Modified immunomodulators
Patent Information
- Application Number
- EP2023828252
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-12-09
- Filing Date
- 2023-12-08
- Publication Date
- 2025-10-15
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Nucleic acid therapies face barriers due to unwanted stimulation of the innate immune system, leading to side effects and decreased expression of therapeutic proteins, as foreign nucleic acids are recognized by pattern recognition receptors, triggering immune responses.
The use of modified oligonucleotides and lipid nanoparticles that include TLR antagonists to inhibit immune responses and increase the expression of therapeutic proteins, with specific sequences and sugar-modified nucleosides to reduce immune recognition and enhance protein expression.
The approach effectively decreases immune responses and increases protein expression in subjects receiving nucleic acid therapy, improving the efficacy and safety of genetic disorder treatments.
Smart Images

Figure 1.1
Abstract
Description
MODIFIED IMMUNOMODULATORSBACKGROUNDTechnical Field
[0001] The present disclosure provides oligonucleotides and modified oligonucleotides, lipid nanoparticles comprising oligonucleotides and modified oligonucleotides, methods for reducing or suppressing an immune response and / or for increasing the expression of the protein encoded by a nucleic acid included in the lipid nanoparticles in a subject receiving nucleic acid therapy, and methods for treating a genetic disorder in a subject.Background
[0002] Unwanted stimulation of the innate immune system by foreign nucleic acids has been one of the barriers preventing nucleic acid-base therapies from reaching market. Foreign nucleic acids can be recognized by multiple pattern recognition receptors (PRRs), e.g., Toll-like receptors (TLRs), which trigger a signaling cascade to activate host defense systems, leading to a range of side effects or decrease of expression of a therapeutic protein encoded by the nucleic acids.
[0003] Accordingly, there is a need in the art for new technology that increase expression of a therapeutic protein encoded by the nucleic acids and / or that inhibits, e.g., reduces, suppresses, prevents, decreases, ameliorates, mitigates, eliminates or prevents, the immune response following administration nucleic acids, e.g., DNA- or RNA-based nucleic acid therapeutics, to a subject that may permit expression of a therapeutic protein in a cell, tissue or subject for the treatment of a wide variety of diseases.BRIEF SUMMARY
[0004] The present disclosure provides oligonucleotides, methods, and pharmaceutical compositions, e.g., lipid nanoparticles, for inhibiting, e.g., reducing or suppressing, an immune response, and / or for increasing the expression of the protein encoded by a nucleic acid included in the compositions in a subject who may suffer from a disease, condition, or disorder, e.g., a genetic disorder, and receiving gene or nucleic acid therapy. In some embodiments, the pharmaceutical compositions and formulations may include one or more ingredients that may reduce the immune response, e.g., the innate immune response, such TLR antagonists, e.g., TLR9 antagonists.
[0005] In the prior art, compositions for nucleic acid therapy comprise a therapeutic nucleic acid covalently bound to an oligonucleotide. The compositions of the present disclosure comprise separate therapeutic nucleic acid and oligonucleotide molecules. The immune response is surprisingly decreased and / or the expression of the protein encoded by the therapeutic nucleic acid is surprisingly increased in a subject following administration of the present compositions. Moreover, compositions comprising the modified oligonucleotides of the present disclosure cause a surprising decrease immune response and / or a surprising increase protein expression in a subject.
[0006] In one aspect, the present disclosure provides a modified oligonucleotide (ODN) comprising the sequence: uuagggttagggttagggtuaggg (SEQ ID NO. 1), ttagggttagggttagggttaggg (SEQ ID NO. 2), ttcaaattcaaattcaaattcaaa (SEQ ID NO. 3), tgggcggttcaaccttca (SEQ ID NO. 4), tgactgtgaaggttagagatga (SEQ ID NO. 5), uuagggttagggttaggguuaggg (SEQ ID NO. 6), cctcattagggtgaggg (SEQ ID NO. 7), uuagggutagggttaggguuaggg (SEQ ID NO. 8), uuaggguuagggttaggguuaggg (SEQ ID NO. 9), uuaggguuaggguuaggguuaggg (SEQ ID NO. 10), uuagggttagggttagggttaggg (SEQ ID NO. 11), utcaaattcaaattcaaattcaaa (SEQ ID NO. 12), uucaaattcaaattcaaattcaaa (SEQ ID NO. 13), uucaaattcaaattcaaatucaaa (SEQ ID NO. 14), ccucattagggtgaggg (SEQ ID NO. 15), ugggcggttcaaccttca (SEQ ID NO. 16), or ugggcggttcaaccuuca (SEQ ID NO. 17); wherein:
[0007] the sequences are written left to right in 5' to 3' orientation;
[0008] a is adenosine, deoxyadenosine, or sugar-modified versions thereof;
[0009] c is cytidine, deoxycytidine, or sugar-modified versions thereof;
[0010] g is guanosine, deoxyguanosine, or sugar-modified versions thereof;
[0011] t is 5-methyluridine, thymidine, or sugar-modified versions thereof;
[0012] u is uridine, deoxyuridne, or sugar-modified versions thereof;
[0013] the internucleoside linkages are phosphodiester, phosphorothioate, or phosphorodithioate linkages, or a combination thereof; and
[0014] at least one of the a, c, g, t, and / or u nucleosides is a sugar-modified version thereof independently selected from the group consisting of
[0015] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 1.
[0016] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 2.
[0017] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 3.
[0018] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 4.
[0019] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 5.
[0020] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 6.
[0021] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 7.
[0022] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 8.
[0023] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 9.
[0024] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 10.
[0025] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 11.
[0026] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 12.
[0027] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 13.
[0028] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 14.
[0029] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 15.
[0030] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 16.
[0031] In another aspect, the present disclosure provides a modified ODN having SEQ ID NO. 17.
[0032] In another aspect, the present disclosure provides an ODN or modified ODN described in Table 1, below.
[0033] In another aspect, the present disclosure provides a lipid nanoparticle comprising a modified ODN of any one of SEQ ID Nos. 1-17 and a therapeutic nucleic acid.
[0034] In another aspect, the present disclosure provides a lipid nanoparticle comprising a modified ODN of any one of SEQ ID Nos. 1-17; a cationic lipid; a non-cationic lipid; and a therapeutic nucleic acid.
[0035] In another aspect, the present disclosure provides a method for inhibiting an immune response in a subject in need thereof, the method comprising administering to the subject a lipid nanoparticle comprising a modified ODN of any one of SEQ ID Nos. 1-17 and a therapeutic nucleic acid.
[0036] In another aspect, the present disclosure provides methods of treating a disease, disorder, or condition in a subject in need thereof, e.g., a genetic disorder, the method comprising administering to the subject a lipid nanoparticle comprising a modified ODN of any one of SEQ ID Nos. 1-17 and a therapeutic nucleic acid.BRIEF DESCRIPTION OF DRAWINGS
[0037] Fig. 1 A is a bar graph showing the luciferase expression enhancement after administration of LNPs of the Disclosure.
[0038] Fig. IB is a bar graph showing the in vivo cytokine suppression after administration of LNPs of the Disclosure.
[0039] Fig. 2A is a bar graph showing the luciferase expression enhancement after administration of LPNs loading an ODN (A151 (SEQ ID NO. 19)) and mRNA, or pGL4.5.
[0040] Fig. 2B is a bar graph showing the plasma IFN-a cytokine concentration after administration of LPNs loading an ODN (A151 (SEQ ID NO. 19)) and mRNA, or pGL4.5.
[0041] Fig. 3 A is a bar graph showing the luciferase expression enhancement after administration of LPNs loading an ODN of the Disclosure and DNA.
[0042] Fig. 3B is a bar graph showing the plasma IFN-a concentration after administration of LPNs loading an ODN of the Disclosure and DNA.
[0043] Fig. 4A is a bar graph showing the luciferase expression enhancement after administration of LPNs loading DNA and an ODN of the Disclosure.
[0044] Fig. 4B is a bar graph showing the plasma IFN-a concentration after administration of LPNs loading DNA and an ODN of the Disclosure.DETAILED DESCRIPTIONI. Oligodeoxynucleotides (ODNs) and Modified ODNs
[0045] In one embodiment, the disclosure provides an oligonucleotide (ODN) comprising the sequence: uuagggttagggttagggtuaggg (SEQ ID NO. 1), ttagggttagggttagggttaggg (SEQ ID NO. 2), ttcaaattcaaattcaaattcaaa (SEQ ID NO. 3), tgggcggttcaaccttca (SEQ ID NO. 4), tgactgtgaaggttagagatga (SEQ ID NO. 5), uuagggttagggttaggguuaggg (SEQ ID NO. 6), cctcattagggtgaggg (SEQ ID NO. 7), uuagggutagggttaggguuaggg (SEQ ID NO. 8), uuaggguuagggttaggguuaggg (SEQ ID NO. 9), uuaggguuaggguuaggguuaggg (SEQ ID NO. 10), uuagggttagggttagggttaggg (SEQ ID NO. 11), utcaaattcaaattcaaattcaaa (SEQ ID NO. 12), uucaaattcaaattcaaattcaaa (SEQ ID NO. 13), uucaaattcaaattcaaatucaaa (SEQ ID NO. 14), ccucattagggtgaggg (SEQ ID NO. 15), ugggcggttcaaccttca (SEQ ID NO. 16), or ugggcggttcaaccuuca (SEQ ID NO. 17); wherein:
[0046] the sequences are written left to right in 5' to 3' orientation;
[0047] a is adenosine or deoxy adenosine;
[0048] c is cytidine or deoxy cytidine;
[0049] g is guanosine or deoxy guanosine;
[0050] t is 5-methyluridine or thymidine;
[0051] u is uridine or deoxyuridne; and
[0052] the internucleoside linkages are phosphodiester, phosphorothioate, or phosphorodithioate linkages, or a combination thereof.
[0053] In another embodiment (referred to as "Embodiment 1 "), the disclosure provides a modifiedODN comprising the any one of SEQ ID NOs. 1-17, wherein:
[0054] the sequences are written left to right in 5' to 3' orientation;
[0055] a is adenosine, deoxyadenosine, or sugar-modified versions thereof;
[0056] c is cytidine, deoxycytidine, or sugar-modified versions thereof;
[0057] g is guanosine, deoxyguanosine, or sugar-modified versions thereof;
[0058] t is 5-methyluridine, thymidine, or sugar-modified versions thereof;
[0059] u is uridine, deoxyuridne, or sugar-modified versions thereof;
[0060] the internucleoside linkages are phosphodiester, phosphorothioate, or phosphorodithioate linkages, or a combination thereof; and
[0061] at least one of the a, c, g, t, or u nucleosides is a sugar-modified version thereof independently selected from the group consisting of:
[0062] With respect to the modified ODNs of Embodiment 1, the disclosure provides the following particular embodiments.
[0063] Embodiment 2. The modified ODN of Embodiment 1 comprising the sequence: uuagggttagggttagggtuaggg (SEQ ID NO. 1).
[0064] Embodiment 3. The modified ODN of Embodiments 1 or 2, wherein at least four of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0065] Embodiment 4. The modified ODN of Embodiment 3, wherein at least six of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0066] Embodiment s. The modified ODN of Embodiment 4, wherein the nucleosides marked with an u*u*a*gggttagggttagggtuag*g*g* (SEQ ID NO. 105) are sugar-modified versions of u, a, and / or g.
[0067] Embodiment 6. The modified ODN of Embodiment 4, wherein at least eight of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0068] Embodiment 7. The modified ODN of Embodiment 6, wherein the nucleosides marked with an u*u*a*g*ggttagggttagggtua*g*g*g* (SEQ ID NO. 106) are sugar-modified versions of u, a, and / or g.
[0069] Embodiment 8. The modified ODN of Embodiment 6, wherein at least ten nucleosides of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0070] Embodiment 9. The modified ODN of Embodiment 8, wherein the nucleosides marked with an u*u*a*g*g*gttagggttagggtu*a*g*g*g* (SEQ ID NO. 107) are sugar-modified versions of u, a, and / or g.
[0071] Embodiment 10. The modified ODN of Embodiment 8, wherein at least twelve of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0072] Embodiment 11. The modified ODN of Embodiment 10, wherein the nucleosides marked with an u*u*a*g*g*g*ttagggttagggt*u*a*g*g*g* (SEQ ID NO. 108) are sugar-modified versions of u, a, t, and / or g.
[0073] Embodiment 12. The modified ODN of Embodiment 10, wherein at least fourteen nucleosides of the a, c, g, t, and / or u nucleosides are sugar-modified versions thereof.
[0074] Embodiment 13. The modified ODN of Embodiment 12, wherein the nucleosides marked with an u*u*a*g*g*g*t*tagggttaggg*t*u*a*g*g*g* (SEQ ID NO. 109) are sugar-modified versions of u, a, t, and / or g.
[0075] Embodiment 14. The modified ODN of Embodiment 12, wherein at least eighteen nucleosides of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0076] Embodiment 15. The modified ODN of Embodiment 14, wherein the nucleosides marked with anu*u*a*g*g*g*t*t*a*gggttag*g*g*t*u*a*g*g*g* (SEQ ID NO. 110) are sugar-modified versions of u, a, t, and / or g.
[0077] Embodiment 16. The modified ODN of Embodiment 14, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.
[0078] Embodiment 17. The modified ODN of Embodiment 3, wherein all of the g nucleosides are sugar-modified versions thereof.
[0079] Embodiment 18. The modified ODN of Embodiment 3, wherein all of the a nucleosides are sugar-modified versions thereof.
[0080] Embodiment 19. The modified ODN of Embodiment 1 comprising the sequence (also known as Al 51): ttagggttagggttagggttaggg (SEQ ID NO. 2).
[0081] Embodiment 20. The modified ODN of Embodiment 19, wherein at least four of the a, g, and / or t nucleosides are sugar-modified versions thereof.
[0082] Embodiment 21. The modified ODN of Embodiment 20, wherein at least six of the a, g, and / or t nucleosides are sugar-modified versions thereof.
[0083] Embodiment 22. The modified ODN of Embodiment 21, wherein the nucleosides marked with an t*t*a*gggttagggttagggttag*g*g* (SEQ ID NO. I l l) are sugar-modified versions of a, g, and / or t.
[0084] Embodiment 23. The modified ODN of Embodiment 21, wherein at least eight of the a, g, and / or t nucleosides are sugar-modified versions thereof.
[0085] Embodiment 24. The modified ODN of Embodiment 23, wherein the nucleosides marked with an t*t*a*g*ggttagggttagggtta*g*g*g* (SEQ ID NO. 112) are sugar-modified versions of a, g, and / or t.
[0086] Embodiment 25. The modified ODN of Embodiment 23, wherein at least ten nucleosides of the a, g, and / or t nucleosides are sugar-modified versions thereof.
[0087] Embodiment 26. The modified ODN of Embodiment 25, wherein the nucleosides marked with an t*t*a*g*g*gttagggttagggtt*a*g*g*g* (SEQ ID NO. 113) are sugar-modified versions of a, g, and / or t.
[0088] Embodiment 27. The modified ODN of Embodiment 25, wherein at least twelve of the a, g, and / or t nucleosides are sugar-modified versions thereof.
[0089] Embodiment 28. The modified ODN of Embodiment 27, wherein the nucleosides marked with an t*t*a*g*g*g*ttagggttagggt*t*a*g*g*g* (SEQ ID NO. 114) are sugar-modified versions of a, g, and / or t.
[0090] Embodiment 29. The modified ODN of Embodiment 27, wherein at least fourteen nucleosides of the a, g, and / or t nucleosides are sugar-modified versions thereof.
[0091] Embodiment 30. The modified ODN of Embodiment 29, wherein the nucleosides marked with an t*t*a*g*g*g*t*tagggttaggg*t*t*a*g*g*g* (SEQ ID NO. 115) are sugar-modified versions of a, g, and / or t.
[0092] Embodiment 31. The modified ODN of Embodiment 29, wherein at least eighteen nucleosides of the a, g, and / or t nucleosides are sugar-modified versions thereof.
[0093] Embodiment 32. The modified ODN of Embodiment 31, wherein the nucleosides marked with an t*t*a*g*g*g*t*t*a*gggttag*g*g*t*t*a*g*g*g* (SEQ ID NO. 116) are sugar-modified versions of a, g, and / or t.
[0094] Embodiment 33. The modified ODN of Embodiment 31, wherein all of the a, g, and t nucleosides are sugar-modified versions thereof.
[0095] Embodiment 34. The modified ODN of Embodiment 19, wherein all of the g nucleosides are sugar-modified versions thereof.
[0096] Embodiment 35. The modified ODN of Embodiment 19, wherein all of the a nucleosides are sugar-modified versions thereof.
[0097] Embodiment 36. The modified ODN of Embodiment 1 comprising the sequence (also known as C151): ttcaaattcaaattcaaattcaaa (SEQ ID NO. 3).
[0098] Embodiment 37. The modified ODN of Embodiment 36, wherein at least four of the a, c, and / or t nucleosides are sugar-modified versions thereof.
[0099] Embodiment 38. The modified ODN of Embodiment 37, wherein at least six of the a, c, and / or t nucleosides are sugar-modified versions thereof.
[0100] Embodiment 39. The modified ODN of Embodiment 38, wherein the nucleosides marked with an t*t*c*aaattcaaattcaaattca*a*a* (SEQ ID NO. 117) are sugar-modified versions of a, c, and / or t.
[0101] Embodiment 40. The modified ODN of Embodiment 38, wherein at least eight of the a, c, and / or t nucleosides are sugar-modified versions thereof.
[0102] Embodiment 41. The modified ODN of Embodiment 40, wherein the nucleosides marked with an t*t*c*a*aattcaaattcaaattc*a*a*a* (SEQ ID NO. 118) are sugar-modified versions of a, c, and / or t.
[0103] Embodiment 42. The modified ODN of Embodiment 40, wherein at least ten nucleosides of the a, c, and / or t nucleosides are sugar-modified versions thereof.
[0104] Embodiment 43. The modified ODN of Embodiment 42, wherein the nucleosides marked with an t*t*c*a*a*attcaaattcaaatt*c*a*a*a* (SEQ ID NO. 119) are sugar-modified versions of a, c, and / or t.
[0105] Embodiment 44. The modified ODN of Embodiment 42, wherein at least twelve of the a, c, and / or t nucleosides are sugar-modified versions thereof.
[0106] Embodiment 45. The modified ODN of Embodiment 44, wherein the nucleosides marked with an t*t*c*a*a*a*ttcaaattcaaat*t*c*a*a*a* (SEQ ID NO. 120) are sugar-modified versions of a, c, and / or t.
[0107] Embodiment 46. The modified ODN of Embodiment 44, wherein at least fourteen nucleosides of the a, c, and / or t nucleosides are sugar-modified versions thereof.
[0108] Embodiment 47. The modified ODN of Embodiment 46, wherein the nucleosides marked with an t*t*c*a*a*a*t*tcaaattcaaa*t*t*c*a*a*a* (SEQ ID NO. 121) are sugar-modified versions of a, c, and / or t.
[0109] Embodiment 48. The modified ODN of Embodiment 46, wherein at least eighteen nucleosides of the a, c, and / or t nucleosides are sugar-modified versions thereof.
[0110] Embodiment 49. The modified ODN of Embodiment 48, wherein the nucleosides marked with ant*t*c*a*a*a*t*t*c*aaattca*a*a*t*t*c*a*a*a* (SEQ ID NO. 122) are sugar-modified versions of a, c, and / or t.[oni] Embodiment 50. The modified ODN of Embodiment 36, wherein all of the a, c, and t nucleosides are sugar-modified versions thereof.
[0112] Embodiment 51. The modified ODN of Embodiment 36, wherein all of the c nucleosides are sugar-modified versions thereof.
[0113] Embodiment 52. The modified ODN of Embodiment 36, wherein all of the a nucleosides are sugar-modified versions thereof.
[0114] Embodiment 53. The modified ODN of Embodiment 1 comprising the sequence: tgggcggttcaaccttca (SEQ ID NO. 4).
[0115] Embodiment 54. The modified ODN of Embodiment 53, wherein at least four of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0116] Embodiment 55. The modified ODN of Embodiment 54, wherein at least six of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0117] Embodiment 56. The modified ODN of Embodiment 55, wherein the nucleosides marked with an t*g*g*gcggttcaacctt*c*a* (SEQ ID NO. 123) are sugar-modified versions of a, c, g, and / or t.
[0118] Embodiment 57. The modified ODN of Embodiment 55, wherein at least eight of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0119] Embodiment 58. The modified ODN of Embodiment 57, wherein the nucleosides marked with an t*g*g*g*cggttcaacct*t*c*a* (SEQ ID NO. 124) are sugar-modified versions of a, c, g, and / or t.
[0120] Embodiment 59. The modified ODN of Embodiment 57, wherein at least ten nucleosides of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0121] Embodiment 60. The modified ODN of Embodiment 59, wherein the nucleosides marked with an t*g*g*g*c*ggttcaacc*t*t*c*a* (SEQ ID NO. 125) are sugar-modified versions of a, c, g, and / or t.
[0122] Embodiment 61. The modified ODN of Embodiment 59, wherein at least twelve of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0123] Embodiment 62. The modified ODN of Embodiment 61, wherein the nucleosides marked with an t*g*g*g*c*g*gtcaac*c*t*t*c*a* (SEQ ID NO. 126) are sugar-modified versions of a, c, g, and / or t.
[0124] Embodiment 63. The modified ODN of Embodiment 61, wherein at least fourteen nucleosides of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0125] Embodiment 64. The modified ODN of Embodiment 63, wherein the nucleosides marked with an t*g*g*g*c*g*g*ttcaa*c*c*t*t*c*a* (SEQ ID NO. 127) are sugar-modified versions of a, c, g, and / or t.
[0126] Embodiment 65. The modified ODN of Embodiment 53, wherein all of the a, c, and t nucleosides are sugar-modified versions thereof.
[0127] Embodiment 66. The modified ODN of Embodiment 53, wherein all of the t nucleosides are sugar-modified versions thereof.
[0128] Embodiment 67. The modified ODN of Embodiment 53, wherein all of the g nucleosides are sugar-modified versions thereof.
[0129] Embodiment 68. The modified ODN of Embodiment 1 comprising the sequence: tgactgtgaaggttagagatga (SEQ ID NO. 5).
[0130] Embodiment 69. The modified ODN of Embodiment 68, wherein at least four of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0131] Embodiment 70. The modified ODN of Embodiment 69, wherein at least six of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0132] Embodiment 71. The modified ODN of Embodiment 70, wherein the nucleosides marked with an t*g*a*ctgtgaaggttagagat*g*a* (SEQ ID NO. 128) are sugar-modified versions of a, g, and / or t.
[0133] Embodiment 72. The modified ODN of Embodiment 70, wherein at least eight of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0134] Embodiment 73. The modified ODN of Embodiment 72, wherein the nucleosides marked with an t*g*a*c*tgtgaaggttagaga*t*g*a* (SEQ ID NO. 129) are sugar-modified versions of a, c, g, and / or t.
[0135] Embodiment 74. The modified ODN of Embodiment 72, wherein at least ten nucleosides of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0136] Embodiment 75. The modified ODN of Embodiment 74, wherein the nucleosides marked with an t*g*a*c*t*gtgaaggttagag*a*t*g*a* (SEQ ID NO. 130) are sugar-modified versions of a, c, g, and / or t.
[0137] Embodiment 76. The modified ODN of Embodiment 74, wherein at least twelve of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0138] Embodiment 77. The modified ODN of Embodiment 76, wherein the nucleosides marked with an t*g*a*c*t*g*tgaaggttaga*g*a*t*g*a* (SEQ ID NO. 131) are sugar-modified versions of a, c, g, and / or t.
[0139] Embodiment 78. The modified ODN of Embodiment 76, wherein at least fourteen nucleosides of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0140] Embodiment 79. The modified ODN of Embodiment 78, wherein the nucleosides marked with an t*g*a*c*t*g*t*gaaggttag*a*g*a*t*g*a* (SEQ ID NO. 132) are sugar-modified versions of a, c, g, and / or t.
[0141] Embodiment 80. The modified ODN of Embodiment 78, wherein at least eighteen nucleosides of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0142] Embodiment 81. The modified ODN of Embodiment 80, wherein the nucleosides marked with an t*g*a*c*t*g*t*g*aaggtta*g*a*g*a*t*g*a* (SEQ ID NO. 133) are sugar-modified versions of a, c, g, and / or t.
[0143] Embodiment 82. The modified ODN of Embodiment 68, wherein all of the a, c, g, and t nucleosides are sugar-modified versions thereof.
[0144] Embodiment 83. The modified ODN of Embodiment 68, wherein all of the t nucleosides are sugar-modified versions thereof.
[0145] Embodiment 83. The modified ODN of Embodiment 68, wherein all of the g nucleosides are sugar-modified versions thereof.
[0146] Embodiment 84. The modified ODN of Embodiment 1 comprising the sequence: uuagggttagggttaggguuaggg (SEQ ID NO. 6).
[0147] Embodiment 85. The modified ODN of Embodiment 84, wherein at least four of the a, u, g, and / or t nucleosides are sugar-modified versions thereof.
[0148] Embodiment 86. The modified ODN of Embodiment 85, wherein at least six of the a, u, g, and / or t nucleosides are sugar-modified versions thereof.
[0149] Embodiment 87. The modified ODN of Embodiment 86, wherein the nucleosides marked with an u*u*a*gggttagggttaggguuag*g*g* (SEQ ID NO. 134) are sugar-modified versions of a, g, and / or t.
[0150] Embodiment 88. The modified ODN of Embodiment 86, wherein at least eight of the a, g, u, and / or t nucleosides are sugar-modified versions thereof.
[0151] Embodiment 89. The modified ODN of Embodiment 88, wherein the nucleosides marked with an u*u*a*g*ggttagggttaggguua*g*g*g* (SEQ ID NO. 135) are sugar-modified versions of a, g, and / or t.
[0152] Embodiment 90. The modified ODN of Embodiment 88, wherein at least ten nucleosides of the a, u, g, and / or t nucleosides are sugar-modified versions thereof.
[0153] Embodiment 91. The modified ODN of Embodiment 90, wherein the nucleosides marked with an u*u*a*g*g*gttagggttaggguu*a*g*g*g* (SEQ ID NO. 136) are sugar-modified versions of a, u, g, and / or t.
[0154] Embodiment 92. The modified ODN of Embodiment 90, wherein at least twelve of the a, u, g, and / or t nucleosides are sugar-modified versions thereof.
[0155] Embodiment 93. The modified ODN of Embodiment 92, wherein the nucleosides marked with an u*u*a*g*g*g*ttagggttagggu*u*a*g*g*g* (SEQ ID NO. 137) are sugar-modified versions of a, u, g, and / or t.
[0156] Embodiment 94. The modified ODN of Embodiment 92, wherein at least fourteen nucleosides of the a, u, g, and / or t nucleosides are sugar-modified versions thereof.
[0157] Embodiment 95. The modified ODN of Embodiment 94, wherein the nucleosides marked with an u*u*a*g*g*g*t*tagggttaggg*u*u*a*g*g*g* (SEQ ID NO. 138) are sugar-modified versions of a, u, g, and / or t.
[0158] Embodiment 96. The modified ODN of Embodiment 95, wherein at least eighteen nucleosides of the a, u, g, and / or t nucleosides are sugar-modified versions thereof.
[0159] Embodiment 97. The modified ODN of Embodiment 97, wherein the nucleosides marked with an u*u*a*g*g*g*t*t*a*gggttag*g*g*u*u*a*g*g*g* (SEQ ID NO. 139) are sugar-modified versions of a, u, g, and / or t.
[0160] Embodiment 98. The modified ODN of Embodiment 84, wherein all of the a, u, g, and t nucleosides are sugar-modified versions thereof.
[0161] Embodiment 99. The modified ODN of Embodiment 84, wherein all of the t nucleosides are sugar-modified versions thereof.
[0162] Embodiment 100. The modified ODN of Embodiment 84, wherein all of the g nucleosides are sugar-modified versions thereof.
[0163] Embodiment 101. The modified ODN of Embodiment 1 comprising the sequence (also known as iSG3): cctcattagggtgaggg (SEQ ID NO. 7).
[0164] Embodiment 102. The modified ODN of Embodiment 101, wherein at least four of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0165] Embodiment 103. The modified ODN of Embodiment 102, wherein at least six of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0166] Embodiment 104. The modified ODN of Embodiment 103, wherein the nucleosides marked with an c*c*t*cattagggtgag*g*g* (SEQ ID NO. 140) are sugar-modified versions of c, g, and / or t.
[0167] Embodiment 105. The modified ODN of Embodiment 103, wherein at least eight of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0168] Embodiment 106. The modified ODN of Embodiment 105, wherein the nucleosides marked with an c*c*t*c*attagggtga*g*g*g* (SEQ ID NO. 141) are sugar-modified versions of a, c, g, and / or t.
[0169] Embodiment 107. The modified ODN of Embodiment 105, wherein at least ten nucleosides of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0170] Embodiment 108. The modified ODN of Embodiment 107, wherein the nucleosides marked with an c*c*t*c*a*ttagggtg*a*g*g*g* (SEQ ID NO. 142) are sugar-modified versions of a, c, g, and / or t.
[0171] Embodiment 109. The modified ODN of Embodiment 107, wherein at least twelve of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0172] Embodiment 111. The modified ODN of Embodiment 109, wherein the nucleosides marked with an c*c*t*c*a*t*tagggt*g*a*g*g*g* (SEQ ID NO. 143) are sugar-modified versions of a, c, g, and / or t.
[0173] Embodiment 111. The modified ODN of Embodiment 109, wherein at least fourteen nucleosides of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0174] Embodiment 112. The modified ODN of Embodiment 111, wherein the nucleosides marked with an c*c*t*c*a*t*t*aggg*t*g*a*g*g*g* (SEQ ID NO. 144) are sugar-modified versions of a, c, g, and / or t.
[0175] Embodiment 113. The modified ODN of Embodiment 111, wherein all of the a, c, g, and t nucleosides are sugar-modified versions thereof.
[0176] Embodiment 114. The modified ODN of Embodiment 101, wherein all of the t nucleosides are sugar-modified versions thereof.
[0177] Embodiment 115. The modified ODN of Embodiment 101, wherein all of the g nucleosides are sugar-modified versions thereof.
[0178] Embodiment 116. The modified ODN of Embodiment 1 comprising the sequence: uuagggutagggttaggguuaggg (SEQ ID NO. 8).
[0179] Embodiment 117. The modified ODN of Embodiment 116, wherein at least four of the a, g, t and / or u nucleosides are sugar-modified versions thereof.
[0180] Embodiment 118. The modified ODN of Embodiment 117, wherein at least six of the of a, g, t and / or u nucleosides are sugar-modified versions thereof.
[0181] Embodiment 119. The modified ODN of Embodiment 118, wherein the nucleosides marked with an u*u*a*gggutagggttaggguuag*g*g* (SEQ ID NO. 145) are sugar-modified versions of u, a, and / or g.
[0182] Embodiment 120. The modified ODN of Embodiment 118, wherein at least eight of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0183] Embodiment 121. The modified ODN of Embodiment 120, wherein the nucleosides marked with an u*u*a*g*ggutagggttaggguua*g*g*g* (SEQ ID NO. 146) are sugar-modified versions of u, a, and / or g.
[0184] Embodiment 122. The modified ODN of Embodiment 120, wherein at least ten nucleosides of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0185] Embodiment 123. The modified ODN of Embodiment 122, wherein the nucleosides marked with an u*u*a*g*g*gutagggttaggguu*a*g*g*g* (SEQ ID NO. 147) are sugar-modified versions of u, a, and / or g.
[0186] Embodiment 124. The modified ODN of Embodiment 122, wherein at least twelve of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0187] Embodiment 125. The modified ODN of Embodiment 124, wherein the nucleosides marked with an u*u*a*g*g*g*utagggttagggu*u*a*g*g*g* (SEQ ID NO. 148) are sugar-modified versions of u, a, and / or g.
[0188] Embodiment 126. The modified ODN of Embodiment 124, wherein at least fourteen nucleosides of the a, c, g, t, and / or u nucleosides are sugar-modified versions thereof.
[0189] Embodiment 127. The modified ODN of Embodiment 126, wherein the nucleosides marked with an u*u*a*g*g*g*u*tagggttaggg*u*u*a*g*g*g* (SEQ ID NO. 149) are sugar-modified versions of u, a, and / or g.
[0190] Embodiment 128. The modified ODN of Embodiment 126, wherein at least eighteen nucleosides of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0191] Embodiment 129. The modified ODN of Embodiment 128, wherein the nucleosides marked with an u*u*a*g*g*g*u*t*a*gggttag*g*g*u*u*a*g*g*g* (SEQ ID NO. 150) are sugar-modified versions of u, a, t, and / or g.
[0192] Embodiment 130. The modified ODN of Embodiment 116, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.
[0193] Embodiment 131. The modified ODN of Embodiment 116, wherein all of the g nucleosides are sugar-modified versions thereof.
[0194] Embodiment 132. The modified ODN of Embodiment 116, wherein all of the a nucleosides are sugar-modified versions thereof.
[0195] Embodiment 133. The modified ODN of Embodiment 1 comprising the sequence: uuaggguuagggttaggguuaggg (SEQ ID NO. 9).
[0196] Embodiment 134. The modified ODN of Embodiment 133, wherein at least four of the a, g, t and / or u nucleosides are sugar-modified versions thereof.
[0197] Embodiment 135. The modified ODN of Embodiment 134, wherein at least six of the of a, g, t and / or u nucleosides are sugar-modified versions thereof.
[0198] Embodiment 136. The modified ODN of Embodiment 135, wherein the nucleosides marked with an u*u*a*ggguuagggttaggguuag*g*g* (SEQ ID NO. 151) are sugar-modified versions of u, a, and / or g.
[0199] Embodiment 137. The modified ODN of Embodiment 135, wherein at least eight of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0200] Embodiment 138. The modified ODN of Embodiment 137, wherein the nucleosides marked with an u*u*a*g*gguuagggttaggguua*g*g*g* (SEQ ID NO. 152) are sugar-modified versions of u, a, and / or g
[0201] Embodiment 139. The modified ODN of Embodiment 137, wherein at least ten nucleosides of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0202] Embodiment 140. The modified ODN of Embodiment 139, wherein the nucleosides marked with an u*u*a*g*g*guuagggttaggguu*a*g*g*g* (SEQ ID NO. 153) are sugar-modified versions of u, a, and / or g.
[0203] Embodiment 141. The modified ODN of Embodiment 139, wherein at least twelve of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0204] Embodiment 142. The modified ODN of Embodiment 141, wherein the nucleosides marked with an u*u*a*g*g*g*uuagggttagggu*u*a*g*g*g* (SEQ ID NO. 154) are sugar-modified versions of u, a, and / or g.
[0205] Embodiment 143. The modified ODN of Embodiment 141, wherein at least fourteen nucleosides of the a, c, g, t, and / or u nucleosides are sugar-modified versions thereof.
[0206] Embodiment 144. The modified ODN of Embodiment 143, wherein the nucleosides marked with an u*u*a*g*g*g*u*uagggttaggg*u*u*a*g*g*g* (SEQ ID NO. 155) are sugar-modified versions of u, a, and / or g.
[0207] Embodiment 145. The modified ODN of Embodiment 143, wherein at least eighteen nucleosides of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0208] Embodiment 146. The modified ODN of Embodiment 145, wherein the nucleosides marked with an u*u*a*g*g*g*u*u*a*gggttag*g*g*u*u*a*g*g*g* (SEQ ID NO. 156) are sugar-modified versions of u, a, and / or g.
[0209] Embodiment 147. The modified ODN of Embodiment 133, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.
[0210] Embodiment 148. The modified ODN of Embodiment 133, wherein all of the g nucleosides are sugar-modified versions thereof.
[0211] Embodiment 149. The modified ODN of Embodiment 133, wherein all of the a nucleosides are sugar-modified versions thereof.
[0212] Embodiment 150. The modified ODN of Embodiment 1 comprising the sequence: uuaggguuaggguuaggguuaggg (SEQ ID NO. 10).
[0213] Embodiment 151. The modified ODN of Embodiment 150, wherein at least four of the a, g, and / or u nucleosides are sugar-modified versions thereof.
[0214] Embodiment 152. The modified ODN of Embodiment 151, wherein at least six of the of a, g, and / or u nucleosides are sugar-modified versions thereof.
[0215] Embodiment 153. The modified ODN of Embodiment 152, wherein the nucleosides marked with an u*u*a*ggguuaggguuaggguuag*g*g* (SEQ ID NO. 157) are sugar-modified versions of u, a, and / or g.
[0216] Embodiment 154. The modified ODN of Embodiment 152, wherein at least eight of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0217] Embodiment 155. The modified ODN of Embodiment 154, wherein the nucleosides marked with anu*u*a*g*gguuaggguuaggguua*g*g*g* (SEQ ID NO. 158) are sugar-modified versions of u, a, and / or g
[0218] Embodiment 156. The modified ODN of Embodiment 154, wherein at least ten nucleosides of the a, c, g, and / or u nucleosides are sugar-modified versions thereof.
[0219] Embodiment 157. The modified ODN of Embodiment 156, wherein the nucleosides marked with an u*u*a*g*g*guuaggguuaggguu*a*g*g*g* (SEQ ID NO. 159) are sugar-modified versions of u, a, and / or g.
[0220] Embodiment 158. The modified ODN of Embodiment 156, wherein at least twelve of the a, c, g, and / or u nucleosides are sugar-modified versions thereof.
[0221] Embodiment 159. The modified ODN of Embodiment 158, wherein the nucleosides marked with an u*u*a*g*g*g*uuaggguuagggu*u*a*g*g*g* (SEQ ID NO. 160) are sugar-modified versions of u, a, and / or g.
[0222] Embodiment 160. The modified ODN of Embodiment 158, wherein at least fourteen nucleosides of the a, c, g, and / or u nucleosides are sugar-modified versions thereof.
[0223] Embodiment 161. The modified ODN of Embodiment 160, wherein the nucleosides marked with an u*u*a*g*g*g*u*uaggguuaggg*u*u*a*g*g*g* (SEQ ID NO. 161) are sugar-modified versions of u, a, and / or g.
[0224] Embodiment 162. The modified ODN of Embodiment 160, wherein at least eighteen nucleosides of the a, c, g, and / or u nucleosides are sugar-modified versions thereof.
[0225] Embodiment 163. The modified ODN of Embodiment 162, wherein the nucleosides marked with an u*u*a*g*g*g*u*u*a*ggguuag*g*g*u*u*a*g*g*g* (SEQ ID NO. 162) are sugar-modified versions of u, a, and / or g.
[0226] Embodiment 164. The modified ODN of Embodiment 150, wherein all of the a, c, g, and u nucleosides are sugar-modified versions thereof.
[0227] Embodiment 165. The modified ODN of Embodiment 150, wherein all of the g nucleosides are sugar-modified versions thereof.
[0228] Embodiment 166. The modified ODN of Embodiment 150, wherein all of the a nucleosides are sugar-modified versions thereof.
[0229] Embodiment 167. The modified ODN of Embodiment 1 comprising the sequence: uuagggttagggttagggttaggg (SEQ ID NO. 11).
[0230] Embodiment 168. The modified ODN of Embodiment 167, wherein at least four of the a, g, and / or t nucleosides are sugar-modified versions thereof.
[0231] Embodiment 169. The modified ODN of Embodiment 168, wherein at least six of the a, c, g, and / or t nucleosides are sugar-modified versions thereof.
[0232] Embodiment 170. The modified ODN of Embodiment 169, wherein the nucleosides marked with an u*u*a*gggttagggttagggttag*g*g* (SEQ ID NO. 163) are sugar-modified versions of u, a, and / or g.
[0233] Embodiment 171. The modified ODN of Embodiment 169, wherein at least eight of the a, g, and / or t nucleosides are sugar-modified versions thereof.
[0234] Embodiment 172. The modified ODN of Embodiment 171, wherein the nucleosides marked with an u*u*a*g*ggttagggttagggtta*g*g*g* (SEQ ID NO. 164) are sugar-modified versions of u, a, and / or g.
[0235] Embodiment 173. The modified ODN of Embodiment 171, wherein at least ten nucleosides of the a, g, and / or t nucleosides are sugar-modified versions thereof.
[0236] Embodiment 174. The modified ODN of Embodiment 173, wherein the nucleosides marked with an u*u*a*g*g*gttagggttagggtt*a*g*g*g* (SEQ ID NO. 165) are sugar-modified versions of a, g, and / or u.
[0237] Embodiment 175. The modified ODN of Embodiment 173, wherein at least twelve of the a, g, and / or t nucleosides are sugar-modified versions thereof.
[0238] Embodiment 176. The modified ODN of Embodiment 175, wherein the nucleosides marked with an u*u*a*g*g*g*ttagggttagggt*t*a*g*g*g* (SEQ ID NO. 166) are sugar-modified versions of a, g, u, and / or t.
[0239] Embodiment 177. The modified ODN of Embodiment 175, wherein at least fourteen nucleosides of the a, g, and / or t nucleosides are sugar-modified versions thereof.
[0240] Embodiment 178. The modified ODN of Embodiment 177, wherein the nucleosides marked with anu*u*a*g*g*g*t*tagggttaggg*t*t*a*g*g*g* (SEQ ID NO. 167) are sugar-modified versions of a, u, g, and / or t.
[0241] Embodiment 179. The modified ODN of Embodiment 167, wherein all of the a, g, and t nucleosides are sugar-modified versions thereof.
[0242] Embodiment 180. The modified ODN of Embodiment 167, wherein all of the t nucleosides are sugar-modified versions thereof.
[0243] Embodiment 181. The modified ODN of Embodiment 167, wherein all of the g nucleosides are sugar-modified versions thereof.
[0244] Embodiment 182. The modified ODN of Embodiment 1 comprising the sequence: utcaaattcaaattcaaattcaaa (SEQ ID NO. 12).
[0245] Embodiment 183. The modified ODN of Embodiment 182, wherein at least four of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0246] Embodiment 184. The modified ODN of Embodiment 163, wherein at least six of the of a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0247] Embodiment 185. The modified ODN of Embodiment 184, wherein the nucleosides marked with an u*t*c*aaattcaaattcaaattca*a*a* (SEQ ID NO. 168) are sugar-modified versions of u, a, t, and / or c.
[0248] Embodiment 186. The modified ODN of Embodiment 184, wherein at least eight of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0249] Embodiment 187. The modified ODN of Embodiment 186, wherein the nucleosides marked with an u*t*c*a*aattcaaattcaaattc*a*a*a* (SEQ ID NO. 169) are sugar-modified versions of u, a, t, and / or c.
[0250] Embodiment 188. The modified ODN of Embodiment 186, wherein at least ten nucleosides of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0251] Embodiment 189. The modified ODN of Embodiment 188, wherein the nucleosides marked with an u*t*c*a*a*attcaaattcaaatt*c*a*a*a* (SEQ ID NO. 170) are sugar-modified versions of u, a, t, and / or c.
[0252] Embodiment 190. The modified ODN of Embodiment 188, wherein at least twelve of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0253] Embodiment 191. The modified ODN of Embodiment 190, wherein the nucleosides marked with an u*t*c*a*a*a*ttcaaattcaaat*t*c*a*a*a* (SEQ ID NO. 171) are sugar-modified versions of u, a, t, and / or c.
[0254] Embodiment 192. The modified ODN of Embodiment 190, wherein at least fourteen nucleosides of the a, c, t, and / or u nucleosides are sugar-modified versions thereof.
[0255] Embodiment 193. The modified ODN of Embodiment 192, wherein the nucleosides marked with an u*t*c*a*a*a*t*tcaaattcaaa*t*t*c*a*a*a* (SEQ ID NO. 172) are sugar-modified versions of u, a, t, and / or c.
[0256] Embodiment 194. The modified ODN of Embodiment 192, wherein at least eighteen nucleosides of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0257] Embodiment 195. The modified ODN of Embodiment 194, wherein the nucleosides marked with an u*t*c*a*a*a*t*t*caaattcaa*a*t*t*c*a*a*a* (SEQ ID NO. 173) are sugar-modified versions of u, a, t, and / or c.
[0258] Embodiment 196. The modified ODN of Embodiment 182, wherein all of the a, c, t, and u nucleosides are sugar-modified versions thereof.
[0259] Embodiment 197. The modified ODN of Embodiment 182, wherein all of the t nucleosides are sugar-modified versions thereof.
[0260] Embodiment 198. The modified ODN of Embodiment 192, wherein all of the a nucleosides are sugar-modified versions thereof.
[0261] Embodiment 199. The modified ODN of Embodiment 1 comprising the sequence: uucaaattcaaattcaaattcaaa (SEQ ID NO. 13).
[0262] Embodiment 200. The modified ODN of Embodiment 199, wherein at least four of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0263] Embodiment 201. The modified ODN of Embodiment 200, wherein at least six of the of a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0264] Embodiment 202. The modified ODN of Embodiment 201, wherein the nucleosides marked with an u*u*c*aaattcaaattcaaattca*a*a* (SEQ ID NO. 174) are sugar-modified versions of u, a, and / or c.
[0265] Embodiment 203. The modified ODN of Embodiment 201, wherein at least eight of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0266] Embodiment 204. The modified ODN of Embodiment 203, wherein the nucleosides marked with an u*u*c*a*aattcaaattcaaattc*a*a*a* (SEQ ID NO. 175) are sugar-modified versions of u, a, and / or c.
[0267] Embodiment 205. The modified ODN of Embodiment 203, wherein at least ten nucleosides of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0268] Embodiment 206. The modified ODN of Embodiment 205, wherein the nucleosides marked with an u*u*c*a*a*attcaaattcaaatt*c*a*a*a* (SEQ ID NO. 176) are sugar-modified versions of u, a, t, and / or c.
[0269] Embodiment 207. The modified ODN of Embodiment 205, wherein at least twelve of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0270] Embodiment 208. The modified ODN of Embodiment 207, wherein the nucleosides marked with an u*u*c*a*a*a*ttcaaattcaaat*t*c*a*a*a* (SEQ ID NO. 177) are sugar-modified versions of u, a, t, and / or c.
[0271] Embodiment 209. The modified ODN of Embodiment 207, wherein at least fourteen nucleosides of the a, c, t, and / or u nucleosides are sugar-modified versions thereof.
[0272] Embodiment 210. The modified ODN of Embodiment 209, wherein the nucleosides marked with an u*u*c*a*a*a*t*tcaaattcaaa*t*t*c*a*a*a* (SEQ ID NO. 178) are sugar-modified versions of u, a, t, and / or c.
[0273] Embodiment 211. The modified ODN of Embodiment 209, wherein at least eighteen nucleosides of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0274] Embodiment 212. The modified ODN of Embodiment 209, wherein the nucleosides marked with an u*u*c*a*a*a*t*t*caaattcaa*a*t*t*c*a*a*a* (SEQ ID NO. 179) are sugar-modified versions of u, a, t, and / or c.
[0275] Embodiment 213. The modified ODN of Embodiment 199, wherein all of the a, c, t, and u nucleosides are sugar-modified versions thereof.
[0276] Embodiment 214. The modified ODN of Embodiment 199, wherein all of the t nucleosides are sugar-modified versions thereof.
[0277] Embodiment 215. The modified ODN of Embodiment 199, wherein all of the a nucleosides are sugar-modified versions thereof.
[0278] Embodiment 216. The modified ODN of Embodiment 1 comprising the sequence: uucaaattcaaattcaaatucaaa (SEQ ID NO. 14).
[0279] Embodiment 217. The modified ODN of Embodiment 216, wherein at least four of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0280] Embodiment 218. The modified ODN of Embodiment 217, wherein at least six of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0281] Embodiment 219. The modified ODN of Embodiment 218, wherein the nucleosides marked with an u*u*c*aaattcaaattcaaatuca*a*a* (SEQ ID NO. 180) are sugar-modified versions of u, a, and / or c.
[0282] Embodiment 220. The modified ODN of Embodiment 218, wherein at least eight of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0283] Embodiment 221. The modified ODN of Embodiment 220, wherein the nucleosides marked with an u*u*c*a*aattcaaattcaaatuc*a*a*a* (SEQ ID NO. 181) are sugar-modified versions of u, a, and / or c.
[0284] Embodiment 222. The modified ODN of Embodiment 220, wherein at least ten nucleosides of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0285] Embodiment 223. The modified ODN of Embodiment 222, wherein the nucleosides marked with an u*u*c*a*a*attcaaattcaaatu*c*a*a*a* (SEQ ID NO. 182) are sugar-modified versions of u, a, and / or c.
[0286] Embodiment 224. The modified ODN of Embodiment 222, wherein at least twelve of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0287] Embodiment 225. The modified ODN of Embodiment 224, wherein the nucleosides marked with an u*u*c*a*a*a*ttcaaattcaaat*u*c*a*a*a* (SEQ ID NO. 183) are sugar-modified versions of u, a, t, and / or c.
[0288] Embodiment 226. The modified ODN of Embodiment 224, wherein at least fourteen nucleosides of the a, c, t, and / or u nucleosides are sugar-modified versions thereof.
[0289] Embodiment 227. The modified ODN of Embodiment 226, wherein the nucleosides marked with an u*u*c*a*a*a*t*tcaaattcaaa*t*u*c*a*a*a* (SEQ ID NO. 184) are sugar-modified versions of u, a, t, and / or c.
[0290] Embodiment 228. The modified ODN of Embodiment 226, wherein at least eighteen nucleosides of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0291] Embodiment 229. The modified ODN of Embodiment 228, wherein the nucleosides marked with an u*u*c*a*a*a*t*t*caaattcaa*a*t*u*c*a*a*a* (SEQ ID NO. 185) are sugar-modified versions of u, a, t, and / or c.
[0292] Embodiment 230. The modified ODN of Embodiment 216, wherein all of the a, c, t, and u nucleosides are sugar-modified versions thereof.
[0293] Embodiment 231. The modified ODN of Embodiment 216, wherein all of the t nucleosides are sugar-modified versions thereof.
[0294] Embodiment 232. The modified ODN of Embodiment 216, wherein all of the a nucleosides are sugar-modified versions thereof.
[0295] Embodiment 233. The modified ODN of Embodiment 1 comprising the sequence: ccucattagggtgaggg (SEQ ID NO. 15).
[0296] Embodiment 234. The modified ODN of Embodiment 233, wherein at least four of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0297] Embodiment 235. The modified ODN of Embodiment 234, wherein at least six of the of a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0298] Embodiment 236. The modified ODN of Embodiment 235, wherein the nucleosides marked with an c*c*u*cattagggtgag*g*g* (SEQ ID NO. 186) are sugar-modified versions of u, g, and / or c.
[0299] Embodiment 237. The modified ODN of Embodiment 235, wherein at least eight of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0300] Embodiment 238. The modified ODN of Embodiment 237, wherein the nucleosides marked with anc*c*u*c*attagggtga*g*g*g* (SEQ ID NO. 187) are sugar-modified versions of u, a, g, and / or c.
[0301] Embodiment 239. The modified ODN of Embodiment 237, wherein at least ten nucleosides of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0302] Embodiment 240. The modified ODN of Embodiment 239, wherein the nucleosides marked with an c*c*u*c*a*ttagggtg*a*g*g*g* (SEQ ID NO. 188) are sugar-modified versions of u, a, g, and / or c.
[0303] Embodiment 241. The modified ODN of Embodiment 239, wherein at least twelve of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0304] Embodiment 242. The modified ODN of Embodiment 241, wherein the nucleosides marked with an c*c*u*c*a*t*tagggt*g*a*g*g*g* (SEQ ID NO. 189) are sugar-modified versions of u, a, g, t, and / or c.
[0305] Embodiment 243. The modified ODN of Embodiment 241, wherein at least fourteen nucleosides of the a, c, g, t, and / or u nucleosides are sugar-modified versions thereof.
[0306] Embodiment 244. The modified ODN of Embodiment 243, wherein the nucleosides marked with an c*c*u*c*a*t*t*aggg*t*g*a*g*g*g* (SEQ ID NO. 190) are sugar-modified versions of u, a, g, t, and / or c.
[0307] Embodiment 245. The modified ODN of Embodiment 233, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.
[0308] Embodiment 246. The modified ODN of Embodiment 233, wherein all of the t nucleosides are sugar-modified versions thereof.
[0309] Embodiment 247. The modified ODN of Embodiment 233, wherein all of the a nucleosides are sugar-modified versions thereof.
[0310] Embodiment 248. The modified ODN of Embodiment 1 comprising the sequence: ugggcggttcaaccttca (SEQ ID NO. 16).
[0311] Embodiment 249. The modified ODN of Embodiment 248, wherein at least four of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0312] Embodiment 250. The modified ODN of Embodiment 249, wherein at least six of the of a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0313] Embodiment 251. The modified ODN of Embodiment 250, wherein the nucleosides marked with an u*g*g*gcggttcaacctt*c*a* (SEQ ID NO. 191) are sugar-modified versions of u, a, g, t, and / or c.
[0314] Embodiment 252. The modified ODN of Embodiment 250, wherein at least eight of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0315] Embodiment 253. The modified ODN of Embodiment 252, wherein the nucleosides marked with an u*g*g*g*cggttcaacct*t*c*a* (SEQ ID NO. 192) are sugar-modified versions of u, a, g, t, and / or c.
[0316] Embodiment 254. The modified ODN of Embodiment 252, wherein at least ten nucleosides of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0317] Embodiment 255. The modified ODN of Embodiment 254, wherein the nucleosides marked with an u*g*g*g*c*ggttcaacc*t*t*c*a* (SEQ ID NO. 193) are sugar-modified versions of u, a, g, t, and / or c.
[0318] Embodiment 256. The modified ODN of Embodiment 254, wherein at least twelve of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0319] Embodiment 257. The modified ODN of Embodiment 256, wherein the nucleosides marked with an u*g*g*g*c*g*gttcaac*c*t*t*c*a* (SEQ ID NO. 194) are sugar-modified versions of u, a, g, t, and / or c.
[0320] Embodiment 258. The modified ODN of Embodiment 256, wherein at least fourteen nucleosides of the a, c, g, t, and / or u nucleosides are sugar-modified versions thereof.
[0321] Embodiment 259. The modified ODN of Embodiment 258, wherein the nucleosides marked with an u*g*g*g*c*g*g*ttcaa*c*c*t*t*c*a* (SEQ ID NO. 195) are sugar-modified versions of u, a, g, t, and / or c.
[0322] Embodiment 260. The modified ODN of Embodiment 248, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.
[0323] Embodiment 261. The modified ODN of Embodiment 248, wherein all of the t nucleosides are sugar-modified versions thereof.
[0324] Embodiment 262. The modified ODN of Embodiment 248, wherein all of the g nucleosides are sugar-modified versions thereof.
[0325] Embodiment 263. The modified ODN of Embodiment 1 comprising the sequence: ugggcggttcaaccuuca (SEQ ID NO. 17).
[0326] Embodiment 264. The modified ODN of Embodiment 263, wherein at least four of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0327] Embodiment 265. The modified ODN of Embodiment 264, wherein at least six of the of a, c, g, t and / or u nucleosides are sugar-modified versions thereof.
[0328] Embodiment 266. The modified ODN of Embodiment 265, wherein the nucleosides marked with an u*g*g*gcggttcaaccuu*c*a* (SEQ ID NO. 196) are sugar-modified versions of u, a, g, and / or c.
[0329] Embodiment 267. The modified ODN of Embodiment 265, wherein at least eight of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0330] Embodiment 268. The modified ODN of Embodiment 267, wherein the nucleosides marked with an u*g*g*g*cggttcaaccu*u*c*a* (SEQ ID NO. 197) are sugar-modified versions of u, a, g, and / or c.
[0331] Embodiment 269. The modified ODN of Embodiment 267, wherein at least ten nucleosides of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0332] Embodiment 270. The modified ODN of Embodiment 269, wherein the nucleosides marked with an u*g*g*g*c*ggttcaacc*u*u*c*a* (SEQ ID NO. 198) are sugar-modified versions of u, a, g, and / or c.
[0333] Embodiment 271. The modified ODN of Embodiment 269, wherein at least twelve of the a, c, t and / or u nucleosides are sugar-modified versions thereof.
[0334] Embodiment 272. The modified ODN of Embodiment 271, wherein the nucleosides marked with an u*g*g*g*c*g*gttcaac*c*u*u*c*a* (SEQ ID NO. 199) are sugar-modified versions of u, a, g, and / or c.
[0335] Embodiment 273. The modified ODN of Embodiment 271, wherein at least fourteen nucleosides of the a, c, g, t, and / or u nucleosides are sugar-modified versions thereof.
[0336] Embodiment 274. The modified ODN of Embodiment 273, wherein the nucleosides marked with an u*g*g*g*c*g*g*ttcaa*c*c*u*u*c*a* (SEQ ID NO. 200) are sugar-modified versions of u, a, g, and / or c.
[0337] Embodiment 275. The modified ODN of Embodiment 263, wherein all of the a, c, g, t, and u nucleosides are sugar-modified versions thereof.
[0338] Embodiment 276. The modified ODN of Embodiment 263, wherein all of the t nucleosides are sugar-modified versions thereof.
[0339] Embodiment 277. The modified ODN of Embodiment 263, wherein all of the a nucleosides are sugar-modified versions thereof.
[0340] Embodiment 278. The modified ODN of any one of Embodiments 1-277 comprising SMN1. With reference to the sequences of Table 1, SMN1 corresponds the modified nucleoside designated "(M)." For example, "G(M)" refers to:
[0341] Embodiment 279. The modified ODN of any one of Embodiments 1-278 comprising SMN2. With reference to the sequences of Table 1, SMN2 corresponds the modified nucleoside designated "(F)." For example, "G(F)" refers to:
[0342] Embodiment 280. The modified ODN of any one of Embodiments 1-279 comprising SMN3. With reference to the sequences of Table 1, SMN3 corresponds the modified nucleoside designated "(m)." For example, "G(m)" refers to:
[0343] Embodiment 281. The modified ODN of any one of Embodiments 1-280 comprising SMN4. With reference to the sequences of Table 1, SMN4 corresponds the modified nucleoside designated "(L)." For example, "G(L)" refers to:
[0344] Embodiment 282. The modified ODN of any one of Embodiments 1-281 comprising SMN5. With reference to the sequences of Table 1, SMN5 corresponds the modified nucleoside designated "(H)." For example, "G(H)" refers to:
[0345] Embodiment 283. The modified ODN of any one of Embodiments 1-282 comprising SMN6. With reference to the sequences of Table 1, SMN6 corresponds the modified nucleoside designated "(E)." For example, "G(E)" refers to:
[0346] Embodiment 284. The modified ODN of any one of Embodiments 1-283 comprisingSMN7.With reference to the sequences of Table 1, SMN7 corresponds the modified nucleoside designated "n"." For example, "g"" refers to:
[0347] Embodiment 285. The modified ODN of any one of Embodiments 1-284 comprising SMN8.With reference to the sequences of Table 1, SMN8 corresponds the modified nucleoside designated "N"." For example, "G"" refers to:
[0348] Embodiment 286. The modified ODN of any one of Embodiments 1-285 comprisingSMN9. With reference to the sequences of Table 1, SMN9 corresponds the modified nucleoside designated "(n)." For example, "(g)" refers to:
[0349] Embodiment 287. The modified ODN of any one of Embodiments 1-286, wherein each of the internucleoside linkages are phosphorothioate linkages.
[0350] Embodiment 288. The modified ODN of any one of Embodiments 1-287, wherein at least one internucleoside linkage is a phosphorodithioate linkage.
[0351] Embodiment 289. The modified ODN of any one of Embodiments 1-286, wherein each of the internucleoside linkages are phosphodiester linkages.
[0352] With reference to the sequences of Table 1, a "A" between nucleosides indicates a phosphorothioate linkage is present at that position of the ODN and a "AA" indicates aphosphorodithioate is present as illustrated for U(M)AU(M)AAA(M)AG(M) below (SEQ ID NO.18):
[0353] Embodiment 290. An ODN or modified ODN comprising the sequence set forth inTable 1.Table 1
[0354] The ODNs and modified ODNs disclosed in this section are collectively referred to as "ODNs of the Disclosure" and individually referred to as an "ODN of the Disclosure."II. Lipid Nanoparticles (LNPs)
[0355] As used herein, the term "lipid nanoparticle" or "LNP" includes a lipid formulation that can be used to deliver a therapeutic agent, e.g., a therapeutic nucleic acid and / or an ODN of the Disclosure to a target site of interest, e.g., cell, tissue, organ, and the like, in a subject in need thereof. LNPs are described, for example, in US 2021 / 0052646.
[0356] In one embodiment, the disclosure provides a lipid nanoparticle comprising one or more ODNs of the Disclosure and a therapeutic nucleic acid, e.g., DNA or RNA. In some embodiments, a therapeutic agent such as a therapeutic nucleic acid may be encapsulated in the particle, thereby protecting it from enzymatic degradation. In some embodiments, one or more ODNs of the Disclosure and a therapeutic nucleic acid are not covalently bonded to one another. In some embodiments, one or more ODNs of the Disclosure and a therapeutic nucleic acid are encapsulated in the same lipid nanoparticle. In some embodiments, one or more ODNs of the Disclosure and a therapeutic nucleic acid are encapsulated in separate lipid nanoparticles.
[0357] In another embodiment, the disclosure provides a lipid nanoparticle comprising one or more ODNs of the Disclosure, a therapeutic nucleic acid, and a cationic lipid.
[0358] In another embodiment, the disclosure provides a lipid nanoparticle comprising one or more ODNs of the Disclosure, a therapeutic nucleic acid, a cationic lipid, and a non-cationic lipid.
[0359] In some embodiments, the LNP has an average diameter of less than 1 pm.
[0360] The LNPs described in this section are collectively referred to as "LNPs of the Disclosure" or individually referred to as a "LNP of the Disclosure."III. Cationic Lipids
[0361] In the present disclosure, the "cationic lipid" means a lipid that has a net positive charge at a selected pH. The cationic lipids used in the lipid nanoparticle of the present disclosure are not particularly limited. For example, cationic lipids described in WO 2015 / 011633, WO 2016 / 021683, WO 2011 / 153493, WO 2013 / 126803, WO 2010 / 054401, WO 2010 / 042877, WO 2016 / 104580, WO 2015 / 005253, WO 2014 / 007398, WO 2017 / 117528, WO 2017 / 075531, WO 2017 / 00414, WO 2015 / 199952, US 2015 / 0239834, WO 2019 / 131839, or WO 2020 / 032184 can be in the lipid nanoparticles of the present disclosure.
[0362] In one embodiment, cationic lipids for use in the LNPs of the present disclosure are described in WO 2015 / 011633.
[0363] In another embodiment, cationic lipids for use in the LNPs of the present disclosure include:
[0364] and salts thereof.
[0365] In another embodiment, cationic lipids for use in the LNPs of the present disclosure are described in WO 2016 / 021683.
[0366] In another embodiment, cationic lipids for use in the LNPs of the present disclosure are compounds of the formula:wherein:
[0367] W is the formula — NRXR2or the formula — N+R3R4R5(Z ),
[0368] R1and R2are each independently a Ci-4 alkyl group or a hydrogen atom,
[0369] R3, R4and R5are each independently a Ci-4 alkyl group,
[0370] Z is an anion,
[0371] X is an optionally substituted Ci-6 alkylene group,
[0372] YA, YBand Ycare each independently an optionally substituted methine group,
[0373] LA, LBand Lcare each independently an optionally substituted methylene group or a bond, and
[0374] RA1, RA2, RB1, RB2, RC1and RC2are each independently an optionally substituted C4-10 alkyl group, or a salt thereof.
[0375] In another embodiment, cationic lipids for use in the LNPs of the present disclosure include:(compound 5)(compound 9)
[0376] and salts thereof.
[0377] In another embodiment, cationic lipids for use in the LNPs of the present disclosure include:(compound 1)
[0378] and salts thereof.
[0379] In another embodiment, cationic lipids for use in the LNPs of the present disclosure are compounds of Formula (II):wherein:
[0380] n is an integer of 2 to 5,
[0381] R is a linear C1-5 alkyl group, a linear C7-11 alkenyl group or a linear C11 alkadienyl group, and
[0382] wavy lines are each independently shows a cis-type or trans-type bond, or a salt thereof.
[0383] In another embodiment, cationic lipids for use in the LNPs of the present disclosure include:
[0384] and salts thereof.
[0385] In another embodiment, cationic lipids for use in the LNPs of the present disclosure include:
[0386] and salts thereof.
[0387] In another embodiment, cationic lipids for use in the LNPs of the present disclosure are compounds of Formula (III):wherein:
[0388] nl is an integer of 2 to 6,
[0389] n2 is an integer of 0 to 2,
[0390] n3 is an integer of 0 to 2,
[0391] L is — C(O)O— or — NHC(0)0—
[0392] Ra is a linear C5-13 alkyl group, a linear C13-17 alkenyl group or a linear C17 alkadienyl group,
[0393] Rb is a linear C2-9 alkyl group,
[0394] Rc is a hydrogen atom or a linear C2-9 alkyl group,
[0395] Rd is a hydrogen atom or a linear C2-9 alkyl group,
[0396] Re is a linear C2-9 alkyl group, and
[0397] Rf is a linear C2-9 alkyl group, or a salt thereof.
[0398] In another embodiment, cationic lipids for use in the LNPs of the present disclosure include:(compound 22)(compound 26)(compound 30)(compound 34)(compound 38)
[0399] and salts thereof.
[0400] In another embodiment, cationic lipids for use in the LNPs of the present disclosure include:(compound 31)
[0401] and salts thereof.
[0402] In another embodiment, cationic lipids for use in the LNPs of the present disclosure are described in WO 2011 / 153493.
[0403] In another embodiment, cationic lipids for use in the LNPs of the present disclosure include:n = 0-2
[0404] In another embodiment, cationic lipids for use in the LNPs of the present disclosure are described in the following table:
[0405] and salts thereof.
[0406] In another embodiment, cationic lipids for use in the LNPs of the present disclosure include:
[0407] and salts thereof.
[0408] In another embodiment, cationic lipids for use in the LNPs of the present disclosure are described in WO 2013 / 126803.
[0409] In another embodiment, cationic lipids for use in the LNPs of the present disclosure include:
[0410] and salts thereof.
[0411] In another embodiment, cationic lipids for use in the LNPs of the present disclosure is:
[0412] and a salt thereof.
[0413] In another embodiment, cationic lipids for use in the LNPs of the present disclosure include K-E12, H-A12, Y-E12, G-O12, K-A12, R-A12, cKK-E12, cPK-E12, PK1K-E12, PK500-E12, CQK-E12, CKK-A12, KK-A12, PK-4K-E12, cWK-E12, PK500-012, PK1K-O12, cYK-E12, cDK- E12, CSK-E12, CEK-E12, cMK-E12, cKK-012, cIK-E12, cKK-ElO, cKK-E14, and cKK-E16 as described in Dong et al., Proc Natl Acad Sci USA. 2014 Apr. 15; 111(15): 5753.
[0414] In another embodiment, cationic lipids for use in the LNPs of the present disclosure include C14-98, C18-96, C14-113, C14-120, C14-120, C14-110, C16-96, and C12-200 as described in Love K T et al. (Proc Natl Acad Sci USA. 2010 May 25; 107(2I):9915).
[0415] In another embodiment, cationic lipids for use in the LNPs of the present disclosure compounds of Formula (I):wherein:
[0416] L1is a Ci-22 alkylene group, a C2-22 alkenylene group or a C3-22 alkadienylene group,
[0417] n is an integer of 0 or 1,
[0418] R1iS
[0419] (1) a hydrogen atom,
[0420] (2) a linear Ci -22 alkyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group,
[0421] (3) a linear C2 -22 alkenyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group, or
[0422] (4) a linear C3 -22 alkadienyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group,R2is — CH2— O— CO— R5, — CH2— CO— O— R5or — R5,R3is a hydrogen atom, — CH2 — O — CO — R6, — CH2 — CO — O — R6or — R6,R4is a hydrogen atom, — CH2 — O — CO — R7, — CH2 — CO — O — R7or — R7,R5, R6and R7are each independently
[0423] (1) a linear Ci -22 alkyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group,
[0424] (2) a linear C2-22 alkenyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group,
[0425] (3) a linear C3 -22 alkadienyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group, and Rs and R<; are each independently a C1-6 alkyl group, or
[0426] (4) -R10-CO-O-Ruor -R10-O-CO-Ru,
[0427] R10represents an optionally substituted Ci-16 alkylene group, an optionally substituted C4- 16 alkenylene group or an optionally substituted C7-16 alkadienylene group, and
[0428] R11represents H, an optionally substituted Ci-is alkyl group, an optionally substituted C3- 18 alkenyl group or an optionally substituted C15-18 alkadienyl group,
[0429] Rs and R9 are each independently a C1-6 alkyl group, or a salt thereof.
[0430] L1is a C1-22 alkylene group, a C2-22 alkenylene group or a C3-22 alkadienylene group,
[0431] L1is preferably a C1-22 alkylene group,
[0432] L1is more preferably a C1-12 alkylene group,
[0433] L1is further preferably a C1-6 alkylene group,
[0434] n is an integer of 0 or 1,
[0435] n is preferably an integer of 1,
[0436] R1is
[0437] (1) a hydrogen atom,
[0438] (2) a linear Ci -22 alkyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group,
[0439] (3) a linear C2 -22 alkenyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group, or
[0440] (4) a linear C3-22 alkadienyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group,
[0441] R1is preferably
[0442] (1) a hydrogen atom,
[0443] (2) a linear Ci -22 alkyl group (preferably linear C6-12 alkyl group) optionally substituted by one or two linear C1-22 alkyl groups (preferably linear C6-12 alkyl groups), or
[0444] (3) a linear C2-22 alkenyl group (preferably linear C6-12 alkenyl group) optionally substituted by one or two linear C2-22 alkenyl groups (preferably linear C6-12 alkenyl groups),
[0445] R1is particularly preferably a hydrogen atom,
[0446] R2is — CH2— O— CO— R5, CH2 CO O R5or — R5,
[0447] R2is preferably — CH2 — O — CO — R5or — R5,
[0448] R2is more preferably — CH2 — O — CO — R5,
[0449] R3is a hydrogen atom, — CH2— O— CO— R6, — CH2— CO— O— R6or — R6,
[0450] R3is preferably a hydrogen atom or — CH2 — O — CO — R6or — R6,
[0451] R3is more preferably — CH2 — O — CO — R6,
[0452] R4is a hydrogen atom, — CH2— O— CO— R7, — CH2— CO— O— R7or — R6,
[0453] R4is preferably a hydrogen atom or — CH2 — O — CO — R7.
[0454] R4is more preferably — CH2 — O — CO — R7,
[0455] R5, R6and R7are each independently
[0456] (1) a linear Ci -22 alkyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group,
[0457] (2) a linear C2 -22 alkenyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group,
[0458] (3) a linear C3 -22 alkadienyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group, or
[0459] (4) -R10-CO-O-R11or -R10-O-CO-R11.
[0460] R10represents an optionally substituted Ci-16 alkylene group, an optionally substituted C4-16 alkenylene group or an optionally substituted C7-16 alkadienylene group, and
[0461] R11represents H, an optionally substituted C1-18 alkyl group, an optionally substituted C3-18 alkenyl group or an optionally substituted C15-18 alkadienyl group,
[0462] R5, R6and R7are each independently preferably
[0463] (1) a linear Ci -22 alkyl group (preferably linear C4-18 alkyl group) optionally substituted by one or two linear C1-22 alkyl groups (preferably linear C1-10 alkyl groups),
[0464] (2) a linear C2 -22 alkenyl group (preferably linear C4-18 alkenyl group),
[0465] (3) a linear C3 -22 alkadienyl group (preferably linear C4-18 alkadienyl group), or
[0466] (4) -R10-CO-O-R11or -R10-O-CO-R11,
[0467] R10represents an optionally substituted Ci-16 alkylene group, an optionally substituted C4-16 alkenylene group or an optionally substituted C7-16 alkadienylene group, and
[0468] R11represents H, an optionally substituted Ci-18 alkyl group, an optionally substituted C3-18 alkenyl group or an optionally substituted C15-18 alkadienyl group,
[0469] R5, R6and R7are each independently more preferably
[0470] (1) a linear C1 -22alkyl group (preferably linear C4-18alkyl group) optionally substituted by one or two linear C1-22alkyl groups (preferably linear C1-10alkyl groups),
[0471] (2) a linear C2 -22alkenyl group (preferably linear C4-18alkenyl group), or
[0472] (3) -R10-CO-O-R11or -R10-O-CO-R11,
[0473] R10represents an optionally substituted C1-16alkylene group, an optionally substituted C4-16alkenylene group or an optionally substituted C7-16alkadienylene group, and
[0474] R11represents H, an optionally substituted C1-18alkyl group, an optionally substituted C3-18alkenyl group or an optionally substituted C15-18alkadienyl group.
[0475] R8and R9are each independently a C1-6alkyl group,
[0476] R8and R9 are each independently a C1-3 alkyl group (preferably methyl).
[0477] Preferably, compound (I) is a compound of the above-mentioned formula (I) wherein
[0478] L1iS a C1-22 alkylene group (preferably C1-12 alkylene group, more preferably Ce alkylene group),
[0479] n is an integer of 1,
[0480] R1is
[0481] (1) a hydrogen atom,
[0482] (2) a linear C1 -22alkyl group (preferably linear C6-12alkyl group) optionally substituted by one or two linear C1-22alkyl groups (preferably linear C6-12alkyl groups), or
[0483] (3) a linear C2 -22alkenyl group (preferably linear C6-12alkenyl group) optionally substituted by one or two linear C2-22alkenyl groups (preferably linear C6-12alkenyl groups), R2is — CH2— O— CO— R5or — R5,R3is a hydrogen atom or — CH2 — O — CO — R6or — R6,R4is a hydrogen atom or — CH2 — O — CO — R7,R5, R6and R7are each independently
[0484] (1) a linear C1 -22alkyl group (preferably linear C4-18 alkyl group) optionally substituted by one or two linear C1-22 alkyl groups (preferably linear C1-10 alkyl groups),
[0485] (2) a linear C2 -22 alkenyl group (preferably linear C4-18 alkenyl group),
[0486] (3) a linear C3 -22 alkadienyl group (preferably linear C4-18 alkadienyl group), or
[0487] (4) -R10-CO-O-R11or -R10-O-CO-R11,
[0488] R10represents an optionally substituted Ci-16 alkylene group, an optionally substituted C4- 16 alkenylene group or an optionally substituted C7-16 alkadienylene group, and
[0489] R11represents H, an optionally substituted C1-18alkyl group, an optionally substituted C3-18alkenyl group or an optionally substituted C15-18alkadienyl group, and R8and R9are each independently a C1-6alkyl group (preferably C1-3alkyl group, particularly preferably methyl).
[0490] In another embodiment, compound (I) is a compound of the above-mentioned formula (I) wherein:
[0491] L1is a C1-12 alkylene group (preferably C1-6 alkylene group), n is an integer of 1,R1is a hydrogen atom,R2is — CH2— O— CO— R5,R3is — CH2— O— CO— R6,R4is — CH2— O— CO— R7,R5, R6and R7are each independently
[0492] (1) a linear C1-22alkyl group (preferably linear C4-18alkyl group) optionally substituted by one or two linear C1-22alkyl groups (preferably linear C1-10alkyl groups),
[0493] (2) a linear C2 -22alkenyl group (preferably linear C4-18alkenyl group),
[0494] (3) a linear C3 -22 alkadienyl group (preferably linear C4-18alkadienyl group), or
[0495] (4) -R10-CO-O-R11or -R10-O-CO-R11,
[0496] R10represents an optionally substituted C1-16alkylene group, an optionally substituted C4-16alkenylene group or an optionally substituted C7-16alkadienylene group, and
[0497] R11represents H, an optionally substituted C1-18alkyl group, an optionally substituted C3-18alkenyl group or an optionally substituted C15-18alkadienyl group, and R8and R9are each independently a C1-6alkyl group (preferably C1-3alkyl group, particularly preferably methyl).
[0498] In another embodiment., compound (I) is a compound of the above-mentioned formula (I) wherein
[0499] L1is a C1-6alkylene group,
[0500] n is an integer of 1,R1is a hydrogen atom,R2is — CH2— O— CO— R5,R3is — CH2— O— CO— R6,R4is — CH2— O— CO— R7,R5, R6and R7are each independently
[0501] (1) a linear C1 -22alkyl group (preferably linear C4-18alkyl group) optionally substituted by one or two linear C1-22alkyl groups (preferably linear C1-10alkyl groups),
[0502] (2) a linear C2 -22alkenyl group (preferably linear C4-18alkenyl group), or
[0503] (3) -R10-CO-O-R11or -R10-O-CO-R11,
[0504] R10represents an optionally substituted C1-16alkylene group, an optionally substituted C4-16alkenylene group or an optionally substituted C7-16alkadienylene group, and
[0505] R11represents H, an optionally substituted C1-18alkyl group, an optionally substituted C3-18alkenyl group or an optionally substituted C15-18alkadienyl group, and R8and R9are each independently a C1-3alkyl group (preferably methyl).
[0506] In another embodiment, the cationic lipid for use in a lipid nanoparticle of the present disclosure includes a lipid of Table 2.Table 2
[0507] In some embodiments, a salt of the cationic lipids described above is a pharmacologically acceptable salt. Examples thereof include salts with inorganic bases (e.g., alkali metal salts such as sodium salt, potassium salt and the like; alkaline earth metal salts such as calcium salt, magnesium salt and the like; aluminum salt, ammonium salt), salts with organic bases (e.g., salts with trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, tromethamine[tris(hydroxymethyl)methylamine], tert-butylamine, cyclohexylamine, benzylamine, dicyclohexylamine, N,N-dibenzyl ethylenediamine), salts with inorganic acids (e.g., salts with hydrofluoric acid, hydrochloric acid, hydrobromic acid, hydrogen iodide acid, nitric acid, sulfuric acid, phosphoric acid), salts with organic acids (salts with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid), salts with basic amino acids (salts with arginine, lysine, ornithine) or salts with acidic amino acids (salts with aspartic acid, glutamic acid).
[0508] The ratio (mol %) of the cationic lipid to the total lipids present in the lipid nanoparticle of the present disclosure is, for example, about 10% to about 80%, about 20% to about 70%, or about 40% to about 60%; however, the ratio is not limited to these.
[0509] Only one kind of the above-mentioned cationic lipid may also be used or two or more kinds thereof may be used in combination. When multiple cationic lipids are used, the ratio of the whole cationic lipid is, for example, as mentioned above.IV. Non-Cationic Lipid
[0510] In the present disclosure, the term "non-cationic lipid" refers a lipid other than the cationic lipid, and is a lipid that does not have a net positive electric charge at a selected pH such as physiological pH and the like. Examples of the non-cationic lipid used in the lipid nanoparticle of the present disclosure include phospholipid, steroids, PEG lipid and the like.
[0511] To enhance the delivery of the nucleic acid payload into the target cell, tissue, organ, the phospholipid is not particularly limited as long as it stably maintains nucleic acid and does not inhibit fusion with cell membranes (plasma membrane and organelle membrane). For example, phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl serine, phosphatidyl inositol, phosphatidic acid, palmitoyloleoylphosphatidyl choline, lysophosphatidyl choline, lysophosphatidyl ethanolamine, dipalmitoylphosphatidyl choline, dioleoylphosphatidyl choline, distearoylphosphatidyl choline, dilinolenoylphosphatidyl choline and the like can be mentioned.
[0512] Phospholipids include, but are not limited to, distearoylphosphatidyl choline (DSPC), dioleoylphosphatidyl choline (DOPC), dipalmitoylphosphatidyl choline (DPPC), dioleoylphosphatidyl glycerol (DOPG), palmitoyloleoylphosphatidyl glycerol (POPG), dipalmitoylphosphatidyl glycerol (DPPG), dioleoyl-phosphatidyl ethanolamine (DOPE), palmitoyloleoylphosphatidyl choline (POPC), palmitoyloleoyl-phosphatidyl ethanolamine (POPE), and di oleoylphosphatidyl ethanolamine 4-(N-mal eimide methyl)-cyclo hexane- 1- carboxylate (DOPE-mal). In some embodiments, the phospholipid is DOPC, DPPC, POPC, or DOPE.
[0513] The ratio (mol %) of the phospholipid to the total lipids present in the lipid nanoparticle of the present disclosure may be, for example, about 0% to about 90%, about 5% to about 30%, or about 8% to about 15%.
[0514] Only one kind of the above-mentioned phospholipid may be used or two or more kinds thereof may be used in combination. When multiple phospholipids are used, the ratio of the whole phospholipid is as mentioned above.
[0515] As the steroids, cholesterol, 5a-cholestanol, 5P-coprostanol, cholesteryl-(2'-hydroxy)- ethylether, cholesteryl-(4'-hydroxy)-butylether, 6-ketocholestanol, 5a-cholestane, cholestenone, 5a-cholestanone, 5P-cholestanone, and cholesteryl decanoate can be mentioned. In some embodiments, the steroid is cholesterol.
[0516] The ratio (mol %) of the steroid to the total lipids present in the lipid nanoparticle of the present disclosure when steroids are present may be, for example, about 10% to about 60%, about 12% to about 58%, or about 20% to about 55%.
[0517] Only one kind of the above-mentioned steroid may be used or two or more kinds thereof may be used in combination. When multiple steroids are used, the ratio of the whole steroid is as mentioned above.
[0518] In the present specification, the "PEG lipid" means any complex of polyethylene glycol (PEG) and lipid. PEG lipid is not particularly limited as long as it has an effect of suppressing aggregation of the lipid nanoparticle of the present disclosure. For example, PEG conjugated with dialkyloxypropyl (PEG-DAA), PEG conjugated with diacylglycerol (PEG-DAG) (e.g., SUNBRIGHT GM-020 (NOF CORPORATION)), PEG conjugated with phospholipids such as phosphatidylethanolamine (PEG-PE), PEG conjugated with ceramide (PEG-Cer), PEG conjugated with cholesterol (PEG-cholesterol), or derivatives thereof, or mixtures thereof, mPEG2000-l,2- Di-O-alkyl-sn3-carbomoylglyceride (PEG-C-DOMG), l-[8'-(l,2-dimyristoyl-3-propanoxy)-carboxamide-3',6-dioxaoctanyl]carbamoyl-co-methyl-poly(ethylene glycol) (2KPEG-DMG) and the like can be mentioned. PEG lipids include PEG-DGA, PEG-DAA, PEG-PE, PEG-Cer, and a mixture of these, e.g., a PEG-DAA conjugate selected from the group consisting of a PEG-didecyl oxypropyl conjugate, a PEG-dilauryl oxypropyl conjugate, aPEG-dimyristyl oxypropyl conjugate, a PEG-dipalmityl oxypropyl conjugate, a PEG-distearyl oxypropyl conjugate, and mixtures thereof.
[0519] The ratio (mol %) of the PEG lipid to the total lipids present in the lipid nanoparticle of the present disclosure may be, for example, about 0% to about 20%, about 0.1% to about 5%, or about 0.7% to about 2%.
[0520] The ratio (mol %) of the terminal reactive PEG lipid in the above-mentioned total PEG lipids is, for example, about 10% to about 100%, about 20% to about 100%, or about 30% to about 100%.
[0521] Only one kind of the above-mentioned PEG lipid may be used or two or more kinds thereof may be used in combination. When multiple PEG lipids are used, the ratio of the whole PEG lipid is as mentioned above.V. Therapeutic Nucleic acid
[0522] An immune response, e.g., an innate immune response, to a therapeutic nucleic acid can be attenuated with the methods and related compositions comprising an ODN of the Disclosure. Hence, the methods and compositions can potentially increase the efficacy of treatment with therapeutic nucleic acid molecules and provide for long-term therapeutic benefits, even if the administration of the nucleic acid therapeutic is repeated.
[0523] Without wishing to be bound by any particular theory, an ODN of the Disclosure can increase the expression of the protein encoded by a therapeutic nucleic acid, decrease the immune response triggered by a therapeutic nucleic acid, or both.
[0524] In one embodiment, the disclosure provides methods for increasing the expression of a protein encoded by a therapeutic nucleic acid in a subject in need thereof, the method comprising administering to the subject an ODN of the Disclosure or a LNP of the Disclosure. In some embodiments, the protein expression level in a subject that would otherwise be achieved by the administration of a therapeutic nucleic acid is increased by at least 10% following administration of a LNP of the Disclosure, e.g., a LNP comprising a therapeutic nucleic acid and an ODN of the Disclosure, to the subject as compared to a LNP comprising a therapeutic nucleic acid but not a ODN of the Disclosure. In some embodiments, the protein expression is increased by at least 25%,by at least 50%, by at least 75%, by at least 100%, by at least 125%, by at least 150%, by at least 175%, by at least 200%, by at least 250%, by at least 500%, by at least 750%, by at least 1000%, or by at least 1500% following administration of an ODN of the Disclosure or a LNP of the Disclosure. Any method known in the art for quantitating specific proteins in a patient or a biological sample taken from a patient may be used in the methods of the disclosure. Examples include, but are not limited to, PCR (polymerase chain reaction) or RT-PCR, flow cytometry, Northern blot, Western blot, immunoassays, e.g., ELISA (enzyme linked immunosorbent assay), RIA (radioimmunoassay), Simoa™, gene chip analysis of RNA expression, immunohistochemistry, immunofluorescence, or mass-spectroscopy.
[0525] Nucleic acids are large, highly charged, rapidly degraded and cleared from the body, and offer generally poor pharmacological properties because they are recognized as a foreign matter to the body and become a target of an immune response, e.g., innate immune response. Hence, certain nucleic acids, such as therapeutic nucleic acids or nucleic acids used for research purposes, e.g., antisense oligodeoxynucleotide or viral vectors, often trigger immune responses in vivo. The present disclosure provides pharmaceutical compositions and methods that may ameliorate, reduce, or eliminate such immune responses and enhance efficacy of the therapeutic nucleic acids by increasing expression levels through maximizing the durability of the therapeutic nucleic acid in a reduced immune-responsive state in a subject recipient. Without wishing to be bound by a particular theory, this may also minimize any potential adverse events that may lead to an organ damage or other toxicity in the course of nucleic acid therapy. In some aspect, the compositions and methods provided herein relate to the administration of a modified ODN as specific ingredient to reduce the immune response, e.g., innate immune response, in conjunction with a therapeutic nucleic acids thereby reducing the immune response triggered by the presence of the therapeutic nucleic acid.
[0526] The immunogenic / immunostimulatory nucleic acids can include both deoxyribonucleic acids and ribonucleic acids. For deoxyribonucleic acids (DNA), a particular sequence or motif has been shown to induce immune stimulation in mammals. These sequence or motifs include, but are not limited to, CpG motifs, pyrimidine-rich sequences, and palindrome sequences. CpG motifs in deoxyribonucleic acid are often recognized by the endosomal toll -like receptor 9 (TLR-9) which, in turn, triggers both the innate immune stimulatory pathway and the acquired immune stimulatory pathway. Certain immunostimulatory ribonucleic acid (RNA) sequences bind to toll-like receptor 6 and 7 (TLR-6 and TLR-7) and are believed to activate proinflammatory response through theimmune response (e.g., innate immune response). Furthermore, double-stranded RNA can be often immunostimulatory because of its binding to TLR-3. Therefore, foreign nucleic acid molecules, either pathogen derived or therapeutic in their origin, can be highly immunogenic in vivo.
[0527] The characterization and development of nucleic acid molecules for potential therapeutic use in conjunction with inhibiting, e.g., preventing, decreasing, reducing, suppressing, ameliorating, mitigating, preventing or eliminating, of the immune response (e.g., innate immune response) are provided herein. In some embodiments, chemical modification of oligodeoxynucleotides for the purpose of altered and improved in vivo properties (delivery, stability, life-time, folding, target specificity), as well as their biological function and mechanism that directly correlate with therapeutic application, are described where appropriate.
[0528] As used herein, the phrases "nucleic acid therapeutic", "therapeutic nucleic acid" and "TNA" are used interchangeably and refer to any modality of therapy using nucleic acids as an active component of the therapeutic agent to treat a disease or disorder. For example, a therapeutic nucleic acid may refer to RNA-based therapeutics and / or DNA-based therapeutics. Non-limiting examples of RNA-based therapeutics include mRNA, antisense RNA and oligodeoxynucleotides, ribozymes, aptamers, interfering RNAs (RNAi), Dicer- substrate dsRNA, small hairpin RNA (shRNA), asymmetrical interfering RNA (aiRNA), microRNA (miRNA). Non-limiting examples of DNA-based therapeutics include minicircle DNA, minigene, viral DNA (e.g., Lentiviral or AAV genome) or non- viral synthetic DNA vectors, closed-ended linear duplex DNA (ceDNA / CELiD), plasmids, Nanoplasmid™, bacmids, doggybone (dbDNA™) DNA vectors, minimalistic immunological-defined gene expression (MIDGE)-vector, nonviral ministring DNA vector (linear-covalently closed DNA vector), or dumbbell-shaped DNA minimal vector ("dumbbell DNA").
[0529] Illustrative therapeutic nucleic acids of the present disclosure that can be immunostimulatory and require use of ODNs of the Disclosure can include, but are not limited to, minigenes, plasmids, minicircles, small interfering RNA (siRNA), microRNA (miRNA), antisense oligodeoxynucleotides (ASO), ribozymes, closed ended double stranded DNA (e.g., ceDNA, CELiD, linear covalently closed DNA ("ministring"), doggybone (dbDNA™), protelomere closed ended DNA, or dumbbell linear DNA), dicer- substrate dsRNA, small hairpin RNA (shRNA), asymmetrical interfering RNA (aiRNA), mricroRNS (miRNA), mRNA, tRNA, rRNA, and DNA viral vectors, viral RNA vector, and any combination thereof. Other therapeutic nucleic acids are known in the art. See, e.g., US 20220119840.
[0530] siRNA or miRNA that can downregulate the intracellular levels of specific proteins through a process called RNA interference (RNAi) are also contemplated by the present disclosure to be nucleic acid therapeutics. After siRNA or miRNA is introduced into the cytoplasm of a host cell, these double-stranded RNA constructs can bind to a protein called RISC. The sense strand of the siRNA or miRNA is removed by the RISC complex. The RISC complex, when combined with the complementary mRNA, cleaves the mRNA and release the cut strands. RNAi is by inducing specific destruction of mRNA that results in downregulation of a corresponding protein.
[0531] Antisense oligodeoxynucleotides (ASO) and ribozymes that inhibit mRNA translation into protein can be nucleic acid therapeutics. For antisense constructs, these single stranded deoxy nucleic acids have a complementary sequence to the sequence of the target protein mRNA, and Watson - capable of binding to the mRNA by Crick base pairing. This binding prevents translation of a target mRNA, and / or triggers RNaseH degradation of the mRNA transcript. As a result, the antisense oligodeoxynucleotide has increased specificity of action (i.e., down-regulation of a specific disease-related protein).
[0532] In any of the methods provided herein, the therapeutic nucleic acid can be a therapeutic RNA. The therapeutic RNA can be an inhibitor of mRNA translation, agent of RNA interference (RNAi), catalytically active RNA molecule (ribozyme), transfer RNA (tRNA) or an RNA that binds an mRNA transcript (ASO), protein or other molecular ligand (aptamer). In any of the methods provided herein, the agent of RNAi can be a double-stranded RNA, single-stranded RNA, micro RNA, short interfering RNA, short hairpin RNA, or a triplex-forming oligodeoxynucleotide.
[0533] According to some embodiments, the therapeutic nucleic acid is a closed ended double stranded DNA, e.g., a ceDNA. According to some embodiments, the expression and / or production of a therapeutic protein in a cell is from a non- viral DNA vector, e.g., a ceDNA vector. A distinct advantage of ceDNA vectors for expression of a therapeutic protein over traditional AAV vectors, and even lentiviral vectors, is that there is no size constraint for the heterologous nucleic acid sequences encoding a desired protein. Thus, even a large therapeutic protein can be expressed from a single ceDNA vector. Thus, ceDNA vectors can be used to express a therapeutic protein in a subject in need thereof.
[0534] In general, a ceDNA vector for expression of a therapeutic protein as disclosed herein, comprises in the 5' to 3' direction: a first adeno-associated virus (AAV) inverted terminal repeat (ITR), a nucleotide sequence of interest (for example an expression cassette as described herein) and a second AAV ITR. The ITR sequences selected from any of: (i) at least one WT ITR and atleast one modified AAV inverted terminal repeat (mod-ITR) (e.g., asymmetric modified ITRs); (ii) two modified ITRs where the mod-ITR pair have a different three-dimensional spatial organization with respect to each other (e.g., asymmetric modified ITRs), or (iii) symmetrical or substantially symmetrical WT-WT ITR pair, where each WT-ITR has the same three-dimensional spatial organization, or (iv) symmetrical or substantially symmetrical modified ITR pair, where each mod- ITR has the same three-dimensional spatial organization.VI. Therapeutic methods
[0535] The present disclosure provides methods to prevent, reduce or eliminate unwanted immune response (e.g., innate immune response) in a subject (e.g., a human subject) by administering to the subject at least one ingredient, e.g., an ODN of the Disclosure, which may reduce the immune response (e.g., innate immune response) as described herein and a nucleic acid (e.g., a therapeutic nuclide acid or a nucleic acid used for research purposes), wherein the administrations of the ingredient which may reduce the immune response (e.g., innate immune response) and the administration of the nucleic acid are correlated in time so as to provide a modulation in an immune response (e.g., innate immune response) when the administration of the two agents are provided in combination. These two agents can be administered at the same time in a co-formulation, e.g., as a LNP, at the same time in different formulations, or they can be administered separately at different times. As noted above, the combination of agents in an LNP of the Disclosure can also (i) increase the expression of the protein encoded by a therapeutic nucleic acid in a subject; or (ii) increase the expression of the protein encoded by a therapeutic nucleic acid and decrease the immune response in a subject.
[0536] In one embodiment, the disclosure provides methods for inhibiting, e.g., preventing, decreasing, reducing, suppressing, ameliorating, mitigating, preventing or eliminating, an immune response in a subject in need thereof, the method comprising administering to the subject an ODN of the Disclosure or a LNP of the Disclosure. In some embodiments, the immune response in a subject that would otherwise be triggered by the administration of a therapeutic nucleic acid is decreased by at least 5% following administration of a LNP of the Disclosure, e.g., a LNP comprising a therapeutic nucleic acid and an ODN of the Disclosure, to the subject as compared to a LNP comprising a therapeutic nucleic acid but not an ODN of the Disclosure. In some embodiments, the immune response is decreased by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, by at least 75%, by at least 80%,by at least 85%, by at least 90%, by at least 95%, or by at least 99% following administration of a LNP of the Disclosure. The decrease in immune response can be measured, for example, by determining the level of inflammatory cytokines, e.g., IFNa, in a subject prior to administration of an ODN of the Disclosure or a LNP of the Disclosure and again after administration of an ODN of the Disclosure or a LNP of the Disclosure. Methods used to measure the expression level of inflammatory cytokines are well known in the art.
[0537] In another embodiment, the disclosure provides methods for treating or preventing a disease, disorder, or condition in a subject in need thereof, the method comprising administering to the subject an ODN of the Disclosure or a LNP of the Disclosure. In some embodiments, the disease, disorder, or condition is a genetic disorder. In some embodiments, the genetic disorder is Duchenne muscular dystrophy (DMD), Gouche disease, Fabry disease, ornithine transcarbamylase deficiency, hemophilia (hemophilia A or hemophilia B), cystic fibrosis, Huntington's chorea, familial hypercholesterolemia (LDL receptor defect), hepatoblastoma, Wilson's disease, phenylketonuria, congenital hepatic porphyria, inherited disorders of hepatic metabolism, Lesch Nyhan syndrome, sickle cell anemia, thalassaemias, xeroderma pigmentosum, Fanconi's anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom's syndrome, retinoblastoma, or Tay-Sachs diseaseVII. Definitions
[0538] In order that the present description can be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description.
[0539] It is to be noted that the term "a" or "an" entity refers to one or more of that entity; for example, "a nucleotide sequence," is understood to represent one or more nucleotide sequences. As such, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein.
[0540] Furthermore, "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" as used in a phrase such as "A and / or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and / or" as used in a phrase such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0541] It is understood that wherever aspects are described herein with the language "comprising," otherwise analogous aspects described in terms of "consisting of' and / or "consisting essentially of' are also provided.
[0542] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei- Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure.
[0543] Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, nucleotide sequences are written left to right in 5' to 3' orientation. Amino acid sequences are written left to right in amino to carboxy orientation. The headings provided herein are not limitations of the various aspects of the disclosure, which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.
[0544] The term "about" is used herein to mean approximately, roughly, around, or in the regions of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term "about" can modify a numerical value above and below the stated value by a variance of 10 percent, up or down (higher or lower).
[0545] The term "oligonucleotide" or "ODN" refers to an oligomer or polymer of nucleosides, such as naturally-occurring and / or modified nucleosides, that are covalently linked to each other through intemucleoside linkages. ODNs useful for the present disclosure may include at least one non- naturally occurring nucleoside.
[0546] The term "nucleoside" as used herein is used to refer to a glycoside comprising a sugar moiety and a base moiety, and can therefore be used when referring to the nucleotide units, which are covalently linked by the internucleoside linkages between the nucleosides of the ODN. In the field of biotechnology, the term "nucleotide" is often used to refer to a nucleic acid monomer or unit.
[0547] As one of ordinary skill in the art would recognize, the 5' terminal nucleoside of an oligonucleotide does not comprise a 5' intemucleoside linkage group, although it can comprise a 5' terminal group.
[0548] As used herein, the terms, "administration," "administering" and variants thereof refers to introducing a composition, e.g., LNP, or agent, e.g., a therapeutic nucleic acid, into a subject and includes concurrent and sequential introduction of one or more compositions or agents. "Administration" can refer, e.g., to therapeutic, pharmacokinetic, diagnostic, research, placebo, and experimental methods. "Administration" also encompasses in vitro and ex vivo treatments. The introduction of a composition or agent into a subject is by any suitable route, including orally, pulmonarily, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), rectally, intralymphatically, intratumorally, or topically. The introduction of a composition or agent into a subject is by electroporation. Administration includes selfadministration and the administration by another. Administration can be carried out by any suitable route. A suitable route of administration allows the composition or the agent to perform its intended function. For example, if a suitable route is intravenous, the composition is administered by introducing the composition or agent into a vein of the subject.
[0549] As used herein, an "effective amount" or "therapeutically effective amount" of an active agent or therapeutic agent, such as an immunosuppressant and / or therapeutic nucleic acid, is an amount sufficient to produce the desired effect, e.g., a normalization or reduction of immune response (e.g., innate immune response) and expression or inhibition of expression of a target sequence in comparison to the expression level detected in the absence of a therapeutic nucleic acid and / or immunosuppressant. Suitable assays for measuring expression of a target gene or target sequence include, e.g., examination of protein or RNA levels using techniques known to those of skill in the art such as dot blots, northern blots, in situ hybridization, ELISA, immunoprecipitation, enzyme function, as well as phenotypic assays known to those of skill in the art. However, dosage levels are based on a variety of factors, including the type of injury, the age, weight, sex, medical condition of the patient, the severity of the condition, the route of administration, and the particular active agent employed. Thus, the dosage regimen may vary widely, but can be determined routinely by a physician using standard methods. Additionally, the terms "therapeutic amount", "therapeutically effective amounts" and "pharmaceutically effective amounts" include prophylactic or preventative amounts of the compositions of the disclosure. In prophylactic or preventative applications of the disclosure, pharmaceutical compositions or medicaments are administered to apatient susceptible to, or otherwise at risk of, a disease, disorder or condition in an amount sufficient to eliminate or reduce the risk, lessen the severity, or delay the onset of the disease, disorder or condition, including biochemical, histologic and / or behavioral symptoms of the disease, disorder or condition, its complications, and intermediate pathological phenotypes presenting during development of the disease, disorder or condition. It is generally preferred that a maximum dose be used, that is, the highest safe dose according to some medical judgment. The terms "dose" and "dosage" are used interchangeably herein.
[0550] As used herein the term "therapeutic effect" refers to a consequence of treatment, the results of which are judged to be desirable and beneficial. A therapeutic effect can include, directly or indirectly, the arrest, reduction, or elimination of a disease manifestation. A therapeutic effect can also include, directly or indirectly, the arrest reduction or elimination of the progression of a disease manifestation.
[0551] The phrase "genetic disease" as used herein refers to a disease, partially or completely, directly or indirectly, caused by one or more abnormalities in the genome, especially a condition that is present from birth. The abnormality may be a mutation, an insertion or a deletion. The abnormality may affect the coding sequence of the gene or its regulatory sequence. The genetic disease may be, but is not limited to Duchenne muscular dystrophy (DMD), Gouche disease, Fabry disease, ornithine transcarbamylase deficiency, hemophilia (hemophilia A or hemophilia B), cystic fibrosis, Huntington's chorea, familial hypercholesterolemia (LDL receptor defect), hepatoblastoma, Wilson's disease, phenylketonuria, congenital hepatic porphyria, inherited disorders of hepatic metabolism, Lesch Nyhan syndrome, sickle cell anemia, thalassaemias, xeroderma pigmentosum, Fanconi's anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom's syndrome, retinoblastoma, and Tay-Sachs disease.EXAMPLESGENERAL METHODSSynthesis of ODNs
[0552] ODNs were synthesized using automatic synthesis systems that are publicly known, e.g., FOCUS (Aapptec) or AKTA oligopilot plus 10 / 100 (GE Healthcare).Lipid Nanoparticle Formulation
[0553] The lipid particle of the present disclosure can be produced by mixing the nucleic acid payload and lipid component(s), with and without an ODN of the Disclosure, and then applying a known method to prepare a lipid nanoparticle. For example, the lipid nanoparticle can be produced as a lipid particle dispersion by dissolving the mixed lipid component, including cationic lipids (shown in Table 2) in an organic solvent and mixing the resulting organic solvent solution with water or a buffer, e.g., through an emulsifying method. The water phase contains nucleic acid payloads, e.g., luciferase coding DNAs, with and without an ODN of the Disclosure. The mixing may be performed by using a microfluid mixing system, e.g., the apparatus NanoAssemblr (Precision NanoSystems). The lipid particle obtained may be subj ected to desalting or dialysis and sterile filtration. As necessary, pH adjustment or osmotic pressure adjustment may be performed.Evaluation of LNPs
[0554] The particle size of the lipid nanoparticle (in the composition) can be measured by a known approach. For example, the particle size can be calculated as a Z-average particle size by the cumulant analysis of an autocorrelation function using a particle size measurement apparatus Zetasizer Nano ZS (Malvern Instruments) based on a dynamic light scattering measurement technique. The particle size (average particle size) of the lipid particle (in the composition) is, for example, 10 to 200 nm, e.g., 60 to 170 nm.
[0555] The concentration and rate of encapsulation of the nucleic acid in the composition of the present disclosure can be measured by a known approach. For example, the nucleic acid is fluorescently labeled using Quant-iT(TM) RiboGreen(R) (Invitrogen Corp.), and the fluorescence intensity can be measured to determine the concentration and the rate of encapsulation. The concentration of the nucleic acid in the composition can be calculated using a calibration curve prepared from aqueous nucleic acid solutions having known concentrations. The rate of encapsulation can be calculated on the basis of the difference in fluorescence intensity between the presence and absence of addition of Triton-X 100 (surfactant for disrupting the lipid nanoparticle). The concentration of the nucleic acid in the composition refers to the total concentration of a nucleic acid encapsulated in the lipid nanoparticle and an unencapsulated nucleic acid. The rate of encapsulation refers to the ratio of the nucleic acid encapsulated in the lipid nanoparticle to all nucleic acids in the composition.ODNs
[0556] The ODN and modified ODNs of Table 1 were prepared using known methods. MS was measured by Mass Spectrometer or LC / MS. As the ionization method, MALDI method, FAB method, ESI method, or APCI method was used. The data indicates actual measured value (found) or value calculated by deconvolution analysis. While a molecular ion peak is generally observed, a fragment ion is sometimes observed. In the case of a salt, a molecular ion peak or fragment ion peak of free form is generally observed.
[0557] Electrophoresis separates molecules based on size or radius of gyration, using electric field to move charged molecule through gel matrix. Reference ladder with determined size is used to dictate size of samples. Example 63 is too large to be promptly measured by MS so electrophoresis was used.EXAMPLE 1Evaluation of in vivo cytokine suppression and luciferase expression enhancement after administration of LNP of the Disclosure
[0558] The lipid nanoparticles loading luciferase coding DNA (CAG or CMV promotor) only, lipid nanoparticles loading ODN of the Disclosure and luciferase coding DNA (CAG or CMV promotor) or Vehicle (10% sucrose in PBS) as control were intravenously administered to the tails of ICrl CD I (ICR) mice (10 mL / kg i.v.). After administration of the lipid particles, luciferin (15 mg / mL) was administered to the mice (10 mL / kg i.p.), which were loaded in an IVIS (in vivo imaging system) apparatus (manufactured by PerkinElmer, Inc.) under isoflurane inhalation anesthesia. Luminescence images of the mice were taken ventrally (in a supine position) 15 minutes after luciferin administration. The luminescence was digitized with the software of IVIS, followed by evaluation using the value of total flux. Higher luminescence means strong expression of the protein encoded by the DNA encapsulate in the lipid particle. Measurement results are also shown in Table 3 and Fig. 1 A.
[0559] Inflammatory cytokines (IFNa and IP 10) were measured using plasma samples collected at 4h-post administration. The plasma samples were treated with U-PLEX Biomarker Group 1 (ms) Assays, SECTOR reagent and analyzed by SECTOR Imager 2400. Measurement results are also shown in Table 4 and Fig. IB.Table 3Table 4EXAMPLE 2Evaluation of in vivo cytokine suppression and luciferase expression enhancement after administration of LNP of the Disclosure - mRNA or pGL4.5
[0560] Vehicle (10% sucrose in PBS) as control, LNPs loading luciferase-coding mRNA (or luciferase-coding pGL4.5) only, or LNPs loading A151 (SEQ ID NO. 19) and luciferase-coding mRNA or luciferase-coding pGL4.5 were intravenously administered to the tails of ICrI CD I (ICR) mice (10 mL / kg i.v.). After administration of the lipid particles, luciferin (15 mg / mL) was administered to the mice (10 mL / kg i.p.), which were loaded in an IVIS (in vivo imaging system) apparatus (manufactured by PerkinElmer, Inc.) under isoflurane inhalation anesthesia. Luminescence images of the mice were taken ventrally (in a supine position) 15 minutes after luciferin administration. The luminescence was digitized with the software of IVIS, followed by evaluation using the value of total flux. Higher luminescence means strong expression of the protein encoded by the DNA encapsulate in the lipid particle. Measurement results are also shown in Table 5 and Fig. 2A.
[0561] Inflammatory cytokines (IFNa and IP 10) were measured using plasma samples collected at 4h-post administration. The plasma samples were treated with U-PLEX Biomarker Group 1 (ms) Assays, SECTOR reagent and analyzed by SECTOR Imager 2400. Measurement results are also shown in Table 6 and Fig. 2B.Table 5Table 6EXAMPLE 3Evaluation of in vivo cytokine suppression and luciferase expression enhancement after administration of lipid particle loading ODN of the Disclosure and DNA
[0562] Vehicle (10% sucrose in PBS) as control, lipid nanoparticles loading luciferase-coding DNA (CAG promotor) only, or lipid nanoparticles loading luciferase-coding DNA (CAG promotor) and an ODN of the Disclosure were intravenously administered to the tails of ICrkCDl (ICR) mice (10 mL / kg i.v.). After administration of the lipid particles, luciferin (15 mg / mL) was administered to the mice (10 mL / kg i.p.), which were loaded in an IVIS (in vivo imaging system) apparatus (manufactured by PerkinElmer, Inc.) under isoflurane inhalation anesthesia. Luminescence images of the mice were taken ventrally (in a supine position) 15 minutes after luciferin administration. The luminescence was digitized with the software of IVIS, followed by evaluation using the value of total flux. Higher luminescence means strong expression of the protein encoded by the DNA encapsulate in the lipid particle. Measurement results are also shown in Table 7 and Fig. 3A.
[0563] Inflammatory cytokines (IFNa and IP 10) were measured using plasma samples collected at 4h-post administration. The plasma samples were treated with U-PLEX Biomarker Group 1 (ms) Assays, SECTOR reagent and analyzed by SECTOR Imager 2400. Measurement results are also shown in Table 8 and Fig. 3B.Table 7Table 8EXAMPLE 4Evaluation of in vivo cytokine suppression and luciferase expression enhancement after administration of lipid particle loading ODN of the Disclosure and DNA (ODNs having various repeat unit numbers)
[0564] The lipid nanoparticles loading luciferase-coding DNA (C AG promotor) and A151-, C151- or iSG3-having various repeat unit numbers were intravenously administered to the tails of ICrkCDl (ICR) mice (10 mL / kg i.v.). After administration of the lipid particles, luciferin (15 mg / mL) was administered to the mice (10 mL / kg i.p.), which were loaded in an IVIS (in vivo imaging system) apparatus (manufactured by PerkinElmer, Inc.) under isoflurane inhalation anesthesia. Luminescence images of the mice were taken ventrally (in a supine position) 15 minutes after luciferin administration. The luminescence was digitized with the software of IVIS, followed by evaluation using the value of total flux. Higher luminescence means strong expression of the protein encoded by the DNA encapsulate in the lipid particle. Measurement results are also shown in Table 9 and Fig. 4 A.
[0565] Inflammatory cytokines (IFNa and IP 10) were measured using plasma samples collected at 4h-post administration. The plasma samples were treated with U-PLEX Biomarker Group 1 (ms) Assays, SECTOR reagent and analyzed by SECTOR Imager 2400. Measurement results are also shown in Table 10 and Fig. 4B.Table 9Table 10
[0566] Having now fully described the methods, compounds, and compositions herein, it will be understood by those of skill in the art that the same can be performed within a wide and equivalent range of conditions, formulations, and other parameters without affecting the scope of the methods, compounds, and compositions provided herein or any embodiment thereof. All patents, patent applications, and publications cited herein are fully incorporated by reference herein in their entirety.
Claims
What is claimed is:
1. A modified oligonucleotide (ODN) comprising the sequence: uuagggttagggttagggtuaggg (SEQ ID NO. 1), ttagggttagggttagggttaggg (SEQ ID NO. 2), ttcaaattcaaattcaaattcaaa (SEQ ID NO. 3), tgggcggttcaaccttca (SEQ ID NO. 4), tgactgtgaaggttagagatga (SEQ ID NO. 5), uuagggttagggttaggguuaggg (SEQ ID NO. 6), cctcattagggtgaggg (SEQ ID NO. 7), uuagggutagggttaggguuaggg (SEQ ID NO. 8), uuaggguuagggttaggguuaggg (SEQ ID NO. 9), uuaggguuaggguuaggguuaggg (SEQ ID NO. 10), uuagggttagggttagggttaggg (SEQ ID NO. 11), utcaaattcaaattcaaattcaaa (SEQ ID NO. 12), uucaaattcaaattcaaattcaaa (SEQ ID NO. 13), uucaaattcaaattcaaatucaaa (SEQ ID NO. 14), ccucattagggtgaggg (SEQ ID NO. 15), ugggcggttcaaccttca (SEQ ID NO. 16), or ugggcggttcaaccuuca (SEQ ID NO. 17); wherein: the sequences are written left to right in 5' to 3' orientation; a is adenosine, deoxyadenosine, or sugar-modified versions thereof; c is cytidine, deoxycytidine, or sugar-modified versions thereof; g is guanosine, deoxy guanosine, or sugar-modified versions thereof; t is 5-methyluridine, thymidine, or sugar-modified versions thereof; u is uridine, deoxyuridne, or sugar-modified versions thereof; the internucleoside linkages are phosphodiester, phosphorothioate, or phosphorodithioate linkages, or a combination thereof; andat least one of the a, c, g, t, or u nucleosides is a sugar-modified version thereof independently selected from the group consisting of:The modified ODN of claim 1 comprising the sequence: uuagggttagggttagggtuaggg (SEQ ID NO. 1). The modified ODN of claims 1 or 2, wherein at least four of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof. The modified ODN of claim 3, wherein at least six of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof. The modified ODN of claim 4, wherein the nucleosides marked with an u*u*a*gggttagggttagggtuag*g*g* are sugar-modified versions of u, a, and / or g. The modified ODN of claim 4, wherein at least eight of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof. The modified ODN of claim 6, wherein the nucleosides marked with an u*u*a*g*ggttagggttagggtua*g*g*g* are sugar-modified versions of u, a, and / or g.The modified ODN of claim 6, wherein at least ten nucleosides of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof. The modified ODN of claim 8, wherein the nucleosides marked with an u*u*a*g*g*gttagggttagggtu*a*g*g*g* are sugar-modified versions of u, a, and / or g. The modified ODN of claim 8, wherein at least twelve of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof. The modified ODN of claim 10, wherein the nucleosides marked with an u*u*a*g*g*g*ttagggttagggu*u*a*g*g*g* are sugar-modified versions of u, a, and / or g. The modified ODN of claim 10, wherein at least fourteen nucleosides of the a, c, g, t, and / or u nucleosides are sugar-modified versions thereof. The modified ODN of claim 12, wherein the nucleosides marked with an u*u*a*g*g*g*u*tagggttaggg*u*u*a*g*g*g* are sugar-modified versions of u, a, and / or g. The modified ODN of claim 12, wherein at least eighteen nucleosides of the a, c, g, t and / or u nucleosides are sugar-modified versions thereof. The modified ODN of claim 14, wherein the nucleosides marked with an u*u*a*g*g*g*u*u*a*gggttag*g*g*u*u*a*g*g*g* are sugar-modified versions of u, a, and / or g. The modified ODN of claim 14, wherein all of the a, c, g, t, and u nucleosides are sugar- modified versions thereof.The modified ODN of claim 3, wherein all of the g nucleosides are sugar-modified versions thereof. The modified ODN of claim 3, wherein all of the a nucleosides are sugar-modified versions thereof. The modified ODN of any one of claims 1-18 comprising SMN1. The modified ODN of any one of claims 1-19 comprising SMN2. The modified ODN of any one of claims 1-20 comprising SMN3. The modified ODN of any one of claims 1-21 comprising SMN4. The modified ODN of any one of claims 1-22 comprising SMN5. The modified ODN of any one of claims 1-23 comprising SMN6. The modified ODN of any one of claims 1-24 comprising SMN7. The modified ODN of any one of claims 1-25 comprising SMN8. The modified ODN of any one of claims 1-26 comprising SMN9. The modified ODN of any one of claims 1-27, wherein each of the intemucleoside linkages are phosphorothioate linkages. The modified ODN of any one of claims 1-27, wherein at least one internucleoside linkage is a phosphorodithioate linkage. An ODN or modified ODN comprising the sequence set forth in Table 1.A lipid nanoparticle comprising:(a) the ODN or modified ODN of any one of claims 1-30;(c) a cationic lipid;(d) a non-cationic lipid; and(b) a therapeutic nucleic acid. The lipid nanoparticle of claim 31, wherein the cationic lipid is a compound of Formula(I):whereinL1is a Ci-22 alkylene group, a C2-22 alkenylene group or a C3-22 alkadienylene group, n is an integer of 0 or 1,R1is(1) a hydrogen atom,(2) a linear C1-22 alkyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group,(3) a linear C2-22 alkenyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group, or(4) a linear C3-22 alkadienyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group,R2is -CH2-O-CO-R5, -CH2-CO-O-R5or -R5,R3is a hydrogen atom, -CH2-O-CO-R6, -CH2-CO-O-R6or -R6,R4is a hydrogen atom, -CH2-O-CO-R7, -CH2-CO-O-R7or -R7,R5, R6and R7are each independently(1) a linear C1-22 alkyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group,(2) a linear C2-22 alkenyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group,(3) a linear C3-22 alkadienyl group optionally substituted by one or two substituents selected from a linear C1-22 alkyl group and a linear C2-22 alkenyl group, or(4) -R10-CO-O-Ruor -R10-O-CO-Ru,R10is an optionally substituted Ci-16 alkylene group, an optionally substituted C4-16 alkenylene group or an optionally substituted C7-16 alkadienylene group, andR11is H, an optionally substituted Ci-is alkyl group, an optionally substituted C3-18 alkenyl group or an optionally substituted C15-18 alkadienyl group, R8and R9are each independently, a C1-6 alkyl group, or a salt thereof. The lipid nanoparticle of claim 31, wherein the cationic lipid is any one or more of the cationic lipids in Table 2. The lipid nanoparticle of any one of claims 31-33, wherein the non-cationic lipid is phospholipid, cholesterol and / or PEG lipid. The lipid nanoparticle of any one of claims 31-34, wherein the therapeutic nucleic acid is a DNA- or RNA-based therapeutic nucleic acid. The lipid nanoparticle of any one of claims 31-34, wherein the therapeutic nucleic acid and the ODN or modified ODN is not covalently bonded to one another. A method for inhibiting an immune response in a subject in need thereof, the method comprising administering to the subject the lipid nanoparticle of any one of claims 31-36. A method of treating or preventing a disease, disorder, or condition in a subject in need thereof, the method comprising administering to the subject the lipid nanoparticle of any one of claims 31-36. The method of claim 38, wherein the disease, disorder, or condition is a genetic disorder. The method of claim 39, wherein the genetic disorder is Duchenne muscular dystrophy (DMD), Gouche disease, Fabry disease, ornithine transcarbamylase deficiency,hemophilia, cystic fibrosis, Huntington's chorea, familial hypercholesterolemia (LDL receptor defect), hepatoblastoma, Wilson's disease, phenylketonuria, congenital hepatic porphyria, inherited disorders of hepatic metabolism, Lesch Nyhan syndrome, sickle cell anemia, thalassaemias, xeroderma pigmentosum, Fanconi's anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom's syndrome, retinoblastoma, or Tay-Sachs disease.