Antisense oligonucleotide analogs of mir-29 and uses thereof

EP4634386A1Pending Publication Date: 2025-10-22MIRSCIENCE THERAPEUTICS SERVICOS DE PESQUISA E DESENVOLVIMENTO LTDA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023901820
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-12-16
Filing Date
2023-11-27
Publication Date
2025-10-22

AI Technical Summary

Technical Problem

Current therapies for muscle atrophy, such as cancer-induced cachexia and sarcopenia, face challenges due to the short half-life and off-target effects of naturally occurring microRNAs, limiting their therapeutic potential.

Method used

Development of chemically modified antisense oligonucleotides (ASOs) derived from miR-29c, specifically designed to inhibit genes related to skeletal muscle atrophy, with a guide strand and passenger strand comprising modified ribonucleotides, enhancing stability and target specificity.

Benefits of technology

The modified ASOs effectively prevent or treat muscle atrophy by stabilizing miR-29c activity, reducing MuRFl and Atrogin-1 expression, and promoting muscle mass preservation in various atrophy models, including cancer-induced cachexia, immobilization, and aging-related muscle loss.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 1.1
    Figure 1.1
Patent Text Reader

Abstract

The present invention relates to synthetic antisense oligonucleotide derived from miRNAs. In particular, the present invention provides double-stranded miR-29c oligonucleotide analogs with chemically modified ribonucleotides, which may be further conjugated to lipidic or polymeric moieties. Pharmaceutical compositions comprising the double-stranded oligonucleotides or their conjugates, and methods of treating or preventing skeletal muscle atrophy associated with aging or conditions such as cancer-induced cachexia, immobilization, and others are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

ANTISENSE OLIGONUCLEOTIDE ANALOGS OF MIR-29 AND USES THEREOFFIELD OF INVENTION

[0001] The present invention relates to synthetic antisense oligonucleotides that increase miRNA activity in vitro and in vivo. In particular, the present invention relates to synthetic antisense oligonucleotides derived from miR-29c and their use in reducing skeletal muscle atrophy associated with aging or conditions such as cancer-associated cachexia and other muscle-related atrophies and myopathies.BACKGROUND OF THE INVENTION

[0002] Antisense oligonucleotides (ASO) are a class of nucleic acid analogues synthesized to target specific mRNAs (messenger RNA) and, as a result, regulate gene expression and protein synthesis (Baker et al., 2022). Many diseases are related to the overexpression or underexpression of proteins, and the ability to modulate this balance has an immense potential for treating disease that traditional medicine is only able to tackle the symptoms. Although ASO was first described in 1978 (Zamecnik & Stephenson, 1978), many challenges to its delivery and stability create setbacks for the advancement of this technology (Baker et al., 2022; Halloy et al., 2021). Recent technological breakthroughs such as chemical modification of nucleotide's backbones, new linkages and terminal conjugations with macromolecules made it possible to reach the market (Baker et al., 2022).

[0003] One strategy that has been used with success to overcome ASO challenges mentioned is chemical modification (Sasso et al., 2022). The most widely used chemical modification is the phosphorothioate (PS) modification where an oxygen (O) of the phosphodiester bond is replaced by a sulfur (S) atom (Kuijper et al., 2021; Sasso et al., 2022). Additional modifications include changes in the 2’ carbon of ribose sugar by adding new function groups such as Omethy (OMe or OCH3) or methoxyethyl (MOE) (Kuijper et al., 2021; Sasso et al., 2022). Not only the type of modification is relevant in this process, but also its position into the 20-22 nucleotide strand. All in all, the chemical modification changes the electronegativity of the single or double strand RNA molecule and, consequently, it secondary and / or tertiary conformations which create a stearicavoidance for nuclease attack. In addition, the modifications have been shown to increase affinity to targets, improve bioavailability and prevent renal clearance and improve non- liver uptake.

[0004] Another strategy that has been used in combination with chemical modification is the conjugation of the ASO strand to macromolecules such as antibodies (Levin, 2017, 2019), peptides (Cerro-Herreros et al., 2021), fatty acids (Biscans et al., 2019; Ostergaard et al., 2019), and others. The conjugated molecule has the potential to actively target a specific cell type or passively induce the accumulation of the ASO into the target tissue acids (Biscans et al., 2019; Ostergaard et al., 2019).

[0005] The underlying mechanism of action of ASO-mediated gene silencing is based on small regulatory RNAs such as small interfering RNAs (siRNAs) and microRNA, discovered more than two decades ago. Since then, new discoveries have demonstrated the important role of these molecules in the regulation of cellular functions and their potential for the treatment of numerous syndromes and diseases (Lam et al., 2015). As an example, the miR-29 family - miR-29a, miR-29b, and miR-29c - is of great importance for the regulation of plasticity and maintenance of skeletal muscle mass and function, and in this context, several works in the literature raise important evidence that modulation of miR-29 family levels are potential targets for therapeutic approaches to diseases involving muscle atrophy (Li et al., 2017; Silva et al., 2019; Wang et al., 2020).

[0006] MicroRNAs (miRNAs or miR) are a class of non-coding RNAs characterized by their relatively small size of 20 to 22 nucleotides (Sasso et al., 2022). Its small size has significant advantages as it allows the molecule to interact with several targets through complete or partial Watson-Crick base pairing complementarity. Due to the ubiquitous control of essential cellular activities by microRNAs, their potential as therapeutic targets in precision medicine is evident.

[0007] In the natural synthesis of miRNAs, primary RNAs (pri-miRNA), which are characterized by their longer size with unpaired bases that create a hairpin structure, are cleaved by Drosha nuclease forming the precursor microRNA (pre-miRNA). Subsequently, the pre-miRNA molecule is transported from the nucleus to the cytoplasm where it is further processed by the Dicer complex to produce a mature double-stranded miRNA, which binds to the Argonaute enzyme to form the RNA-induced silencing complex (RISC) (Sasso et al., 2022). Upon RISC assembly, one of the strands of themiRNA - the passenger or sense strand - is removed, leaving only the strand that is complementary to the target mRNA - the guide or antisense strand.

[0008] Of particular interest for this invention, the miR-29 family comprises two clusters of miR29a>miR29b and miR29b>miR29c which are associated with chromosome 4 and 13, respectively. The miR-29c member have been associated with silencing crucial genes for muscle atrophy including but not limited to MuRFl and Atrogin-1 (Silva et al., 2019). These genes regulate the balance between protein synthesis and degradation in the muscle tissue which can control the adaptive response of muscle atrophy and hypertrophy. MuRFl and Atrogin-1 are overexpressed in several cases of muscle loss, therefore, they are also known as atrogenes, and the control of its elevation is an interesting target for inhibiting the muscle atrophy process (Adams et al., 2020; Baehr et al., 2011; Wang et al., 2020).

[0009] Overall, there is a need for a new ASO capable of regulating the miR-29 family with focus on skeletal muscle tissue. Despite the high therapeutic potential and clinical interest, medical uses of miRNAs have been mostly limited by their natural short half-life and off-target effects.

[0010] International patent application published as W02007070483 discloses methods of using microRNAs (miRNAs) to modulate the expression level of a gene in a myocyte, and to compositions comprising miRNAs. The invention broadly mentions that the microRNA that modulates gene expression in myocytes can be selected from miR-1, miR-133, miR-206, miR-208, miR-22, miR-26, miR-29, miR- 30, miR-128, miR-143, and miR- 145. However, the invention does not teach the biological activities of miR-29c in the myocyte nor its application to prevent skeletal muscle mass loss. Moreover, the microRNAs of the invention are not chemically-modified and, therefore, are subject to the short half-life and off-target effects that underpin the broad adoption of naturally- occurring microRNAs as therapeutic tools.

[0011] International patent application published as WO 2012 / 012676 describes the use of miR-29 to downregulate the expression of the BH3-only family of genes and protect cells from apoptosis. The inventors suggest that the miR-29-mediated reduction of apoptosis could be useful in treating muscle atrophy, sarcopenia, or cachexia. Although the invention suggests that any member of the miR-29 family could provide the desiredinhibition of the BH3-only genes, the examples show that only miR-29b produced the intended effect.

[0012] Brazilian patent application No BR102018067702-0, to Moriscot and Silva, describes the use of naturally occurring sequence of MIR-29c to induce muscle mass and strength gain upon downregulating the expression of genes involved in muscle atrophy. However, the invention does not deal with the biochemical stability issues underlying the therapeutic administration of naturally occurring miRNAs to modulate gene expression in vivo.

[0013] United States patent No 9,376,681, to Montgomery et al, describes chemically-modified oligonucleotide mimetics of miR-29 and their use in treating or preventing conditions associated with dysregulation of extracellular matrix genes, such as tissue fibrotic conditions. The invention is based, in part, on the discovery that miRNA mimics with modifications for stability and cellular uptake can be used to replicate endogenous functions of miR-29. The modified nucleotides of US 9,376,681 may be 2' sugar modifications, such as 2'-alkyl (2'-O-methyl) or 2'-fluoro modifications, and may be present in at least one position of the guide strand, the passenger strand, or both.

[0014] However, US 9,376,681 does not describe the compounds here disclosed unprecedentedly nor their effects over the expression of genes involved in muscle atrophy and the significant prevention of muscle loss in vivo. Moreover, although US 9,376,681 discloses chemically-modified miR-29c mimics, it neither discloses a structure-activity relationship for miR-29c derivatives nor antisense oligonucleotides with the efficacy and stability of those described herein.

[0015] The present invention demonstrates a novel family of chemically modified analogues of miR-29c, which are highly stable and efficacious in preventing or treating muscle atrophy in vivo. The newly designed ASOs, henceforth generally referred to as MT-29, can provide a useful treatment for patients with, but not only, diseases related to muscle wasting, such as cancer-induced-cachexia, sarcopenia, immobilization among others.SUMMARY OF THE INVENTION

[0016] The invention provides new miR-29c-derived double-stranded antisense oligonucleotides (ASO) that can inhibit the expression of genes related to skeletal muscleatrophy. Pharmaceutical compositions comprising said ASOs are also provided herein as well as methods of treating or preventing skeletal muscle mass loss associated with the regular process of aging or related with a plethora of diseases.

[0017] In one embodiment, the double-stranded antisense oligonucleotide comprises a guide strand and a passenger strand consisting of chemically-modified ribonucleotides, wherein the guide strand has about 22 ribonucleotides comprising a mature miR-29c sequence, and the passenger strand has about 19 ribonucleotides comprising a sequence that is substantially complementary to the first strand, and wherein the guide strand has a 3' nucleotide overhang relative to the passenger strand. Said chemically-modified ribonucleotides are selected from 2'-O-methyl, 2’-fluoro, 2’-O- methoxyethyl, inverted base, methylphosphonate, 2’ aminopurine and 5’Bromo.

[0018] In a further embodiment, the double-stranded antisense oligonucleotide has a monophosphate at the 5’ end of the guide strand. The nucleotides in positions 1, 2, 7, 9, 11, 13, 15, 17, and 19 of the guide strand and in positions 1, 19, and 20 of the passenger strand may be 2'-O-methyl modified nucleotides.

[0019] In yet another embodiment, the double-stranded antisense oligonucleotide of the invention may have nucleotides in positions 2, 4, 6, 8, 10, 14, 16, and 18 of the guide strand that are 2’-fluoro modified nucleotides. In a further embodiment, the nucleotides in positions 21 and 22 of the guide strand are either 2'-O-methyl or 2’-O- methoxyethyl modified nucleotides.

[0020] It is also encompassed by the invention double-stranded antisense oligonucleotides wherein the nucleotides in positions 5, 12, and 20 of the guide strand and in positions 3-18 of the passenger strand may be either 2'-O-methyl or 2’-fluoro modified nucleotides.

[0021] In a further embodiment, one or more nucleotides in positions 1, 2, 10, 12, 14, 16, 18, 20, and 21 of the guide strand and in positions 1, 2, 18, and 19 of the passenger strand further have a 5’ phosphorothioate.

[0022] The double-stranded antisense oligonucleotide of the invention may also have 10 or 11 mismatches between the nucleotide sequences of the guide strand and the passenger strand, optionally said mismatches occur at positions 2, 5-7, 9, 12, 14-16, 18 and / or 19.

[0023] In preferred embodiments, the double-stranded antisense oligonucleotide comprises a guide strand that has a nucleotide sequence as set forth in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7, and a passenger strand that has a nucleotide sequence as set forth in SEQ ID NO: 12.

[0024] In another preferred embodiment, the double-stranded antisense oligonucleotide comprises a guide strand that has a nucleotide sequence as set forth in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7, and a passenger strand that has a nucleotide sequence as set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12.

[0025] Another embodiment of the invention encompasses an antisense oligonucleotide conjugate, which comprises a double stranded antisense oligonucleotide of the previous embodiments conjugated to a lipid or a polymer moiety at the 5’ end of the passenger strand. Said lipid moiety may be a C8-C22 fatty acid chain.

[0026] The invention also encompasses pharmaceutical compositions comprising any of the afore-mentioned double-stranded antisense oligonucleotides or antisense oligonucleotide conjugates, and at least one pharmaceutically acceptable excipient or carrier.

[0027] In a preferred embodiment, the invention also provides methods of treating or preventing muscle atrophy comprising administering an effective amount of any of the afore-mentioned double-stranded antisense oligonucleotide, antisense oligonucleotide conjugate, or pharmaceutical composition to a subject suffering from a disease or condition that promotes or derives from skeletal muscle mass loss.

[0028] The use of any of the afore-mentioned double-stranded antisense oligonucleotide, antisense oligonucleotide conjugate, or pharmaceutical composition in the preparation of a medicament to treat a subject suffering from a disease or condition that promotes or derives from skeletal muscle mass loss is also encompassed by the invention.BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 shows the effect of the overexpression of miR-29c in cancer- induced cachexia models. (A) Mice Tibialis Anterior (TA) muscle (Balb / c - 8 weeks old) were electroporated with control plasmid EV (Empty Vector) or with miR-29coverexpression plasmid (pMIR29c), then after 16 days animals were injected with CT26 cells to induce cachexia and after 14 days euthanized. The following groups were formed: naive control (Control), cachectic (CC), cachectic electroporated with EV (CC+EV), and cachectic electroporated with pMIR29c (CC+pMIR29c). (B) Muscle Tibialis anterior mass. (C) Fibers’ cross-sectional area. (D) Representative photomicrographs of tibialis anterior muscle. Scale bar = 50pm. (E) Frequency distribution of fibers’ cross-sectional area. (F) Maximal tetanic force assessment of the tibialis anterior muscle before and after a fatigue protocol. The data are shown as the mean and standard deviation. One-way ANOVA followed by Tukey's post hoc test was applied. *P < 0.05 against Control, &P < 0.05 vs CC+EV. n=5 per group.

[0030] Figure 2 shows the effect of the overexpression of miR-29c over the protein expression of MuRFl in the cancer-induced cachexia mice. (A) representative western blot of MuRFl, GAPDH as a loading control. (B) densitometry of western blot for MuRFl normalized by the GAPDH.

[0031] Figure 3 shows the effect of the overexpression of miR-29c in immobilization models. (A) Mice Tibialis Anterior (TA) muscle (C57bl / 6 - 8 weeks old) were electroporated with control plasmid EV (Empty Vector) or with miR-29c overexpression plasmid (pMIR29c), then after 16 days animals had their left paw immobilized and after 14 days euthanized. The following groups were formed: naive control (Control), immobilized (Imm), immobilized electroporated with EV (Imm+EV), and immobilized electroporated with pMIR29c (Imm+pMIR29c). (B) Muscle Tibialis anterior mass normalized by body weight (BW). (C) Fibers’ cross-sectional area. (D) Representative photomicrographs of tibialis anterior muscle. Scale bar = 50pm. One-way ANOVA followed by Tukey's post hoc test was applied. *P < 0.05 against Control, &P < 0.05 vs Imm+EV. n=5 per group.

[0032] Figure 4 shows the effect of the overexpression of miR-29c in dexamethasone-induced atrophy models. (A) Mice Tibialis Anterior (TA) muscle (C57bl / 6 - 8 weeks old) were electroporated with control plasmid EV (Empty Vector) or with miR-29c overexpression plasmid (pMIR29c), then after 16 days animals were injected with dexamethasone (25 mg / kg, i.p.) daily, and after 14 days euthanized. The following groups were formed: Saline 0,9% injected control (Control), Dexamethasone (Dex), Dexamethasone electroporated with EV (Dex+EV), and Dexamethasoneelectroporated with pMIR29c (Dex+pMIR29c). (B) Muscle Tibialis anterior mass normalized by body weight (BW). (C) Fibers’ cross-sectional area. (D) Representative photomicrographs of tibialis anterior muscle. Scale bar = 50pm. One-way ANOVA followed by Tukey's post hoc test was applied. *P < 0.05 against Control, &P < 0.05 vs Dex+EV. n=5 per group.

[0033] Figure 5 shows the effect of the overexpression of miR-29c in fasting- induced atrophy models. (A) Mice Tibialis Anterior (TA) muscle (C57bl / 6 - 8 weeks old) were electroporated with control plasmid EV (Empty Vector) or with miR-29c overexpression plasmid (pMIR29c), then after 28 days animals were maintained for 48 h with no food but free access to water, and after 2 days euthanized. The following groups were formed: Fed group control (Control), Fasting (Fas), Fasting electroporated with EV (Fas+EV), and Fasting electroporated with pMIR29c (Dex+pMIR29c). (B) Body weight before (Initial) and after (Final) food removal. (C) Muscle Tibialis anterior mass normalized by body weight (BW). (D) Fibers’ cross-sectional area. (E) Representative photomicrographs of tibialis anterior muscle. Scale bar = 50pm. One-way ANOVA followed by Tukey's post hoc test was applied. *P < 0.05 against Control, &P < 0.05 vs Dex+EV. n=5 per group.

[0034] Figure 6 shows the effect of the overexpression of miR-29c in aging sarcopenic mice models. (A) Mice Tibialis Anterior (TA) muscle (C57bl / 6 - 23 months old) were electroporated with control plasmid EV (Empty Vector) or with miR-29c overexpression plasmid (pMIR29c), then after 30 days animals were euthanized. The following groups were formed: Naive young mice 4 months old (Control), Old (Old), Old electroporated with EV (Old+EV), and Old electroporated with pMIR29c (Old+pMIR29c). (B) Muscle Tibialis anterior mass normalized by body weight (BW). (D) Fibers’ cross-sectional area. (E) Representative photomicrographs of tibialis anterior muscle. Scale bar = 50pm. One-way ANOVA followed by Tukey's post hoc test was applied. *P < 0.05 against Control, &P < 0.05 vs Old+EV. n=5 per group.

[0035] Figure 7 shows the effect of different guide strands over morphological features of mature C2C12 myotubes. (A) Immunofluorescence and Representative photomicrographs of mature myotubes (eMCH-positive) three days after transfection of the MT-29 compounds. (B) Diameter measurements of myotubes. (C) Fusion index evaluation. Scrambled sequence (Control); miR™ (commercially available miR-29cmimic, Thermo Fisher); NT (no-transfected cells); MT-29 guide strands compounds (1002, 1004, 1006, 1008 and 1010). The data are shown as the mean and standard deviation. One-way ANOVA followed by Tukey's post hoc test was applied. * p<0.05 vs Control. n=4 per group.

[0036] Figure 8 demonstrates stability and target inhibition efficacy of different MT-29 guide strands in mature C2C12 myotubes. (A) MuRFl gene expression in myotubes three days after transfection, as determined by real time PCR and normalized by GAPDH expression. (B) miR-29c levels in myotubes three days after transfection, as determined by qPCR and normalized by U6 expression. The data are represented by their mean and standard deviation. A one-way ANOVA and Tukey's post hoc test were used. * p<0.05 vs Control. n=4 per group.

[0037] Figure 9 illustrates the hypertrophic effects induced by MT-29 sequences over mature C2C12 myotubes. (A) Diameter measurements of myotubes determined by immunofluorescence with eMHC. (B) Table demonstrating the level of increase in the myotube diameter to the control group. The data are shown as the mean and standard deviation. One-way ANOVA followed by Tukey's post hoc test was applied. * p<0.05 vs Control. n=4 per group.

[0038] Figure 10 demonstrates stability and target inhibition efficacy of MT-29 sequences over mature C2C12 myotubes. (A) MuRFl gene expression in myotubes three days after transfection, as determined by real time PCR and normalized by GAPDH expression. (B) Table demonstrating the level of inhibition in the MuRFl gene expression relative to the control group. The data are shown as the mean and standard deviation. One-way ANOVA followed by Tukey's post hoc test was applied. * p<0.05 vs Control. n=4 per group.

[0039] Figure 11 demonstrates stability and target inhibition efficacy of MT-29 sequences compounds 2014, 2026 and 2030 over mature C2C12 myotubes several days after transfection. MuRFl gene expression determined by real time PCR and normalized by GAPDH expression (Graphic in the top) and respective level of inhibition in the MuRFl gene expression relative to the control group (Table in the bottom), after 1 (A), 3 (B) and 5 (C) days of MT-29 transfection. The data are shown as the mean and standard deviation. One-way ANOVA followed by Tukey's post hoc test was applied. * p<0.05 vs Control. n=4 per group.

[0040] Figure 12 is an MTT assay to investigate the cytotoxicity effect of MT-29 compound 2026. C2C12 cells were transfected with increased concentrations of MT-29 (5nM, 12.5nM, 25nM, 50nM, 100nM, 200nM and 500nM). The positive control group is a representative for normal cell viability and did not receive MT-29 (OnM). Experiments were conducted without transfectant (blue line) or with lipofectamine™ (green line). The data are shown as the mean and standard deviation. One-way ANOVA followed by Tukey's post hoc test was applied. * p<0.05 vs 0. n=4 per group.

[0041] Figure 13 It is an in vitro transfection of three different lipidic bioconjugations of MT-29 (50μM each), OA: MT-29-OA; DCA: MT-29-DCA and PA: MT-29-PA, into muscle cell myoblasts (C2C12). Scrambled was used as a control. The expression levels of microRNA miR-29c (A) and the target gene MuRFl (B) were observed by qPCR. Data were expressed in arbitrary units (au) as mean and SEM; One- way ANOVA followed by Tukey's post hoc test was applied. n=4 per group. *P ≤ 0.05 vs the scrambled group (blue bars).

[0042] Figure 14 illustrated the experimental design of example 3 using immobilization model and two weeks of treatment with three different lipidic bioconjugations of MT-29 (25 mg / kg per week, subcutaneously), OA: MT-29-OA; DCA: MT-29-DCA and PA: MT-29-PA (A), demonstrates the soleus muscle mass weight (B), the cross sectional area (CSA) (C), a representative panel of photomicrographs of cross- sectional soleus muscle sections stained with H&E (D). Data were expressed as mean and SEM. Muscle mass was normalized by tibia size (mg / mm); Scale bar = 50pm. One-way ANOVA followed by Tukey's post hoc test was applied. n=4 per group. *P ≤ 0.05 vs the scrambled group (blue bars); #P ≤ 0.05 vs the Naive group (gray bars).

[0043] Figure 15 illustrated the anatomopathological and histological images of liver, kidney, lung and heart for Scrambled, MT-29-PA, MT-29-DCA and MT-29-OA, in the experimental design of example 3 using immobilization model and two weeks of treatment with three different lipidic bioconjugations of MT-29 (25 mg / kg per week, subcutaneously).

[0044] Figure 16 Illustrated the experimental design of Example 4 with MT-29 treatment in healthy animals. Balb / c mice were treated with MT-29 or Scrambled for four weeks (25 mg / kg per week, subcutaneously) (A), demonstrating the muscle mass of the tibialis anterior (B), soleus (C), the mean cross-sectional area (CSA) of the soleus muscle,with a representative panel of photomicrographs of cross-sectional soleus muscle sections stained with H&E (D). Muscle function was assessed using the grip strength method, utilizing two analysis protocols for the Forelimb (E) and Four paws (F), showing the final strength one day before euthanasia (Grip Strength) or normalized to baseline strength (Delta Grip Strength). Data were expressed as mean and SEM. Muscle mass was normalized by tibia size (mg / mm); Scale bar = 50pm. Student's t-test was applied. n=6 per group. *P ≤ 0.05 vs the scrambled group (blue bars).

[0045] Figure 17 shows the molecular analyses after treatment in healthy animals with MT-29 or Scrambled (50 mg / kg, intravenous) after 4 days, with Western blot demonstrating the protein expression of MuRFl in the Gastrocnemius (A) and Tibialis Anterior (B) muscles, and their respective band densitometry (C) and (D). And molecular analyses after MT-29 or Scrambled treatment (25 mg / kg, subcutaneously) after 7 days, with analysis of MuRFl gene expression (E) and its protein expression (F), followed by band densitometry (G) in the Tibialis Anterior muscle. GAPDH was used as an endogenous control. Data were expressed as mean and SEM. Student's t-test was applied. n=6 per group. *P ≤ 0.05 vs. the Scrambled group (blue bars).

[0046] Figure 18 illustrates the experimental design of Example 5 using C57bl / 6 mice with 24 months aged as a sarcopenia model and two weeks of treatment with MT- 29 or Scrambled (25 mg / kg per week, subcutaneously). A Naive group with 5 months aged was included as a young control (A). Demonstrates the Tibialis Anterior (B), soleus muscle mass weight (C), soleus cross sectional area mean (CSA) (D) and a representative panel of photomicrographs of cross-sectional soleus muscle sections stained with H&E (D). Data were expressed as mean and SEM. Muscle mass was normalized by tibia size (mg / mm); Scale bar = 50pm. One-way ANOVA followed by Tukey's post hoc test was applied. n=5 per group. *P ≤ 0.05 vs the scrambled group (blue bars); #P ≤ 0.05 vs the Naive group (gray bars).

[0047] Figure 19 shows the molecular analyses after treatment in aged mice (24 months age) with MT-29 or Scrambled (25 mg / kg per week, subcutaneously) after two weeks of treatment, with qPCR for gene expression analysis of MuRFl (A) and Atrogin- 1 (B) in Tibialis anterior muscle and Western blot demonstrating the protein expression of MuRFl in the Gastrocnemius (C) and Tibialis Anterior (D) muscles, and their respective band densitometry (E) and (F). GAPDH was used as an endogenous control.Data were expressed as mean and SEM. One-way ANOVA followed by Tukey's post hoc test or Student's t-test was applied. n=5 per group. *P ≤ 0.05 vs. the Scrambled group (blue bars). #P ≤ 0.05 vs the Naive group (gray bars).

[0048] Figure 20 Illustrates the experimental design of Example 6 using a cancer- induced cachexia model with CT26 murine cancer cell injection in Balb / c mice and twenty days of treatment with MT-29 at different doses (12.5, 25, 50, and 100 mg / kg single-dose, intravenous) or Scrambled. A Naive group was included as a healthy control (A). Demonstrates the Gastrocnemius muscle mass weight (B) and cross sectional area mean (CSA) (C) and a representative panel of photomicrographs of cross-sectional muscle sections stained with H&E (D). Muscle function was assessed using the grip strength method, utilizing two analysis protocols for the Forelimb (E) and Four paws (F), showing the final strength one day before euthanasia (Grip Strength) or normalized to baseline strength (Delta Grip Strength). Data were expressed as mean and SEM. Muscle mass was normalized by tibia size (mg / mm); Scale bar = 50pm. One-way ANOVA followed by Tukey's post hoc test was applied. n=6 per group. *P ≤ 0.05 vs the scrambled group (blue bars); #P ≤ 0.05 vs the Naive group (gray bars).

[0049] Figure 21 shows the molecular analyses after treatment in cancer-induced cachexia mice with MT-29 at different doses (12.5, 25, 50, and 100 mg / kg single-dose, intravenous) or Scrambled. qPCR for gene (A) and western blot for protein (B) expression analysis of MuRFl in Tibialis anterior muscle. GAPDH and 18S were used as an endogenous control. Data were expressed as mean and SEM. One-way ANOVA followed by Tukey's post hoc test. n=5 per group. *P ≤ 0.05 vs. the Scrambled group (blue bars).#P ≤ 0.05 vs the Naive group (gray bars).DETAILED DESCRIPTION

[0050] The terms used in this specification generally have their ordinary meanings in the art, within the context of the disclosure, and in the specific context where each term is used. Certain terms that are used to describe the disclosure are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner regarding the description of the disclosure. Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference in their entirety.

[0051] The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. For convenience, certain terms may be highlighted, for example using italics and / or quotation marks: The use of highlighting has no influence on the scope and meaning of a term; the scope and meaning of a term is the same, in the same context, whether or not it is highlighted.

[0052] It will be appreciated that the same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein. No special significance is to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonyms does not exclude the use of other synonyms. The use of examples anywhere in this specification including examples of any terms discussed herein is illustrative only and is not intended to further limit the scope and meaning of the disclosure or of any exemplified term. Likewise, the disclosure is not limited to various embodiments given in this specification.

[0053] As used herein, the term "miR-29", refers to a microRNA in the human miR-29c family. The term includes miR-29, pri-miR-29, pre-miR-29, and mature miR- 29. The term also includes sequence variants of members of the miR-29c family (e.g., 1 2, 3, 4, 5, or more variant nucleotides) as long as the variant substantially retains the biological activity of the wild-type miR-29c. The term also includes variants that have been modified to resist degradation within a subject and / or within a cell. The term further includes fragments of a miR-29c variant that substantially retain the biological activity of the wild-type miR-29c or of the corresponding full-length variant. The term "substantially retains the biological activity" is defined as a level of at least one biological activity (e.g., inhibition of expression of a gene) of at least 50% of the activity of the wild-type sequence.

[0054] Throughout the disclosure, the term “antisense oligonucleotide” may be used interchangeably with the terms “ASO”, “microRNA analogue”, “miR-29c agonist” “microRNA agonist,” “microRNA mimic,” “miRNA mimic” or “miR-29c mimic”; the term “first strand” may be used interchangeably with the terms “antisense strand” or “guide strand', while the term “second strand’ may be used interchangeably with the term “sense strand’ or “passenger strand”.

[0055] As used herein, "nucleic acid," "nucleotide sequence," and "polynucleotide" are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, and synthetic (e.g., chemically synthesized) DNA or RNA. The term polynucleotide, nucleotide sequence, or nucleic acid refers to a chain of nucleotides without regard to length of the chain.

[0056] The nucleic acid can be double-stranded or single-stranded. Where single- stranded, the nucleic acid can be a sense strand or an antisense strand. The nucleic acid can be synthesized using oligonucleotide analogs or derivatives (e.g. inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids that have altered base-pairing abilities or increased resistance to nucleases. The present invention further provides a nucleic acid that is the complement (which can be either a full complement or a partial complement) of a nucleic acid, nucleotide sequence, or polynucleotide of this invention.

[0057] The terms "percent identity" and "percent identical," in the context of two nucleic acid or protein sequences, refer to two or more sequences or subsequences that have in some embodiments at least 60%, in some embodiments at least 70%, in some embodiments at least 80%, in some embodiments at least 85%, in some embodiments at least 90%, in some embodiments at least 95%, in some embodiments at least 96%, in some embodiments at least 97%, in some embodiments at least 98%, and in some embodiments at least 99% nucleotide identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is publicly available through the National Center for Biotechnology Information via the World Wide Web.

[0058] An "isolated polynucleotide" is a nucleotide sequence (e.g. DNA or RNA) that is not immediately contiguous with nucleotide sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived. Thus, in one embodiment, an isolated nucleic acid includes some or all of the 5' non-coding (e.g. promoter) sequences that are immediately contiguous to a coding sequence. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, orwhich exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment), independent of other sequences.

[0059] An isolated polynucleotide that includes a gene is not a fragment of a chromosome that includes such gene, but rather includes the coding region and regulatory regions associated with the gene, but no additional genes naturally found on the chromosome.

[0060] The term "isolated" can refer to a nucleic acid or nucleotide sequence that is substantially free of cellular material, viral material, and / or culture medium (when produced by recombinant DNA techniques), or chemical precursors or other chemicals (when chemically synthesized). Moreover, an "isolated fragment" is a fragment of a nucleic acid, nucleotide sequence or polypeptide that is not naturally occurring as a fragment and would not be found in the natural state, even if obtained by synthetic / recombinant techniques. "Isolated" does not mean that the preparation is technically pure (homogeneous), but it is sufficiently pure to provide the nucleic acid in a form in which it can be used for the intended purpose.

[0061] As used herein, the term "myocyte" refers broadly to all classifications of muscle cells at all stages of development. Thus, "myocyte" encompasses both undifferentiated muscle cells, such as for example myoblasts, as well as differentiated muscle cells, such as for example terminally differentiated myotubes. "Myocyte" also encompasses muscle cells of varying histological types, including but not limited to striated muscle cells (e.g., skeletal muscle cells), smooth muscle cells (e.g., intestinal muscle cells), and cardiac muscle cells. Further, "myocyte" as used herein is not species specific. The term "naturally occurring", as applied to an object, refers to the fact that an object can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including bacteria) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring. It must be understood, however, that any manipulation by the hand of man can render a "naturally occurring" object an "isolated" object as that term is used herein.

[0062] The terms "inhibit", "reduce", or grammatical variations therefrom, as used herein, refer to a decrease in the specified level or activity of at least about 15%, 25%, 35%, 40%, 50%, 60%, 75%, 80%, 90%, 95% or more. In particular embodiments,the inhibition or reduction results in little or essentially no detectable activity (at most, an insignificant amount, e.g., less than about 10% or even 5%).

[0063] The term “therapeutic activity” as used herein refers to a demonstrated or potential biological activity whose effect is consistent with a desirable therapeutic outcome in humans, or to desired effects in non-human mammals or in other species or organisms. A given therapeutic peptide may have one or more therapeutic activities, however, the term “therapeutic activities’ as used herein may refer to a single therapeutic activity or multiple therapeutic activities. “Therapeutic activity” includes the ability to induce the desired response and may be measured in vivo or in vitro. For example, a desirable effect may be assayed in cell culture, isolated tissues, animal models, clinical evaluation, EC50 assays, IC50 assays, or dose-response curves. The term therapeutic activity includes preventive or curative treatment of a disease, disorder, or condition. Treatment of a disease, disorder or condition can include improvement of a disease, disorder or condition by any amount, including the elimination of a disease, disorder or condition.

[0064] The term “therapeutically effective” as used herein depends on the condition of a subject and the specific compound administered as well as its dose, frequency of dosing, pharmaceutical preparation and administration modes. The term refers to an amount effective to achieve a desired clinical effect. A therapeutically effective amount varies with the nature of the condition being treated, the length of time that activity is desired, and the age and the condition of the subject, and ultimately is determined by the health care provider.

[0065] As used herein, the acronyms IC and EC stand for, respectively, “Inhibitory Concentration” and “Effective Concentration” and the notation IC50 and EC50 denote either the half-maximal or the maximal inhibition or activation of a particular biological phenomenon promoted by a compound in an in vitro assay. Likewise, the acronym ED stands for “Effective Dose” and the notation ED50 denote either the half-maximal or the maximal inhibition or activation of a particular biological phenomenon promoted by a compound in an in vitro assay

[0066] Herein, the term “treating or preventing” includes abrogating, substantially inhibiting, slowing or reversing the progression of a disease or disorder,substantially ameliorating clinical symptoms of a disease or disorder or substantially preventing the appearance of clinical symptoms of a disease or disorder.

[0067] As used herein the phrase “preparation of a medicament” includes the use of the components of the invention directly as the medicament in addition to their use in any stage of the preparation of such a medicament.

[0068] As used herein, the term "subject" refers to any animal (e.g., a mammal), including, but not limited to, humans, non-human primates, rodents, and the like, to which the compositions and methods of the present invention are administered. Typically, the terms "subject" and "patient" are used interchangeably herein in reference to a human subject.

[0069] The term "pharmaceutically acceptable", as used herein, refers to that which is useful in preparing a pharmaceutical composition that is generally safe, non- toxic, and neither biologically nor otherwise undesirable and includes that which is acceptable for veterinary as well as human pharmaceutical use.

[0070] Antisense oligonucleotide

[0071] As miR-29c analogues, the ASOs according to the invention are double- stranded polyribonucleotides comprising a first strand - guide strand - and a second strand - passenger strand - wherein the guide strand comprises a mature miR-29c sequence, containing at least one chemically-modified ribonucleotide, and the passenger strand comprises a sequence that is substantially complementary to the first strand and contains at least one chemically-modified ribonucleotide.

[0072] In one embodiment, the antisense strand of the ASOs of the invention comprises from about 20 to about 23 nucleotides comprising a sequence of mature miR- 29c with at least one modified nucleotide and the passenger strand comprises from about 19 to about 21 nucleotides comprising a sequence that is partially, substantially, or fully complementary to the guide strand. In various embodiments, the guide strand may comprise about 21, 22, 23, or 24 nucleotides and the passenger strand may comprise about 19 or 20 nucleotides.

[0073] It is understood that the sequence of the guide strand is considered to be identical to the sequence of a mature miR-29c even if the first strand includes a modified nucleotide instead of a naturally-occurring nucleotide. For example, if a mature, naturally-occurring miRNA sequence comprises a cytidine nucleotide at a specificposition, the guide strand of the ASO of the invention may comprise a modified cytidine nucleotide, such as 2'-fluoro-cytidine, at the corresponding position or if a mature, naturally-occurring miRNA sequence comprises a uridine nucleotide at a specific position, the miRNA region of the guide strand of the mimetic compound may comprise a modified uridine nucleotide, such as 2'-fluoro-uridine, 2'-O-methyl-uridine, 2 - methoxyethyl-uridine, 5-fluorouracil, or 4-thiouracil at the corresponding position. Thus, as long as the modified nucleotide has the same base-pairing capability as the nucleotide present in the mature, naturally-occurring miR-29c sequence, the sequence of the guide strand is considered to be identical to the mature, naturally-occurring miRNA sequence. In some embodiments, the guide strand may include a modification of the 5'-terminal residue. For example, the guide strand may have a 5 '-terminal monophosphate.

[0074] In some embodiments, the passenger strand of the microRNA mimic is partially complementary to the sequence of the first strand. For example, the sequence of the second strand is at least about 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%, inclusive of all values therebetween, complementary to the sequence of the first strand. In some other embodiments, the second strand is substantially complementary to the sequence of the first strand.

[0075] It is understood that the sequence of the passenger strand is considered to be complementary to the guide strand even if the passenger strand includes a modified nucleotide instead of a naturally-occurring nucleotide. For example, if the guide strand sequence comprises a guanosine nucleotide at a specific position, the passenger strand may comprise a modified cytidine nucleotide, such as 2'-O-methyl-cytidine, at the corresponding position.

[0076] However, in some embodiments, the passenger strand comprises several mismatches relative to the guide strand. That is, up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 nucleotides between the guide strand and the passenger strand may not be complementary. The mismatches may be consecutive, not consecutive, or mixed, being distributed throughout the passenger strand.

[0077] In some embodiments, the guide strand of the mimetic compound may comprise an overhang on the 5' or 3' end of the strands. In certain embodiments, the guide strand comprises a 3' overhang, i.e., a single-stranded region that extends beyond the duplex region, relative to the passenger strand. The 3' overhang of the first strand mayrange from about one nucleotide to about four nucleotides. In certain embodiments, the 3' overhang of the first strand may comprise 1 or 2 nucleotides. In some embodiments, the nucleotides comprising the 3' overhang in the first strand are linked by phosphorothioate linkages. In certain embodiments, the 3' overhang in the guide strand comprises two modified nucleotides. In one embodiment, the 3' overhang of the first strand comprises one uridine-based and one adenosine-based modified nucleotides linked through a phosphorothioate linkage.

[0078] In various embodiments, the ASOs of the present invention comprise modified nucleotides. For instance, in one embodiment, the guide strand of the mimic comprises one or more 2'-fluoro nucleotides. In one embodiment, the second strand comprises one or more 2'-O-methyl modified nucleotides. Examples of modified nucleotides which can be used to generate the microRNA include, but are not limited to, 2’-fluoro, 2’-O-methyl, 2'-O-methoxyethyl, and other known derivatives of adenine, guanine, cytosine or uridine. Such derivatives may be selected from the group comprising 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomet- hyluracil, dihydroiiracil, beta-D- galactosylqueosine, inosine, N6-isopentenyiadenine, 1- methylguanine, 1 -methylinosine, 2,2-dimethyl guanine, 2’-O-methyladenine, 2'-O-methylguanosine, 2'-O-methylcytidine, 2'-O-methyluridine, 2’-O-methoxyethyl adenine, 2 ’-O-methoxy ethyluridine, 3- methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyl uracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'- methoxycarboxymethyluracii, 5-methoxyuracil, 5 ’Bromo, 2-methylthio-N6-isopenten- yladenine, uracil-5 -oxy acetic acid, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2- thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, inverted base, methylphosphonate, 2’ aminopurine and 2,6-diaminopurine.

[0079] In particular embodiments, which may be preferred embodiments for clinical use, 2’O-methyl modified nucleotides may be preferred over 2’fluoro modified nucleotides due to better safety profile.

[0080] The ASOs of the present invention may further include nucleotide sequences wherein at least one of the intemucleotide bridging phosphate residues aremodified phosphates, such as methyl phosphonate, methyl phosphonothioate, phosphonothioate phosphorothioate, phosphoropiperazidate and phosphoramidate. For example, two out of three nucleotides in the 5’ end, in the 3’ end, or in both, of the guide strand and / or the passenger strand, have phosphate residues that can be modified as described.

[0081] The guide strand of the ASOs of the present invention has the general nucleotide sequence set forth in SEQ ID NO: 1, outlined in the 5 ’-3’ direction. In various embodiments, the guide strands are 22 nucleotides long, with a 5 '-terminal monophosphate and a 3’ overhang of 2 nucleotides. Positions 1, 3, 7, 9, 11, 13, 15, 17, and 19 are 2'-O-methyl modified nucleotides, while those positions 2, 4, 6, 8, 10, 14, 16, and 18 are 2’ -fluoro modified nucleotides. In some embodiments, nucleotides in positions 5, 12, and 20 may be either 2'-O-methyl or 2’-fluoro modified nucleotides, while those in positions 21 and 21 may be either 2'-O-methyl or 2’-O-methoxyethyl modified nucleotides. In yet some embodiments, nucleotides in positions 1, 2, 10, 14, 16, 18, 20, and 21 may have a further modified phosphate such that the resulting bond to the preceding 5’ nucleotide is a phosphorotioate bond.

[0082] The passenger strand of the ASOs of the present invention has the general nucleotide sequence set forth in SEQ ID NO: 2, outlined in the 5 ’-3’ direction. In various embodiments, nucleotides in positions 1, 2, 19, and 20 are 2'-O-methyl modified nucleotides and, except for the adenine in position 1, may have a further modified phosphate such that the resulting bond to the preceding 5’ nucleotide is a phosphorotioate bond. Positions 3-18 may be either 2'-O-methyl or 2’-fluoro modified nucleotides. In some embodiments, nucleotides in position 2 may have a further modified phosphate such that the resulting bond to the preceding 5’ nucleotide is a phosphorotioate bond.

[0083] In preferred embodiments, the guide strand of the double-stranded ASOs of the invention may have a nucleotide sequence selected from the group comprising SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8. Likewise, the passenger strand of the said ASOs may have a nucleotide sequence selected from the group comprising SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13.

[0084] The guide strands and the passenger strands of the present invention may be combined in varying configurations to form double-stranded ASOs according to theinvention. In various embodiments, the guide strand of the resulting ASOs have 10 or 11 mismatches with the passenger strand, particularly at positions 2, 5-7, 9, 12, 14-16, 18 and / or 19.

[0085] In certain preferred embodiments, the ASO comprises a guide strand that has a nucleotide sequence as set forth in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8, and a passenger strand that has a nucleotide sequence as set forth in SEQ ID NO: 9.

[0086] In other preferred embodiments, the ASO comprises a guide strand that has a nucleotide sequence as set forth in SEQ ID NO: 3 and a passenger strand that has a nucleotide sequence as set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.

[0087] In yet other preferred embodiments, the ASO comprises a guide strand that has a nucleotide sequence as set forth in SEQ ID NO: 4 and a passenger strand that has a nucleotide sequence as set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.

[0088] In yet other preferred embodiments, the ASO comprises a guide strand that has a nucleotide sequence as set forth in SEQ ID NO: 5 and a passenger strand that has a nucleotide sequence as set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.

[0089] In yet other preferred embodiments, the ASO comprises a guide strand that has a nucleotide sequence as set forth in SEQ ID NO: 6 and a passenger strand that has a nucleotide sequence as set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.

[0090] In yet other preferred embodiments, the ASO comprises a guide strand that has a nucleotide sequence as set forth in SEQ ID NO: 7 and a passenger strand that has a nucleotide sequence as set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.

[0091] In yet other preferred embodiments, the ASO comprises a guide strand that has a nucleotide sequence as set forth in SEQ ID NO: 8 and a passenger strand that has a nucleotide sequence as set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13

[0092] Antisense oligonucleotides synthesis

[0093] Oligonucleotides of the invention can be synthesized by any method known in the art, e.g., using enzymatic synthesis and / or chemical synthesis. The oligonucleotides can be synthesized in vitro (e.g., using enzymatic synthesis and chemical synthesis) or in vivo (using recombinant DNA technology well known in the art).

[0094] Oligomerization of modified and unmodified nucleosides is performed according to literature procedures for DNA-like compounds (Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press) and / or RNA-like compounds (Scaringe, Methods (2001), 23, 206-217. Gait et al, Applications of Chemically synthesized RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36. Gallo et al, Tetrahedron 57:5707-5713 (2001),) synthesis as appropriate, (see, also, Current Protocols in Nucleic Acid Chemistry, Beaucage, S. L. et al, John Wiley & Sons, Inc., New York, N.Y., USA, which is herein incorporated herein by reference in its entirety).

[0095] Oligonucleotides are preferably chemically synthesized using appropriately protected reagents and a commercially available oligonucleotide synthesizer. Suppliers of oligonucleotide synthesis reagents useful in manufacturing the oligonucleotides of the invention include, but are not limited to, Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL , USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK). Alternatively, oligomers may be purchased from various oligonucleotide synthesis companies such as, for example, Dharmacon Research Inc., (Lafayette, Colo.), Qiagen (Germantown, MD), Proligo and Ambion.

[0096] In certain embodiments, the preparation of oligonucleotides as disclosed herein is performed according to literature procedures for DNA: Protocols for Oligonucleotides and Analogs, Agrawal, Ed., Humana Press, 1993, and / or RNA: Scaringe, Methods, 2001, 23, 206-217; Gait et al, Applications of Chemically synthesized RNA in RNA: Protein Interactions, Smith, Ed., 1998, 1-36; Gallo et al, Tetrahedron, 2001, 57, 5707-5713. Additional methods for solid-phase synthesis may be found U.S. Patent Nos. 4,415,732; 4,458,066; 4,500,707; 4,668,777; 4,725,677; 4,973,679; and 5,132,418; and Re. 34,069.

[0097] Irrespective of the particular protocol used, the oligonucleotides used in accordance with this invention may be conveniently and routinely made through the well- known technique of solid phase synthesis. Suitable solid phase techniques, including automated synthesis techniques, are described in Oligonucleotides and Analogues, a Practical Approach, F. Eckstein, Ed., Oxford University Press, New York, 1991. Any other means for such synthesis known in the art may additionally or alternatively be employed (including solution phase synthesis).

[0098] Methods and tools for delivering antisense nucleotides

[0099] There are two major obstacles to effective delivery of oligonucleotides to cells or tissues, namely: poor transport of oligonucleotides across cell membranes, and rapid degradation by tissue and serum nucleases. Several solutions to these limitations have been proposed, including, for instance, (1) the use of electroporation, lipid-mediated transfection (lipofection), or calcium phosphate-mediated transfection to induce cell uptake, mostly in vitro; (2) conjugation of oligonucleotides with fatty acids, polymers, or biological macromolecule carriers; (3) incorporation into lipid, polymeric, or mixed lipid- polymeric vesicles or particles; and (4) insertion of the information to express the desired oligonucleotides into expression vectors.[000100] One skill in the art will recognize that the four delivery concepts may be employed individually or in combination to provide the best delivery profile to the desired oligonucleotide. The available methods for delivering oligonucleotides have been extensively discussed in, for instance, documents W02010011346, W02013090648, W02013090457, which are incorporated herein by reference.[000101] Preferred embodiments include conjugates of ASOs with lipidic and / or polymeric moieties. The ASOs of the present invention may be reversibly or irreversibly conjugated to a liposome-forming or a micelle-forming lipid, with or without a linker. Upon exposure to reducing conditions, such as within a cell, the ASO may be unconjugated from the lipid of the liposome or micelle and can downregulate the expression of a target mRNA. Examples of lipidic and / or polymeric moieties and methods that can be employed to produce such conjugates are further detailed, for instance, in WO2009123185 and WO2011008857.[000102] In particular embodiments, the passenger strand of the ASOs of the present invention may be conjugated to a lipidic or polymeric moiety at the 5’ end, with or withouta linker. The lipidic moieties may be saturated or unsaturated C8-C22 fatty acids chains with mono, bi, or trivalency, such as caprylic acid (8:0), capric acid (10:0), lauric acid (12:0), myristic acid (14:0), palmitic acid (16:0), stearic acid (18:0), arachidic acid (20:0), docosanoic acid (22:0), lignoceric acid (24:0), cerotic acid (26:0), myristoleic acid (14:1(9)), palmitoleic acid (16:1(9)), sapienic acid (16:1(6)), oleic acid (18:1(9)), elaidic acid (18:l(9t)), vaccenic acid 18: 1(1 It), linoleic acid (18:2(9,12)), linoelaidic acid 18:2(9t,12t), linolenic acid (18:3(9,12,15) arachidonic acid (20:4(5,8,11,14)), eicosapentaenoic acid (20:5(5,8,11,14,17)), erucic acid (22:1(13)) and decosahezaenoic acid (22:6 (4,7,10,13,16,19)). [000103] When a linker is present, it may be an amino C3-C12 linker, such as aminoC3, amino C6, amino C7, amino Cl 2, carboxyl, thiol via a phosphorothiate, phosphotothiolate or phosphodiester linkage. Linkers applicable to the ASO conjugates of the present invention include, but are not limited to, those shown in Table 1, wherein R1 is an oxygen or a sulfur atom, R2 is an ASO of the invention, and R3 is a lipid or polymer moiety.[000104] Table 1: structure of applicable linkers.[000105] It should be promptly acknowledged that the double-stranded ASO of the invention may be further conjugated to a fluorophore for investigational purposes. In such embodiments, the ASO may comprise a guide strand conjugated to a fluorophore dye such as Cy3, Cy5, Cy 5.5 and Flurescein dT.[000106] The ASOs of the present invention, conjugated or unconjugated, may be further formulated according to the ordinary knowledge of a skilled person. For instance, the pharmaceutical forms of the invention can be prepared and formulated in accordance with the conventional methods and using pharmaceutically acceptable excipients such as disclosed, for example, in the British, European and United States Pharmacopeias, Remington's Pharmaceutical Sciences (REMINGTON and GENNARO, 2020), Martindale: The Extra Pharmacopoeia (MARTINDALE and REYNOLDS, 1996) and Pharmaceutical technology (PRISTA et al, 1996).[000107] Therefore, in one embodiment, the invention encompasses pharmaceutical compositions comprising the double-stranded antisense oligonucleotide according to the invention. In another embodiment, said pharmaceutical composition comprises the antisense oligonucleotide conjugate as described herein.[000108] In one embodiment, the compositions of the present invention are formulated such that they are suitable for extended-release of the ASOs contained therein. Such extended-release compositions may be conveniently administered to a subject at extended dosing intervals. For example, in one embodiment, the compositions of the present invention are administered to a subject twice a day, daily or every other day. In a preferred embodiment, the compositions of the present invention are administered to a subject twice a week, once a week, every ten days, every two weeks, every three weeks,or more preferably every four weeks, once a month, every six weeks, every eight weeks, every other month, every three months, every four months, every six months, every eight months, every nine months or annually. Also contemplated are compositions which are formulated for depot administration (e.g., intramuscularly, subcutaneously, intravitreally) to either deliver or release an ASO over extended periods of time. Preferably, the extended- release means employed are combined with modifications made to the ASO to enhance stability.[000109] The compositions may be formulated for any route of administration including, for example, topical, oral nasal, rectal, or parenteral administration. The term parenteral, as used herein, includes subcutaneous injection, intradermal injection, intravascular injection (for example, intravenous), intramuscular injection, spinal injection, intracranial injection, intrathecal injection, and intraperitoneal injection, as well as any similar technique of injection or infusion. In certain modalities, compositions for oral use are preferred. Such compositions include, for example, pills, tablets, solutions, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules or syrups or elixirs. Among other modalities, pharmaceutical compositions may be formulated with a freeze-dried powder.[000110] Exemplary formulations are also disclosed in U.S. Pat. Nos. 5,981,505; 6,217,900; 6,383,512; 5,783,565; 7,202,227; 6,379,965; 6,127,170; 5,837,533: 6,747,014; and WO03 / 093449, which are herein incorporated by reference in their entireties.[000111] Therapeutic uses of antisense oligonucleotides and methods of treating or preventing age-related or disease-related muscle atrophy with antisense oligonucleotides[000112] As discussed, it has been demonstrated that miR-29c naturally controls the expression of genes related to skeletal muscle mass loss both in physiological and disease- related conditions. The artificial increase of the availability of miR-29c in myocytes by contacting these cells to miR-29c analogs has been correlated with downregulation of atrogenes, such as, for instance, MuRFl and Atrogin-1, ultimately leading to prevention of muscle mass loss or muscle mass gain, both in normal (i.e. physiological) and disease- associated conditions.[000113] Supported by the ability of the ASOs of the present invention to inhibit atrogenes, the present invention provides methods for treating or preventing diseases orconditions wherein skeletal muscle atrophy is promoted by atrogenes. The methods provided herein comprise administering a therapeutically effective amount of an AS O of the present invention or a conjugate thereof to a subject in need of treatment.[000114] The atrogenes described here as targets of the ASOs of the invention include targets in multiple molecular pathways controlling cellular functions, such as protein synthesis, apoptosis, protein degradation, autophagy, mitophagy, and other pathways associated with the atrophy and hypertrophy process.[000115] The aforementioned atrogenes include molecules capable of hybridizing with the nucleotide sequence of an ASO of the invention. Without wishing to limit the scope of the invention, examples of atrogenes that hybridizing with the nucleotide sequence of an ASO of the invention are AKT1S 1, FOXO3, PIK3C3, CTNNB 1,RPTOR, GSK3B, MSTN, PDCD4, FBXO32, HDAC4, NFATC1, NFATC2, TRIM54, TRIM63, TSC2, ATG13, BECN1, EIF2B2, IGF1, IGF1R, IKBKB, IRS1, NFATC4, PPARGC1A, PRKAA2, TGFBR1, TSC1, IRF1, MTOR, RPS6KB1, SMAD3, KLF15, PLD1, SMAD2, MAPK8, ACVR2B, DDIT4, LATS1, MAPK1, PRKAA1, STK3, ACVR1B, AKT3, BNIP3, CHUK, LATS2, NUAK2, SGK1, NFKB1, PDK1, SRF, NFATC3, and PTEN. The molecules referred to herein as targets of an ASO of the invention also include mRNA sequences indirectly impacted by the hybridization of an ASO of the invention with a target sequence, indirectly as a secondary effect of individual or hub genes, and indirectly as a secondary effect of pathways. Therefore, the invention protects all molecules specified herein as targets, including known and yet-to-be- discovered components of impacted pathways.[000116] The use of the said ASOs in the preparation of compositions and medicaments useful in the treatment or prevention of diseases and conditions related to or underlying skeletal muscle atrophy is also disclosed herein.[000117] Examples of diseases or conditions wherein skeletal muscle atrophy is promoted by atrogenes, such as MuRFl and Atrogin-1, include but are not limited to, cancer-related cachexia, denervation, myopathy, motor neuron diseases, diabetes, chronic obstructive pulmonary disease, liver disease, congestive heart failure, chronic renal failure, chronic infection, sepsis, fasting, sarcopenia, glucocorticoid-induced atrophy, disuse, space flight, and immobilization muscular dystrophy, such as Duchenne MuscularDystrophy, Becker Muscular Dystrophy, myotonic muscular dystrophy, and Facioscapulohumeral (FSHD).[000118] In addition to the treatment of skeletal muscle atrophy, this treatment can also be used in healthy patients for skeletal mass gain for fitness and athletic purposes.[000119] Cachexia is an acquired, accelerated loss of muscle caused by an underlying disease. In some instances, cachexia refers to a loss of body mass that cannot be reversed nutritionally, and is generally associated with an underlying disease, such as cancer, chronic obstructive pulmonary disease (COPD), acquired immunodeficiency syndrome (AIDS), and heart failure.[000120] Sarcopenia, or age-related muscle atrophy, is the continuous process of muscle atrophy in the course of regular aging that is characterized by a gradual loss of muscle mass and muscle strength over a span of months and years. A regular aging process means herein an aging process that is not influenced or accelerated by the presence of disorders and diseases which promote skeletomuscular neurodegeneration.[000121] Myopathy is a generic term that refers to a disease of the muscle. In some instances, myopathy includes myotonia; congenital myopathy such as nemaline myopathy, multi / minicore myopathy and myotubular (centronuclear) myopathy; mitochondrial myopathy; familial periodic paralysis; inflammatory myopathy; metabolic myopathy, for example, caused by a glycogen or lipid storage disease; dermatomyositis; polymyositis; inclusion body myositis; myositis ossificans; rhabdomyolysis; and myoglobinuria. In some instances, myopathy is caused by a muscular dystrophy syndrome, such as Duchenne, Becker, myotonic, fascioscapulohumeral, Emery-Dreifuss, oculopharyngeal, scapulohumeral, limb girdle, Fukuyama, a congenital muscular dystrophy, or hereditary distal myopathy.[000122] Other diseases or conditions that lead to skeletal muscle atrophy are, for instance, denervation, motor neuron diseases, diabetes, chronic obstructive pulmonary disease, liver disease, congestive heart failure, chronic renal failure, chronic infection, sepsis, fasting, disuse, bed resting, immobilization, glucocorticoid-induced loss of skeletal muscle mass, disuse, or space flight.[000123] Suitable methods for administering to a subject an AS O or a vector encoding the ASO of the present invention include but are not limited to systemic administration, parenteral administration (including intravascular, intramuscular,intraarterial administration), oral delivery, subcutaneous administration, inhalation, surgical implantation, transdermal delivery, local injection, and hyper- velocity injection / bombardment. Where applicable, continuous infusion can enhance drug accumulation at a target site. The particular mode of administration used in accordance with the methods of the present subject matter depends on various factors, including but not limited to the ASO employed, the severity of the condition to be treated, and mechanisms for metabolism or removal of the active compound(s) following administration.[000124] The invention disclosed herein, and illustrative embodiments therefrom, will now be described by means of practical examples. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the ASOs and / or methods claimed herein are made and evaluated and are intended to be purely exemplary of the invention. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.EXAMPLESExample 1: Proof of concept: miR-29c overexpression in vivo by plasmid electroporation[000125] The ability of miR-29c to regulate genes associated with atrophy creating protective benefits for the skeletal muscle was initially validated using in vivo electroporation and an expression plasmid for the natural RNA sequence of miR-29c.METHODSIn vivo miR-29c overexpression[000126] For the exclusive expression of miR-29c in the anterior tibial muscle, a gene expression method by electroporation was employed, as previously standardized by our team (SILVA et al., 2019; SOKOOWSKA; BACHNIO-ZABIELSKI, 2019). In order to expose the anterior tibial muscle, mice were anesthetized by an intraperitoneal injection of ketamine / xylazine cocktail (100 mg / kg and 10 mg / kg, respectively). Then, the surgically exposed muscle was injected with hyaluronidase solution (0.4 U / pl - 25pl) inan effort to promote muscle permeability by loosening the extracellular matrix (MCMAHON et al., 2001). After thirty minutes, the muscle was injected with miR-29c expression plasmid pMIR29c (50ng - 25pl) or an Empty Vector (50ng - 25pl) and instantly received current via platinum electrodes parallel to the muscle fibers (5 pulses - 20ms - 1Hz - 50 volts). According to a previously published scientific research, this approach is around 85 percent effective in transfecting muscle fibers (SILVA et al., 2019).Cancer-induced-cachexia in mice[000127] Sixteen days after muscle electroporation, male Balb-c mice (8 weeks old) were injected with CT26 cells (CT26 colorectal cancer) to induce cancer-cachexia. First, CT26 cells were cultivated on culture plates using growth media (RPMI 1640 + 10% FBS) at 37°C and 5% CO2. Then, cells were harvested at 90% confluence after two consecutive passages, centrifuged, and resuspended in RPMI 1640 medium. Immediately after resuspension, the animals were sedated with a intraperitoneal injection of ketamine / xylazine cocktail (100 mg / kg and 10 mg / Kg, respectively) and a solution containing 10E6 CT26 cells were injected subcutaneously into the dorsal area. Finally, fourteen days later the animals were euthanized to evaluate muscle function and to harvest tissues for further analysis. limb immobilization-induced muscle atrophy in mice[000128] Sixteen days after muscle electroporation, male C57bl / 6 mice (8 weeks old) were sedated with a intraperitoneal injection of ketamine / xylazine cocktail (100 mg / kg and 10 mg / Kg, respectively), then the left hind paw was properly cleaned, and using a metal splint and microporous tape, the paw was positioned at an angle of 90° (dorsiflexion) in order to keep the tibialis anterior muscle in a state of permanent relaxation. A plaster mold was placed on the animal's paw, and after drying, a metal grid was placed just above it, in order to protect the plaster from possible gnawing by the animal. Finally, fourteen days later the animals were euthanized to evaluate muscle tissues for further analysis.Dexamethasone treatment to induce muscle atrophy in mice[000129] Sixteen days after muscle electroporation, male C57bl / 6 mice (8 weeks old) were treated with dexamethasone solution (Dex, Decadron 4 mg injectable- ache®)or saline 0,9% (Control group) intraperitoneally at a dose of 25 mg / kg daily. All animals were euthanized after 14 days.Fasting-induced muscle atrophy in mice[000130] Twenty-eight days after muscle electroporation, male C57bl / 6 mice (8 weeks old), were maintained for 48 h with no food but free access to water. The control group was fed normally. All animals were euthanized after 2 days of fasting.Aging-related muscle atrophy in mice[000131] Male C57bl / 6 mice (23 months old) had the TA muscle electroporated with a plasmid for overexpression of miR-29c (pMIR29c) or EV control, according to the protocol described above. Young 4-month-old mice were used as controls. After 30 days, the animals were euthanized.In situ evaluation of tibialis anterior function[000132] Tribromoethanol solution (20 mg / 100 g of body wt, ip) was used to anesthetize the animals, after which a lateral incision in the hindlimb exposed the sciatic nerve, followed by tibialis anterior tendon dissection and isolation. The animals were then placed in a supine position on a platform in order to connect the tibialis anterior distal tendon to a force transducer and attach an electrode to the sciatic nerve. After a five- minute adaptation period, the optimal muscle length was established by progressively stretching the muscle until the maximum tetanic force is obtained. Then, two separate stimulation protocols were used to determine maximum tetanic force before and after muscular fatigue. Maximal tetanic force was evaluated by a protocol of single twitches (0.2 Hz, 2 seconds, for 2 minutes) followed by a tetanic contraction (200 Hz, 2 seconds). The fatigue protocol was then carried out (100Hz, 2 seconds, every 4 seconds for 1 minute). Muscles were then rested for 2 minutes (0.2 Hz, 2 seconds, for 2 minutes) prior post-fatigue tetanic evaluation (200 Hz, 2 seconds). Finally, results were retrieved from the force transducer software and represented as the average tetanic force before to and after fatigue.Tibialis anterior morphology and cross-sectional area[000133] Following euthanasia, the skeletal muscle was dissected, weighed, and sectioned transversely. Before being frozen in liquid nitrogen, the distal part was cryopreserved in liquid nitrogen-cooled isopentane for one minute. The samples were then placed in a freezer at -80 °C for further examination. Samples were sectioned using a cryostat (Leica, #CM3050, Germany) and stained with hematoxylin (Amresco, #0701, USA) and eosin (Amresco, #0109, USA) on 10 pm sections. Finally, pictures were acquired under a light microscope and the fiber cross-sectional area measured on ImageJ software (version 2.0; NIH).Western blot analysis of Protein expression[000134] Muscle samples were ground with a metallic pestle frozen in liquid nitrogen (Mortar). Homogenized with RIP A buffer (lOOmM KC1, lOmM HEPES, 3mM MgC12, 5mM EDTA, 10% glycerol, ImM DTT, 10% SDS) and proteinase and phosphatase inhibitor cocktail (Thermo Fisher Scientific cat# 78430). The samples were centrifuged and the supernatant collected. Protein electrophoresis was performed on SDS- PAGE acrylamide gel, later transferred by electrophoresis (Semi-Dry) to nitrocellulose membrane. The membrane was incubated with TBS-T blocking buffer (0.02M Tris-HCl, 0.16M NaCl and 0.1% Tween 20 and pH 7.4) with 5% skim milk and rabbit-Anti MuRFl primary antibody (Abeam - cat# ab 183094) or GAPDH (Cell Signaling cat#2118) 1:1000, overnight at 4°C. The next day the membrane was washed in TBS-T and incubated with blocking solution containing Peroxidase-conjugated goat anti-rabbit IgG secondary antibody (Jackson ImmunoResearch cat#l 11-032-003) 1:1000 for Ih. Then, the membrane was washed and the protein bands developed on an image detection system (Fusion Fx, Vilber Lourmat) using Luminata™ Forte Western HRP Substrate (Sigma Aldrich cat#WBLUF01500).RESULTSEffects of miR-29c overexpression upon cancer-cachexia model[000135] In the cancer-cachexia only (CC) and cachexia-plus-EV plasmid (CC+EV) groups, muscle mass and fiber cross-sectional area were both decreased by 30%, with smaller-diameter fibers predominating (Fig.lB-E respectively). The muscle mass, cross-sectional area, and fiber-size prevalence of cachectic mice withoverexpressed miR-29c (CC+pMIR29c) were comparable to those of control mice (Fig.lB-D respectively). Additionally, the skeletal muscle force was decreased by 40- 50% in the CC and CC+EV groups both at pre- and post-fatigue protocols (Fig. I F). In contrast, overexpression of miR-29c restored muscle function loss caused by cachexia back to normal levels (Fig. IF). Moreover, the molecular effects on the expression of MuRFl were also analyzed. In the cancer-cachexia only (CC) and cachexia-plus-EV plasmid (CC+EV) groups, as predicted in the literature, increase the protein expression of MuRFl (~2 fold). On the other hand, the overexpression of miR-29c prevented this elevation of MuRFl expression to levels similar to the control group. (Fig.2A and B).Effects of miR-29c overexpression upon immobilization model[000136] Immobilized-only animals (Imm) showed reduced muscle mass and cross- sectional area (~20-30%) compared to the non-immobilized control group (Figure 3B-D). Animals immobilized with plasmid IV (Imm+EV) showed reduction (~20%) only in the cross-sectional area (Figure 3C and D). In contrast, overexpression of miR-29c (Imm+pMIR29c) restored muscle mass and cross-sectional area loss caused by immobilization back to normal levels (Figure 3B-D).Effects ofmiR-29c overexpression upon dexamethasone treatment[000137] Dexamethasone treated-only animals (Dex) and Dexamethasone with EV (Dex+EV) showed reduced muscle mass and cross-sectional area (~15-20%) compared to the non-immobilized control group (Figure 4B-D). In contrast, overexpression of miR- 29c (Imm+pMIR29c) restored muscle mass and cross-sectional area loss caused by immobilization back to normal levels (Figure 4B-D).Effects ofmiR-29c overexpression upon fasting-induced atrophy[000138] Fasting-only animals (Fas) Fasting with EV (Fas+EV) and Fasting with pMIR29c (Fas+pMIR29c) showed reduced body weight (~20%) after 48h of fasting compared to fed control group (Figure 5B). Fas and Fas+EV group showed reduced cross- sectional area (~20-25%) compared to Control (Figure 5D and E). In contrast, overexpression of miR-29c (Fas+pMIR29c) restored muscle cross sectional area loss caused by fasting back to normal levels (Figure 4D and E).Effects ofmiR-29c overexpression upon aging-induced, atrophy[000139] Old-only animals (Old) Old with EV (Old+EV) showed reduced muscle mass and cross-sectional area (~30%) compared to the young control group (Figure 6B- D), on the other hand, the old group overexpressing miR-29c (Old+pMIR29c) has a lower reduction in muscle mass (~17%) (Figure 6B). Furthermore, the overexpression of miR- 29c (Old+pMIR29c) restored muscle cross sectional area loss caused by aging back to normal levels (Figure 6C and D).Example 2: In vitro activity of MT -29 sequences and effects of nucleotide modificationGuide Strand Screening (MT -29)Cell culture and transfection[000140] Muscle cells from the mouse lineage C2C12 were used as a model for skeletal muscle plasticity in order to screen several MT-29 oligonucleotides constructs as described in Table 1. Several combinations of chemical modification on the guide strand and their effects on molecular targets and myotube morphology were analyzed. Firstly, C2C12 myoblasts (ATCC #CRL1772) were seeded onto a 24-well plate (Coming #CLS3527) and cultured in growth medium (Dulbecco's Modified Eagle's Medium High Glucose, supplemented with 10 percent v / v of Fetal Bovine Serum and 1 percent v / v of ampicillin / streptomycin) at 37°C in an atmosphere of 5 percent of CO2 and 80 percent of humidity with medium changes every two days. At 90 percent confluence, the cells were washed with phosphate-buffered saline (PBS) and transfected for 8 hours using RNAiMax lipofectamine (Thermo Fisher cat#13778150), according to the manufacturer's procedure, as follows:[000141] a) Scrambled guide strand + universal passenger strands (50nM); b) 1002 guide strand + universal passenger strand (50nM); c) 1004 guide strand + universal passenger strand (50nM); d) 1006 guide strand + universal passenger strand (50nM); e) 1010 guide strand + universal passenger strand (50nM); f) 1012 guide strand + universal passenger strand (50nM); g) positive control - commercially available “mimetic sequence of miR-29c” (50nM; ThermoFisher mirVana miRNA sequence #MC11335). All sequences were described in detail in Table 2.[000142] After transfection, cells were washed with PBS and differentiation was promoted by deprivation using differentiation medium (Dulbecco's Modified Eagle's Medium High Glucose, supplemented with 2 percent v / v Horse Serum and 1 percent v / v ampicillin / streptomycin) for three days, with medium change every two days.Effects of the MT-29 guide strand on the morphology of myotubes muscle cells[000143] To ensure that only mature myotubes were analyzed, immunofluorescence for eMHC (embryonic MHC) was conducted. Consequently, following transfection, the cells were washed twice with ice-cold PBS and fixed for 10 minutes at room temperature with a 4 percent paraformaldehyde solution. After fixation, the cells were washed three times with PBS and permeabilized for 25 minutes at room temperature with 0.3 percent Triton lOOx in PBS (PBS-T). After permeabilization, the cells were treated for one hour at room temperature with a blocking solution (1 percent Bovine Serum Albumin in PBS- T). Cells were then incubated in the primary antibody solution (anti-MYH3, OriGene cat#TA349138 - 1:250 in blocking solution) for 16 hours in a humid chamber. After this, the cells were washed three times for five minutes with PBS-T and incubated for one hour at room temperature with a secondary antibody solution (Donkey anti-rabbit IgG, Jackson Imm. Research, cat#711-165-152 - 1:250 in blocking solution). Finally, the cells were rinsed with PBS-T and DAPI (Thermo Fisher cat#D3571) was applied. For morphological measurements, images were captured under a fluorescent microscope for eMHC localisation (Olympus, inverted fluorescence microscope 1X51, Japan) and the diameter of myotubes was determined by taking three transversal measurements along the cell. For fusion index assessment, six random photomicrographs (1 mm2) were selected and the proportion of nuclei inside eMHC-positive cells relative to the total number of nuclei was computed.RESULT[000144] Clearly, all sequences of guide strands promoted an increase in myotube diameter (hypertrophy), visibly seen in the immunofluorescence panel of eMHC-positive myotubes (Figure 7A). Moreover, compound designs 1002 and 1004 increase the myotube diameter about 40%, outperforming the commercially available miR-29c mimic (miR™, about 30% increase) in producing hypertrophy (Figure 7B). In addition, guidestrands enhanced myogenesis, as shown by the increased fusion index seen in all strands (about 40-60%), outperforming the commercially available miR™ once again (Figure 7C).Effects of the ASO guide strand on molecular markers[000145] Myotubes were solubilized in TRIzol reagent (Life Technologies, #15596026, USA), followed by isolation and precipitation of total RNA according to the manufacturer's instructions. After solubilizing whole RNA pellets in ultrapure water, the concentration and purity of nucleic acids were determined using a NanoDrop 1000 (Thermo-Fisher, #ND-1000, USA). SuperScript™ IV Reverse Transcriptase (Thermo- Fisher, #18090010) was used to synthesize complementary DNA from 0,5pg of total RNA in a reverse transcriptase process according to the manufacturer's instructions. Last but not least, coding gene expression (mRNA) was determined using equal quantities of complementary DNA (2pl) in a real-time PCR reaction including EvaGreen qPCR mix (Solis BioDyne, #08-36-0028, Estonia) and a specified set of primers (200nM). Following forty temperature cycles (15 seconds at 95°C, 30 seconds at 60°C, and 30 seconds at 72°C) in a QuantStudio™ 6 Flex Real-Time PCR System (ThermoFisher), the reaction was established. Fluorescence cycle threshold (Ct) was employed in accordance with the delta-delta CT technique to determine the relative expression of genes. GAPDH gene expression was used to normalize all Ct values. The primer set was created for Primer- Blast. Exon-exon junctions are spanned by forward or reverse sequences (GAPDH Forward 5' ACTCCACTCACGGCAAATTC 3' - GAPDH Reverse 5’ TCTCCATGGTGGTGAAGACA 3’ - MURF1 Forward 5’AGCAGCTCATCAAGAGCATTGT 3’ - MURF1 Reverse 5’CCAAAGTCAATGGCCCTCAA 3’).[000146] For microRNA evaluation, lOng of total RNA was used in the reverse transcription reaction using the TaqMan® MicroRNA Reverse Transcription Kit (Applied cat.4366596). The reaction followed the manufacturer's recommendations and contained 5X Loop Primers for RT-PCR specific for each miRNA. The Real-Time PCR reaction was performed using the manufacturer's recommendations (TaqMan® Universal Master MixII - Applied cat.4440040) with probes and primers specific for each miRNA analyzed. Fluorescence cycle threshold (Ct) was employed in accordance with the delta-delta CT technique to determine the relative expression of genes. U6 gene expression was used to normalize all Ct values.RESULT[0001471 Since MT-29 transfection resulted in morphological modifications, the molecular influence was examined. Initially, real-time PCR (qPCR) was used to confirm the transfection effectiveness and molecule stability overtime. Three days after MT-29 transfection, the produced patterns were still ubiquitous expressed in myotubes, with compound designs 1002, 1004, 1006, and 1008 demonstrating more stability than the commercially available miR-29c mimic "miR™" (Figure 8A). The decrease of its target gene MuRFl, validates the efficacy of MT-29 in regulating molecular pathways related to muscle atrophy. Additionally, the level of miR-29c was also measured and the results demonstrate that all compound designs increase miR-29c expression to levels above commercially available miR™, demonstrating the transfection efficiency of this compound (Figure 8B).Guide and Passenger strands screening[000148] In order to increase tissue permeability and target engagement in vivo, passenger strands with chemical modifications were created and synthesized once the characteristics of the guide strands were identified. In addition, a bioconjugation with palmitic acid was incorporated at 5' of passenger strand (Table 2).[000149] For clarity, the molecules resulting from the interaction between the preceding guide strands and the modified passenger strands are referred to as ASO compounds. Further in vitro tests were conducted to confirm that compound formulations retain the ability to induce myotube hypertrophy and inhibit MuRFl gene expression. A negative control ASO (“Scrambled”) comprises a non-targeting sequence with the same number of nucleotides in each strand and ligand conjugation of the ASOs of the invention without the chemical modifications.[000150] Table 2: Nucleotide sequences of the miR-29c ASOs analogs according to the invention.5’ P stands for monophosphate; m stands for 2’-O-methyl modified nucleotide; f is 2’-Fluoro stands for modified nucleotide; moe stands for 2 ’Methoxy ethyl modified nucleotide; 5 stands for phosphorothioate bond; 5’ PA3 stands for Palmitic Acid.Cell culture and transfection[0001511 Cell culture and transfection were carried out as reported for the screening of the ASO compounds. The twenty compounds of MT-29 are listed in Table 2.Effects of ASO compounds on the morphology of myotubes[000152] To ensure that only mature myotubes were analyzed, immunofluorescence for eMHC and measurements were conducted, as described in MT-29 screening.RESULTS[000153] The diameter of myotubes statistically increased by about 14-33% after transfection of the following compound designs: 2026, 2030, 2021, 2018, 2014, 2017, 2028, 2015, 2022, 2027 and 2029 in order of the largest increase to the smelliest, respectively. (Figure 9A and B). Intriguingly, the interaction between the modified passenger strands altered the efficiency of individual guide strands, conclusively demonstrating that compounds of the MT-29 had enhanced properties. The compounds designed 2026 and 2030 were the ones that most increased the myotubes diameter, and this increase was greater than the commercially available miR-29c mimic "miR™", demonstrating the potential to modulate muscle mass.Effects of ASO compounds on molecular markers[000154] The assessment of molecular markers by gene expression analyses was conducted as stated for the ASO screening.RESULTS[000155] The MuRFl gene expression was reduced by about 23-71% in all compound designs, with the exception of compounds 2031 and 2032 (Figure 10A and B). In agreement with the myotube diameter data, compounds 2026, 2030, and 2014 have the highest levels of inhibition of MuRFl, 71.83%, 58.87% and 57.38% respectively, and were more effective than the commercially available miR-29c mimic "miR™"(53.39%) (Figure 10B). In addition, the stability of these compounds is confirmed by the continued suppression of MuRFl, one, three and five days following transfection, with emphasis oncompound 2026, which obtained the best inhibition rates of MuRFl over 3 and 5 days (Figure 11A-C).[000156] Similarly, international patent application W02016 / 040373 studies a synthetic sequence based on miR-29 family, in particular miR-29b, however, they focused their studies on lung fibrosis. In addition, the patent US 10881743 studies a synthetic sequence based on miR-29 family for muscle diseases, however, they focus on a class of RNAs called siRNAS which has only one strand and the sequences here in studies are composed of two complementary strands (guide and passenger). And, additionally, the patent application BR1020180677020 described the effects of miR-29c on muscle cells, however, they focus their studies on the natural sequence of miR-29c which is different from the synthetic sequences proposed herein, with chemical modifications in every nucleotide.Effects of the ASO compound 2026 on Cytotoxicity[000157] Since the compound design 2026 showed the best results in increasing the diameter of myotubes and inhibiting the target gene MuRFl, in order to investigate its effect on cell viability, an MTT assay was performed to analyze the cytotoxicity of this molecule.[000158] C2C12 cells (4 x 10E3 per well) were grown in a 96-well plate. After the cells adhered within 24 hours, they were transfected with various concentrations of MT- 29 (0 - 500nM) using lipofectamine™ (RNAiMAX Transfection Reagent, Thermo Fisher, cat#13778030) according to the manufacturer's instructions. One group did not receive MT-29, serving as a positive control for cell viability in the experiment. As a control for the intrinsic toxicity level of lipofectamine™, part of the experiment was conducted without using the transfectant (no transfectant). After 24h, cells were treated with lOOpl of fresh growth medium containing 0.5mg / ml MTT (Invitrogen - cat#V13154), incubated at 37 °C for 4 h protected from light. Then, the medium was removed and lOOul of DMSO was added for formazan precipitation, followed by incubation at 37 °C for 10 min. The absorbance reading at 540 nm was performed on a Varioskan LUX plate reader (Thermo Fisher).RESULTS[000159] Transfection of increasing concentrations of MT-29 compound 2026 showed no cytotoxic effects at doses up to 100 nM. The doses of 200 nM and 500 nM showed reduced cell viability, but these doses are high for the standards of RNA transfection in cells along the literature and cytotoxic effects in this dose range are already expected. In addition, MT-29 was also transfected without a transfectant agent to rule out a possible intrinsic bias of the use of lipofectamine in the transfection, and no cytotoxic effects were detected across all doses used (Figure 12). These results demonstrate that the MT-29 has an excellent level of safety and applicability.Effects of the ASO MT-29 in vivo modelsExample 3: In vivo activity of ASO compounds with different fatty acids conjugations[000160] After determining the best formulation in the previous steps, the antisense oligonucleotide n. 2026 was further optimized using an addition of phosphorothioate bond in the guide strand between 19th and 20th position. To achieve high levels of ASO compounds optimization, not only the nucleotide sequence has to be screened, but also their ligands. Ligands and liters can modify pharmacokinetics parameters such as absorption, distribution, metabolites, and excretion by changing many factors including hydrophilic-lipophilic balance (HLB), half-life and affinity to plasmatic proteins (Prakesh et al. 2019 and Biscans et al. 2021).[000161] In order to determine the optimal formulation, three lipidic bioconjugations were tested using an in vitro assay to assess the molecular mechanism and in vivo limb immobilization model to assess the effectivity of the treatment. The performance of MT-29 bioconjugates was evaluated using three ligands, including: palmitic acid (16:0), docosanoic acid (22:1), and oleic acid (18:2) (Prakesh et al. 2019 and Biscans et al. 2021). All ligands were bioconjugated through an aminohexyl linker (C6-NH2) to MT-29 5’ terminus of the passenger strand.METHODSCell culture and transfection[000162] C2C12 myoblasts (ATCC #CRL1772) were seeded onto a 24-well plate (Coming #CLS3527) and cultured in growth medium (Dulbecco's Modified Eagle'sMedium High Glucose, supplemented with 10 percent v / v of Fetal Bovine Serum and 1 percent v / v of ampicillin / streptomycin) at 37°C in an atmosphere of 5 percent of CO2 and 80 percent of humidity with medium changes every two days. At 90 percent confluence, the cells were washed with phosphate-buffered saline (PBS) and transfected for 8 hours using RNAiMax lipofectamine (Thermo Fisher cat#13778150), according to the manufacturer's procedure, as follows: a) Scrambled (50nM); b) MT-29-AO (50nM); c) MT-29-DCA (50nM); d) MT-29-PA (50nM). They were harvested after 24 hours for the molecular analysis.[000163] Muscle fragments (20 mg) were solubilized in TRIzol reagent (Life Technologies, #15596026, USA) using a precellys homogenizer (Bertin Technologies), followed by total RNA isolation and precipitation as specified by the manufacturer. After solubilizing whole RNA pellets in ultrapure water, the concentration and purity of nucleic acids were determined using a NanoDrop 1000 (Thermo-Fisher, #ND-1000, USA). SuperScript™ IV Reverse Transcriptase (Thermo-Fisher, #18090010) were used to synthesize complementary DNA from 0.5pg of total RNA in a reverse transcriptase process according to the manufacturer's instructions. qPCR analysis for gene and microRNA expression[000164] Coding gene expression (mRNA) was determined using equal quantities of complementary DNA (2pl) in a real-time PCR reaction including EvaGreen qPCR mix (Solis BioDyne, #08-36-0028, Estonia) and a specified set of primers (200nM). Following forty temperature cycles (15 seconds at 95°C, 30 seconds at 60°C, and 30 seconds at 72°C) in a QuantStudio™ 6 Flex Real-Time PCR System (ThermoFisher), the reaction was established. Fluorescence cycle thresholds (Ct) were employed in accordance with the delta-delta Ct technique to determine the relative expression of genes. GAPDH gene expression was used to normalize all Ct values. The primer sets were created for Primer- Blast. Exon-exon junctions are spanned by forward or reverse sequences by forward or reverse sequences (GAPDH Forward 5' ACTCCACTCACGGCAAATTC 3' - GAPDH Reverse 5’ TCTCCATGGTGGTGAAGACA 3’ - MURF1 Forward 5’ AGCAGCTCATCAAGAGCATTGT 3’ - MURF1 Reverse 5’CCAAAGTCAATGGCCCTCAA 3’).[000165] For microRNA evaluation, Taqman® probes and fluorophore (TaqMan® Universal Master Mix II - Life Technologies #4440040) was utilized for MT-29 assessment. cDNA was be synthesized from ten nanograms of total RNA using a TaqMan reverse transcriptase kit specific for miR-29c (TaqMan® MicroRNA Reverse Transcription Kit - Life Technologies #4366596) in order to quantify MT-29 levels. The absolute values of fluorescence (Ct, from English threshold cycle) produced by polymerase chain reaction cycles were used to assess the levels of miR-29c using QuantStudio™ 6 Flex Real-Time PCR System (ThermoFisher). The relative levels of microRNA were determined by the comparative delta-delta Ct method and U6 expression was utilized as normalization. limb immobilization-induced muscle atrophy in mice[000166] In order to evaluate the treatment efficacy, the limb immobilization model was used. For that purpose, male C57bl / 6 mice (8 weeks old) were sedated with an intraperitoneal injection of a ketamine / xylazine cocktail (100 mg / kg and 10 mg / kg, respectively), then the left hind paw was properly cleaned, and using a metal splint and microporous tape, the paw was positioned at an angle of 90° (dorsiflexion) in order to keep the tibialis anterior muscle in a state of semi-contraction. A plaster mold was placed on the animal's paw, and after it dried, a metal grid was placed above it to protect the plaster from possible gnawing by the animal. Mice were divided into 5 groups, including: (i) naive, (ii) scrambled, (iii) MT-29 bioconjugated to palmitic acid (MT-29-PA), (iv) MT-29 bioconjugated to docosanoic acid (MT-29-DCA), and (v) MT-29 bioconjugated to oleic acid (MT-29-OA) (n = 5 mice per group). Each group received subcutaneous (SC) MT-29 injections on days 1 (24 h after immobilization) and on day 8. Mice received two injections of MT-29 at 25 mg / kg with a one- week interval between applications according to each mouse's group, and the termination was performed at day 14. Following euthanasia, the skeletal muscles were dissected, weighed, and sectioned transversely.Muscle fiber Cross Sectional Area analysis[000167] Then, to prepare samples for histological analysis the distal portion of the muscle was embedded in OCT compound and cryopreserved in liquid nitrogen-cooled isopentane for one minute and frozen in liquid nitrogen. The samples were then placed ina freezer at -80 °C for further examination. Samples were sectioned using a cryostat (Leica, #CM3050, Germany) and stained with hematoxylin (Amresco, #0701, USA) and eosin (Amresco, #0109, USA) on 10 pm sections. Then, tissues underwent hematoxylin and eosin staining. The photomicrographs were acquired under a light microscope (Carl Zeiss Microscopy, Axio Scope.Al, Germany). The cross-section area (CSA) of muscle fibers was measured on the image J software (version 2.0; NIH). Approximately 300 fibers were analyzed per animal.RESULTS[000168] In order to evaluate the efficacy in vitro, the following endpoints were observed: molecular mechanism of miR-29c expression and target gene MuRFl. In order to evaluate the efficacy of the treatment, the following endpoints were observed: muscle weight and cross-sectional area (CSA) of tibialis anterior. In order to evaluate the safety of the treatment, the following endpoints were observed: vital organ weight, anatomopathological analysis of vital organs (liver, kidney, spleen and lungs) and blood cells by hemogram. All assessments of skeletal muscle morphology, molecular analysis, and toxicology were carried out in accordance with what has been described so far.[000169] As expected, it was found a high and significant expression of miR-29c in myoblasts transfected with MT-29-PA (+125%) and MT-29-DCA (+96%), except for the MT-29-OA group (Figure 13 A). Additionally, the MT-29-PA and MT-29-OA groups exhibited a great reduction of 51% and 21%, respectively, in the target gene MuRFl (Figure 13 B). These results demonstrate the effectiveness of the bioconjugates in modulating the intrinsic molecular mechanisms of MT-29 treatment within a short time frame of in vitro experiments (24 hours) and support further investigation in animal studies.[000170] In the in vivo studies, all experimental groups were atrophied by immobilization with the exception of the naive group (not immobilized). The treatment of two-doses of MT-29-PA resulted in an increase of 7% in tibialis anterior weight (p = 0.0453, in comparison with Scrambled), an increase of 6.6 % in gastrocnemius muscle weight mean (non-significative difference, p = 0.3424, in comparison with Scrambled), an increase of 17% in soleus muscle weight (p=0.035, in comparison with Scrambled), and a 5% increase in diaphragm muscle weight (non-significative difference, p=0.4142,in comparison with Scrambled). The treatment with two-doses of MT-29-OA resulted in an increase of 14% in soleus muscle weight (p=0.0078, in comparison with Scrambled). The treatments with MT-29-DCA and MT-29-OA in other tissues did not significantly change the muscle weight. All statistical analysis were performed using a t-test analysis with a p<0.05 (Table 3 and Figure 14). The CSA analysis showed an increase of the fiber area of 37% for MT-29-PA and 26% for MT-29-OA in soleus muscle which corroborated with the muscle weight data shown in Figure 14.[000171] There was non-significant difference between liver, kidney, lung, heart and carcass weight in groups treated with MT-29-PA, MT-29-DCA and MT-29-OA, in comparison with scrambled (Table 4).[000172] The hemogram analyzed white blood cells (WBC), lymphocytes, monocytes, granulocytes, red blood cells (RBC), hematocrit, and platelets, and the biochemistry analysis of the blood included alanine aminotransferase (ALT) and aspartate aminotransferase (AST) enzymes quantification, creatinine, and urea to assess liver and hepatics functions (Table 5). ALT and AST enzymes showed non-significance difference between the groups treated with MT-29 with all bioconjugation in comparison with saline, indicating no liver toxicity. The liver toxicity is corroborated by the no weight changes (Table 4) and the anatomical analysis, indicating no pathological events (Figure 15). All statistical analyses were performed using a one-way ANOVA analysis with a p<0.05 (Table 4 and 5).[000173] Similarly, urea and creatinine showed no significant difference between groups treated with MT-29-PA and MT-29-DCA in comparison with saline. The group MT-29-OA significantly increased creatinine in comparison with saline (p=0.0064). The anatomopathological studies didn’t show any lesion in the kidneys for all treated groups (Figure 15). The other hemogram parameters including platelets also didn’t show significant difference between groups treated and controls.[000174] With all that, palmitic acid conjugation showed greater efficacy in vitro experiments and in increasing muscle weight and CSA with the best safety profile in vivo. Henceforth, the sequence number 2026 conjugated with palmitic acid is going to be called MT-29.[000175] Table 3: Mean and standard deviation of tibialis anterior, gastrocnemius, soleus and diaphragm muscle weight after two doses of MT-29 at 25 mg / kg with each conjugate palmitic acid (MT-29-PA), docosanoic acid (MT-29-DCA), and oleic acid (MT-29-OA) using in vivo immobilization model (SC, 1 dose per week). The asterisk indicates a statistical difference with the scrambled group (one-way ANOVA, p < 0.05).[000176] Table 4: Mean and standard deviation of kidney, liver, lung and total fat, heart and carcass weight after two doses of MT-29 at 25 mg / kg with each conjugate palmitic acid (MT-29-PA), docosanoic acid (MT-29-DCA), and oleic acid (MT-29-OA) using in vivo immobilization model (SC, 1 dose per week). The asterisk indicates a statistical difference with the scrambled group (one-way ANOVA, p < 0.05).[000177] Table 5: Mean and standard deviation of ALT, AST, urea, creatinine and platelets after two doses of MT-29 at 25 mg / kg with each conjugate palmitic acid (MT-29-PA), docosanoic acid (MT-29-DCA), and oleic acid (MT-29-OA) using in vivo immobilization model (SC, 1 dose per week). The asterisk indicates a statistical difference with the scrambled group (one-way ANOVA, p < 0.05).Example 4: In vivo evaluation of MT -29 therapy efficacy method in health mice[000178] As can be seen in Example 3, the results indicated that MT-29 bioconjugated with palmitic acid, called simply MT-29, yields better outcomes in improving muscle mass and fiber CSA in an immobilization-induced atrophy model. Thus, to evaluate the efficacy of MT-29 and mechanism of action, a multiple dose toxicity and pharmacology experiment was performed using healthy mice.METHODSEffects of MT-29 Treatment in health mice[000179] Eight-week-old (25g) male Balb / c mice were housed in controlled rooms (24°C; 12-hour light / dark cycle), in conventional plastic cages lined with sawdust, and free access to food and water. They received three subcutaneously applications of MT-29 at 25 mg / kg with 1 week between the applications with 7 days of observation time, in a total of 4 weeks experiment (n=6 mice per group), as shown in Figure 16 A.In vivo evaluation of muscle function[000180] To assess muscular force in vivo, the grip strength meter test method was performed in two protocols for the purpose of measuring grip strength of only the forelimb or all four paws. The mice were raised by their tails until their front paws, or four paws were at the same level as the equipment bar (Bonther, Ribeirao Preto, Brazil). Then, it was visually determined whether the grasp is adequate. The mice were then softly repelled at a consistent rate until their grip was broken, and the force transducer recorded the applied force values. The test was administered three times (with a one-minute interval in between) and the best performance was maintained each time. The findings were finally reported as a multiple of body mass divided by grip strength. qPCR analysis for gene and microRNA expression[000181] As described in the previous example.Western blot analysis of Protein expression[000182] Additionally, to evaluate protein levels, fragments from the skeletal muscle (~20mg) were solubilized in radioimmunoprecipitation assay buffer (RIP A) (1mM EDTA, pH 7.4, 0.0625% sodium deoxycholate, 0.0625% nonidet P-40, 6.2 mM sodium phosphate), including phosphatase inhibitor cocktail (1:100; Thermo-Scientific, #78447, USA), using a precellys homogenizer (Bertin Technologies), then homogenates were to be centrifuged (10 minutes at 1000 x g at 4°C), and insoluble material discarded. The homogenate concentrations were measured by Pierce™ BCA Protein Assay Kit (Thermo Scientific, #23225, USA), following the manufacturer's recommendations, to ensure protein loading equally. Initially, an equal mass of total homogenate was loaded into SDS-PAGE (TGX Stain-Free FastCast Acrylamide Kit, 12% - Bio-Rad, #161-0185, USA) gels following electrophoresis and transfer to a PVDF membrane (Thermo- Scientific, #88518, USA) to verify the specific proteins' relative levels. Then, membranes were incubated in blocking solution (tris-buffered saline with 5% Non-fat milk, 0.5 M NaCl, 50 mM tris-HCl pH 7.4 with 0.1% Tween-20 - TBST) for 1 hour at room temperature proceeding to overnight incubation in primary antibody solution mouse-anti MuRFl (Santa Cruz, #sc-398608) 1:1000 or rabbit-anti GAPDH (Cell Signaling, #2118) 1:5000 at 4 °C. Then, after 15-minutes of washing in TBST, the secondary antibody solution (peroxidase-conjugated goat anti-mouse or anti-rabbit IgG, Jackson ImmunoResearch, 1:1000) was incubated for 1 hour at room temperature. Finally, membranes were incubated for 1 minute in a detection solution SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Scientific, #34577, USA) and images obtained by ChemiDoc MP Imaging System (Bio-Rad, USA) followed by blot band densitometry.RESULTS[000183] In order to evaluate the efficacy of the treatment, the following endpoints were observed: muscle weight, cross sectional area (CSA), functional muscle strength and mechanism of action, accessed through the analysis of MuRFl gene expression. In order to evaluate the safety of the treatment, the following endpoints were observed: vital organ weight, anatomopathological analysis of vital organs (liver, kidney, spleen and lungs) and hemogram, renal function, kidney function, food intake and body weight. All assessments of skeletal muscle morphology, molecular analysis, and toxicology were carried out in accordance with what has been described so far.[000184] The treatment showed ad increased the muscle weight of 5% for gastrocnemius (p=0.043), of 7% for tibialis anterior (p=0.049) (Figure 16 B), of 17% for soleus (p=0.009) (Figure 16 C) and there was no significant difference for diaphragm tissue. All statistical analyses were performed using a t-test analysis with a p<0.05 (Table 6). Similarly, CSA of soleus muscle showed a 12% increase (p= 0.0267) with a clear increase in muscle fibers (Figure 16 D). In the mice treated with MT-29, the final muscle function showed a significant improvement of 12% and a 230% in comparison with basal strength of the animal (Figure 16 E), using forelimb protocol. Similarly, using four paws protocol, mice treated with MT-29 showed an increase of 19% in the final strength and 150% increase in delta grip strength (Figure 15 F).[000185] Regarding safety endpoints, there was non-significant difference between the weight of vital organs analyzed (Table 7) and, similarly, no alterations in anatomopathological analysis. The food intake and body weight also did not change after animals received MT-29 treatment for the duration of the experiment. The hemogram, hepatic enzymes and kidney function results showed no significant differences between control and treated groups (Table 8).[000186] To further analyze the efficacy of the treatment the mechanism of action of MT-29 was investigated. For that, MT-29 (50 mg / kg) or a placebo (scrambled) was delivered intravenously (IV, tail vein) or MT-29 (25 mg / kg) or a placebo (scrambled) was delivered subcutaneously (SC) to the animals (SC, access under the skin over dorsal region). A Western blot analysis shows that the MuRFl protein decreased in 76% in gastrocnemius muscle and 86% in tibialis anterior, in comparison with scrambled, after 4 days of MT-29 application in endovenous application (Figure 17 A - D). Similarly, the MuRFl expression is still downregulated after 7 days of treatment with decreased gene expression of 21% in tibialis anterior with a correlated decrease of protein translation of 15% (Figure 17 E-G). Based on the results, the efficacy of MT-29 in increasing muscle weight and fibers diameter is relevant and consistent in different models. The mechanism of action involves the inhibition of MuRFl gene expression, and, consequently, its translation into MuRFl protein. The safety profile didn’t describe any concerns so far in the study. Both routes of administration are accessible and have a similar profile.[000187] Table 6: Mean and standard deviation of tibialis anterior, gastrocnemius, soleus and diaphragm of muscle weight after three doses of MT-29 at 25 mg / kg in health mice (SC, 1 dose per week).The asterisk indicates a statistical difference with the scrambled group (t- test, p < 0.05).[000188] Table 7: Mean and standard deviation of kidney, liver, lung, total fat, heart and spleen weight after three doses of MT-29 at 25 mg / kg in health mice (SC, 1 dose per week).The asterisk indicates a statistical difference with the scrambled group (t-test, p < 0.05).[000189] Table 8: Mean and standard deviation of ALT, AST and platelets after three doses of MT-29 at 25 mg / kg (SC, 1 dose per week). The asterisk indicates a statistical difference with the scrambled group (t-test, p < 0.05).Example 5: In vivo evaluation of a more effective dose to treat sarcopenia[000190] In order to evaluate the efficacy of MT-29 in sarcopenic mice, multiple dose toxicity in aged mice were performed. C57B1 / 6 mice 24 months old submitted to two applications of MT-29 at 25 mg / kg or placebo (Scrambled) (1 dose per week). A Naive group of young animals without any treatment was included as a control for the sarcopenia model (Figure 19 A). They were housed in controlled rooms (24°C; 12-hour light / dark cycle), in conventional plastic cages lined with sawdust with free access to food and water. The mice were euthanized after 1 week of the last dose and all assessments of skeletal muscle morphology, molecular analysis, and toxicology were carried out in accordance with what has been described so far.RESULTS[000191] First, evident degrees of muscle mass and CSA can be noted in the scrambled group compared to naive one, which is an indicative of the sarcopenia atrophy in aged compared to young mice (Figure 18). The treatment with MT-29 at 25 mg / kg (1 dose per week) showed an increased the muscle weight of 15% for tibialis anterior (p=0.048), of 27% for soleus (p=0.018), of 18% for trapezius mean (p=1.73, no significative difference), of 13% for gastrocnemius mean (p=0.102, no-significative difference), and there was no significant difference for diaphragm tissue (Figure 18 B and C, Table 9). All statistical analysis were performed using a t-test analysis with a p<0.05 in comparison with Scrambled as control (Table 9). Similarly, CSA of soleus muscle showed an 15% increase, in comparison with Scrambled (Figure 18 D - E). Regarding the safety profile, vital organs weight showed no significant difference between group treatment and control (Table 10).[000192] The atrophic genes expression showed a decrease of 41% and 53% for MuRFl and Atrogin-1, respectively. These results demonstrated the effect of MT-29 in at least two genes related to sarcopenia atrophy (Figure 19 A and B). In addition to that, the MuRFl protein showed a great decrease of 32% for gastrocnemius muscle and 40% for tibialis anterior muscle (Figure 19 C-F). These results indicate the inhibitory effect of MT-29, both at the transcriptional and post-transcriptional levels of MuRFl, elucidating the mechanism of action of MT-29 for muscle mass improvement in sarcopenia.[000193] Table 9: Mean and standard deviation of tibialis anterior, gastrocnemius, soleus, diaphragm and trapezius muscle weight after two doses of MT-29 at 20 mg / kg in sarcopenic mice (SC, 1 dose per week). The asterisk indicates a statistical difference with the scrambled group (t-test, p < 0.05).[000194] Table 10: Mean and standard deviation of kidney, liver, lung, total fat, heart and spleen weight after two doses of MT-29 at20 mg / kg in sarcopenic mice (SC, 1 dose per week). The asterisk indicates a statistical difference with the scrambled group (t-test, p < 0.05).Example 6: Dose-response experiment in mice with cachexia[000195] Cachexia is noted in many chronic inflammatory conditions, including autoimmune disorders, chronic lung diseases, acquired immunodeficiency syndrome (AIDS), congestive heart failure (CHF), and cancer. To induce the cachectic condition in Balb-c mice, CT26 cells (CT26 colorectal cancer) were implanted. This is one of the most often used and efficient methods for evaluating cachexia and severe skeletal muscle atrophy. To implement this technique, CT26 cells were first cultivated on 150mm culture plates using a growth medium (RPMI 1640 + 10% FBS) at 37°C and 5% CO2. After two consecutive passages, the cells were harvested at 90% confluence, centrifuged, and resuspended in RPMI 1640 medium. Immediately after resuspension, the mice were anesthetized with isoflurane (2 percent) and a solution containing 10E6 CT26 cells will be injected into the dorsal region. One day before CT26 injection and one day before euthanasia, the grip strength of skeletal muscle was assessed. After tumor development (nine days after CT26 injection), the animals were injected with MT-29 using four distinct dosages (12.5 mg / kg, 25 mg / kg, 50 mg / kg, and 100 mg / kg). 20 days after the CT26 injection, the mice were euthanized to collect tissues for further examination (Figure 20 A). Finally, assessments of skeletal muscle function, morphology, molecular analysis, and toxicology were carried out in accordance with what has been described so far.RESULTS[000196] First, evident degrees of muscle mass, CSA and function can be noted in the cachectic group treated with scrambled compared to naive group, this is an indicative of the cancer-induced-cachexia atrophy (Figure 20). The treatment with a single administration of MT-29 with different concentrations (12.5, 25, 50 and 100 mg / kg) increased the muscle weight compared to the scrambled group. Considering the dose of 50 mg / kg, there was an increase of 15% in tibialis anterior mean mass (p=0.108, ns), of 17% in gastrocnemius mean mass (p=0,0247), of 2,8% in soleus mean mass (p=0.7211, ns) and of 12% in diaphragm mean mass (p>0,999) (Table 11). Figure 20 B shows the increase in gastrocnemius muscle weight of 17% for 50 mg / kg and 22% for 100 mg / kg. Similarly, the fiber diameters showed an increase of 29% and 41% for 50 mg / kg and 100 mg / kg, respectively (Figure 20 C-D). The analysis of muscle function from the forelimb showed an increase of 23% and 26 % for 50 mg / kg and 100 mg / kg, respectively in thefinal grip strength (Figure 20 E). Similarly, the four-limb measurements demonstrated 18% and 23% force increase for the 50 mg / kg and 100 mg / kg respectively. This protection in force can be better observed when comparing the basal and after treatment force of the animals (Figure 20 F). [000197] Regarding the safety profile, vital organs weight showed no significant difference between group treated and control (Table 12 and 13). All statistical analyses were performed using ANOVA one way analysis with a p<0.05 in comparison with Scrambled as control (Table 11).[000198] In addition, the molecular analysis of the tissues showed a decrease of MuRFl expression of 220% at 50 mg / kg (Figure 21A) and a linear decrease of protein translation with the increase of dosage (Figure 2 IB). This is an indication of the inhibitory effect of MT-29, both at the transcriptional and post-transcriptional levels of MuRFl, elucidating the mechanism of action of MT-29 for muscle mass improvement in cancer induced cachexia.[000199] Table 11: Mean and standard deviation of tibialis anterior, gastrocnemius, soleus, diaphragm and trapezius muscle weight after a single dose of MT-29 at 12.5, 25, 50 or 100 mg / kg in cachexic mice (IV administration). The asterisk indicates a statistical difference with the scrambled group (one-way ANOVA, p < 0.05).[000200] Table 12: Mean and standard deviation of kidney, liver, lung, total fat, heart and spleen weight after a single dose of MT-29 at 12.5, 25, 50 or 100 mg / kg in cachexic mice (IV administration). The asterisk indicates a statistical difference with the scrambled group (One-way ANOVA, p < 0.05).[000201] Table 13: Mean and standard deviation of ALT, AST, white blood cells, red blood cells and platelets after a single dose of MT-29 at 12.5, 25, 50 or 100 mg / kg in cachexic mice (IV administration). The asterisk indicates a statistical difference with the scrambled group (One-way ANOVA, p < 0.05).REFERENCESAdams, V., GuBen, V., Zozulya, S., Cruz, A., Moriscot, A., Linke, A., & Labeit, S. (2020). Small-Molecule Chemical Knockdown of MuRFl in Melanoma Bearing Mice Attenuates Tumor Cachexia Associated Myopathy. Cells, 9(10), 2272.5ittps: / / doi.org / 10.3390 / cells9102272Baehr, L. M., Furlow, J. D., & Bodine, S. C. (2011). Muscle sparing in muscle RING finger 1 null mice: response to synthetic glucocorticoids. The Journal of Physiology, 559(19), 4759- 4776. https: / / doi.Org / 10.l 113 / jphysiol.2011.212845Baker, Y. R., Thorpe, C., Chen, J., Poller, L. M., Cox, L., Kumar, P., Lim, W. F., Lie, L., ltMcClorey, G., Epple, S., Singleton, D., McDonough, M. A., Hardwick, J. S., Christensen, K.E„ Wood, M. J. A., Hall, J. P., El-Sagheer, A. H., & Brown, T. (2022). An LNA-amide modification that enhances the cell uptake and activity of phosphorothioate exon-skipping oligonucleotides. Nature Communications, 75(1). https: / / doi.org / 10.1038 / s41467-022-31636- 2 lJBiscans, A., Coles, A., Haraszti, R., Echeverria, Di., Hassler, M., Osborn, M., & Khvorova,A. (2019). Diverse lipid conjugates for functional extra-hepatic siRNA delivery in vivo. Nucleic Acids Research, 47(3), 1082-1096. https: / / doi.org / 10.1093 / nar / gky 1239Biscans, A., Caiazzo, J., McHugh, N., Hariharan, V., Muhuri, M., & Khvorova, A. (2021). Docosanoic acid conjugation to siRNA enables functional and safe delivery to skeletal and 2Gbardiac muscles. Molecular Therapy, 29(4), 1382-1394. 10.1016 / j.ymthe.2020.12.023Cerro-Herreros, E., Gonzalez-Martinez, I., Moreno, N., Espinosa-Espinosa, J., Fernandez- Costa, J. M., Colom-Rodrigo, A., Overby, S. J., Seoane-Miraz, D., Poyatos-Garcia, J., Vilchez, J. J., Lopez de Munain, A., Varela, M. A., Wood, M. J., Perez-Alonso, M., Llamusí,B., & Artero, R. (2021). Preclinical characterization of antagomiR-218 as a potential treatment 25'or myotonic dystrophy. Molecular Therapy - Nucleic Acids, 26, 174-191. https: / / doi.Org / 10.1016 / j.omtn.2021.07.017Halloy, F., Hill, A. C., & Hall, J. (2021). Efficient Synthesis of 2’-O-Methoxyethyl Oligonucleotide-Cationic Peptide Conjugates. ChemMedChem, 16(22), 3391-3395. https: / / doi.org / 10.1002 / cmdc.202100388Kuijper, E. C., Bergsma, A. J., Pijnappel, W. W. M. P., & Aartsma-Rus, A. (2021). Opportunities and challenges for antisense oligonucleotide therapies. Journal of Inherited Metabolic Disease, 44(1), 72-87. https: / / doi.org / 10.1002 / jimd.12251Lam, J. K. W., Chow, M. Y. T., Zhang, Y., & Leung, S. W. S. (2015). siRNA Versus miRNA las Therapeutics for Gene Silencing. Molecular Therapy - Nucleic Acids, 4, e252. https: / / doi.org / 10.1038 / mtna.2015.23Levin, A. A. (2017). Targeting Therapeutic Oligonucleotides. New England Journal of Medicine, 376(1), 86-88. https: / / doi.org / 10.1056 / NEJMcibrl613559Levin, A. A. (2019). Treating Disease at the RNA Level with Oligonucleotides. New England ^Journal of Medicine, 380(1), 57-70. https: / / doi.org / 10.1056 / NEJMral705346Li, J., Chan, M. C., Yu, Y., Bei, Y., Chen, P., Zhou, Q., Cheng, L., Chen, L., Ziegler, O., Rowe, G. C., Das, S., & Xiao, J. (2017). miR-29b contributes to multiple types of muscle atrophy. Nature Communications, <8(1), 15201. https: / / doi.org / 10.1038 / ncommsl5201Ostergaard, M. E., Jackson, M., Low, A., E Chappell, A., G Lee, R., Peralta, R. Q., Yu, J., lKinberger, G. A., Dan, A., Carty, R., Tanowitz, M., Anderson, P., Kim, T. W., Fradkin, L., Mullick, A. E., Murray, S., Rigo, F., Prakash, T. P., Bennett, C. F., ... Seth, P. P. (2019). Conjugation of hydrophobic moieties enhances potency of antisense oligonucleotides in the muscle of rodents and non-human primates. Nucleic Acids Research, 47(12), 6045-6058. https: / / doi.org / 10.1093 / nar / gkz3602(Sasso, J. M., Ambrose, B. J. B., Tenchov, R., Datta, R. S., Basel, M. T., Delong, R. K., & Zhou, Q. A. (2022). The Progress and Promise of RNA Medicine-An Arsenal of Targeted Treatments. In Journal of Medicinal Chemistry (Vol. 65, Issue 10, pp. 6975-7015). American Chemical Society, https: / / doi.org / 10.1021 / acs.jmedchem.2c00024Silva, W. J., Graga, F. A., Cruz, A., Silvestre, J. G., Labeit, S., Miyabara, E. H., Yan, C. Y. I., 29Vang, D. Z., & Moriscot, A. S. (2019). miR-29c improves skeletal muscle mass and function throughout myocyte proliferation and differentiation and by repressing atrophy-related genes. Acta Physiologica, 226(4). https: / / doi.0rg lO.l 11,1 / apha.13278Prakash, T. P., Mullick, A. E., Lee, R. G., Yu, J., Yeh, S. T., Low, A., CHappell, A. E., Ostergaard, M. E., Murray, S., Swayze, E. E., & Seth, P. P. (2019) Fatty acid conjugation enhances potency of antisense oligonucleotides in muscle. Nucleic acids research, 47(12). https: / / doi.org / 10.1093 / nar / gkz354JWang, B., Wang, J., He, W., Zhao, Y., Zhang, A., Liu, Y., Hassounah, F., Ma, F., Klein, J. D., Wang, X. H., & Wang, H. (2020). Exogenous miR-29a Attenuates Muscle Atrophy and Kidney Fibrosis in Unilateral Ureteral Obstruction Mice. Human Gene Therapy, 31(5-6), 367-375. https: / / doi.org / 10.1089 / hum.2019.287Xie, W., He, M., Yu, D., Wu, Y., Wang, X., Lv, S., Xiao, W., & Li, Y. (2021). Mouse models lGbf sarcopenia: classification and evaluation. Journal of Cachexia, Sarcopenia and Muscle,12(3), 538-554. https: / / doi.org / 10.1002 / jcsm.12709Zamecnik, P. C., & Stephenson, M. L. (1978). Inhibition of Rous sarcoma virus replication and cell transformation by a specific oligodeoxynucleotide. Proceedings of the National Academy of Sciences, 75(1), 280-284. https: / / doi.org / 10.1073 / pnas.75.L280

Claims

CLAIMS1. A double-stranded antisense oligonucleotide comprising a guide strand and a passenger strand consisting of chemically-modified ribonucleotides, wherein the guide strand has about 22 ribonucleotides comprising a mature miR-29c sequence, and the passenger strand has about 19 ribonucleotides comprising a sequence that is substantially complementary to the first strand, and wherein the guide strand has a 3' nucleotide overhang relative to the passenger strand.

2. The double-stranded antisense oligonucleotide of claim 1, wherein the 5’ end of the guide strand has a monophosphate.

3. The double- stranded antisense oligonucleotide of claim 1 or 2, wherein the chemically- modified ribonucleotides are selected from 2'-O-methyl, 2’ -fluoro, 2’-O-methoxyethyl, inverted base, methylphosphonate, 2’ aminopurine and 5’Bromo modified nucleotides.

4. The double- stranded antisense oligonucleotide of any of claims 1-3, wherein the nucleotides in positions 1, 2, 7, 9, 11, 13, 15, 17, and 19 of the guide strand and in positions 1, 19, and 20 of the passenger strand are 2'-O-methyl modified nucleotides.

5. The double- stranded antisense oligonucleotide of any of claims 1-4, wherein the nucleotides in positions 2, 4, 6, 8, 10, 14, 16, and 18 of the guide strand are 2’-fluoro modified nucleotides.

6. The double- stranded antisense oligonucleotide of any of claims 1-5, wherein the nucleotides in positions 21 and 22 of the guide strand are either 2'-O-methyl or 2’-O- methoxy ethyl modified nucleotides.

7. The double- stranded antisense oligonucleotide of any of claims 1-6, wherein the nucleotides in positions 5, 12, and 20 of the guide strand and in positions 3-18 of the passenger strand may be either 2'-O-methyl or 2 ’-fluoro modified nucleotides.

8. The double-stranded antisense oligonucleotide of any of claims 1-7, wherein one or more nucleotides in positions 1, 2, 10, 12, 14, 16, 18, 20, and 21 of the guide strand and in positions 1, 2, 18, and 19 of the passenger strand further have a 5’ phosphorothioate.

9. The double-stranded antisense oligonucleotide of any of claims 1-8, wherein 10 or 11 mismatches occur between the nucleotide sequences of the guide strand and the passenger strand, optionally wherein the mismatches occur at positions 2, 5-7, 9, 12, 14-16, 18 and / or 19.

10. A double-stranded antisense oligonucleotide comprising a guide strand that has a nucleotide sequence as set forth in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7, and a passenger strand that has a nucleotide sequence as set forth in SEQ ID NO: 12.

11. A double-stranded antisense oligonucleotide comprising a guide strand that has a nucleotide sequence as set forth in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7, and a passenger strand that has a nucleotide sequence as set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12.

12. An antisense oligonucleotide conjugate comprising a double stranded antisense oligonucleotide of any of claims 1-11 conjugated to a lipid or a polymer moiety at the 5’ end of the passenger strand, optionally via a linker.

13. The antisense oligonucleotide conjugate of claim 12, wherein the conjugated lipid moiety is a C8-C22 fatty acid chain, optionally selected from the group comprising palmitic acid, docosanoic acid, and oleic acid.

14. Pharmaceutical composition comprising the double- stranded antisense oligonucleotide of any of claims 1-11, or the antisense oligonucleotide conjugate of claim 12 or 13, and at least one pharmaceutically acceptable excipient or carrier.

15. Method of treating or preventing muscle atrophy comprising administering an effective amount of the double-stranded antisense oligonucleotide of any of claims 1-11, the antisense oligonucleotide conjugate of claim 12 or 13, or the pharmaceutical composition of claim 14 to a subject suffering from a disease or condition that promotes or derives from skeletal muscle mass loss.