (commonly a protein) in a liquid sample using antibodies directed against the protein to be measured. Performing an ELISA involves at least one antibody with specificity for a particular antigen. The sample with an unknown amount of antigen is immobilized on a solid support (usually a polystyrene microtiter plate) either non-specifically (via adsorption to the surface) or specifically (via capture by another antibody specific to the same antigen, in a "sandwich" ELISA). After the antigen is immobilized, the detection antibody is added, forming a complex with the antigen. The detection antibody can be covalently linked to an enzyme or can itself be detected by a secondary antibody that is linked to an enzyme through bioconjugation. Several enzymatic markers which allow the results of the assay to be measured upon completion of the assay, can be used in ELISA. The most commonly used are without limitation, OPD (o- phenylenediamine dihydrochloride) which turns amber to detect HRP (Horseradish Peroxidase) and is often used to as a conjugated protein; TMB (3,3',5,5'-tetramethylbenzidine) which turns blue when detecting HRP and turns yellow after the addition of sulfuric or phosphoric acid; ABTS (2,2'-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt) whhhich turns green when detecting HRP; PNPP (p-Nitrophenyl Phosphate, Disodium Salt) which turns yellow when detecting alkaline phosphatase; and ONPG (o-nitrofenil-p-D- galactopiranosido) which turns yellow when detecting beta-galactosidasa (b-Gal).

[0108] During the first step of the method of the invention, the choice of first and second markers might alter the sample to be use. Therefore, in a particular embodiment of the method of the invention, if the first and second markers are antibodies, the sample is a serum sample or wherein if the first and second markers are genes or gene fragments, then the sample is a blood sample.

[0109] Step (77)

[0110] Step (ii) of the method of the invention is where the determination of whether the animal is infected with a wild type ASFV strain or is vaccine is made.

[0111] In order to identify the animal as having been vaccinated, at least one first marker and the second ASFV vaccine marker have to be detected. Furthermore, the vaccination can be confirmed by further verifying that the first ASFV vaccine marker is absent. As such, in a particular embodiment the identification of the animal as vaccinated is further confirmed by testing the first ASFV vaccine marker, wherein the animal is confirmed as vaccinated if said marker is not detected.

[0112] In order to identify the animal as infected at least one first marker is detected and, optionally, the first ASFV vaccine marker is detected or the second ASFV vaccine marker is not detected. Furthermore, said identification can be further improved by determining if the animal is infected by a genotype II ASFV strain or a non-genotype II ASFV strain. In a particular embodiment the identification of the animal as infected is further confirmed by testing the first ASFV vaccine marker, wherein said first ASFV vaccine marker is a genotype II specific marker, wherein the animal is confirmed as infected by an ASFV strain of genotype II if said marker is detected or as infected by an ASFV strain of a genotype other than genotype II if said marker is not detected.

[0113] The term “genotype II specific marker” as used herein refers to an antibody against the EP402R gene product or against the EP153R gene product, or the EP402R gene or a fragment thereof or the EP153R gene or a fragment thereof, wherein the detection of said antibody, gene or fragment thereof, indicates that the ASFV strain present in the animal sample in test belongs to the genotype II.

[0114] The fact that the animal is vaccinated does not stop said animal of contracting the ASFV and therefore being infected. Thus, in a particular embodiment of the method of the invention the animal is identified as having been vaccinated and infected with an ASFV strain if the first marker is detected, the first ASFV vaccine marker is detected and the second ASFV vaccine marker are detected.

[0115] The method of the invention does not comprise the testing of ASFV strains wherein certain genes are inactivated. Hence, in a particular embodiment of the method of the invention the method does not comprise testing the sample for antibodies against the DP148R, the 9GL / B119L, the MGF_360-12L, the MGF-13L and the MGF_360-14L gene products and / or wherein the method does not comprise testing the sample for the presence of the DP148R, the 9GL / B119L, the MGF_360-12L, the MGF-13L and the MGF_360-14L genes or fragments thereof.

[0116] The term “DP148R” as used herein refers to a gene of unknown function which is located between positions 183187 and 184012 of the genome of the ASFV Georgia 2007 / 1 strain (GenBank accession no. NC044959, version 2 of December 20th, 2020). Deletions of this gene are known to not affect virus replication by affect virus infection.

[0117] The term “9GL / B119L” as used herein refers to the gene which encodes for a FAD- linked sulfhydryl oxidase located between positions 95936 and 96295 of the genome of the ASFV Georgia 2007 / 1 strain. Deletions of this gene are known to not affect virion maturation, viral growth in macrophages and viral virulence in swine. The terms “MGF_360-12L”, “MGF_360-13L” and “MGF_360-14L”, as used herein, refer to the genes present in the multigene family 360, whose function can affect the host's immune response mechanism and have host specificity. The genes MGF_360-12L, MG_360-13L and MG_360-14L are located between positions 30355 and 33887 of the genome of the ASFV Georgia 2007 / 1 strain.

[0118] Kit of the invention

[0119] The reagents required for performing the method of the invention might all or part of them form a kit. Therefore, another aspect of the present invention relates to a kit, from here onwards the kit of the invention, comprising

[0120] (iii) reagents suitable for the detection of a first marker, wherein the first marker is selected from the group consisting: an antibody against an ASFV-specific antigen which is not the EP402R gene product or the EP153R gene product and an ASFV gene or fragment thereof which is not the EP402R gene or the EP153R gene and

[0121] (iv) reagents suitable for the detection of a second marker, wherein the second marker is a “first ASFV vaccine marker” and / or a “second ASFV vaccine marker” wherein the first ASFV vaccine marker is selected from the group consisting of an antibody against the EP402R gene product or against the EP153R gene product and the EP402R gene or a fragment thereof or the EP153R gene or a fragment thereof and wherein the second ASFV vaccine marker is selected from the group consisting of: an antibody specific for an heterologous gene product or an heterologous gene or a fragment thereof.

[0122] All previous definitions and embodiments described in relation to previous aspects are equally valid for the current aspect and its embodiments.

[0123] In the context of the present invention, “kit” is understood as a product of the different reagents for performing the methods described in the present invention, both in those cases in which the detection is performed with antibodies / antigens and in the cases in which the detection is performed with nucleotide sequence techniques such as PCR using primers and probes, in which the different reagents are packaged together to allow for transport and storage. Nevertheless, if the kits defined in the present invention do not comprise the reagents necessary for putting the methods of the invention into practice, such reagents are commercially available and can be found as part of a kit. Suitable materials for packaging the components of the kit include, without being limited to, glass, plastic (polyethylene, polypropylene, polycarbonate and the like), bottles, vials, paper, sachets and the like. Kits can additionally contain instructions for using the different components in the kit. Said instructions can be in printed format or in an electronic device capable of storing instructions such that they can be read by a person, such as electronic storage media (magnetic discs, tapes and the like), optical means (CD-ROM, DVD, USB) and the like. The media can additionally or alternatively contain Internet addresses where said instructions are provided.

[0124] In a particular embodiment of the kit of the invention the first marker is an antibody against an ASFV-specific antigen which is not the EP402R gene product or the EP153R gene product, in which case the reagent is the ASFV-specific antigen.

[0125] In a more particular embodiment of the kit of the invention, wherein the first marker is an ASFV gene or fragment thereof which is not the EP402R gene or the EP153R gene and wherein the reagents is a primer pair and / or probe which is specific for said gene or gene fragment.

[0126] In another particular embodiment of the kit of the invention, if the second marker is an antibody against the EP402R gene product, then the reagent is the EP402R gene product or an immunogenic fragment thereof and wherein if the second marker is an antibody against the EP153R gene product, then the reagent is the EP153R gene product or an immunogenic fragment thereof.

[0127] In another particular embodiment of the kit of the invention, if the second marker is the EP402R gene or a fragment thereof, then the reagent is a primer or probe specific for the EP402R gene product or the fragment thereof and wherein if the second marker is the EP153R gene or a fragment thereof, then the reagent is a primer or probe specific for the EP153R gene product or the fragment thereof.

[0128] In yet another particular embodiment of the kit of the invention, the reagent specific for the antibody against EP153R is specific for the antibody against EP153R of SEQ ID NO:1 and / or wherein the reagent specific for the antibody against EP402R is specific for the antibody against EP402R of SEQ ID NO:3.

[0129] In one more particular embodiment of the kit of the invention, if the second marker is an antibody against the heterologous gene product, then the reagent is the heterologous gene product or an immunogenic fragment thereof.

[0130] In another particular embodiment of the kit of the invention, if the second marker is the heterologous gene or a fragment thereof, then the reagent is a primer or probe specific for the heterologous gene product or the fragment thereof.

[0131] Another particular embodiment of the kit of the invention the ASFV-specific antigen which is not the EP402R gene product or the EP153R gene product is the p72, the CP312 and / or the p30 antigen or wherein the ASFV gene which is not the EP402R gene or the EP153R gene is the p72 gene, the CP312 gene or the p30 gene.

[0132] In a particular embodiment of the kit of the invention the heterologous gene is the eGFP gene or wherein the heterologous gene product is the eGFP protein.

[0133] In another particular embodiment of the kit of the invention the kit does not comprise reagents for the detection of antibodies against the DP148R, the 9GL / B119L, the MGF_360- 12L, the MGF-13L and the MGF_360-14L gene products and / or does not comprise reagents for the detection of the DP148R, the 9GL / B119L, the MGF_360-12L, the MGF-13L and the MGF_360-14L genes or fragments thereof.

[0134] One more particular embodiment of the kit of the invention the first and second reagents are primers and / or probes.

[0135] A particular embodiment of the kit of the invention is wherein the primers are the primers according to SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11 and SEQ ID NO: 12. In another particular embodiment the probes are the probes according to SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 13.

[0136] One more particular embodiment of the kit of the invention, the TaqMan probe specific for p72 gene PCR fragment contains 6FAM as a reporter and BHQ1 as quencher, the TaqMan probe specific for the EP153R gene PCR fragment contains JOE as a reporter and BHQ1 as quencher and / or the TaqMan probe specific for the eGFP gene PCR fragment contains Cy5 reporter and BBQ as quencher.

[0137] Another particular embodiment of the kit of the invention the first and second reagents are polypeptides.

[0138] The term “polypeptide” as used herein refers to a linear chain of amino acid residues of any length, joined together with peptide bonds. The term “peptide” as used herein, refers to a linear chain of amino acids as a polypeptide, although shorter than that of a polypeptide. It will be understood that the terms “peptide bond”, “peptide”, “polypeptide” and “protein” are known to the person skilled in the art.

[0139] In another particular embodiment of the kit of the invention the polypeptides are immobilized in a support.

[0140] The term "solid support" as used herein denotes a non-fluid substance, and includes chips, vessels, and particles (including microparticles and beads) made from materials such as polymer, metal (paramagnetic, ferromagnetic particles), glass, and ceramic; gel substances such as silica, alumina, and polymer gels; capillaries, which may be made of polymer, metal, glass, and / or ceramic; zeolites and other porous substances; electrodes; microtiter plates; solid strips; and cuvettes, tubes or other spectrometer sample containers. A solid support component of an assay is distinguished from inert solid surfaces with which the assay may be in contact in that a "solid support" contains at least one polypeptide on its surface, which is intended to interact with the first and / or second markers of the method of the invention, either directly or indirectly. A solid support may be a stationary component, such as a tube, strip, cuvette, or microtiter plate, or may be non-stationary components, such as beads and microparticles. Microparticles can also be used as a solid support for homogeneous assay formats. A variety of microparticles that allow both non-covalent or covalent attachment of proteins and other substances may be used. Such particles include polymer particles such as polystyrene and poly(methylmethacrylate); gold particles such as gold nanoparticles and gold colloids; and ceramic particles such as silica, glass, and metal oxide particles.

[0141] In one more particular embodiment of the kit of the invention the kit further comprises antibodies specific for swine antibodies.

[0142] The kit of the invention finds use in an in vitro diagnostic method to differentiate African Swine Fever Virus (ASFV) infected animals from animals which have been vaccinated against ASFV. Therefore another aspect of the present invention relates to an in vitro diagnostic method to differentiate African Swine Fever Virus (ASFV) infected animals from animals which have been vaccinated against ASFV using an immunogenic composition comprising an attenuated ASFV in which the EP153R gene and the EP402R gene have been inactivated and wherein the region of the ASFV genome comprising the EP402R and the EP153R genes is replaced by a heterologous gene.

[0143] The invention will be described by way of the following examples which are to be considered as merely illustrative and not limitative of the scope of the invention.

[0144] EXAMPLE - DIVA METHOD OF THE INVENTION

[0145] EXAMPLE 1 :

[0146] MATERIALS AND METHODS

[0147] Brief description ofEP153R antigen

[0148] The EP153R protein (pEP153R) of ASFV is a type II transmembrane protein of 159 amino acids and multiple putative sites for posttranslational modifications: N-glycosylation, myristoylation and phosphorylation. The pEP153R is involved in hemadsorption of the virus and it is highly variable among genotypes.

[0149] Cloning and expression of the pEP153R

[0150] The completed extracellular domain of pEP153R of ASFV (Lv17 / WB / Rie1 strain as disclosed in the patent application WO2020 / 049194) has been expressed in the mammalian cell system. The corresponding gene sequence was amplified from a synthetic gene optimized for Homo sapiens and cloned into the vector pCMV6-Ac-Fc-S, which add an interleukin-2 secretion signal to the amino terminus and a mouse Fc tag to the carboxy terminus of the protein. The recombinant vector was used to transfect HEK-293 cells using FectoPRO® reagent (Polyplus). After 6 days post-transfection, the pEP153R was obtained from the culture media. The protein was purified by affinity chromatography using a Protein G Sepharose® column (Cytiva), and it was eluted with glycine-HCI 0.1 M pH 2.6 buffer. The purity of the purified protein was analyzed by SDS-PAGE followed by silver staining (Figure 1A), and its identity was analyzed by western blot using a monoclonal antibody against the mouse Fc tag (Figure 1 B). This analysis revealed a diffused band with the expected molecular weight for the protein (64 kDa), considering that the gene cloned has six N-glycosylation putative sites (NetNGIyc 1.0 Server, DTU Bioinformatics), and experimental evidence shows that the molecular weight of each of these N-glysosylation is about 4 kDa.

[0151] Brief description ofeGFP antigen

[0152] The enhanced green fluorescent protein (eGFP), derived from Aequorea Victoria, was included in the prototype DIVA vaccine candidate. Thus, the eGFP was further tested as DIVA antigen for its potential use as target in the prototype DIVA assay.

[0153] Cloning and expression of the eGFP protein

[0154] The completed sequence of eGFP was expressed using the insect cells system. The corresponding sequence was amplified from a synthetic gene and cloned into the vector pAcHLTA, which add six histidines to the amino terminus of the protein. The corresponding recombinant baculovirus was obtained by cotransfection with the recombinant plasmid and linear BacPAK6 DNA, using jetPEI® transfection reagent (Polyplus). Sf9 cells were infected with the recombinant baculovirus (MOI 1.5). After 3 days post-infection, the cells were lysated with 25 mM bicarbonate buffer. eGFP was obtained from the soluble fraction of the cell extract and purified by affinity chromatography, using a nickel column (High Density Metal Free resin, ABT). The purity of the purified protein was analysed by SDS-PAGE-Coomassie staining and its identity by western blot using a monoclonal antibody against the histidine tag. This analysis revealed a band with the expected molecular weight of the protein (33 kDa) (Figure 2).

[0155] Serum samples used in the studies

[0156] In order to set up an ELISA for detection of antibodies in domestic pigs (DP) and wild boar (WB) against the target DIVA antigens of ASFV (pEP153R) and eGFP, several well characterized sera were analysed. The experimental serum samples from DP were obtained from in vivo studies conducted in BSL-3 facilities at CISA-INIA and the samples from WB, came from in vivo experiments conducted in BSL-3 facilities at VISAVET, UCM.

[0157] Furthermore, in order to test the specificity of the assays, a total of 386 negative field samples from Spanish farms free of ASFV were included in the studies.

[0158] Description of the D IVA-ELI SA

[0159] PEP153R ELISA For detection of antibodies against pEP153R, 96-well plates were coated with 15 ng / well of the antigen and incubated at 4 °C overnight. Then, the coated wells were stabilized and blocked with StabiIZyme™ Select Stabilizer (SS) (SURMODICS), for 1 h at room temperature (RT). After removing the blocking solution, the wells were incubated with the serum diluted 1 :100 in serum dilution buffer, for 1 h at RT. After washing the plates 3 times with washing solution (Ingenasa), an anti-swine IgG monoclonal antibody conjugated with horseradish peroxidase (1 BH7, Ingenasa), was used as secondary antibody, diluted 1 :40000 in SS and incubated for 1 h at RT. After a washing step, as described before, the assay was developed by adding TMB. The reaction was stopped 20 minutes later by adding 0.5 M sulphuric acid. The signal was measured by reading the optical density (OD) at 450 nm. The Sample / Positive (S / P) ratio of each sample was calculated using the following formula: eGFP ELISA

[0160] For detection of antibodies against eGFP, 96-well plates were coated with 0.2 pg / well of the antigen and incubated at 4 °C, overnight. The coated wells were stabilized and blocked with SS, for 1 h at room temperature (RT). After removing the blocking solution, the serum samples diluted 1 :100 in serum dilution buffer, were incubated for 1 h at RT. After washing the plates 3 times with washing solution, protein A / G conjugated with horseradish peroxidase and diluted 1 / 80000 was incubated for 1 h at RT. After a washing step as described before, the assay was developed by adding TMB. The reaction was stopped 10 minutes later, by adding 0.5 M sulphuric acid. The signal was measured by reading the OD at 450 nm. The S / P ratio of each sample was calculated using the following formula:

[0161] Interpretation of the serological DIVA ELISA

[0162] The DIVA serological diagnostic assay will be based in the detection of antibodies against different antigens: highly immunogenic viral antigen (p72, CP312 and / or p30), pEP153R and eGFP. Table 1 shows the expected results obtained with the serological DIVA assay, considering that pEP153R is highly variable among genotypes.

[0163] Table 1. Interpretation of the serological DIVA ELISA.

[0164] P: positive; N: negative.

[0165] RESULTS

[0166] Analysis of the immunogenicity of pEP153R

[0167] The immunogenicity of pEP153R was evaluated by indirect ELISA. In this preliminary study, two positive sera and two negative sera were analyzed. Differential signal between the positive and negative sera in both animals was observed. Furthermore, when the same sera were tested with a no-related antigen expressed in the same system and conditions as pEP153R, no signal was observed (Figure 3). These results suggested that pEP153R was immunogenic in ELISA.

[0168] Analysis of the immunogenicity of eGFP

[0169] The immunogenicity of eGFP was evaluated by indirect ELISA. In this preliminary study, sera from a domestic pig, experimentally infected with a marker ASFV mutant including the eGFP gene as reporter, was analyzed. The sera were collected at different times postinfection: 0-, 16- and 35 dpi. Also, 3 field sera from ASFV-free Spanish farms, were included in the assay. All sera were analysed against eGFP and a no-related antigen produced in the same expression system and conditions as eGFP (negative antigen). Differential signal between the experimental positive and negative sera was observed and no signal was detected with the field negative sera. Furthermore, when the same sera were analysed against the negative antigen, no signal was observed in none of the cases (Figure 4). These results suggested that eGFP was immunogenic in ELISA.

[0170] Analysis of the immunogenicity of mCherry

[0171] The reporter protein mCherry was produced recombinantly in E. coli and baculovirus expression systems. Consecutively, protein purification was performed, obtaining a high level of purity for both forms (data not shown). The immunogenicity of the protein was evaluated by indirect ELISA. As mCherry is a fluorescence protein derived from dsRed with a high percentage of amino acid sequence identity (around 80 %), serum samples from a domestic pig experimentally inoculated with a modified ASFV that includes dsRed as a reporter protein (Lv17 / WB / Rie1 AUK) were included in the assessment. As the Figure 8 shows, a differential signal between negative (0 dpi) and positive sera (14 dpi) was detected, when mCherry was used as coated antigen in the ELISA plate (results obtained with the form expressed in baculovirus system are only shown in the Figure). Furthermore, since the signal of the positive serum seemed to raise when the amount of coated antigen increased, and the OD of the negative serum remained similar, the positive signal seems to be specific to the antigen. These preliminary results suggest that mCherry is immunogenic by ELISA.

[0172] Analysis of the potential ofpEP153R and eGFP as DIVA antigens

[0173] Based on the marker candidate vaccine (Lv17 / WB / Rie1AEP402RAEP153R: ACD), a DIVA serological assay to differentiate infected from vaccinated animals was developed. This assay is based on the detection of antibodies against the protein codified by the deleted gene EP153R (pEP153R) and the protein codified by the reporter gene used in the vaccine (eGFP). Additionally other highly immunogenic viral antigens, such as p72, was used as control for the detection of infection and monitoring immunity in vaccinated animals.

[0174] Serum samples from DP and WB were analysed by indirect ELISA to evaluate the antibody response against pEP153R and eGFP as serological DIVA candidates. Moreover, the antibody response against p72 was also evaluated.

[0175] In the case of DP, a total of 122 serum samples from 8 animals experimentally inoculated with the parental virus were analysed. Six of these 8 animals were inoculated intramuscularly with a dose of 1O2TCDl5o / mL of Lv17 / WB / Rie1 , and the sera were collected between 0- and 54 dpi: 100 % of these pigs seroconverted against pEP153R after 23 ± 5 dpi and against p72 protein, after 13 ± 2 dpi (the pig C18 was not included in the average because died at 12 dpi). All sera resulted negative against eGFP. Furthermore, two DP were inoculated intramuscularly with a dose of 10 TCDIso / mL of Lv17 / WB / Rie1 , and the sera were collected between 0- and 126 dpi. In this case, 100 % of these pigs seroconverted against pEP153R at different times after 22 dpi and against p72 protein, after 7 dpi. All sera resulted negative against eGFP. In addition, another animal was put in contact with Lv17 / WB / Rie1 : after 29 dpi, an antibody response against pEP153R was detected and, antibodies against p72 protein were detected after 14 dpi. Also, all serum samples from this animal resulted negative against eGFP.

[0176] Regarding vaccinated pigs, a panel of 60 serum samples from 5 different animals vaccinated intramuscularly with a dose of 102TCDIso / mL of ACD candidate vaccine and collected between 0- and 54-days post-vaccination (dpv) were analysed. All DP resulted negative against pEP153R and positive against eGFP after 21 dpv, and p72 protein after 14 dpv (Table 2).

[0177] As an example, Figure 5 shows the antibody response of the animals C17 and C7.

[0178] Table 2. Summary of the analysis of the potential of pEP153R and eGFP as DIVA antigens in domestic pigs.

[0179] *The negative pig died at 12 dpi. dpi: days post-infection; dpv: days post-vaccination; IM: intramuscular; ACD: Lv17 / WB / Rie1AEP153RAEP402R; Ab: antibody.

[0180] Concerning immunogenicity of pEP153R in WB, a total of 91 serum samples from 6 different animals experimentally inoculated with the parental virus were analysed. Three out of the 6 animals were inoculated via oronasal with a dose of 1O3TCDl5o / mL of Lv17 / WB / Rie1 and the sera were collected between 0- and 89-dpi: 100 % of the WB seroconverted against p72 at different times after 11 dpi and against pEP153R at different times after 25 dpi. All animals resulted negative against eGFP. Furthermore, 46 serum samples from 3 WB inoculated via oronasal with a dose of 1O4TCDl5o / mL of Lv17 / WB / Rie1 and collected between 0- and 89-dpi, were analysed. In this case, 100 % of the WB seroconverted against p72 protein at different times after 11 dpi and against pEP153R at different times after 25 dpi. Some animals showed an unspecific response against eGFP around 11 dpi.

[0181] Regarding vaccinated WB, a panel of 103 serum samples from 9 animals vaccinated with ACD candidate vaccine were analysed. Four out of the 9 animals were inoculated via oronasal with a dose of 1O4TCDl5o / mL of the candidate vaccine and the sera were collected between 0- and 61-dpv: 100 % of the WB seroconverted against p72 protein after 13 ± 3 dpv and against eGFP after 18 ± 2 dpv. All animals resulted negative against pEP153R. Furthermore, 59 serum samples from 5 WB inoculated via oronasal with a dose of 102TCDIso / mL of the candidate vaccine and boost after 30 dpv with 104TCDIso / mL of Lv17 / WB / Rie1 , were analysed. The sera were collected between 0- and 63-dpi. In this case, 100 % of the WB seroconverted against p72 protein at different times after 16 dpv and against eGFP after 23 dpv. All animals resulted negative against pEP153R (Table 3).

[0182] As an example, Figure 6 shows the antibody response of the animals RA1 and MU4.

[0183] Table 3. Summary of the analysis of the potential of pEP153R and eGFP as DIVA antigens in wild boar.

[0184] * 2 animals developed an unspecific response against eGFP around 11 dpi. dpi: days post-infection; dpv: days post-vaccination; ON: oronasal; ACD: Lv17 / WB / Rie1AEP153RAEP402R; Ab: antibody.

[0185] To verify whether the antibody response against pEP153R was maintained in time, sera from two DP experimentally infected with the parental virus and collected between 0- and 126-dpi were analysed. The response against pEP153R was steady in time up to 126 dpi (Figure 7).

[0186] Finally, to study the specificity of the eGFP and pEP153R ELISAs, a panel of 386 field negative samples from ASF-free areas were analyzed against pEP153R and eGFP: 152 sera from pigs and 234 sera from wild boar. In both ELISAs, it was obtained a preliminary diagnostic specificity of 100 % for pigs, and of 99.9 % in the case of wild boar.

[0187] EXAMPLE 2:

[0188] Design of a triplex real-time PCR method for differentiating ASFV infected from vaccinated animals (DIVA test)

[0189] Goal

[0190] To develop a DIVA molecular method accompanying the ASFV vaccine prototype Lv17 / WB / Rie1-ACD, which is a constructed double mutant lacking the adjacent ASFV EP153R and EP402R genes that are replaced by the incorporation of eGFP as reporter gene. To this end, a triplex real-time PCR method for the simultaneous and differential detection of both deleted ASFV-EP153R and inserted eGFP genes together with the control ASFV-VP72 gene was planned.

[0191] Methodology

[0192] Genome sequences of the parental Lv17 / WB / Rie1 and the vaccine Lv17 / WB / Rie1-ACD strains were aligned to place the regions corresponding to the deleted viral genes EP153R- EP402R and the inserted reporter eGFP gene. Sets of primer pairs and hydrolysis TaqMan probes were designed manually to target either EP153R or eGFP genome regions. Additionally, previously designed primers and probe for ASFV VP72-coding gene detection (J. Fernandez-Pinero et al, 2013 Transbound Emerg Dis. 60(1):48-58), which are recommended and widely used for the routine ASF diagnostics, were incorporated into the multiplex real-time PCR to act as control of ASFV presence. In order to obtain analogous sensitivity with each PCR target gene, special care was taken in the design of the assay selecting primers and probes with similar Tm values. Finally, each probe was labelled with a different reporter fluorochrome allowing the differential detection of the three target genes in a triplex reaction (Table 4).

[0193] Table 4: Primers and probes designed for the triplex DIVA PCR assay.aPositions according to the ASFV Lv17 / WB / Rie1 genome;bpositions according to Lv17 / WB / Rie1-ACD.

[0194] JOE can be substituted by VIC or HEX reporter fluorochrome.

[0195] Note: R=A+G; nucleic acids marked in bold with a + correspond to LNA positions (locked-nucleic acids) Reaction conditions were optimised testing different primers / probes concentrations and several PCR reagents to get the highest sensitivity for each target gene without compromising the specificity of the technique. Finally, the triplex PCR was established using the Luna Universal Probe qPCR Master mix kit (New England Biolabs) with the following reaction conditions disclosed in Table 5. Table 5: Reaction conditions for the triplex PCR.

[0196] The incubation profile for DNA amplification was established as follows: 1 min at 95°C, 45 cycles at 95°C 15 sec and 60°C 30 sec, with fluorescence acquisition in the FAM, JOE- VIC-HEX, and Cy5 channels at the end of each PCR cycle. A positive result in the triplex real-time PCR was determined by identifying the threshold cycle value (Ct) at which any reporter dye emission appeared above background within 40 cycles. Interpretation of the fluorescence signals that can be obtained from a swine sample is summarized in Table 6.

[0197] Table 6: Summary of interpretation of results

[0198] Results

[0199] Initial PCR experiments aimed to establish the best performance primers / probe combinations for the vaccine deleted EP153R gene detection. This corresponds, together with the adjacent EP402R gene, to an ASFV genome region with an extremely high content on A / T, which makes the primers / probe design very complex. On the contrary, the reporter eGFP sequence contains a high proportion of G / C that also hinders a design that should be compatible with the simultaneous detection of ASFV VP72 and EP153R targets. Obtaining a similar sensitivity for each PCR target gene was key to setting the final DIVA triplex PCR test (Tables 7 and 8). Table 7: Triplex PCR analysis of 10-fold serial dilutions of a blood sample collected at 7 dpi from a pig experimentally infected with a virulent genotype II strain. E70 is the reference Spain70 genotype I strain. Table 8. Single vs. triplex PCR analysis for each amplification target of a 10~2dilution of the parental Lv17 / wb / RIE1 and vaccine Lv17 / WB / Rie1 -ACD genotype II strains. E70 is the reference Spain70 genotype I strain.

[0200] Once triplex DIVA PCR conditions were optimized, a panel of 53 porcine samples collected from previous in vivo experimental study, performed to define the safety and protection of the Lv17 / WB / Rie1-ACD vaccine prototype, were analyzed. Other 66 blood samples collected during experimental studies testing two additional Lv17 / WB / Rie1 -derived mutants (Lv17 / WB / Rie1-ACD+AUK and Lv17 / WB / Rie1-AEP153) were tested. Finally, 19 porcine samples from pigs experimentally inoculated with the parental Lv17 / WB / Rie1 were incorporated in the study.

[0201] Specifically, DNA extraction was followed by the triplex DIVA PCR assay that was run in parallel to the routine ASFV diagnostic PCR test (VP72 gene, described by J. Fernandez- Pinero et al, 2013 Transbound Emerg Dis. 60(1):48-58). From the PCR results it is worth remarking the following:

[0202] • As expected, blood samples (n=21) taken before vaccination with any prototype reported negative PCR result.

[0203] • After immunization with any mutant containing AEP153, results of DIVA PCR for the VP72 and eGFP genes detection were in agreement with the parallel results of routine VP72 PCR, while samples remained negative for EP153R (n=32).

[0204] • After challenge with the virulent Armenia strain, DIVA PCR allowed the discrimination of the presence of the vaccine prototype and the challenge virus in the 97% of blood samples reporting a positive result for the routine VP72 PCR (n=32). Even more, DIVA PCR reported very similar Ct values for any of the target genes confirming the high analogous sensitivity, being able to identify the co-infection status in 4 samples. Due to the very low level of viremia produced in the animals, some discordant (n=2) and inconclusive results (n=7) were obtained for samples showing a Ct>36 in any of the target genes. These samples are at the extreme detection limit of the PCR and are usually difficult to reproduce. Finally, 27 blood samples remained negative to all target genes.

[0205] • Besides, DIVA PCR reported concordant results for the VP72 and EP153R genes in the 75% of the blood samples collected from pigs inoculated with the parental Lv17 / WB / Rie1 , while all remained negative for eGFP (n=12). In detail, 3 blood samples reporting amplification for VP72 gene (Ct range 30-33), were negative for EP153R gene. These samples will require further studies to explain and resolve these discordant results.

Claims

CLAIMS An in vitro diagnostic method to differentiate African Swine Fever Virus (ASFV) infected animals from animals which have been vaccinated against ASFV using an immunogenic composition comprising an attenuated ASFV in which the EP153R gene and the EP402R gene have been inactivated and wherein the region of the ASFV genome comprising the EP402R and the EP153R genes is replaced by a heterologous gene, the method comprising:(i) testing a sample from said animal for the presence of a first marker and of second marker, wherein the first marker is selected from the group consisting: an antibody against an ASFV-specific antigen which is not the EP402R gene product or the EP153R gene product and an ASFV gene or fragment thereof which is not the EP402R gene or the EP153R gene, and wherein the second marker is a “first ASFV vaccine marker” and / or a “second ASFV vaccine marker” wherein the first ASFV vaccine marker is selected from the group consisting of an antibody against the EP402R gene product or against the EP153R gene product and the EP402R gene or a fragment thereof or the EP153R gene or a fragment thereof and wherein the second ASFV vaccine marker is selected from the group consisting of: an antibody specific for the heterologous gene product or the heterologous gene or a fragment thereof and and(ii) identifying the animal as a) having been vaccinated if the at least one first marker and the second ASFV vaccine marker are detected or b) having been infected if the at least one first marker is detected and, optionally, the first ASFV vaccine marker is detected or the second ASFV vaccine marker is not detected. The method according to claim 1 wherein the identification of the animal as vaccinated is further confirmed by testing the first ASFV vaccine marker, wherein the animal is confirmed as vaccinated if said marker is not detected.. The method according to claim 1 wherein the identification of the animal as infected is further confirmed by testing the first ASFV vaccine marker, wherein said first ASFV vaccine marker is a genotype II specific marker, wherein the animal is confirmed as infected by an ASFV strain of genotype II if said marker is detected or as infected by an ASFV strain of a genotype other than genotype II if said marker is not detected.

4. The method according to claim 1 wherein the animal is identified as having been vaccinated and infected with an ASFV strain if the first marker is detected, the first ASFV vaccine marker is detected and the second ASFV vaccine marker are detected.

5. The method according to any one of claims 1 to 4 wherein the antibody against an ASFV-specific antigen which is not the EP402R gene product or the EP153R gene product is an antibody against the p72, an antibody against the CP312 or an antibody against the p30 gene product or wherein the ASFV gene which is not the EP402R gene or the EP153R gene is the p72 gene, the CP312 gene or the p30 gene.

6. The method according to any one of claims 1 to 5 wherein the first ASFV vaccine marker is an antibody against EP153R, an antibody against EP402R, the EP153R gene or a fragment thereof or the EP402R gene or fragment thereof.

7. The method according to claim 6 wherein the antibody against EP153R is specific for the EP153R as defined in SEQ ID NO:1 , wherein the EP153R gene is as defined in SEQ ID NO:2, wherein the antibody against EP402R is specific for the EP402R as defined in SEQ ID NO:3 , wherein the EP402R gene is as defined in SEQ ID NO:4.

8. The method according to any one of claims 1 to 7 wherein the heterologous gene is the eGFP gene.

9. The method according to any of claims 1 to 8 wherein the method does not comprise testing the sample for antibodies against the DP143R, the 9GL / B119L, the MGF_360- 12L, the MGF-13L and the MGF_360-14L gene products and / or wherein the method does not comprise testing the sample for the presence of the DP143R, the 9GL / B119L, the MGF_360-12L, the MGF-13L and the MGF_360-14L genes or fragments thereof.

10. The method according to any one of claims 1 to 9 wherein the first and the second marker are genes or gene fragments.11 . The method according to claim 10 wherein the detection of the first and second markers is carried out by a polymerase chain reaction (PCR), preferably a real-time PCR.

12. The method according to claim 11 wherein each PCR fragments is detected using a specific TaqMan probe.

13. The method according to claims 11 or 12 wherein the PCR is a multiplex PCR wherein the first and second markers are detected in the same reaction.

14. The method according to claims 11 to 13 wherein: the first marker is the ASFV p72 gene and the PCR is carried out with the forward primer of SEQ ID NO: 5 and the reverse primer of SEQ ID NO: 6.The first ASFV vaccine marker is the EP153R gene and the PCR is carried out with the forward primer SEQ ID NO: 8 and the reverse primer of SEQ ID NO: 9 and / orThe second ASFV vaccine marker is the eGFP gene and the PCR is carried out with the forward primer SEQ ID NO: 11 and the reverse primer of SEQ ID NO: 12.

15. The method according to claim 14 wherein the p72 gene PCR fragment is detected with a TaqMan probe comprising a sequence as defined in SEQ ID NO: 7, the EP153R gene PCR fragment is detected with a TaqMan probe comprising a sequence as defined in SEQ ID NO: 10 and / or the eGFP gene PCR fragment is detected with a TaqMan probe comprising a sequence as defined in SEQ ID NO: 13.

16. The method according to any of claims 14 or 15 wherein the TaqMan probe specific for p72 gene PCR fragment is labelled with 6-FAM, the TaqMan probe specific for the EP153R gene PCR fragment is labelled with JOE and / or the TaqMan probe specific for the eGFP gene PCR fragment is labelled with Cy5.

17. The method according to claim 16 wherein the TaqMan probe specific for p72 gene PCR fragment contains BHQ1 as quencher, the TaqMan probe specific for the EP153R gene PCR fragment contains BHQ1 as quencher and / or the TaqMan probe specific for the eGFP gene PCR fragment contains BBQ as quencher.

8. The method according to claim 17 wherein the reagents used for the detection of the first marker comprise a primer pair having the sequences of SEQ ID NO:5 and 6 and aTaqMan probe having the sequence 6FAM-TCCTGGCCRACCAAGTGCTT-BHQ1 (SEQ ID NO: 7), the reagents used for the detection of first ASFV vaccine marker comprise a primer pair having the sequences of SEQ ID NO:8 and 9 and a TaqMan probe having the sequence JOE*-AGGAG+AGATTAATAAA+C+CAATA+T+GTTACC- BHQ1 (SEQ ID NO: 10) and the reagents used for the detection of second ASFV vaccine marker comprise a primer pair having the sequences of SEQ ID NO:11 and 12 and a TaqMan probe having the sequence Cy5-TGTAGTTGTACTCCAGCTTGTGCC-BBQ (SEQ ID NO: 13), wherein R indicates A or G and + indicates LNA nucleotides.

19. The method according to any one of claims 1 to 9 wherein the first and second markers are antibodies.

20. The method according to any of claim 18 wherein the detection of the first and second markers is carried out by an immunoassay.

21. The method according to claim 19 wherein the immunoassay involves the capture of the antibodies using immobilized antigens which can be specifically bound by said antibodies.

22. The method according to claim 20 wherein the immunoassay involves the capture of the antibodies against the EP153R gene product and the capture is carried out using the EP153R gene product or a fragment thereof.

23. The method according to any of claims 20 to 22 wherein the immunoassay is a sandwich immunoassay wherein the antibodies are captured using the EP153R gene product or a fragment thereof and the captured antibodies are detected using antibodies specific for swine antibodies.

24. The method according to any of claims 1 to 23 wherein if the first and second markers are antibodies, the sample is a serum sample or wherein if the first and second markers are genes or gene fragments, then the sample is a blood sample.

25. A kit comprising(i) reagents suitable for the detection of a first marker, wherein the first marker is selected from the group consisting: an antibody against an ASFV-specific antigen which is not the EP402R gene product or the EP153R gene product andan ASFV gene or fragment thereof which is not the EP402R gene or the EP153R gene and(ii) reagents suitable for the detection of a second marker, wherein the second marker is a “first ASFV vaccine marker” and / or a “second ASFV vaccine marker” wherein the first ASFV vaccine marker is selected from the group consisting of an antibody against the EP402R gene product or against the EP153R gene product and the EP402R gene or a fragment thereof or the EP153R gene or a fragment thereof and wherein the second ASFV vaccine marker is selected from the group consisting of: an antibody specific for an heterologous gene product or an heterologous gene or a fragment thereof and26. The kit according to claim 25 wherein the first marker is an antibody against an ASFV- specific antigen which is not the EP402R gene product or the EP153R gene product, in which case the reagent is the ASFV-specific antigen.

27. The kit according to claim 25 or 26 wherein the first marker is an ASFV gene or fragment thereof which is not the EP402R gene or the EP153R gene and wherein the reagents is a primer pair and / or probe which is specific for said gene or gene fragment.

28. The kit according to any one of the claims 25 to 27 wherein if the second marker is an antibody against the EP402R gene product, then the reagent is the EP402R gene product or an immunogenic fragment thereof and wherein if the second marker is an antibody against the EP153R gene product, then the reagent is the EP153R gene product or an immunogenic fragment thereof.

29. The kit according to any one of the claims 25 to 28 wherein if the second marker is the EP402R gene or a fragment thereof, then the reagent is a primer or probe specific for the EP402R gene product or the fragment thereof and wherein if the second marker is the EP153R gene or a fragment thereof, then the reagent is a primer or probe specific for the EP153R gene product or the fragment thereof.

30. The kit according to claims 28 or 29 wherein the reagent specific for the antibody against EP153R is specific for the antibody against EP153R of SEQ ID NO:1 and / orwherein the reagent specific for the antibody against EP402R is specific for the antibody against EP402R of SEQ ID NO:2.

31. The kit according to any one of claims 25 to 30 wherein if the second marker is an antibody against the heterologous gene product, then the reagent is the heterologous gene product or an immunogenic fragment thereof.

32. The kit according to any one of claims 25 to 31 wherein if the second marker is the heterologous gene or a fragment thereof, then the reagent is a primer or probe specific for the heterologous gene product or the fragment thereof.

33. The kit according to any of claims 25 to 32 wherein the ASFV-specific antigen which is not the EP402R gene product or the EP153R gene product is the p72, the CP312 and / or the p30 antigen or wherein the ASFV gene which is not the EP402R gene or the EP153R gene is the p72 gene, the CP312 gene or the p30 gene.

34. The kit according to any of claims 25 to 33 wherein the heterologous gene is the eGFP gene or wherein the heterologous gene product is the eGFP protein.

35. The kit according to any of claims 25 to 34 wherein the kit does not comprise reagents for the detection of antibodies against the DP143R, the 9GL / B119L, the MGF_360-12L, the MGF-13L and the MGF_360-14L gene products and / or does not comprise reagents for the detection of the DP143R, the 9GL / B119L, the MGF_360-12L, the MGF-13L and the MGF_360-14L genes or fragments thereof.

36. The kit according to any of claims 25 to 35 wherein the first and second reagents are primers and / or probes.

37. The kit according to claim 36 wherein the primers are the primers according to SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11 and SEQ ID NO: 12.

38. The kit according to claim 36 or 37 wherein the probes are the probes according to SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 13.

39. The kit according to claim 38 wherein the TaqMan probe specific for p72 gene PCR fragment contains BHQ1 as quencher, the TaqMan probe specific for the EP153R genePCR fragment contains BHQ1 as quencher and / or the TaqMan probe specific for the eGFP gene PCR fragment contains BBQ as quencher. The kit according to any of claims 25 to 35 wherein the first and second reagents are polypeptides. The kit according to claim 40 wherein the polypeptides are immobilized on a support. The kit according to claims 40 or 41 wherein the kit further comprises antibodies specific for swine antibodies. Use of a kit according to any of claims 25 to 42 in an in vitro diagnostic method to differentiate African Swine Fever Virus (ASFV) infected animals from animals which have been vaccinated against ASFV using an immunogenic composition comprising an attenuated ASFV in which the EP153R gene and the EP402R gene have been inactivated and wherein the region of the ASFV genome comprising the EP402R and the EP153R genes is replaced by a heterologous gene.