Use of dupd1 inhibitors in the treatment of inflammatory bowel disease and metabolic disorders
Patent Information
- Application Number
- EP2023904975
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-02-14
- Filing Date
- 2023-12-22
- Publication Date
- 2025-10-29
AI Technical Summary
Current therapies are inadequate for effectively treating and preventing inflammatory bowel disease (IBD), colitis-associated colon cancer, obesity, and related metabolic disorders, as the underlying mechanisms remain poorly understood, leading to a need for new therapeutic approaches.
Inhibiting DUPD1 activity or reducing its expression using specific or non-specific inhibitors to treat or prevent IBD, colitis-associated colon cancer, obesity, and metabolic disorders, with the goal of regulating glucose levels.
Inhibiting DUPD1 activity is shown to protect mice from DSS-induced colitis, Helicobacter hepaticus-induced colitis, and HFD-induced obesity and metabolic diseases, demonstrating potential therapeutic benefits for these conditions.
Smart Images

Figure IMGF000043_0001 
Figure IMGF000060_0001 
Figure 00000084_0000
Abstract
Description
METHODS AND COMPOSITIONS FOR DUPD1 INHIBITIONCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority to United States Application No. 63 / 476,971, filed December 23, 2022, and United States Application No. 63 / 445,416, filed February 14, 2023, the contents of which are both incorporated herein by reference in their entirety.FIELD OF THE INVENTION
[0002] The present application pertains generally to methods and compositions for treatment of conditions affected by DUPD1 activity. More particularly, the present application relates to methods and compositions for inhibition of the phosphatase DUPD1 in the treatment of conditions including inflammatory bowel disease (i.e., Crohn's disease, and ulcerative colitis), colitis-associated colon cancer, and metabolic disorders, including obesity, type-2 diabetes (T2D), non-alcoholic fatty liver disease (NAFLD), cancer, and for glucose regulation.INTRODUCTION
[0003] Inflammatory bowel disease (IBD) is characterized by chronic and recurrent mucosal inflammation of the digestive tract and is associated with periods of abdominal pain, rectal bleeding, diarrhea, and loss of body weight [6], The development of IBD also increases the risk of colon cancer [7, 8], which represents one of the leading causes of cancer related mortalities worldwide including 10-15% of deaths in patients with IBD [9, 10], The prevalence of IBD, comprising of Crohn's Disease (CD) and ulcerative colitis (UC), is on the rise globally [1-4], The cause of IBD is unknown but is thought to involve an interplay between host genetics, microbial and / or environmental factors. While genetic risk alone is not sufficient to cause disease, extensive work has identified numerous genetic risk loci that are associated with IBD, although most of these associations remain poorly understood.
[0004] Obesity and related metabolic abnormalities have become a global health concern and are responsible for a significant proportion of morbidity and mortality [39,40], Theincidence of obesity has tripled since 1975 according to the World Health Organization (WHO)
[0041] , with approximate 40% of adults in the U.S.A are classified as obese
[0042] , Approximately 1.6 million deaths were caused by diabetes in 2016, and the worldwide prevalence of the disease has increased from 4.7% in 1980s to 8.5% in 2014 in adults over 18 years of age
[0041] , A high fat western style diet (HFD) rich in fat and processed meats have been identified as one of the major contributing factors in obesity-associated metabolic diseases. However, despite recent advances, precise mechanistic insights into how a HFD interacts with other etiologic factors, such as genetic risk factors to induce disorders related to obesity (i.e., T2D, NAFLD, cancer) is not well understood.
[0005] A need remains for effective therapies and preventative treatments for inflammatory bowel disease (e.g., colitis), colitis-associated colon cancer, obesity, and obesity-associated metabolic disorders. The causative mechanisms for these conditions remain poorly understood and, consequently, research into methods for treatment and / or prevention of these conditions is ongoing.
[0006] The above information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the present invention. No admission is necessarily intended, nor should be construed, that any of the preceding information constitutes prior art against the present invention.SUMMARY OF THE INVENTION
[0007] An object of the present application is to provide methods and compositions for DUPD1 inhibition, which can be used for treatment or prevention of conditions including IBD, colitis-associated colon cancer, obesity and associated metabolic disorders, and for glucose regulation. In accordance with an aspect of the present application, there is provided a method of treating or preventing inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis), colitis-associated colon cancer, metabolic disorders (e.g., obesity or an obesity-associated metabolic disorder) or DUPD-l-mediated inflammatory disorders, or for glucose regulation in a subject, comprising inhibiting or reducing DUPD1 activity in the subject. Inhibition or reduction of DUPD1 activity can be prevention, retardation, reduction or otherwise hindrance of DUPD1 expression and / or activity. In someembodiments, the method comprises administering one or more DUPD1 inhibitor to the subject. Such an inhibitor can be a specific DUPD1 inhibitor or non-specific phosphatase inhibitor (such as, a dual specificity phosphate inhibitor).
[0008] In accordance with another aspect, there is provided a pharmaceutical composition comprising an inhibitor of DUPD1 and a pharmaceutically acceptable diluent, excipient, carrier, or combination thereof. In one embodiment, the DUPD1 inhibitor or pharmaceutical composition comprising the DUPD1 inhibitor is for use in treatment and / or prevention of inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis), colitis-associated colon cancer, or a metabolic disorder (e.g., obesity or an obesity-associated metabolic disorder) in a subject.
[0009] In accordance with another aspect, there is provided a method for identifying a compound capable of a therapeutic treatment, wherein the therapeutic treatment is: (i) treating and\or preventing inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis) and / or colitis-associated colon cancer, (ii) treating and\or preventing metabolic syndromes, and / or (iii) regulating glucose in a subject, which method comprises: (a) providing a test compound; and (b) comparing under comparable reaction conditions the activity of the polypeptide, which polypeptide is DUPD1 or a variant or active portion thereof, in the presence and absence of the test compound, wherein the compound is capable of the therapeutic treatment if the comparison in step (b) shows that the activity of the polypeptide is reduced in the presence of the test compound in comparison to its absence.BRIEF DESCRIPTION OF FIGURES
[0010] For a better understanding of the application as described herein, as well as other aspects and further features thereof, reference is made to the following description which is to be used in conjunction with the accompanying drawings, where:
[0011] Figure 1: Generation of Dupdl' ' mice and response of Dupdl' / ' mice to DSS induced colitis, related to Figure 2: a. Dupdl- / - mice were generated using CRISPR / Cas9 mutagenesis. A founder was identified that had edited the Dupdl gene leading to a 64- nucleotide deletion downstream of the ATG start codon in exon 2. b. Founder mutation ofthe edited Dupdl gene leading to a 64-nucleotide deletion downstream of the ATG start codon in exon 2 in Dupdl ''' mice c. Treatment paradigm to assess DSS induced colitis in Dupdl ''' mice. d. Caecum weight of Dupdl+ / +and Dupdl ''' mice measured on day 8 post-DSS treatment, e. Small intestine length was measured on day 8 post-DSS treatment in Dupdl+ / +and Dupdl' / ' mice. f. Body weight of Dupdl+ / +a nd Dupdl' ' mice was measured daily post DSS treatment. Shown here is the percent change in body weight from day 0. g. Additional histology images (upper panel) and Masson's Trichrome staining (lower panel) in the colon of Dupdl+ / +and Dupdl' / ' mice post-DSS treatment. Blue colour indicates the deposition of collagen in the colon tissue of Dupdl+ / +mice and Dupdl' / ' mice. Scale bar: 50 pm.
[0012] Figure 2: Dupdl deficiency protects mice from DSS induced colitis and colitis associated colon cancer. Age-matched Dupdl' / ' and littermate control mice were given 2% DSS in their drinking water and colons were harvested on day 8. a. Shown here are representative colons from Dupdl+ / +and Dupdl' / ' mice on day 8. b. Colon length and c. Clinical scores were evaluated using a scoring system described in the methods on day 8 post-DSS treatment, d. Frozen colon sections from Dupdl+ / +and Dupdl' / ' mice were assessed by histology (H and E). Scale bar: 200 pm. See additional images in Figure lg (upper panel), e. Length of colonic crypts were measured from histological assessment of Dupdl+ / +and Dupdl' / ' mice. Graph shows the difference in the length of crypts between Dupdl+ / +and Dupdl' / ' mice treated with DSS. f. q-PCR analysis was performed to assess the expression of inflammatory cytokines in the colon post-DSS treatment. HPRT was used as a control. Fold change in the expression of genes are shown compared to untreated Dupdl+ / +mice. g. Immunohistochemistry was performed on the frozen colon sections from Dupdl+ / +and Dupdl' / ' mice treated with DSS. Shown here are representative images of CD45 positive cells (red) and nuclei were stained with DAPI (blue). Scale bar: 50 pm. Right panel shows quantification of CD45+ cells in the colon of wild type and Dupdl' / ' mice. h. Dupdl+ / +and Dupdl' / ' littermates were injected with AOM (10 mg / kg ) followed by 1% DSS for 9 weeks. Shown are the percent change in the body weights of Du pdl+ / +and Dupdl' / ' mice treated with AOM and DSS. i. Representative colons are shown from 3 mice / group from 6-7 mice / group. j. Colon length and k. caecum weight was measured after 9 weeks in Dupdl+ / +and Dupdl' / ' mice treated with AOM and DSS. I. Numbers of colonic polyps were counted in Dupdl+ / +and Dupdl' / ' mice treated with AOM and DSS. Each dot represents a mouse in allgraphs. 6-8 mice / group were used for DSS induced colitis experiments and 6-7 mice / group were used for the AOM and DSS induced CAC. Values shown are the mean ± SEM. P values were calculated using either with a one-way ANOVA with Sidak's multiple comparison's test, two-way ANOVA with Sidak's multiple comparison's test, or an unpaired student's two tailed Mann-Whitney t-test (for comparing two groups). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
[0013] Figure 3: Reduced inflammation and proliferation in the colon of DSS-treated Dupdl~ ~ mice, related to Figure 2. a. Immunohistochemistry was performed to assess Ly6G+ (clone: 1A8) positive neutrophils in the colon of Dupdl+ / +and Dupdl ''' mice treated with DSS. Representative images are shown. Scale bar: 50 pm. Graph (right panel) shows the average number of Ly6G+ neutrophils / FOV in the colon, b. Immunohistochemistry was performed to assess F4 / 80 macrophages in the colon of Du pdl+ / +and Dupdl ''' mice treated with DSS. Representative images are shown. Scale bar: 50 pm. Graph (right panel) shows the average number of F4 / 80 macrophages / FOV in the colon, c. Representative immunofluorescence images are shown with F4 / 80 macrophages (green) and iNOS (red) positive cells. Double positive cells are shown in yellow and are indicated with a white arrow. Scale bar: 50 pm. Right panel shows quantification of double positive cells, d. Representative images of Ki67 immunohistochemistry on frozen colon sections from Dupdl+ / +and Dupdl ''' mice. Shown here are the average number of Ki67 positive cells (red) within the colonic crypts and nuclei were stained with DAPI (blue). Scale bar: 50 pm. Right panel shows quantification of Ki67 positive cells in the colonic crypts of Dupdl+ / +and Dupdl' mice. Each dot represents a mouse in all graphs. Values shown are the mean ± SEM. P values were calculated using an unpaired student's two tailed Mann-Whitney t-test. *p<0.05, **p<0.01, ns= not significant.
[0014] Figure 4: Dupdl deficiency reduces CAC and colonic inflammation, related to Figure 2. a. Size of individual polyps in the colon of Dupdl+ / +and Dupdl ''' mice treated with AOM and DSS were measured, catagorized and shown in the graph, b. Representative histology (H and E) images from paraffin embeded colonic tissues from Dupdl+ / +and Dupdl ''' mice treated with AOM and DSS. Scale bar: 200 pm. c. q-PCR analysis was performed to assess the expression of inflammatory cytokines in the colon post-AOM-DSS treatment. HPRT was used as a control. Fold change in the expression of genes are shown. Each dot represents amouse in all graphs. Values shown are the mean ± SEM. P values were calculated using an unpaired student's two tailed Mann-Whitney t-test. *p<0.05, **p<0.01, ns= not significant.
[0015] Figure 5: Assessment of Helicobacter hepaticus colonization, clinical outcomes, and immune cell infiltration in the colon, related to Figure 6: a. Treatment paradigm to assess Helicobacter induced colitis in Dupdl' / ' mice. b. PCR was performed to assess the colonization of Helicobacter hepaticus in the colon of control and Dupdl' / ' mice postinfection from the faeces of mice. c. Images showing stool consistency and the presence of blood in the feces of control and Dupdl' / ' mice upon Helicobacter hepaticus infection, d, e. Representative images of colons from Helicobacter hepaticus treated mice stained with F4 / 80 is shown. Scale bar: 50 pm. Graph shows the F4 / 80 area in the colon of wild type and Dupdl ' / ' mice. f. Small intestine length was measured on day 21 post-infection in Dupdl+ / +and Dupdl' / ' mice. g. Body weight shown post H. hepaticus infection. Each dot represents a mouse in all graphs. Values shown are the mean ± SEM. P values were calculated using an unpaired student's two tailed Mann-Whitney t-test. ns= not significant.
[0016] Figure 6: Dupdl deficiency protects from H. hepaticus-induced colitis in IL-10' / ' mice. Age-matched IL- 10' / ' mice either Dupdl+ / ' and Dupdl' / ' were infected with 2xl08cfu / mice of H. hepaticus in 0.2 mL of PBS. a. Representative colons from H. hepaticus treated mice 3 weeks post-infection, b. Colon length and c. caecum weight was measured from H. hepaticus treated mice 3 weeks post-infection, d. Clinical scores were recorded from Dupdl+ / +and Dupdl' / ' mice based on the scoring system described in methods section every 3 days until 3 weeks post-infection, e. H and E-stained colon sections from Helicobacter hepaticus treated IL-10' / 'Dupdl+ / ' and IL- 10' / ' Dupdl' / ' mice. f-g. Paraffin embeded colon sections were immunostained with Ly6G+ (clone: 1A8) neutrophils. Shown here is the Ly6G+ area in the colon of Dupdl+ / +and Dupdl' / ' mice. Each dot represents a mouse in indicated graphs. Values shown are the mean ± SEM. P values were calculated using either with a two-way ANOVA with Sidak's multiple comparison's test, or an unpaired student's two tailed Mann-Whitney t-test (for comparing two groups). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
[0017] Figure 7: Dupdl' / ' mice are not protected from anti-CD3 induced acute enteropathy in the small intestine. Age-matched Dupdl' / ' and Dupdl+ / +mice were injected with anti-CD3by intraperitoneal injection and small intestine length (a) and caecum weight (b) were measured, c. Myeloperoxidase activity was performed in the ileam of small intestine 24 hours after anti-CD3 injection, d. Paraffin embedded small intestinal sections were assessed by histology (H & E). e. Body weight was recorded at the beginning and 24 hours after the injection of anti-CD3. f. Quantitation of Ki67+ cells in the small intestines of Dupdl ^ and Dupdl+ / +mice treated with anti-CD3. g. RNA was extracted from small intestine. q-PCR analysis was performed for the indicated cytokines, and the results were reported relative to isotype antibody treated Dupdl+ / +mice. Each dot represents a mouse in all graphs. P values were calculated using either with a one-way ANOVA with Sidak's multiple comparison's test (for comparing more than two groups), or an unpaired student's two tailed Mann-Whitney t-test (for comparing two groups). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. ns= not significant.
[0018] Figure 8: Generation of DUPD1 specific monoclonal antibodies, related to Figure 9: a. DUPD1 polyclonal antisera isolated from DUPD1 immunized mice was used to assess expression of mouse DUPD1 protein by Western blot analysis, b. HEK293T cells were transiently transfected with mouse DUPD1 plasmid for 48 hours and Western blot analysis was performed to assess DUPD1 expression using polyclonal antisera from DUPD1 immunized mice. Ponceau S staining was performed to assess equivalent loading (right) c. HEK293T cells were either mock transfected or transiently transfected with mouse DUPD1 plasmid for 48 hours and immunocytochemistry was performed to assess DUPD1 expression using DUPD1 antisera and two independent monoclonal antibody clones against DUPD1 (6b9 and la3). Representative images are shown, d-e. HEK293T cells were either mock transfected or transiently transfected with mouse DUPD1 plasmid for 48 hours and flow cytometry was performed to assess DUPD1 expression using DUPD1 antisera and clone 6b9 DUPD1 monoclonal antibody. Shown here is the histogram and the frequency of parent (%) in DUPD1 transfected cells compared to mock transfected cells. Each dot represents an independent experiment. One-way ANOVA with Sidak's multiple comparison's test. ****p<0.0001.
[0019] Figure 9: DUPD1 is expressed in the colon and regulates autophagy, a.Immunohistochemistry was performed on frozen human colon cancer patient samples.Shown here is DUPD1 expression (brown) Scale bar: 10 pm. b. Representativeimmunohistochemistry image showing the presence of DUPD1 (brown) in normal mouse colon. Scale bar: 10 pm. c. C2C12 mouse myotubes express DUPD1. C2C12 myoblasts were differentiated using 2% FBS for five days and DUPD1 expression (Red) was assessed. Nuclei were stained with DAPL Scale bar: 50 pm. d. Wild type or Dupdl' / ' C2C12 myotubes were treated with Torin 1 for 6 hours and Western blot analysis was performed to assess the expression of p-70-S6K, LC3 and p62. Tubulin was used as loading control. Results from one experiment is shown from at least four independent experiments, e. Wild type or Dupdl' / ' C2C12 myotubes were treated with Rapamycin (luM) and Western blot analysis was performed to assess p-70-S6K, LC3 and p62 expression. Tubulin was used as loading control. Results from one experiment is shown from at least four independent experiments, f. Wild type or Dupdl' / ' C2C12 myotubes either unstarved, amino acid starved or treated with Bafilomycin Al (lOOnM) and Western blot analysis was performed to asess LC3 and p62 expression. Tubulin was used as loading control. Shown here are both low and high exposure blots. N=4. g. Immunocytochemistry was performed in control or Dupdl' / ' C2C12 myotubes under starved or unstarved conditions to assess the expression of LC3 (green) and DUPD1 (red). Nuclei were stained with DAPI (blue). Scale bar: 50 pm. h-i.Immunohistochemistry on frozen colon sections from DSS treated either control or Dupdl' / ' mice was performed to assess LC3 (brown) expression. Shown here is the average number of LC3 A / B positive puncta per cell within the colonic mucosae. Scale bar: 10 pm. Each dot represents a mouse in indicated graphs. Values shown are the mean ± SEM. P values were calculated using an unpaired student's two tailed Mann-Whitney t-test. *p<0.05.
[0020] Figure 10: DUPD1 and LC3 expression in normal colon and generation of a DUPD1 deficient C2C12 cell line by CRISPR / cas9, related to Figure 9. a. Frozen human colon sections were immunostained with DUPD1 monoclonal antibody (clone: 6b9) to assess DUPD1 expression. One representative image is shown. Scale bar: 10 pm. b. Paraffin embedded mouse skeletal muscle and colon (normal) sections from indicated genotypes were immunostained with either 6b9 clone conjugated with biotin or with Sigma DUPD1 antibody to assess DUPD1 expression. Scale bar: 50 pm. c. Frozen human colon sections were immunostained with Sigma DUPD1 antibody to assess DUPD1 expression. One representative image is shown. Scale bar: 10 pm. N=3. d. Generation of a DUPD1 deficient C2C12 cell line. A 16 base pair deletion in CRISPR edited Dupdl gene in clone 67 (C2C12cells) by sanger sequencing. Benchling was used to perform the sequence alignment, e. CRISPR / Cas9 mediated editing resulted in a bi-a llelic single cell population in C2C12 clone 67. f. Representative immunofluorescence microscopy images of differentiated C2C12 cells showing DUPD1 expression in wild type C2C12 cells and no expression in CRISPR edited clone 67. Scale bar: 10 pm. g. Control or Dupdl ^ C2C12 myotubes were either unstarved or amino acid starved, and Western blot analysis was performed to assess LC3 and p62 expression. Tubulin was used as loading control. N=3. h. Additional images of LC3 A / B immunostaining in the colon of DSS treated mice. N=4. i. Representative images of LC3 A / B immunostaining in normal mouse colon (frozen). Scale bar: 50 pm.
[0021] Figure 11: NSC-663284 reduces DSS-induced colitis, a. Recombinant murine and human DUPD1 protein was purified from IPTG-induced BL21(DE3) E. coli, followed by SDS- PAGE electrophoresis and Coomassie blue staining, b. Catalytic activity of mouse (m) and human (h) DUPD1 was assessed with DiFMUP as a substrate in 50 mM NaCI (pH6). NSC- 663284 was added at the indicated concentrations, and fluorescence was measured after 10 minutes. IC50 for inhibition of mDUPDl and hDUPDl by NSC-663284 are shown in red. c. NSC-663284 reduces inflammation in DSS-treated mice. 5 weeks old control (Dupdl+ / +and Dupdl+ / ~) and Dupdl ^ mice were given DSS for 5 days followed by NSC-663284 (7mg / kg) for indicated days in drinking water containing 5% dextrose. Colon length in Dupdl+ / +, Dupdl+ / ~, and Dupdl+ / +mice treated with NSC-663284 after DSS exposure is shown, d. Colon length and e. caecum weight of the indicated genotypes were measured after NSC-663284 treatment, f. Percent change in body weight in Dupd / ~ mice is shown compared to control mice. g. Clinical scores in NSC-663284 treated wildtype mice after DSS exposure are shown after 10 days. h. Frozen colon sections of indicated genotypes were assessed by histology (H and E). Scale bar: 200 pm. i. Colon sections from control and Dupdl / ' mice were immunostained with Ly6G+ (clone: 1A8) neutrophils. Shown here is the number of Ly6G positive cells in the colon of Dupdl+ / +and Dupdl ^ mice. Each dot represents a mouse in indicated graphs. Values shown are the mean ± SEM. P values were calculated using either with a one-way ANOVA with Sidak's multiple comparison's test, two-way ANOVA with Sidak's multiple comparison's test, or an unpaired student's two tailed Mann-Whitney t-test (for comparing two groups). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
[0022] Figure 12: Assessment of phosphatase inhibitors on DUPD1 enzyme activity, small intestine length and qPCR analysis of inflammatory cytokines in the colon of NSC-663284 treated Dupdl / mice, related to Figure 11. a. Recombinant murine DUPD1 protein was purified from IPTG-induced BL21(DE3) E. coli, and catalytic activity of DUPD1 was assessed with DiFMUP as a substrate in the presence of indicated phosphatase inhibitors. 50 nM purified DUPD1 protein was used. Fluorescence was measured every 35 seconds for 30 minutes, b. Control (wildtype) and Dupdl~ / ~ mice were treated with DSS followed by NSC- 663284 in drinking water and small intestine length was measured, c. qPCR analysis was performed on mouse colon tissues to assess expression of inflammatory cytokines. HGPRT was used as a control. Each dot represents a mouse in all graphs. P values were calculated using either with a two-way ANOVA with Sidak's multiple comparison's test (for comparing more than two groups), or an unpaired student's two tailed Mann-Whitney t-test (for comparing two groups). ns= not significant.
[0023] Figure 13: DUPD1 promotes high fat western diet induced obesity. A. 4-6 week-old Dupdll+ / +and Dupdl~ / ~ female mice were fed a high fat western diet (HFD) (40% fat and 43% carbohydrate) for 15 weeks. Body weights were recorded once a week for 15 weeks. A photographic representation of Du pdl+ / +and Dupdl~ / ~ female mice 15 weeks after HFD. B. Graph shows body weights of HFD-fed Dupdl~ / ~ and Dupdl+ / +female mice. Values shown are the mean ± SEM. P values were calculated using an unpaired student's t-test (two-tailed). N=10 Dupdl+ / +mice and 9 Dupdl~ / ~ mice. C. Histological assessment of white adipose tissue from Dupdl+ / +and Dupdl~ / ~ female mice fed a HFD. A representative image is shown. Scale bar: 20 pm. D. Same as B, except mice were fed a normal chow diet (NCD) for 15 weeks. N=4 Dupdl+ / +mice and 3 Dupdl~ / ~ mice. E. A photographic representation of Du pdl+ / +and Dupdl~ / ~ male mice 15 weeks after HFD. F. 4-6 week-old Dupdl+ / +and Dupdl~ / ~ male mice were fed a HFD for 15 weeks. Body weights were recorded once a week for 15 weeks N= 11 Dupdl+ / +mice and 12 Dupdl~ / ~ mice.
[0024] Figure 14: DUPD1 promotes obesity induced type 2 diabetes in female and male mice. A. 4-6 week-old Dupdl+ / +and Dupdl~ / ~ female mice were fed a HFD for 10 weeks and a glucose tolerance test was performed. Graph shows the difference in glucose tolerance levels between Dupdl~ / ~ mice and Dupdl+ / +female mice. B. Graph shows the area under the curve (AUG) that demonstrates a significant improvement in glycemic control in Dupdl~ / ~female mice, a characteristic observed in mice with better glucose homeostasis and reduced T2D. C. Graph shows fasting glucose levels. Values shown are the mean ± SEM. P values were calculated using an unpaired student's t-test (two-tailed). N=ll Dupdl+ / +mice and 14 Dupdl' / mice. D. Same as A, except that 4-6 week-old Dupdl+ / +and Dupdl' / male mice were fed a HFD for 10 weeks. E. Same as B, except that Dupdl+ / +and Dupdl' / ' male were used. F. Same as C, except that Dupdl+ / +and Dupdl' / ' male mice were used. N=7 Dupdl+ / +mice and 6 Dupdl' / ' mice. G. Insulin tolerance test (ITT) was performed in Dupdl+ / +and Dupdl' / ' female mice 12 weeks after a HFD. Graph shows insulin tolerance levels between Dupdl' / ' female mice compared to Dupdl+ / +m ice. H. Graph shows the AUG of panel G. P values were calculated using an unpaired student's t-test (two-tailed). N=ll Du pdl+ / +mice and 14 Dupdl- / - mice. I. Same as G, except that Dupdl+ / +and Dupdl' / ' male mice were used. J. Same as H, except that Dupdl+ / +and Dupdl' / ' male mice were used. Values shown are the mean ± SEM. P values were calculated using an unpaired student's t-test (two-tailed). N= 7 Dupdl+ / +mice and 7 Dupdl' / ' mice.
[0025] Figure 15: Absence of DUPD1 does not induce significant changes in glucose tolerance in Dupdl' / ' female mice fed a NCD. GTT in Dupdl+ / +and Dupdl' / ' female mice fed a NCD. N=4 Dupdl+ / +mice and 3 Dupdl' / ' mice.
[0026] Figure 16: Absence of DUPD1 protects mice from high fat western diet induced non-alcoholic fatty liver disease (NAFLD). A. 4-6 week-old Dupdl+ / +and Dupdl' / ' female mice were fed a HFD for 18 weeks and a pyruvate tolerance test (PTT) was performed. B. Same as A, except that male mice were used. C. Representative images of the liver 4-6 week-old Dupdl+ / +and Dupdl' / ' female mice that were fed a HFD for 15 weeks. 4-6 week-old Dupdl+ / +and Dupdl' / ' female mice that were fed a HFD for 15 weeks and graphs showing liver weight (D) and spleen weight (E). F and G are the same as D and E, respectively, except that male mice were analyzed. H. Representative images of the histological assessment by hematoxylin and eosin in the liver of female Dupdl+ / +and Dupdl' / mice fed a NCD (upper panel) and HFD (lower panel). Scale bar: 100 pm. N=4. I. Same as H, except that male mice were examined. J. Representative images of Oil Red O (red) in the frozen liver tissue section of female Dupdl+ / +and Dupdl' / mice are shown. Scale bar: 100 pm. N=4. K. Same as J, except that male mice were analyzed.
[0027] Figure 17: Reduced inflammation in the liver of Dupdl' / ' male and female mice fed a HFD. A. 4-6 week-old Dupdl+ / +and Dupdl' / male and female mice were fed a HFD for 15 weeks and sacrificed. Frozen liver sections were immunostained with anti-CD8 to detect the presence of CD8+ T cells in the liver. Representative images are shown (two left panels) where CD8 T cells are in red and DAPI was used to stain the nucleus. CD8 T cells were counted in three different field of views and are presented as the mean here. Each dot represents the mean of a mouse from three field of views. Scale bar: 100 pm. N=3. B. Same as A, except that tissues were stained for CD45 expression. C. Same as A, except that tissues were stained for CD8 expression. D. Relative mRNA expression for TNF-a and IL-6 are shown in the liver of Dupdl+ / +and Dupdl' / ' female mice fed a HFD. N=4.
[0028] Figure 18: Absence of DUPD1 does not induce significant changes in metabolic parameters in male Dupdl / mice fed a HFD. 4-6 week-old Dupdl+ / +and Dupdl' / ' male mice were fed a HFD for 7 weeks and basic differences in energy metabolism in Dupdl+ / +and Dupdl' / male mice were investigated using Comprehensive Lab Animal Monitoring System (CLAMS). A. Food and water intake are reported for Dupdl+ / +and Dupdl' / male mice. B. Body temperature (heat), oxygen consumption (VO2), and respiratory exchange ratio (RER) are reported for Dupdl+ / +and Dupdl' / ' male mice. C. Physical activity in Dupdl+ / +and Dupdl' male mice was assessed. Briefly, mice were separately housed in a ComprehensiveLaboratory Animal Monitoring System (Columbus Instruments) with free access to food and water. Results were collected after 24 hours acclimatization to the apparatus. Beam break X ambulant measures the physical activity associated with ambulation, Beam break Z total detects rearing or jumping, while beam break X total measures the total activity of mice towards a particular direction. Values shown are the mean ± SEM. P values were calculated using an unpaired student's t-test (two-tailed). Dupdl+ / += 4 mice and Dupdl' / = 3 mice.
[0029] Figure 19: Absence of DUPD1 does not induce significant changes in metabolic parameters in Dupdl' / ' female mice fed a HFD. Same as Figure 18, except that Dupdl+ / +and Dupdl' / ' female mice were analyzed. Dupdl+ / += 2 mice and Dupdl' / = 5 mice.
[0030] Figure 20: Involvement of Dupdl in obesity and metabolic diseases, related toFigure 21. a. A schematic for the generation of Dupdl' / ' mice using CRISPR / Cas9 mutagenesis. See methods, b. 4-6-week-old Dupdl+ / +and Dupdl' / ' male mice were fed aHFD for 15 weeks. Body weights were recorded once a week for 15 weeks. Photographic representation of Du pdl+ / +and Dupdl ''' male mice 15 weeks after HFD. c. Graph shows body weights of HFD-fed Dupdl ' and Dupdl+ / +male mice. N=ll-12 mice / group. d. T2W Magnetic Resonance Imaging (MRI) images showing the distribution of fat in HFD-fed Dupdl7' and Dupdl+ / +male mice. e. Graph shows body weights of control (ob / ob'7~ Dupdl+7+and ob / ob'7' Dupdl+7') and ob / ob'7' Dupdl'7' female mice. N= 4 mice / group. f. AUG of body weight from e. P values were calculated using an unpaired student's t-test (two-tailed) is d and g. Body weights from Dupdl7' and Dupdl+ / +female mice fed a normal chow diet (NCD). N=9=10 mice / group. h-j. Graph shows GTT, AUG and fasting glucose levels in NCD fed Dupdl7' and Dupdl+ / +female mice. N=3-4 mice / group. k-l. 4-6-week-old Dupdl+ / +and Dupdl7' female mice were fed a HFD for 12 weeks and insulin tolerance test (ITT) was performed. Graph shows insulin tolerance levels in Dupdl+ / +and Dupdl7' female mice and AUC (j-k) and in male mice (m-n). N=ll-14 mice / group for female mice and 7 mice / group for male mice. o-p. Pyruvate tolerance test (PTT) was performed in HFD-fed female and male Dupdl+ / +and Dupdl7' mice 18 weeks post HFD. Graph shows pyruvate tolerance levels and AUC in female (o-p) and male (q-r) Dupdl+ / +and Dupdl7' mice. N=8-9 mice / group for female mice and 5-12 mice / group for male mice. P values were calculated using an unpaired student's t-test (two-tailed), s. Hematoxylin and Eosin (H and E) stained liver images from Dupdl7' and Dupdl+ / +ma\e mice are shown in the upper panel. Lower panels show oil red o stained liver images from indicated genotypes. Each dot represents a mouse. **p<0.01, ns=not significant.
[0031] Figure 21: Dupdl promotes high fat western diet (HFD) induced obesity, T2D and NAFLD. 4-6-week-old Dupdl+ / +and Dupdl'7' female mice were fed a high fat western diet (HFD: 40% fat and 43% carbohydrate) for 15 weeks, a. A photographic representation of Dupdl+ / +and Dupdl ''' female mice 15 weeks after HFD. b. Graph shows body weights of HFD-fed Dupdl+ / +and Dupdl ''' and female mice. c. T2W Magnetic Resonance Imaging (MRI) images showing the distribution of fat in female Dupdl+ / +and Dupdl ''' mice fed HFD after 15 weeks, d. Dupdl+ / +and Dupdl female mice were fed a HFD for 10 weeks and a glucose tolerance test was performed. Graph shows the difference in glucose tolerance levels between Dupdl ''' mice and Dupdl+7+female mice. e. Graph shows the area under the curve (AUC) that demonstrates a significant improvement in glycemic control in Dupdl femalemice. f. Graph shows fasting glucose levels, g. Same as d, except that Dupdl+ / +and Dupdl ^ male mice were used. h. Same as e, except that Dupdl+ / +and Dupdl ^ male mice were used, i. Same as f, except that Dupdl+ / +and Dupdl ^ male mice were used. j. Representative images of livers from Dupdl+ / +and Dupdl ^ female mice fed a HFD for 15 weeks, k. Graphs shows liver weight in Dupdl+ / +and Dupdl ^ female mice. I. Representative hematoxylin and eosin images of the liver of female Dupdl+ / +and Dupdl ^ mice fed a HFD. Scale bar: 200 pm. m. Representative images of Oil Red O (red) in the frozen liver tissue sections of female Dupdl+ / +and Dupdl ^ mice are shown. Scale bar: 100 pm. Right panel shows quantification of Oil red O area in female mice using image J. Values shown are the mean ± SEM. P values were calculated either using a two-way ANOVA, an unpaired student's two tailed Mann- Whitney t-test, or an unpaired student's t-test (two-tailed). N=ll-14 female mice and N=6-7 male mice.
[0032] Figure 22: Increased physical activity of Dupdl ' mice, related to Figure 21. a.Metabolic caging using CLAMS was performed in Dupdl+ / +and Dupdl ^ female and male mice fed a HFD. Shown here are the physical activity (X,Y and Z) and food intake in Dupdl+ / +and Dupdl ^ mice. Light and dark cycles were analyzed separately, b. Dupdl+ / +and Dupdl ^ male and female mice were sacrificed and different skeletal muscle compartments were dissected. Shown here are the weights of EDL, TA, gastrocnemius, soleus, and quadriceps. N=4 male mice / group and N=2-3 female mice / group. P values were calculated using either an unpaired student's two tailed t-test or an unpaired student's two tailed Mann-Whitney t- test. *p<0.05.
[0033] Figure 23: Reduced inflammation and proliferation in the colon of Dupdl^ mice in response to DSS, related to Figure 24: a. Treatment paradigm to assess DSS-induced colitis in Dupdl ^ mice. b. Caecum weight of Dupdl+ / +and Dupdl ^ mice recorded on day 8 post- DSS treatment, c. Percent body weight change of Dupdl+ / +and Dupdl ^ mice post DSS treatment are reported, d. Additional hematoxylin and eosin (H and E) images from DSS treated Dupdl+ / +and Dupdl ^ mice. Upper panel shows 40X images of colons using a swiss roll method while lower panel shows different higher magnification images. Scale bar: 500 pm (upper panel) and 50 pm (lower panels), e. Representative images of Masson's Trichrome staining in the colon of Du pdl+ / +and Dupdl ^ mice post-DSS treatment. Blue colour indicates the deposition of collagen in the colon of Dupdl+ / +mice and Dupdl ^ mice.Inset shows a magnified field of view. Scale bar: 50 urn. f. Immunohistochemistry was performed to assess Ly6G+ (clone: 1A8) positive neutrophils in the colon of Dupdl+ / +and Dupdl' / ' mice treated with DSS. Representative images are shown. Graph (right panel) shows the average number of Ly6G+ neutrophils / FOV in the colon, g. Immunohistochemistry was performed to assess F4 / 80 macrophages in the colon of Dupdl+ / +and Dupdl' / ' mice treated with DSS. Representative images are shown. Graph (right panel) shows the average number of F4 / 80 macrophages / FOV in the colon, h. Representative immunofluorescence images are shown with F4 / 80 macrophages (green) and iNOS (red) positive cells. Double positive cells are shown in yellow and are indicated with a white arrow. Right panel shows quantification of double positive cells, i. Representative immunofluorescence images of Ki67 staining on frozen colon sections from Dupdl+ / +and Dupdl' / ' mice. Shown here are the average number of Ki67 positive cells (red) within the colonic crypts. Nuclei were stained with DAPI (blue). Right panel shows quantification of Ki67 positive cells in the colonic crypts of Dupdl+ / +and Dupdl' / ' mice. Each dot represents a mouse in all graphs. Scale bar: 50 pm. Values shown are the mean ± SEM. P values were calculated using either with a one-way ANOVA with Sidak's multiple comparison's test, a two-way ANOVA with Sidak's multiple comparison's test or using an unpaired student's two tailed Mann-Whitney t-test. *p<0.05, **p<0.01, ***p<0.001, ns= not significant.
[0034] Figure 24: Dt / pdl-deficiency protects mice from DSS and Helicobacter hepaticus- induced colitis. Age-matched Dupdl' / ' and littermate control mice were given 2% DSS in their drinking water and colons were harvested on day 8. a. Shown are representative colons from Dupdl+ / +and Dupdl' / ' mice on day 8, and b. Compiled data of colon lengths, c. Clinical scores were evaluated using a scoring system described in method section on day 8 post-DSS treatment, d. Frozen colon sections (using Swiss roll method) from Dupdl+ / +and Dupdl' / ' mice were assessed by histology (H and E). Scale bar: 500 pm. See additional images in Fig. 20e. e. Graph shows the length of colonic crypts that were measured and quantified from H and E stained colon sections of DSS-treated Dupdl+ / +and Dupdl' / ' mice. f. q-PCR analysis on the expression of inflammatory cytokines in the colon post-DSS treatment. HPRT was used as a control. Fold change in the expression of genes is shown compared to untreated Dupdl+ / +mice. g. Immunofluorescence was performed on frozencolon sections from Dupdl+ / +and Dupdl' / ' mice treated with DSS. Shown here are the representative images of CD45 positive cells (red). Nuclei were stained with DAPI (blue). Scale bar: 50 pm. Right panel shows quantification of CD45+ cells in the colon of wild type and Dupdl' / ' mice. I. Age-matched Dupdl+ / ~ and Dupdl' / ' mice in the 11-10' / ' background were infected with 2xl08cfu / mice of H. hepaticus in 0.2 mL of PBS. Representative colons from H. hepaticus-infected mice 3 weeks post-infection, m. Colon length of mice infected after 3 weeks, n. Clinical scores were recorded from indicated genotypes based on the scoring system described in methods section every 3 days until 3 weeks post-infection, o. Paraffin embedded colon sections were immunostained with Ly6G+ (clone: 1A8) neutrophils. Shown is the Ly6G+ area in the colon of Du pdl+ / +and Dupdl' / ' mice in the ll-10~ / ~ background. Each dot represents a mouse in all graphs. 6-8 mice / group were used for DSS-induced colitis experiments, 3 mice / group were used for as controls (untreated, normal water) and 6-10 mice / group were used in Helicobacter induced colitis experiments. Values shown are the mean ± SEM. P values were calculated using either with a one-way ANOVA with Sidak's multiple comparison's test, two-way ANOVA with Sidak's multiple comparison's test, or an unpaired student's two tailed Mann-Whitney t-test (for comparing two groups). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
[0035] Figure 25: Dt / pdl-deficiency reduces Helicobacter hepaticus induced colitis in 11-10' / ~ Du pdl~ / ~ mice, related to Figure 24. a. Treatment paradigm to assess Helicobacter induced colitis in Dupdl' / ' mice. b. PCR was performed from the faeces of mice to assess the colonization of Helicobacter hepaticus in the colon of control and ll-lO' / Dupdl' / ' mice postinfection. Shown here is an image confirming the colonization of Helicobacter hepaticus in indicated genotypes. 4 mice / groups are shown, c. Caecum weight of Helicobacter hepaticus infected control and H-lO^Dupdl' / ' mice on day 21 post-infection, d. Images showing stool consistency and the presence of blood in the feces of control and Dupdl' ' mice upon Helicobacter hepaticus infection, e. Representative images of paraffin embedded colon sections from Helicobacter hepaticus treated mice stained with Ly6G (clone: 1A8). Inset shows a magnified field of view of the same image. Scale bar: 50 pm. f. Representative images of paraffin embedded colon sections stained with F4 / 80 from Helicobacter hepaticus treated mice. g. Graph shows F4 / 80 area in the colon of control and Dupdl' / ' mice. h. Body weight was measured every 3 days up to 3 weeks post-infection. Each dot represents amouse in all graphs. Values shown are the mean ± SEM. P values were calculated using an unpaired student's two tailed Mann-Whitney t-test. *p<0.05, **p<0.01, ****p<0.0001, ns= not significant.
[0036] Figure 26: Dupdl ^ mice are not protected from a-CD3 induced acute enteropathy in the small intestine. Age-matched Dupdl ^ and Dupdl+ / +mice were injected with a-CD3 by intraperitoneal injection and small intestine length (a) and caecum weight (b) were measured after 24 hours, c. Myeloperoxidase activity (MPO) was performed in the ileum of small intestine 24 hours after a-CD3 injection, d. Paraffin embedded small intestinal sections were assessed by histology (H & E). e. Body weight was recorded in the beginning and 24 hours after a-CD3 treatment, f. Immunohistochemical quantification of Ki67+ cells in the small intestines of Du pdl ^ and Dupdl+ / +mice treated with a-CD3. g. RNA was extracted from small intestine and q-PCR analysis was performed for the indicated cytokines, and the results were reported relative to isotype antibody treated Dupdl+ / +mice. Each dot represents a mouse in all graphs. P values were calculated using either with a one-way ANOVA with Sidak's multiple comparison's test, or an unpaired student's two tailed Mann- Whitney t-test. *p<0.05, **p<0.01, ****p<0.0001. ns= not significant.
[0037] Figure 27: Dt / pdl-deficiency protects mice from colitis-associated colon cancer, a. Dupdl+ / +and Dupdl ^ littermates were injected with AOM (10 mg / kg) followed by three different cycles of 1% DSS (five days / cycle). Shown are the percent change in body weights of Du pdl+ / +and Dupdl ^ mice treated with AOM and DSS. b. Representative colons of 3 mice / group from 6-7 mice / group are shown, c. Colon length d. Caecum weight and e. numbers of colonic polyps in Dupdl+ / +and Dupdl ^ mice treated with AOM and DSS after 9 weeks, f. Size of individual polyps in the colon of Dupdl+ / +and Dupdl ^ mice treated with AOM and DSS were measured, catagorized based on the size and shown in the graph, g. Representative histology (H and E) images from paraffin embeded colonic tissues from Dupdl+ / +and Dupdl ^ mice treated with AOM and DSS. Scale bar: 200 pm. h. q-PCR analysis was performed to assess the expression of inflammatory cytokines in the colon post-AOM- DSS treatment. HPRT was used as a control. Each dot represents a mouse in all graphs. N= 6- 7 mice / group. Values shown are the mean ± SEM. P values were calculated using an unpaired student's two tailed Mann-Whitney t-test. *p<0.05, **p<0.01, ****p<0.0001, ns= not significant.
[0038] Figure 28: Generation of DUPDl-specific monoclonal antibodies, related to Figure 29: a. DUPD1 polyclonal antisera isolated from Dupd / ' mice immunized with mouse DUPD1 protein and was used to assess expression of purified mouse DUPD1 protein by Western blot analysis, b. HEK293T cells were transiently transfected with mouse DUPD1 plasmid for 48 hours and Western blot analysis was performed to assess DUPD1 expression using polyclonal antisera from DUPDl-immunized mice. Ponceau S staining was performed to assess equivalent loading (right) c. HEK293T cells were either mock transfected or transiently transfected with mouse DUPD1 plasmid for 48 hours and immunocytochemistry was performed to assess DUPD1 expression using DUPD1 antisera and two independent monoclonal antibody clones against DUPD1 (6b9 and la3). Nuclei were stained with DAPI and shown in green . Representative images are shown, d-e. HEK293T cells were either mock transfected or transiently transfected with mouse DUPD1 plasmid for 48 hours and flow cytometry was performed to assess DUPD1 expression using DUPD1 antisera and DUPD1 monoclonal antibody (clone: 6b9). Shown here is the histogram and the frequency of parent (%) in DUPD1 transfected cells compared to mock transfected cells. P values were calculated using One-way ANOVA with Sidak's multiple comparison's test. ****p<0.0001.
[0039] Figure 29: DUPD1 expressed in the skeletal muscle and regulates colitis by autophagy, a. q-PCR analysis was performed in the skeletal muscle, WAT, liver, and colon of Dupdl+ / +mice. HPRT was used as a control. N=3 mice for skeletal muscle, WAT and liver and N=6 mice for colon, b. Immunohistochemistry was performed on paraffin embedded mouse skeletal muscle tissue (left panel). Shown here is DUPD1 expression in brown. Scale bar: 200 pm. C2C12 mouse myotubes express DUPD1 (right panel). C2C12 myoblasts were differentiated using 2% FBS for five days and DUPD1 expression (Red) was assessed. Nuclei were stained with DAPI (shown here in green). Scale bar: 50 pm. c. Schematic design of bone marrow transplantation experiments using Dupdl+ / +and Dupdl ^ mice. d. Colon lengths and e. H & E images (Scale bar: 200 pm) of the colons from 2% DSS treated CD45.2 C57BL / 6 mice after bone marrow transplantation from Dupdl+ / +and Dupdl ^ mice. f. Control (Dupdlfl+and Dupdlfl / fl) and Dupdlfl / flMyf6Cremice were treated 2% DSS and colon lengths were meaured on day 8, and g. H & E images of the colons from control (Dupdlfl+and DupdlW) and Dupdl^!Myf6Cremice. h. Expression of inflammatory cytokines in the colon was assessed by qPCR. i. Wild type or Dupdl ^ C2C12 myotubes were treated withTorin 1 (3.3 pM) for 6 hours and Western blot analysis was performed to assess the expression of phospho and total p-70-S6K and LC3 A / B. Tubulin was used as loading control. Results from one experiment is shown from at least four independent experiments, j. Same as i. except that cells were treated with Rapamycin (luM) for 16 hours, k. Wild type or Dupdl ^ C2C12 myotubes either unstarved, amino acid starved or treated with Bafilomycin Al (100 nM) and Western blot analysis was performed to asess LC3 expression. Tubulin was used as loading control. Shown here are both low and high exposure blots. At least four independent in vitro experiments were performed to assess the role of DUPD1 in autophagy. I. Western blot analysis was performed in the skeletal muscle of Du pdl+ / +and Dupdl ^ mice either untreated and treated with DSS to assess LC3 A / B expression. N=3 mice / group. Values shown are the mean ± SEM. P values were calculated either using a two-way ANOVA, an unpaired student's two tailed Mann-Whitney t-test, or an unpaired student's t-test (two-tailed). 15 mice / group were used in the bone marrow transplantation DSS experiments, 6 mice / group were used in Dupdl^Myf6Cremice DSS experiments. **p<0.01, ns=not significant.
[0040] Figure 30: DUPD1 is expressed in metabolic tissues, hematopoietic cells are not involved in DUPDl-mediated DSS-induced colitis and characterization of Dupdlfl / flmice, related to Figure 29. a. q-PCR analysis was performed to assess DUPD1 expression in the skeletal muscle of Dupdl+ / +and Dupdl ^ mice. HPRT was used as a control. N=4. b. Immunohistochemistry was performed in normal mouse skeletal muscle tissue to assess DUPD1 expression (brown) in Dupdl+ / +and Dupdl ^ mice. c. Visceral white adipose tissues from indicated genotypes were stained with anti-DUPDl (Sigma) to assess DUPD1 expression. N=3. Scale bar: 50 pm. d. Dupdl+ / +(C57BL / 6 CD45.2) recipient male mice were irradiated and re-constituted with bone marrow cells isolated from either Dupdl+ / +or Dupdl ^ donor male mice. 8 weeks after re-constitution, mice were treated with 2% DSS in drinking water for 8 days followed by 2 days in normal water. PCR analysis using genotyping primers that detect a ~220 bp product for WT and ~150 bp product for CRISPR-edited Dupdl ^ genotype. Shown are PCR from FACS-sorted B cells from 3 different WT-WT mice and 3 KO-WT mice (left 6 columns). Tail genotyping of 1 KO, Het, and WT (right 3 columns), e. Caecum weights of DSS-treated Dupdl+,+(WT) or Dupdl ^ (KO) BM into WT recipients 8 weeks post-irradiation and BM reconstitution, f. Body weights of Dupdl+ / +(WT) or Dupdl ^'(KO) bone marrow transplanted WT recipients, g. PCR was performed using skeletal muscle derived cDNA. Shown here are the floxed and WT band at 296 and 521 bp in mice with indicated genotypes, h. qPCR analysis for DUPDlexpression in the skeletal muscle from the control and Dupdl^Myf6Cremice was performed. N=3-4 mice / group. Shown here is the relative expression of Dupdl mRNA. HPRT was used as a control. Each dot represents a mouse in all graphs. P values were calculated using either an unpaired student's two tailed t-test or an unpaired student's two tailed Mann-Whitney t-test, *p<0.05, ***p<0.001, ns= not significant.
[0041] Figure 31: Dupdl regulates autophagy, related to Figure 29. a. Representative immunofluorescence images of differentiated C2C12 cells showing DUPD1 expression in wild type C2C12 cells and no expression in CRISPR edited Dupdl ''' clone 67. Scale bar: 10 pm. b. Immunocytochemistry was performed in wild type or Dupdl ''' C2C12 myotubes under HBSS starvation or unstarved conditions to assess the expression of LC3 A / B (green) and DUPD1 (red). Nuclei were stained with DAPI (blue). Scale bar: 50 pm.DETAILED DESCRIPTION
[0042] Definitions
[0043] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0044] As used in the specification and claims, the singular forms "a", "an" and "the" include plural references unless the context clearly dictates otherwise.
[0045] The term "comprising," which is synonymous with "including," "containing," or "characterized by," is open-ended and is used herein to mean that the list following is non- exhaustive and may or may not include any other additional suitable items or method steps, for example one or more further feature(s), component(s), step(s) and / or ingredient(s), as appropriate.
[0046] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unlessotherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein.
[0047] Reference throughout this specification to "one embodiment," "an embodiment," "another embodiment," "a particular embodiment," "a related embodiment," "a certain embodiment," "an additional embodiment," or "a further embodiment" or combinations thereof means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.
[0048] As used herein, the term "effective amount" of a substance is an amount sufficient to produce a desired effect. In some embodiments, an effective amount of a compound or composition is an amount sufficient to treat a subject having a condition that is improved by DUPD1 (also known as DUSP27 or DUSP29) inhibition or to prevent the condition from occurring in the subject. In some embodiments, the condition is colitis, colitis-associated colon cancer, or a metabolic disorder. In other embodiments the condition is one that requires glucose regulation in the subject. The effective amount will depend on a variety of factors such as, for example, the species, age, weight, health of the subject, the mode or site of administration, or the nature of the condition, and may thus vary among subjects, administrations and condition-specific therapies.
[0049] As used herein, a "subject" or "patient" or "individual" to be treated by the method or therapeutic use of the invention is meant to refer to either a human or non-human animal. A "non-human animal" includes any vertebrate or invertebrate organism, but is preferably a mammal. A human subject can be of any age, gender, race or ethnic group, e.g., Caucasian (white), Asian, African, black, African American, African European, Hispanic, Middle Eastern, etc. In some embodiments, the subject can be a patient or other subject in a clinical setting. In some embodiments, the subject is already undergoing treatment. In some embodiments, the subject is a neonate, infant, child, adolescent, adult, or an elderly adult.
[0050] As used herein, the terms "protein" and "polypeptide" are used interchangeably and thus the term polypeptide may be used to refer to a full-length protein and may also be used to refer to a fragment of a full-length protein, and / or functional variants thereof. A "functional" variant is a polypeptide that has the same or similar level of activity as the full- length protein.
[0051] The present invention relates to compositions and methods of their use in treating or preventing inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis), colitis-associated colon cancer, or a metabolic disorder (e.g., obesity or an obesity- associated metabolic disorders) or for glucose regulation in a subject, by inhibiting DUPD1 activity or by reducing or eliminating expression of DUPD1.
[0052] Protein tyrosine phosphatases are essential regulators of various biological processes and represent a group of enzymes that can be targeted pharmacologically [34, 35], Dual specificity phosphatases (DUSPs) are a subgroup of protein tyrosine phosphatases that dephosphorylate not only Tyr(P) residues, but also Ser(P) and Thr(P) residues of proteins. The DUSPs are linked to the regulation of many cellular functions and signaling pathways and, consequently, represent promising targets for new pharmacological therapies.
[0053] DUPD1 is a poorly characterized member of the non-receptor atypical class of dual specificity phosphatases, and has no known physiological function. DUPD1 is highly expressed in skeletal muscle, fat, and liver with some expression in other tissues
[0014] , many of which are involved in energy metabolism.
[0054] A previous genome-wide association study (GWAS) suggested an involvement of locus 10q22 in IBD
[0013] , Interestingly, a gene within the cytogenetic region of 10q22 called Dupdl was found in a cohort of ~1500 Polish IBD patients [5], Furthermore, recent studies have identified protein tyrosine phosphatases as potential therapeutic targets in obesity, Type 2 diabetes (T2D), and non-alcoholic fatty liver disease (NAFLD)
[0056] , In addition, a regulatory noncoding RNA was shown to promote insulin sensitivity, potentially by regulating DUPD1
[0059] ,
[0055] The present inventors have now surprisingly found that DUPD1 promotes colitis and colitis-associated colon cancer (CAC) and also identified a role of DUPD1 in obesity and associated metabolic diseases.
[0056] Treatment and / or Prevention of Inflammatory Bowel Disease and Colitis-associated Colon Cancer
[0057] Using Dupdl' / ' mice, the inventors have demonstrated that the absence DUPD1 activity is effective in protecting mice from dextran sodium sulfate (DSS) and Helicobacter hepaticus-induced colitis. The Dupell' / ' mice were not protected from T cell driven acute small intestinal enteropathy, which demonstrates a colon specific role of DUPD1. Dupdl' / ' mice also displayed reduced colitis-associated adenomas in the colon compared to littermate controls. Mechanistically, CRISPR / Cas9 mediated loss-of-function studies demonstrated a key involvement of DUPDl-mediated autophagy in this process. A promiscuous pharmacological phosphatase inhibitor (NSC-663284), which inhibits DUPD1 catalytic activity, reduced DSS-induced colitis in both Dupdl+ / +or Dupdl+ / ' mice but not in Dupdl' / ' mice. This result means that DUPD1 was the primary therapeutic target in DSS- induced colitis in this murine model, thus, identifying DUPD1 as a central gene involve in IBD pathogenesis and colitis-associated colon cancer (CAC) and thus targeting this phosphatase with small molecule pharmacological inhibitors can improve therapeutic outcome in patients with colitis and CAC.
[0058] Accordingly, the present application provides a method for treating and / or preventing IBD, including, for example, colitis (e.g., ulcerative colitis) and Crohn's disease, and for treating and / or preventing colitis-associated colon cancer. The method comprises inhibiting the activity of DUPD1 and / or reducing or eliminating expression of DUPD1. In some embodiments, the method comprises administering an inhibitor of DUPD1, which may be a specific inhibitor or a non-specific inhibitor, as described in more detail below.
[0059] Although in some cases DUPD1 inhibition is provided as a sole therapy, in some cases the subject is provided a one or more additional therapies for treating and / or preventing IBD, including, for example, colitis (e.g., ulcerative colitis) and Crohn's disease, and for treating and / or preventing colitis-associated colon cancer.
[0060] Treatment and / or Prevention of Metabolic Disorders
[0061] The present inventors have demonstrated that Dupdl expression promotes high-fat western diet (HFD)-induced metabolic diseases. Specifically, the inventors have surprisingly found that DUPD1 deficiency protects mice from HFD-induced obesity, type 2 diabetes (T2D), and non-alcoholic fatty liver disease (NAFLD). Some of these effects were more pronounced in female than in male mice. Genome-wide association studies (GWAS) have linked DUPD1 to female weight gain in humans, mirroring the findings in pre-clinical models. Both male and female Dupdl ''' mice displayed a significant reduction of immune infiltrates in the liver, illustrating that DUPD1 can promote obesity-associated metabolic diseases through a sustained low-grade inflammation induced by a HFD.
[0062] Metabolic caging studies revealed no significant differences in food and water consumption, respiratory exchange ratio and physical activity between Dupdl ''' mice compared to their corresponding wild-type littermates, indicating that this parameter was not the reason for reduced body weight in Dupdl' ' mice.
[0063] Accordingly, the present application provides a method for treating and / or preventing obesity and obesity-associated metabolic disorders by inhibiting DUPD1 and / or reducing or eliminating expression of DUPD1. In some embodiments, the method comprises administering an inhibitor of DUPD1, which may be a specific inhibitor or a non-specific inhibitor, as described in more detail below. In some embodiments, the method comprises glucose regulation by inhibiting DUPD1 and / or reducing or eliminating expression of DUPD1.
[0064] The term "metabolic disorder" is used herein to refer to both obesity and obesity- related metabolic disorders, which include but are not limited to T2D, NAFLD (including the severe pathological condition known as non-alcoholic steatohepatitis (NASH)), cardiovascular disease and cancer. In addition, in treating and / or preventing a metabolic disorder, the inhibition of DUPD1 activity can be effective in regulating glucose levels in the subject.
[0065] Although in some cases DUPD1 inhibition is provided as a sole therapy, in some cases the subject is provided one or more additional therapies for treating and / or preventing obesity and obesity-associated metabolic disorders, or for glucose regulation.
[0066] In a further embodiment, a method is provided for reducing weight gain in a female subject by inhibiting DUPD1.
[0067] DUPD1 Inhibitors
[0068] DUPD1 inhibitors, or antagonists, useful in the methods described herein include, but are not limited to small molecules, nucleic acids, or mimetic polypeptides. For example, anti-DUPDl agents antisense nucleotides, blocking peptides, and / or small molecule antagonists. As used herein, an "DUPD1 inhibitor" or "anti-DUPDl agent," or grammatical variations thereof, refers to an agent that inhibits the expression or activity of DUPD1 protein or polypeptide, including variants or isoforms thereof. The inhibition may be to an extent (in magnitude and / or spatially), and / or for a time, sufficient to produce the desired effect. Inhibition may be prevention, retardation, reduction or otherwise hindrance of DUPD1 expression and / or activity. Such inhibition may be in magnitude and / or be temporal or spatial in nature. Inhibition of expression of DUPD1 can be assessed using methods well known in the art to measure transcription and / or protein production. The expression and / or activity of DUPD1 can be inhibited by an agent by at least or about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more compared to the expression and / or activity of DUPD1 in the absence of the inhibitor. A DUPD1 inhibitor may be specific or selective for DUPD1 or may be capable of inhibiting the expression or activity of one or more other proteins or polypeptides in addition to DUPD1. Furthermore, a DUPD1 inhibitor may act directly or indirectly on DUPD1. Accordingly, the inhibitor may operate directly or indirectly on DUPD1 proteins or polypeptides, a DUPD1 mRNA or gene, or alternatively act via the direct or indirect inhibition of any one or more components of a DUPDl-associated pathway. Such components may be molecules activated, inhibited or otherwise modulated prior to, in conjunction with, or as a consequence of DUPD1 polypeptide or protein activity.
[0069] As used herein the term "expression" can refer to expression of a polypeptide or protein, or to expression of a polynucleotide or gene, depending on the context. Expression of a polynucleotide can be determined, for example, by measuring the production of mRNA transcript levels. Expression of a protein or polypeptide can be determined, for example, by immunoassay using an antibody(ies) that binds with the polypeptide.
[0070] As used herein, "DUPD1 activity" or an "activity of DUPD1" refers to any activity associated with DUPD1 polypeptides and / or DUPD1 proteins, including, but not limited to, the dual phosphatase activity of DUPD1, the activity of DUPD1 in modulating autophagy and / or inflammation, the activity of DUPD1 in promoting colitis and / or colitis-associated cancer, the activity of DUPD1 in promoting obesity and / or obesity-associated metabolic disease. Inhibition of DUPD1 activity can include inhibition of dephosphorylation of a DUPD1 substrate(s).
[0071] The term "inhibiting" and variations thereof such as "inhibition" and "inhibits" as used herein in relation to activity of DUPD1 means complete or partial inhibition of characteristics, including, but not limited to, dual phosphatase activity of DUPD1, the activity of DUPD1 in modulating autophagy and / or inflammation, the activity of DUPD1 in promoting colitis and / or colitis-associated cancer, the activity of DUPD1 in promoting obesity and / or obesity-associated metabolic disease. The inhibition may be to an extent (in magnitude and / or spatially), and / or for a time, sufficient to produce the desired effect. Inhibition may be prevention, retardation, reduction or otherwise hindrance of activity or activation of DUPD1. Such inhibition may be in magnitude and / or be temporal or spatial in nature and can be assessed by methods well known to those of skill in the art, such as those detailed in the following examples. Inhibition of the DUPD1 activity by an agent (i.e. an DUPD1 inhibitor) can be inhibited by the agent by at least or about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more compared to DUPD1 activity in the absence of exposure to the agent. In some embodiments, the method for assessing DUPD1 inhibition can include a comparison of the measured level of inhibition from a test agent with a level of inhibition from a known DUPD1 inhibitor.
[0072] The present application further provides a method of identifying an agent useful in treating and / or preventing IBD, including, for example, colitis (e.g., ulcerative colitis) and Crohn's disease, and for treating and / or preventing colitis-associated colon cancer. The method includes a comparison of the measured level of activity of DUPD1 from a test agent to DUPD1 activity in the absence of exposure to the agent. A decrease in DUPD1 activity in the presence of the test agent is indicative of agent's usefulness in treating and / orpreventing IBD, including, for example, colitis (e.g., ulcerative colitis) and Crohn's disease, and for treating and / or preventing colitis-associated colon cancer.
[0073] The present application further provides a method of identifying an agent useful in treating and / or preventing obesity and obesity-associated metabolic disorders. The method includes a comparison of the measured level of activity of DUPD1 from a test agent to DUPD1 activity in the absence of exposure to the agent. A decrease in DUPD1 activity in the presence of the test agent is indicative of agent's usefulness treating and / or preventing obesity and obesity-associated metabolic disorders.
[0074] Examples of DUPD1 inhibitors suitable for use in the methods described herein include, but are not limited to competitive inhibitors, non-competitive inhibitors, and uncompetitive inhibitors of protein phosphatases (e.g., human or murine). The inhibitors can be specific or non-specific. Examples of suitable non-specific DUPD1 inhibitors include PTP Inhibitor IV, SHP1 / 2 PTPase Inhibitor (NSC-87877), and the dual specific phosphatase inhibitors NSC-95397 and NSC-663284. DUPD1 inhibitors can be identified by screening chemical libraries using purified native or recombinant human or mouse DUPD1 protein, or DUPD1 from another species, and measuring the effects of these chemicals on the biochemical activity of DUPD1 using in vitro substrates of phosphatases, such as 6,8- Difluoro-4-Methylumbelliferyl Phosphate (diFMUP), that produce a coloured or fluorescent readout. Examples of suitable detectable substrates include, but are not limited to, p- nitrophenyl phosphate, 6,8-Difluoro-4-Methylumbelliferyl Phosphate (diFMUP), the combination of nitro blue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP), AttoPhos™ (from Promega), and Vector™ AP substrates (from Vector Laboratories). Following the in vitro testing, the effects of these inhibitors can then be validated using in vivo substrates of DUPD1 by measuring the effects of these chemicals on the phosphorylation of DUPD1 substrates currently known, as well as others to be identified in the future, in vitro and in vivo.
[0075] DUPD1 Inhibitor Compositions
[0076] In particular embodiments, there is provided a DUPD1 inhibitor composition formulated as a pharmaceutical composition for use in the methods described herein.Pharmaceutical compositions of the present disclosure comprise an effective amount of one or more DUPD1 inhibitors dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases "pharmaceutical," "pharmaceutically acceptable" and "pharmacologically acceptable" are used interchangeably herein refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a subject, such as, for example, a human, as appropriate, and do not interfere with the therapeutic methods of the disclosure. The preparation of a pharmaceutical composition that contains at least one DUPD1 inhibitor or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington: The Science and Practice of Pharmacy, 21st Ed. Lippincott Williams and Wilkins, 2005, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by regulatory authorities.
[0077] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g.., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art. Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the pharmaceutical compositions is contemplated.
[0078] The DUPD1 inhibitor compositions may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it needs to be sterile for such routes of administration, such as injection. The DUPD1 inhibitor compositions of the present disclosure can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, intracardically, intranasally, intravaginally, intrarectally, topically, intramuscularly, subcutaneously, mucosally, intratumorally, orally, topically, locally, inhalation ( e.g., aerosol inhalation), injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in creams, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art.
[0079] The DUPD1 inhibitor composition(s) can be formulated into a composition in a free base, neutral or salt form. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as formulated for parenteral administrations such as injectable solutions, or aerosols for delivery to the lungs, or formulated for alimentary administrations such as drug release capsules and the like.
[0080] Further in accordance with the present disclosure, the composition of the present disclosure suitable for administration may be provided in a pharmaceutically acceptable carrier with or without an inert diluent. The carrier should be assimilable and includes liquid, semi solid, e.g., pastes, or solid carriers. Except insofar as any conventional media, agent, diluent or carrier is detrimental to the recipient or to the therapeutic effectiveness of a composition contained therein, its use in practicing the methods of the present disclosure is appropriate. Examples of carriers or diluents include fats, oils, water, saline solutions, lipids, liposomes, resins, binders, fillers, alcohols, and the like, or combinations thereof. The composition can also comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.
[0081] In accordance with the present disclosure, the composition is combined with the carrier in any convenient and practical manner, i.e., by solution, suspension, emulsification, admixture, encapsulation, absorption and the like. Such procedures are routine for those skilled in the art. In some embodiments, the DUPD1 inhibitor composition can be lyophilized.
[0082] In a specific embodiment of the present disclosure, stabilizing agents can be also added during formulation, to protect the composition from loss of therapeutic activity, e.g., denaturation in the stomach. Examples of stabilizers for use in the composition include buffers, amino acids such as glycine and lysine, carbohydrates such as dextrose, mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol, mannitol, etc.
[0083] In further embodiments, the present disclosure may include the use of a pharmaceutical compositions that are formulated for colon specific drug delivery. Since DUPD1 is expressed in colonic tissue, such targeted delivery can improve therapeutic effect, particularly in the method for treating and / or preventing IBD, including, for example, colitis (e.g., ulcerative colitis) and Crohn's disease, and for treating and / or preventing colitis- associated colon cancer. Examples of such formulations include prodrug formulations, pH and / or time dependent release systems, microbially triggered systems, pressure controlled colonic delivery capsules and osmotic controlled drug delivery.
[0084] The actual dosage amount of a composition of the present disclosure administered to the subject can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the subject and on the route of administration. Depending upon the dosage and the route of administration, the number of administrations of a preferred dosage and / or an effective amount may vary according to the response of the subject. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
[0085] In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% (by weight) of one or more active compound (i.e., DUPD1 inhibitor). In other embodiments, the active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. Naturally, the amount of active compound(s) in each therapeutically useful composition can be prepared in such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
[0086] In particular embodiments of the present disclosure, the DUPD1 inhibitor composition is formulated to be administered via an alimentary route. Alimentary routes include all possible routes of administration in which the composition is in direct contactwith the alimentary tract. Specifically, the pharmaceutical compositions disclosed herein may be administered orally, buccally, rectally, or sublingually. As such, these compositions may be formulated with an inert diluent or with an assimilable edible carrier, or they may be enclosed in hard- or soft- shell gelatin capsule, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet.
[0087] In certain embodiments, the active compounds may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Gelatin capsules, tablets, or pills may be enterically coated. Enteric coatings prevent denaturation of the composition in the stomach or upper bowel where the pH is acidic. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed. In addition, the active compounds may be incorporated into sustained-release preparation and formulations.
[0088] In further embodiments, the DUPD1 inhibitor compositions can be administered via a parenteral route. As used herein, the term "parenteral" includes routes that bypass the alimentary tract. Specifically, the pharmaceutical compositions disclosed herein may be administered for example, but not limited to intravitreally, intravenously, intradermally, intramuscularly, intraarterially, intrathecally, subcutaneous, or intraperitoneally.
[0089] Solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a lubricant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy injectability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (i.e., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitablemixtures thereof, and / or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
[0090] For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in isotonic NaCI solution and injected at the proposed site of infusion. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by regulatory authorities.
[0091] Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. A powdered composition is combined with a liquid carrier such as, e.g.., water or a saline solution, with or without a stabilizing agent.
[0092] Kits
[0093] Any of the inhibitors or compositions described herein can be part of a kit. The kits may comprise a suitably aliquoted DUPD1 inhibitor composition (comprising one or more DUPD1 inhibitor) of the present disclosure, and the component(s) of the kits may be packaged either in aqueous media or in lyophilized form. The container of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain a second, third or other additional container into which the additional component(s) may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present disclosure also will typically include a container for holding the DUPD1 inhibitor composition and any other reagent containers in close confinement for commercial sale.
[0094] When the components of the kit are provided in one and / or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being contemplated. The compositions can also be formulated into a syringeable composition. In which case, the container may itself be a syringe, pipette, and / or other such like apparatus, from which the formulation may be applied to a particular area of the body, injected into an individual, and / or even applied to and / or mixed with the other components of the kit. However, the component(s) of the kit can alternatively be provided as dried powder(s). When reagents and / or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container.
[0095] To gain a better understanding of the invention described herein, the following examples are set forth. It should be understood that these examples are for illustrative purposes only. Therefore, they should not limit the scope of this invention in any way.EXAMPLES
[0096] EXAMPLE 1: DUPD1 promotes colitis and colitis associated colon cancer
[0097] Method details
[0098] Mice: All mice were on the C57BL / 6 J background. Dupdl' / ' mice were generated using CRISPR / Cas9 mutagenesis at The Centre For Phenogenomics (Molecular Biology Core, 25 Orde Street, Toronto, ON M5T 3H7). In brief, the sequences within the Dupdl exon 2 were analyzed for the presence of appropriate gRNA protospacer sequences. These gRNA sequences were scored for specificity according to Hsu et al.,
[0036] and using this prediction algorithm, two gRNAs (Table 1) were identified to have good specificity (no off targets with less than 3 mismatches), one of which was further screened to validate in a cultured B cell line in vitro (CH12). A founder was identified harbouring an edited Dupdl gene with a 64- nucleotide deletion immediate downstream of the ATG start codon in exon 2 that resulted in a shift in the reading frame (Figure 1). Founders were identified and validated based on sequence based genotyping analysis and PCR. These mice were backcrossed to the C57BL / 6 mice for 6 generations. The approximate amplicon size for DUPD1 is 150 bp. The primer sequences for genotyping are provided in Table 1. Dupdl' / ' mice did not exhibits any signs of health issues and abnormalities, and experimental animals were generated by following a normal breeding strategy (i.e., breeding Dupdl+ / ~ males with Dupdl+ / ~ females) under the specific guidelines of University of Toronto, University Animal Care Committee. In addition to the gastrointestinal tract, gross pathology in most of the other organs studied including liver, skeletal muscle, spleen, adipose tissues were normal in Dupdl' / ' mice. However, a detailed pathology was not investigated in organs other than the ones mentioned here. The I LIO' / ' mice were provided by Dr. Ken Croitoru from University of Toronto. I LI O' / ' Dupdl' / ' mice were generated by breeding Dupdl+ / ' mice with IL10' / ' mice in a specific pathogen free facility (SPF). IL10' / ' mice do not develop intestinal pathology in the mouse facility under normal conditions unless infected by pathogens such as Helicobacter hepaticus. All mice were raised under specific pathogen-free conditions and fed a Teklad Global 18% protein rodent chow (Harlan, Wl, USA). Mice were assessed routinely at the Terrence Donnelly Centre for Cellular and Biomolecular Research (CCBR) and were negative for the presence of any pathogens. All experimental animal procedures were approved by University of Toronto, University Animal Care Committee.Table 1: Oligonucleotides for genotyping PCR
[0099] DSS induced colitis: For DSS-induced colitis model, Dupdl+ / +and Dupdl' / ' mice were treated with 2% (w / v) DSS (molecular weight ranges from 36-50 kDa; MP BIOMEDICALS) in the drinking water for five days followed by normal drinking water for an additional two days. Mice were observed every day and body weights were recorded. To measure colitis, each of the following parameters was given a value of either 0 or 1: stool with excreted mucus, rectal inflammation, rectal prolapse, bloody stool, over 15% weight loss, and a moribund state, leading to a maximum grade of 6. Mice were sacrificed on day eight and colon, small intestine and caecum were collected, and the length or weight was measured. For the DSS and AOM induced CAC, mice were injected intraperitoneally (single injection) with 10 mg / kg AOM on day 0 and then treated with three cycles (1 cycle = 5 days) of 1% DSS. Mice were given normal water between DSS cycles. AOM and DSS treated mice were sacrificed after 9 weeks and colons were harvested, washed with PBS and polyps were counted using a dissection light microscope (Plan Apo Nikon, SMZ 800). Colon length and caecum weight was measured, and tissues were processed for further analysis. For the assessment of NSC-326684 in DSS induced colitis, two different DSS concentrations were used, 1.5% and 2%. Dupdl+ / +and Dupdl+ / ~ mice were used as controls in these experiments. Control and Dupdl' / ' mice were first given DSS in drinking water for five days followed by 7mg / kg of NSC-326684 in drinking water containing 5% dextrose for an additional five or seven days. The optimal dose for the assessment of NSC-326684 in vivo was determined based on a previous study by Guo et al.
[0037] ,
[0100] Helicobacter hepaticus infection induced colitis: H. hepaticus strain 3B1 (ATCC 51449) was obtained from ATCC. H. hepaticus was grown on brucella agar supplemented with 5% defibrinated sheep's blood at 37°C in a microaerobic environment (85% N2, 10% CO2, and 5% O2). H. hepaticus was harvested after 4 days of growth and resuspended in PBS.Four weeks old IL10^Dupdl+ / and ILl ^Dupdl ^ mice were administered with water containing 500 mg / L cefoxitin for 48 hours and then switched to normal water for at least for 24 hours before orally inoculating them with a mixture containing 2xl08cfu of H. hepaticus in 0.2 mL of PBS. To monitor infection status throughout the experiment, fecal pellets were collected once a week and the presence or absence of H. hepaticus were assessed by qPCR (Genomic DNA from soil Kit, Macherey-Nagel) using primers described here
[0026] , Body weights were collected once every three days.
[0101] Anti-CD3 induced small intestinal acute enteropathy: 4 to 5 weeks old Dupdl+ / +and Dupdl ^ mice were treated either with a 50 pg dose of a monoclonal antibody to CD3 (UltraLEAFTM purified anti-mouse CD3e, clone 145-2C11, Bio Legend Cat No:100340) diluted in PBS or by an isotype control antibody by intraperitoneal injection (i.p.). Mice were monitored for weight loss, diarrhea, other clinical parameters and were sacrificed 24 hours after treatment and small intestine length and caecum weights were recorded and tissues were collected for further analysis.
[0102] Tissue culture, transfections, and treatments: C2C12 cells were a kind gift from Dr. Minna Woo from the University Health Network (UHN) at the University of Toronto. C2C12 myoblasts were cultured and maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum in a humidified incubator with 5% CO2. Cells were passaged using T rypsin once they reached 75%-85% confluency. Cells were differentiated using 2% FBS for 5 days when they became confluent. All experiments were performed using differentiated C2C12 cells. HEK293T cells were obtained from Open Biosystems (Cat No: HCL4517), cultured and maintained in Dulbecco's Modified Eagle's Medium (DMEM). Upon reaching to a confluency of 65-70%, cells were transfected with 3 pg of murine DUPD1 plasmid cloned into a pcDNA 3.1+ backbone using lipofectamine 2000 (Invitrogen) in absence of any serum. Transfected cells were provided with DMEM supplemented with 10% FBS, 6 hours after transfection. All transient transfections were performed for 48 hours. For the autophagy experiments, differentiated wild type and Dupdl ^ C2C12 myotubes were either amino acid starved (HBSS) or treated with Bafilomycin (100 nM), Torin (3.3 pM) and Rapamycin (lpM) for indicated time points as mentioned in the figure legends.
[0103] Generation of Dupdl ' C2C12 cells using CRISPR: For the generation of Dupdl ' C2C12 cells Dupdl-specific CRISPR guide (single-guide RNA against exon 2 of Dupdl TGAGAGGCTGTCCGTGCGGG) was designed using http: / / www.crispr.mit.edu.myaccess.library.utoronto.ca. The Dupdl specific CRISPR guide was cloned into the pX459 (Cas9-2A-puro) vector and confirmed by sequencing. The CRISPR construct was electroporated into differentiated C2C12 myoblasts. C2C12 cells were cultured a day before electroporation at a cell density of 8xl05cells / 100 mm dish. On the day of electroporation, lxlO6cells were resuspended in 600 pL ZAP buffer (25 mM HEPES, 0.75 mM Na2HPO4, 140 mM KCL, 5 mM NaCI, 2 mM MgCI2 and 0.5% w / v Ficoll) and mixed with 3 pg of DUPD1 CRISPR construct (mouse). The mixture was added to a 4 mm electroporation cuvette and electroporated using the BioRad GenePulser™ Xcell (voltage= 500 V, capacity= 500 uF, resistance= ■»). Electroporated cells were placed on ice for 5 minutes and then plated onto a 100 mm dish containing C2C12 culture media (lx DMEM, 1% P / S, 10% FBS) and incubated at 37°C / 5% CO2 for 72 hours. To select single clones, lpg / mL of puromycin was added into 10 mL culture media. Medium was replaced with fresh puromycin-containing media every 2-3 days. 10 days after puromycin selection, transfected cells were serially diluted into 96 well flat bottom plates at a concentration of 0.5 cells / well in 10% conditioned media (IX DMEM, 1% P / S, 10% filter-sterilized conditioned media, 10% FBS). After 10 days, single C2C12 clones were passaged into 96 well plates, where a fraction of each clone was collected for further screening. Clones were screened by T7EI mismatch cleavage, and all candidate mutant clones were subsequently sequenced. Briefly, genomic DNA (gDNA) was isolated using proteinase K digestion, amplified and confirmed using PCR and by gel electrophoresis. PCR products were used for T7EI mismatch cleavage assay and potential candidate mismatch-cleavage positive clones were sent for sequencing. Bia I lei ic mutations were confirmed using TIDE (http: / / shinyapps.datacurators.nl / tide / ).
[0104] Histology, immunohistochemistry, and immunofluorescence studies: For histology, colons or small intestines were processed either as frozen tissues or as formalin fixed paraffin embedded tissues following the Swiss roll method. Once harvested, tissues were washed with IX PBS (twice), external fats were removed and fixed in 4% formalin+lX PBS for 3-5 days and were embedded in paraffin and processed. For the preparation of frozen blocks, tissues were washed with IX PBS (twice) and then submerged into an O.C.Tsolution (Fisher Healthcare). 10 pm cut sections were stained with hematoxylin and eosin. For immunohistochemistry using frozen tissues, 10 urn colonic sections were processed using a cryostat and sections were stained using antibodies against CD45 (1 / 200), Ly6G clone:lA8 (Biolegend, Cat No: 127601) (1 / 300), F4 / 80 clone: BM8 (eBioscience, Cat No: 14- 4801-82) (1 / 100), Ki67 (1 / 100), iNOS (Novus Biologicals, Cat No: NB300-605SS) (1 / 100). For DUPD1 immunohistochemistry on mouse tissues, two independent antibodies were used for majority of the studies. In house anti-mouse DUPD1 (clone: 6b9) and a commercially available DUPD1 antibody (Sigma) were used for immunohistochemistry. For some studies, clone: 6b9 was conjugated with biotin (Thermo Scientific) according to manufactures instruction and an HRP conjugated streptavidin (Abeam) was used to amplify the biotinstreptavidin interaction. A 1 / 100 concentration was determined to be optimal for both the DUPD1 antibodies. For all immunohistochemistry studies, sections were first incubated with primary antibodies either conjugated with biotin / flurophore or unconjugated for 1 hour at room temperature followed by either a horse radish peroxidase or a flurophore conjugated secondary antibody or only HRP conjugated streptavidin for 30 minutes at room temperature. 3, 3' diaminobenzidine tetrahydrochloride (DAB) (Dako) was used to for the detection of HRP-conjugated secondary antibodies. 30% hydrogen peroxide was used to block endogenous peroxidase activity. For antigen retrieval, sodium citrate (pH: 6) was used for 10 minutes at 955C. Sections were blocked using 2% BSA+10% FBS. Masson Trichrome staining on frozen colon tissues were performed according to manufactures instructions (Abeam).
[0105] Immunohistochemistry in human colons: Fresh and frozen human CRC samples were obtained from the LTRI-Biospecimen Repository and Processing Laboratory at the Mount Sinai Hospital, Toronto. For the assessment of DUPD1 expression in human colons, either colon cancer or normal adjacent frozen colon tissues were first fixed with 4% formalin and processed for immunohistochemistry. DUPD1 clone: 6b9 (1 / 100) and anti- DUPD1 (Sigma) (1 / 100) was used for 1 hour at room temperature followed by an HRP- conjugated secondary antibody (1 / 300) for 30 minutes at room temperature. 3, 3' diaminobenzidine tetrahydrochloride (DAB) was used for the detection of HRP-conjugated secondary antibodies.
[0106] Immunocytochemistry in vitro: In the immunocytochemistry experiments using C2C12 myotubes, cells grown on rounded coverslips were fixed with 4% formaldehyde at room temperature for 10 minutes. 0.5% Triton X-100 in IX PBS was used for permeabilization at room temperature for 5 minutes. Cells were blocked using 2% BSA+10% FBS and incubated with primary antibodies (1 / 100 dilution of LC3, DUPD1) for 1 hour at room temperature. Alexa flurophore conjugated secondary antibodies (Alexa fluor™ 488, Alexa fluor™ 555) and FITC were used, and cells were incubated for 30 minutes at room temperature. DAPI was used to visualize the nucleus. Similar experimental procedures were used for the immunocytochemistry experiments in HEK293T cells.
[0107] Microscopy: For the visualization of immunohistochemistry and immunofluorescence slides, a Zeiss fluorescence IHC microscope and a light microscope (Axiocam 105 Color, Scope Al) equipped with ZEN software was used.
[0108] Quantitative PCR for cytokine expression: Total RNA was extracted from the proximal part of colonic tissues and ileum (S.l) using TRIzol® (Life Technologies) following manufacturer's instructions. A total of 1 pg of DNA free RNA was used for cDNA synthesis using Maxima H Minus reverse transcriptase (Thermo Fisher). For qPCR, gene-specific mRNA transcripts were amplified from cDNA in CFX384 Touch™ Real-Time PCR Detection System (BioRad) using SYBR™ FAST qPCR master mix (Kapa Biosystems) and specific primers. The specificity of PCR products was verified by melting curve analysis. Relative quantitation was performed by a comparative CT method. Data are presented as fold change after normalization with HPRT expression.Table 2: Oligonucleotides for real time PCR
[0109] Myeloperoxidase assay: Myeloperoxidase (MPO) activity in the ileum (S.l) was performed as described previously
[0038] , Samples were measured in a 96-well microtiter plate and the absorbance was recorded at 530 nm using SoftMax PRO software. Values are expressed as absorbance units / mg of tissues.
[0110] Purification of native murine and human DUPD1 protein: pRSET A vector containing polyhistidine-tag (6xHis-tag) followed by tobacco etch virus (TEV) recognition sequence (ENLYFQ / G) upstream of the human DUPD1 (hDUPDl) cDNA (6xHis-TEV-hDUPDl), was transformed into BL21 (DE3) E. coli. BL21 cells containing 6xHis-TEV-hDUPDl were streaked on Luria broth (LB) agar plates containing ampicillin (100 pg / mL) and grown overnight at 37°C. IL of LB culture containing ampicillin (200 pg / mL) was grown until midlog phase (OD600=~0.5). Recombinant fusion protein (6xHis-TEV-hDUPDl) was induced with 0.2 mM isopropylthio-|3-galactoside (IPTG) and incubated overnight at 16°C. Cells were pelleted down by centrifugation at 5000 rpm for 20 minutes at 4°C and the pellet was resuspended in 20 mL of cold lysis buffer (50 mM Tris, 150 mM NaCI, 0.1% Triton X-100 and ImM imidazole, pH=7.4) and 20 mL lysozyme buffer containing protease inhibitor (4 mg / mL lysozyme in lysis buffer and 1 complete EDTA-free protease-inhibitor cocktail tablet) for 30 minutes on ice. Cells were sonicated with 9 pulses of 1 second "on", 0.1 seconds "off" for a total length of 30 seconds at an amplitude of 15%, using Sonic Dismembrator Model 500 (Fischer Scientific). Lysed cells were centrifuged at 20,000 g for 30 minutes at 4°C and the supernatant was collected. The HisPur™ cobalt resin (Thermo Scientific) was used to isolate 6xHis-TEV-hDUPDl. Briefly, 3 mL resin was incubated with 30 mL lysis buffer for 15 minutes at 4°C and centrifuged at 400g for 2 minutes at 4°C and the supernatant was decanted. Approximately 40mL of the bacterial lysate supernatant containing 6xHis-TEV-hDUPDl was incubated with the resin for 1 hour at 4°C. The resin was centrifuged at 400 g for 2 minutes at 4°C and the supernatant was removed. The resin was washed twice with 30 mL wash buffer (10 mM imidazole in lysis buffer) and subsequently transferred to a gravity column at4°C. The resin was left to settle, and the wash buffer was drained until the buffer was just above the resin. 20 mL of elution buffer (150 mM imidazole in lysis buffer) was gently added to the column to not disturb the resin and equilibrated with the resin for 10 minutes. 1 mL elution / fraction was collected, and each fraction was measured for its protein concentration using Bio-Rad Protein Assay Kit II. Fractions containing 6xHis-TEV-hDUPDl were pooled and concentrated using the Amicon Ultra-15 centrifugal filter unit (MilliporeSigma). The concentrated 6xHis-TEV-hDUPDl was digested with 6xHis-TEV protease (5mg / mL, kind gift from Dr. Frank Sicheri's laboratory at Mount Sinai Hospital) at a 20:1 ratio of 6xHis-TEV- hDUPDl: TEV in an overnight dialysis at 4°C using the Slide-A-Lyzer™ MINI Dialysis Device, 3.5K MWCO (Thermo Scientific) with dialysis buffer [10 mM HEPES pH 7.5, 200mM NaCI and ImM tris (2-carboxyethyl)] phosphine (TCEP). The digest was collected from the top of the dialysis cup and tag-less recombinant hDUPDl was recovered using HisPur™ cobalt resin (Thermo Scientific) batch method. ImL resin / 10 mg protein was washed 2x with dialysis buffer by incubating the resin with the buffer for 15 minutes at 4°C. The resin was centrifuged at 400g for 2 minutes at 4°C and the supernatant was discarded. The digest was then incubated with the resin for 1 hour at 4°C. The resin was centrifuged at 400 g for 2 minutes at 4°C and the supernatant was carefully collected, ensuring no resin was disturbed. The native hDUPDl was concentrated using the Amicon™ Ultra-15 centrifugal filter unit (MilliporeSigma) to a final concentration of 10-30 mg / mL. The concentration was determined using the NanoDrop™ One (Thermo Scientific) at 280 nm with a molar extinction coefficient 1% (el%) of 12.4. Aliquots of native hDUPDl were flash-frozen and stored in liquid nitrogen. A 14% SDS-PAGE gel was run to confirm the presence and purity of native hDUPDl by Coomassie blue staining. Murine DUPD1 was purified following the exact same experimental procedure.
[0111] Fluorometric detection of catalytic activity of murine and human DUPD1 in vitro: The catalytic activity of purified DUPD1 was assessed using DiFMUP as a substrate according to the principles and protocols earlier established by Friedberg et al.
[0014] with some modifications. The phosphatase (DUPD1) inhibition assay was conducted in a total reaction volume of 20 pL in 384 well black flat bottom plates (Corning, cat#: 3573) at room temperature (RT). The assay conditions were: 50 nM hDUPDl or 50nM mDUPDl, 250uM 6,8-difluoro-4 methylumbelliferyl phosphate (DiFMUP) (Invitrogen) as the substrate forhDUPDl assays or 600 pM DiFMUP as the substrate for the mouse and human DUPD1 assays, and varying NSC 663284 (MilliporeSigma) concentrations (2 pM-2000 pM) as the inhibitor. Positive control wells (100% DUPD1 activity) contained DUPD1 and DiFMUP. Negative control wells (0% activity) contained DiFMUP only. Inhibitor wells contained DUPD1, DiFMUP and varying amounts of NSC 663284. Optimal substrate concentrations for hDUPDl and mDUPDl assays were determined using Michaelis-Menten kinetic experiments and selecting a substrate concentration near the Km. The optimal assay buffer consists of 50mM MES pH6.0, 150 mM NaCI, 1 mM TCEP, 0.1 mg / mL BSA and 0.01% (v / v) Tween-20. The final DMSO concentration in each reaction was 1% (v / v). In brief, 17 pL of DUPD1 (human or mouse) plus buffer (58.8 nM DUPD1 solution for a final concentration of 50 nM DUPD1 in a 20 pL reaction volume) was added to each well, aside from the negative control wells. In the negative control wells, 17 pL buffer only was added. NSC 663284 was resuspended in DMSO for a stock concentration of 77.7 mM (25 mg / mL). 1 pL of NSC 663284 buffer (varying inhibitor concentrations for a final concentration of 2 pM-2000 pM in 20 pL) was added to their respective wells and incubated for 10 minutes at room temperature. For the positive and negative controls, 1 pL of DMSO plus buffer was added. DiFMUP was resuspended in DMSO for a stock concentration of 100 mM. 2 pL of DiFMUP with buffer (2.5 mM DiFMUP solution for a final concentration of 250 pM DiFMUP in 20 pL for the hDUPDl assays, 6 mM DiFMUP solution for a final concentration of 600 pM DiFMUP in 20 pL for the mDUPDl assays) was added to all wells to start the reaction. Fluorescence values of the conversion of DiFMUP to DiFMU (Ex: 358nm, Em: 455nm) were monitored every 35 seconds for 30 minutes at room temperature using a SpectraMax™ i3 (Molecular Devices). Initial rates (RFU / min) were determined for each condition. % DUPD1 activity at each inhibitor concentration was determined by using the following equation:
[0112] A dose-response curve and relative IC50 values were determined using a nonlinear regression analysis of log (inhibitor) vs. response (three parameters) on GraphPad Prism 9.0.2.
[0113] Flow cytometry: HEK293T cells were transfected with murine DUPD1 pcDNA 3.1 or an empty vector control using a Lipofectamine™ 2000 (Thermo fisher). Cells were harvested 48 hours after transfection and stained with fixable viability dye 780 (Thermofisher) before fixation and permeabilization using a FoxP3 transcription factor staining kit (Thermofisher). Cells were then incubated either with anti-sera or with mouse anti-DUPDl monoclonal primary antibody (clone: 6B9, generated in lab) before staining with anti-mouse AF568 or AF647 (Thermofisher). Stained samples were run on an LSR Fortessa (BD Biosciences) and analyzed using FlowJo (BD Biosciences).
[0114] Immunoblot analysis: Cells were lysed with RIPA lysis buffer containing protease and phosphatase inhibitor cocktails on ice and then centrifuged at 13,000 rpm. Protein samples were resuspended in Laemmli sample buffer, boiled, and ran on acrylamide gels and transferred onto PVDF membranes. Membranes were blocked with 5% milk in TBST and incubated with primary antibodies; mouse monoclonal anti-Tubulin (#T5168, Sigma, 1:10,000 dilution), LC3-A / B (#4108, Cell Signaling Technology, 1 / 1000), Anti-SQSTMl / p62 antibody (#ab56416, Abeam 1:5000), Phospho p70-S6 Kinase and Total p70-S6 Kinase. For the detection of purified DUPD1 protein or DUPD1 in murine DUPD1 transfected HEK293T cells, anti-sera (1 / 1000) from DUPD1 immunized mice were used.
[0115] Generation of DUPD1 antibodies in mice: For the generation of DUPD1 specific monoclonal antibodies in mice similar principles and protocols were used as established originally by Aguilar et al.
[0030] , Briefly, Dupell ^ mice were first immunized with 25 pg of purified DUPD1 protein (murine) in CFA by intraperitoneal injection. Mice were boosted after 14 days and 3 days prior to sacrifice using 25 pg of purified DUPD1 protein in IFA (i.p.). Mice were sacrificed six weeks later, and serum was isolated by cardiac puncture and spleens were harvested for the isolation of splenocytes and subsequent processing and generation of hybridomas for monoclonal antibodies exactly as described by Aguilar et al.
[0030] , The polyclonal antisera were used for the detection of DUPD1 on Western blot and immunofluorescence studies. Hybridoma supernatants were screened for the detection of DUPD1 using ELISA. Three independent monoclonal antibody clones specific to DUPD1 was generated (6b9, la3, 2h6). All the experiments in this study used the 6B9 clone of DUPD1 antibody unless otherwise stated.
[0116] Quantification and statistical analysis: Data were analyzed using GraphPad Prism version 8.0 and 9.0. Unless otherwise indicated, all data were analyzed using one-way ANOVA with Sidak's multiple comparison's test, two-way ANOVA with Sidak's multiple comparison's test, or an unpaired student's two tailed Mann-Whitney t-test (for comparing two groups). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
[0117] Discussion
[0118] IBD is characterized by chronic and recurrent mucosal inflammation of the digestive tract and is associated with periods of abdominal pain, rectal bleeding, diarrhea, and loss of body weight [6], The development of IBD also increases the risk of colon cancer [7, 8], which represents one of the leading causes of cancer related mortalities worldwide including 10-15% of deaths in patients with IBD [9, 10], Although several studies have identified many loci that have been previously linked to IBD [11, 12], not all have been explored. A previous genome-wide association study (GWAS) screen suggested an involvement of locus 10q22 in IBD
[0013] , Interestingly, a gene within the cytogenetic region of 10q22 called Dupdl (also called DUSP27 and DUSP29) was found in a cohort of ~1500 Polish IBD patients [5], DUPD1 is a member of the non-receptor atypical class of dual specificity phosphatases and has no known physiological function. Although largely uncharacterized, a previous study suggested that DUPD1 is expressed in skeletal muscle, adipose tissue, and liver
[0014] , Although, DUPD1 substrates are largely unknown, a BiolD interaction analysis indicated that DUPD1 was in proximity with two proteins, Pyruvate Dehydrogenase El Subunit Beta and FIP200, also called RB1CC1
[0015] , FIP200 functions in autophagy and was recently found to interact with ATG16L1 [16, 17], a known, albeit ill- defined, factor that is associated with IBD
[0018] ,
[0119] Based on a GWAS screen suggesting a possible involvement of DUPD1 in IBD [5] and given a potential role of DUPD1 in modulating autophagy
[0015] , DUPD1 was investigated to determine whether it impacts colitis in mouse models of IBD. Dupdl' / ' mice were generated through CRISPR / Cas9 mutagenesis (Figure la). A founder was identified that had edited the Dupdl gene leading to a 64-nucleotide deletion just downstream of the ATG start codon in exon 2 that resulted in a shift in the reading frame (Figure lb). These mice were backcrossed to C57BL / 6 mice for six generations. Dupdl' ' mice and Dupdl+ / +littermate controls were treated with 2% DSS that induces tissue damage and colitis in the gastrointestinal (Gl) tract (Figure lc). Since the measurement of colon length is a reliable parameter of colitis
[0019] , the length of the colon was first assessed. DSS treated Dupdl ^ mice exhibited a less pronounced colon shortening compared to Dupdl+ / +mice (Figure 2a, b). In addition, DSS treatment did not lead to any decrease in caecum weight in Dupdl ^ mice compared to littermate controls (Figure Id) suggesting reduced diarrhea and gastrointestinal inflammation. This effect was specific to the colon as there was no difference in the length of the small intestine in Dupdl ^ mice compared to controls (Figure le). Dupdl ^ mice exhibited a reduction in the colitis-associated disease severity (Figure 2c) measured by stool with excreted mucus, rectal inflammation and prolapse, bloody stool, over 15% weight loss, and a moribund state. Importantly, Dupdl ^ mice did not display any signs of severe sickness, hunched posture or defective grooming compared to littermate controls. Consistent with these results, Dupdl ^ mice did not lose as much body weight post-DSS treatment as littermate controls (Figure If). Next colonic inflammation was assessed by histology and reduced damage of colonic crypts and epithelium was found with a decreased shortening of colonic crypts in Dupdl ^ mice (Figure 2d,e, and lg upper panel). Furthermore, Masson Trichrome staining of colonic tissues displayed reduced deposition of collagen suggesting decreased fibrosis in the colon of Du pdl ^ mice (Figure lg lower panels).
[0120] Increased expression and secretion of pro-inflammatory cytokines are critical in colitis and are associated with disease progression and severity
[0020] , In the present study a reduction in the expression of TNF-a, IL-10, and IL-6 was found in the colon of Dupdl ^ mice post-DSS treatment compared to littermate controls (Figure 2f). These cytokines are produced predominantly by activated immune (macrophages, T cells) and epithelial cells in the colon. Therefore, the presence of inflammatory infiltrates in the colon of mice treated with DSS was assessed. Specifically, the infiltration of myeloid cells was assessed since they have been previously shown to be associated with DSS-induced colitis [21, 22], Reduced CD45+ cells were observed in the colon of Dupdl ^ mice compared to DSS-treated littermate controls (Figure 2g). The number of infiltrating Ly6G+ (clone: 1A8) neutrophils and F4 / 80 macrophages were similar in the colon of Du pdl ^ and wild type littermates in the presence of DSS (Figure 3a, b). As TNF-a, IL1-0, and IL-6 are mainly produced by classically activated / polarized macrophages
[0023] and since they were reduced in the colon of Du pdl ^mice, polarized macrophages in the colon of mice treated with DSS were also assessed. Indeed, classically polarized Ml macrophages defined by the expression of iNOS on F4 / 80 (double positive) were reduced in the colon of Dupdl' / ' mice compared to littermate controls (Figure 3c). In addition to inflammation, a substantial reduction in the aberrant proliferation of cells was found within the base and walls of colonic crypts in Dupdl' / ' mice (Figure 3d), as revealed by ki67 immunohistochemistry.
[0121] Since inflammatory bowel disease represents a major risk factor for developing colon cancer and since Dupell' / ' mice were protected from DSS induced colitis, the remaining question was whether absence of DUPD1 led to reduced CAC. To address this question, mice were first treated with a single dose of azoxymethane (AOM) (10 mg / kg) followed by three cycles of 1% DSS. Dupell' / ' mice did not lose body mass during any cycle of DSS (Figure 2h) and displayed longer colons and improved caecum weights compared to littermate controls (Figure 2i-k). Strikingly, Dupdl' / ' mice developed fewer colonic adenomas compared to littermate controls (Figure 21), and displayed reduced medium to large size colonic polyps (Figure 4a) and decreased tubular and mild to moderate adenomas as revealed by histology (Figure 4b). Akin to DSS-induced colitis, expression of TNF-a, I Ll-0, and IL-6 was also reduced in the colon of Dupdl' / ' mice treated with AOM in the presence of DSS (Figure 4c). In addition, expression levels of IL-17 and I FN-y were also decreased in AOM-DSS treated Dupdl' / ' mice, indicating a reduced involvement of T cell (Thl7, Thl) driven chronic inflammation in the colon. Together, these results suggest a crucial role for DUPD1 in colitis-associated colon cancer.
[0122] Helicobacter hepaticus, a microaerobic bacterium, induces colitis and colorectal cancer in various mouse models [24, 25], including mice deficient in IL-10 [25, 26], To test whether DUPD1 promotes colitis after Helicobacter hepaticus exposure, Dupdl' / ' mice were bred to the I LlO-nu 11 C57BL / 6 background in a specific pathogen free facility (SPF). Four-week-old ILlO' / 'Dupdl' / ' and IL10' / 'Dupdl+ / ' mice were infected with Helicobacter hepaticus (Figure 5a-b). Helicobacter hepaticus infection caused shorter colons in IL10' / ' Dupdl+ / ' mice compared to IL10r / 'Dupdl' / ' mice (Figure 6a-b). Helicobacter infected I LIO' / ' Dupdl+ / ' mice also exhibited decreased caecum weight and worsened clinical scores compared to I LI O' / ' Dupdl' / ' mice (Figure 6c, d, and 5c). In addition, Helicobacter hepaticusinfection induced severe colonic inflammation with increased Ly6G+ neutrophils, but not macrophages, in IL10' / ~Dupd / ~ mice compared to ILlCT^Dupdl ^ mice (Figure 6e-g, and 5d- e). There were no observable differences in weight or length of the small intestine between ILlO^Dupdl ^ and controls (Figure 5f-g). These results show that DUPD1 promotes Helicobacter hepaticus induced colitis in ILIO^ mice.
[0123] Since DUPD1 promotes colitis in two independent mouse models, it was next investigated whether DUPD1 also facilitates T cell induced inflammatory diseases of the bowel such as coeliac disease using a CD3 model of acute small intestinal enteropathy [27- 29], Although an intraperitoneal injection of anti-CD3 antibody induced a rapid inflammatory response in the small bowel of Du pdl+ / +and Dupdl ^ mice, it did not lead to any differences in the length of the small intestine, caecum weight, and in myeloperoxidase activity (MPO) in the ileum of the small bowel between both groups of mice (Figure 7a-c). Moreover, there was no observable difference in the histopathological appearance of the ileum, in the body weight, in the presence of Ki67 positive proliferative cells, and in the transcription of inflammatory cytokine genes within the ileal compartment of small intestine of Du pdl ^ mice compared to Dupdl+ / +littermates (Figure 7d-g). These results suggest that DUPD1 does not promote T cell activation-induced acute small intestinal enteropathy.
[0124] To gain an insight into the mechanism by which DUPD1 promotes colitis and CAC, expression of DUPD1 in human and mouse tissues was studied. DUPD1 monoclonal antibodies were generated by immunizing Dupdl ^ mice as described by Aguilar et al.
[0030] (Figure 8). Discrete cells were found within human colon cancer tissue as well as adjacent normal tissue that expressed DUPD1 in a punctate expression pattern (Figure 9a, 10a). Discrete cells in the mouse colon also expressed DUPD1 in a punctate pattern (Figure 9b and Figure 10b lower panels). A commercially available antibody (Sigma, Cat No: HPA042964) showed similar results to the 'in house' DUPD1 antibody clone 6b9 (Figure 10b lower panels, and 10c). Importantly, the Sigma antibody was used in the 'Human Protein Atlas' to assess DUPD1 expression and was shown to have some positive immune reactivity in the human colon tissue. However, strong expression of DUPD1 was observed in the mouse skeletal muscle (Figure 10b upper panels), consistent with a previous study
[0014] , and in C2C12 myoblasts
[0031] when differentiated into myotubes (Figure 9c).
[0125] DUPD1 interacts with FIP200 and FIP200 regulates autophagy. To determine whether DUPD1 affects autophagy, DUPD1 knockout C2C12 cells were generated by CRISPR / Cas9 mutagenesis (Figure lOd-f) and the expression of autophagy specific proteins was assessed by Western blot analysis and immunofluorescence. Treatment of differentiated C2C12 cells with either Torinl or Rapamycin, two known inhibitors of mTOR, showed an impairment of LC3 lipidation in DUPDl-deficient C2C12 cells when mTOR was blocked (Figure 9d, e). This result suggests that DUPD1 is important to convey the autophagic induction downstream of mTOR inhibition when cells are starved. Treatment with Bafilomycin Al (BafAl) alone demonstrated that DUPD1 is dispensable for homeostatic autophagy (such as mitophagy / aggrephagy / nucleophagy) when cells are not under metabolic stress (Figure 9f). However, DUPDl-deficient C2C12 cells had minimal reduction in LC3 lipidation compared to controls in Hank's Balanced Salt Solution (HBSS) (Figure 9f, 10g), a buffer that induces autophagy through amino acid starvation, suggesting that these cells are more or less sensitive to these stresses. On the other hand, treatment with BafAl in the absence of HBSS did not induce any differences between DUPDl-deficient cells compared to the wild type C2C12 cells in the lipidation of LC3 suggesting that DUPD1 does not affect the autophagic flux at homeostasis (Figure 9f). Immunofluorescence studies using DUPD1 deficient C2C12 cells showed similar results (Figure 9g). These findings show that DUPD1 is important for starvation-induced autophagy but may not be important for homeostatic autophagy, which occurs in repleted cells.
[0126] As autophagy is known to have a dual role in certain pathologies, especially chronic inflammation and cancer
[0032] , and based on the results obtained in differentiated C2C12 cells in vitro, the expression of LC3 in mouse colon was assessed. Although, detection of LC3 by immunohistochemistry is challenging, some studies have successfully developed methods to overcome this
[0033] , A reduced number of LC3 A / B puncta in discrete cells was found within the colonic mucosae in DSS treated Dupd / ' mice compared to the littermate controls (Figure 9h-i, lOh). This difference was not evident in untreated normal colons (Figure lOi). Collectively, these results suggest that DUPD1 regulates autophagy and that aberrant and deregulated autophagic machinery may be detrimental in DUPDl-mediated colonic inflammation.
[0127] Protein tyrosine phosphatases are essential regulators of various biological processes and represent a group of enzymes that can be targeted pharmacologically [34, 35], Being an enzyme, the phosphatase activity of DUPD1 is considered to be "druggable". Thus, known phosphatase inhibitors were investigated to demonstrate reduction of DUPD1- mediated colitis in mice. To address this, murine and human native DUPD1 protein was purified from IPTG-induced BL21 (DE3) E. co / / and confirmed purified DUPD1 expression by SDS-PAGE and Coomassie blue staining (Figure 11a). DiFMUP (6,8-difluoro-4- methylumbelliferyl phosphate) was employed as a substrate for DUPD1 to assess the catalytic activity of DUPD1 in vitro
[0014] , Using DiFMUP, four promiscuous competitive inhibitors of protein phosphatases were screened against murine and human DUPD1. These included PTP Inhibitor IV, SHP1 / 2 PTPase Inhibitor (NSC-87877), and two dual specific phosphatase inhibitors NSC-95397 and NSC-663284. All were found to inhibit DUPD1 to varying degrees (Figure 12a) with NSC-663284 being the most effective, inhibiting human and mouse DUPD1 with an IC50 2.76 pM and 2.12 pM, respectively (Figure lib).
[0128] Although none of the small molecule inhibitors studied are specific to DUPD1, NSC-663284 was further studied to demonstrate its effect in reducing DSS-induced colitis in vivo. By providing NSC-663284 in the drinking water for Dupdl+ / +and Dupdl+ / ~ mice, it was demonstrated that this compound reduced DSS-induced colitis in the Dupdl+ / +and Dupdl+ / ~ mice (Figure llc-h). This effect was evidenced by i) reduced shortening of colon, ii) increased caecum weight, iii) improved body weight and iv) improved clinical parameters associated with disease severity, v) improved architecture of intestinal epithelium morphology, and vi) reduced infiltration of Ly6G+ neutrophils in NSC-663284 + DSS-treated Dupdl+ / +and Dupdl+ / ~ mice compared to DSS-treated mice (Figure llc-i). NSC-663284 did not affect the length of small intestine (Figure 12b), nor did it impact the expression of inflammatory cytokines within the colon in either Dupdl ^ or Dupdl+ / +mice (Figure 12c). Importantly, NSC-663284 did not impact the outcome of colitis in Dupdl ^ mice suggesting DUPD1 was a major target in this mouse model (Figure lld-f). These results illustrate that oral administration of a small molecule phosphatase inhibitor can ameliorate DSS-induced colitis and thus, targeting DUPD1 with pharmacological inhibitors can provide a therapeutic benefit in treating IBD.
[0129] GWAS have identified several genomic loci associated with IBD susceptibility, however only a limited number of loci have a validated functional role. In this study, using two independent mouse models of colonic inflammation, Dupdl was identified as a novel gene that promotes colitis and CAC. DUPD1 is expressed in human colonic tissue, a result that provides a strong translational relevance of this novel phosphatase. The present data demonstrated a crucial involvement of DUPD1 in autophagy and, without wishing to be bound by theory, may indicate the existence of DUPD1-FIP200-ATG16L1 axis in DUPD1 induced colonic inflammation and CAC. Lastly, despite recent advances, the limited therapeutic options in IBD emphasize a need to develop more effective therapies to treat colitis and CAC. Notably, the present Example demonstrates that a small molecule inhibitor (NSC-326684) of DUPD1 reduced colitis in mice. These data, along with GWAS that previously linked DUPD1 to IBD, provides a strong rationale to employ DUPD1 as a novel therapeutic target in colitis and CAC. Inhibitors that are specific to DUPD1 are useful to improve colonic inflammation associated with IBD and CAC.
[0130] EXAMPLE 2: Dual-specificity phosphatase DUPD1 regulates glucose homeostasis and metabolic syndrome
[0131] A high fat western style diet (HFD) rich in fat and processed meats have been identified as one of the major contributing factors in obesity-associated metabolic diseases. Excess fat in affected individuals gradually accumulates within cells and its breakdown leads to the generation of free radicals and toxic substances that inhibit the insulin signaling axis to induce hyperglycemia
[0039] , Genetic risk factors have also been reported
[0043] , Despite recent advances, precise mechanistic insights into how a HFD interacts with other etiologic factors such as genetic risk factors to induce disorders related to obesity (i.e., T2D, NAFLD, cancer) is not well understood.
[0132] NAFLD represents another major form of metabolic liver disease primarily caused by obesity (>85% of obese / overweight individuals develops NAFLD) and affects a significant population in the western world
[0044] , NAFLD includes the more severe pathological condition known as non-alcoholic steatohepatitis (NASH). NASH is characterized by inflammation, hepatocellular ballooning, and can progress to extensive fibrosis or cirrhosis and to hepatocellular carcinoma [45,46], NASH is the primary cause ofliver-related mortality and the third leading cause of liver transplantation
[0047] , Several factors such as oxidative and endoplasmic reticulum (ER) stress, inflammation, and lipotoxicity contributes to the development and progression of fatty liver to NASH and fibrosis [48-51], Generation of reactive oxygen species (ROS) have been shown to be associated with mouse models of obesity related liver diseases and in patients with hepatitis [52,53], Activation and recruitment of immune cells is one of the hallmarks of NASH
[0054] , Infiltration of different subset of T cells (CD4 and CD8), B cells, NK cells and activation of liver resident macrophages (Kupffer cells) promotes inflammation in the liver and subsequent liver damage
[0054] , Besides Kupffer cells, NK cells have also been shown to be involved in the development of NASH as NK cell-depleted mice were resistant to high fructose diet induced NASH
[0055] ,
[0133] Recent studies have identified protein tyrosine phosphatases as potential therapeutic targets in obesity, T2D, and NAFLD
[0056] , The intricate relationship between insulin resistance with T2D and the evidence that tyrosine phosphorylation and dephosphorylation are critical mediators of insulin signaling has led to the notion that protein tyrosine phosphatases might be therapeutic targets in obesity-associated metabolic diseases
[0057] , Generation of ROS have been shown to facilitate the progression of NASH through inactivation and oxidation of protein tyrosine phosphatases
[0058] , However, most recently, a regulatory noncoding RNA was shown to promote insulin sensitivity potentially by regulating an uncharacterized and novel gene that encodes a protein phosphatase called DUPD1 (also known as DUSP27)
[0059] , However, validation of this finding is required using mice genetically deficient in Dupdl. DUPD1 is a poorly characterized member of the nonreceptor class of dual specificity phosphatases, and has no known physiological function. DUPD1 is highly expressed in skeletal muscle, fat, and liver with some expression in other tissues
[0014] (https: / / www.proteinatlas.org / ENSG00000188716-DUPDl / tissue), many of which are involved in energy metabolism.
[0134] In this study, the role of DUPD1 in obesity and associated metabolic diseases was studied. It was found that mice deficient in DUPD1 are resistant to HFD-induced obesity, T2D, and NAFLD. DUPD1 deficiency protected female mice from HFD-induced weight gain, which correlated with a significant reduction in the size of gonadal visceral white adipocytes in female mice. Strikingly, Dupell' / ' male mice were not protected fromHFD-induced weight gain, despite exhibiting improved glucose tolerance and reduced NAFLD. Importantly, genome wide association studies (GWAS) have linked the DUPD1 gene to human female weight gain, mirroring the findings in the pre-clinical mouse models and emphasizing the relevance of DUPD1 to human metabolic disorders (https: / / www.ebi.ac.uk / gwas / publications / 19851299)
[0060] ,
[0135] Experimental Procedures:
[0136] Mice and diet: All mice used in this study were on the C57BL / 6J background. Dupdl ''' mice were generated using CRISPR / Cas9 technology (as described in Example 1) and were raised and maintained under specific pathogen free conditions and fed a Teklad Global 18% protein rodent chow (Harlan, Wl, USA). Mice were fed either with normal chow diet (NCD 15% fat) or irradiated high fat western diet (HFD) with a composition of 40% fat and 43% carbohydrate (Research Diet). All experimental animal procedures were approved by University of Toronto - University Animal Care Committee (UACC).
[0137] Metabolic studies: Glucose tolerance, insulin tolerance and pyruvate tolerance tests were performed based on the principles and protocols originally established by Winer et al, 2009 and Ghazarian et al. 2017 [67,68], Briefly, mice were fed a HFD for 15- 18 weeks. After 10 weeks, these mice were tested for glucose tolerance by performing a GTT (glucose tolerance test) or insulin tolerance with an ITT (insulin tolerance test). GTTs was performed by mixing lg / kg of glucose in sterile PBS and injected intraperitoneally with 26-gauge needle. Mice were fasted overnight for GTTs (2g D-glucose / kg body weight) and 6 hours for ITTs (0.75U insu lin / kg body weight). Glucose levels were measured every 15 minutes for 120 minutes using glucose test strip (Contour Next test trips, Diabetes Express) to check a small nick on the distal tip of the tail (this is the world wide standard GTT protocol, a small nick on the distal tip is less than 1 mm, and is used for each time point so that only 1 nick is made throughout the entire GTT). ITT was performed in a similar fashion, using 0.75 U / kg of human regular insulin (Eli Lilly) in a single intraperitoneal injection.Following insulin injection, blood glucose levels were measured as described above in GTT.
[0138] Metabolic cage studies: In the metabolic energy cage studies using the Comprehensive Laboratory Animal Monitoring System or CLAMS (Columbus Instruments),experimental parameters such as food and water intake, VO2, respiratory exchange ratio (RER), physical activity and body temperature were assessed. To measure energy expenditure, mice fed with a HFD for 7 weeks were separately housed in CLAMS system with free access to food and water and results were collected 24 hours after acclimatization to the apparatus. These experiments were performed exactly as described by Shi et al. previously
[0069] ,
[0139] Histology and immunofluorescence: For histology, liver and adipose tissues were harvested from mice fed either with NCD or a HFD, and processed for frozen tissue blocks using the OCT solution. 5 pm sections were cut using a cryostat (company) and hematoxylin and eosin staining was performed. Sections were mounted using paramount and visualized in Axioscope IHC microscope using the Zen software. For oil red O staining, 5 pm frozen sections were fixed using 4% formaldehyde first before staining with oil red O (Sigma) for 15 minutes. For immunofluorescence, formaldehyde fixed sections were washed and blocked using 10% FBS in PBS and incubated with primary antibodies, anti-CD3-Percep cy 5.5 (clone: 17A2, Biolegend), anti-CD45-PE cy7 and anti-CD8-PE (clone: 53-6.7, Ebioscience) for one hour at room temperature in a humidifier chamber. Sections were washed and mounted with fluorescent mounting media (DAKO) and imaged using an upright confocal microscope. For analysis, at least 3 random field of views were captured and the mean was plotted using graph pad prism 8 software.
[0140] Results
[0141] DUPD1 promotes high fat western diet-induced obesity and type 2 diabetes.
[0142] To assess whether DUPD1 has an essential role in obesity and T2D, Dupdl- / - mice were generated in the C57BL / 6 background using CRISPR / Cas9 mutagenesis. A high fat western diet (HFD), composed of 40% fat, 43% carbohydrates and 17% protein, was used since this diet model provides an excellent system to study obesity, T2D, NAFLD / NASH, cardiovascular diseases as well as certain forms of cancers [61,62], Mice were fed a HFD over 15 weeks. The HFD-fed Dupdl / ' female mice displayed a significant reduction in body weight compared to their corresponding wild type littermates (Figure 13A-B). This difference in body weight was not observed when Dupdl ^ and littermate control femaleswere fed with a standard normal chow diet (NCD) (Figure 13D). HFD-fed Dupdl ^ female mice also demonstrated a reduced size in visceral white adipocytes compared to their corresponding littermates (Figure 13C). Strikingly, Dupdl ^ males were not protected from HFD-induced weight gain (Figure 13E-F). These data mirror findings observed in human females
[0060] , and suggest a specific role of DUPD1 in female body weight gain.
[0143] As obesity drives several metabolic diseases, Dupdl ^ mice were studied to determine if they were resistant to obesity-associated metabolic diseases such as T2D and NAFLD. The results show that Dupdl ^ female and male mice had a significant improvement in glucose tolerance (GTT) compared to their corresponding littermates (Figure 14A-F). Dupdl ^ female mice fed a normal chow diet (NCD) did not show any difference in glucose tolerance compared to their corresponding wild type littermates (Figure 15). However, there was no difference in insulin tolerance between HFD-fed Dupdl ^ female and male mice compared to their littermate controls as assessed by an intraperitoneal insulin tolerance test (ITT) (Figure 14G-J). Together, these observations reveal a critical role for DUPD1 in obesity and glucose intolerance.
[0144] Absence ofDUPDl protects mice from obesity-induced NAFLD.
[0145] The liver is one of the major metabolic organs primarily affected in patients with obesity and T2D. Since Dupdl ^ mice displayed reduced body weight and / or improved glucose tolerance, the study was further performed to determine if DUPD1 regulates liver glucose homeostasis. Since gluconeogenesis is one of the central metabolic pathways that generate glucose from different non-carbohydrate substrates (such as lactate, amino acids) an intraperitoneal pyruvate tolerance test (PTT) was carried out. However, Dupdl ^ female and male mice did not show any differences in pyruvate tolerance compared to littermate controls (Figure 16A-B).
[0146] Based on the finding that DUPD1 promotes HFD-induced weight gain and T2D (Figures 13 and 14), a study was done to determine if DUPD1 deficiency protects mice from NAFLD. In mice fed a HFD for 15 weeks, a significant decrease was observed in the weight of the liver, but not in the spleen, in Dupdl ^ female mice compared to their wild type littermates (Figure 16C-16E). A HFD did not lead to differences in liver weight or spleen inDupdl' / ' male mice compared to controls (Figure 16F-G). Histological assessment by hematoxylin and eosin staining revealed a significant reduction in the formation of lipid droplets / vacuoles in the liver of Du pdl' / ' females (Figure 16H; lower panels) compared to littermate Dupdl+ / +controls and female Dupdl' / ' mice fed a NCD (Figure 16H; upper panels). Despite no effect of HFD in liver weight in Dupdl' / ' male mice, histological assessment showed a reduction in formation of lipid vacuoles in livers of Dupdl' / ' mice compared to Dupdl+ / +controls (Figure 161). These observations were further validated using oil red O staining, which showed a significant reduction in the deposition of triglycerides in the livers of Dupdl' / ' female and male mice compared to Dupdl+ / +controls (Figure 16J and 16K). Collectively, these results demonstrate that DUPD1 promotes NAFLD in both male and female mice fed a HFD.
[0147] Absence ofDUPDl prevents high fat western diet induced low-grade inflammation in the liver.
[0148] A HFD is known to induce low-grade inflammation
[0062] and inflammation associated with fatty liver is a predominant factor leading to severe liver pathologies, such as NASH. Accordingly, this study was performed to assess whether the absence of DUPD1 protected mice from HFD-induced liver inflammation. Indeed, a dramatic reduction in the infiltration of immune cells was observed, specifically a marked reduction in the subpopulation of CD45+cells, CD3+T cells, and CD8+T cells in the liver of Dupdl' / ' female and male mice compared to their respective controls (Figures 17A-C). Pro-inflammatory cytokines Tumor Necrosis Factor-a (TNF-a) and lnterleukin-6 (IL-6) are critical mediators of NASH. However, assessment of TNF-a and IL-6 expression in the liver tissue secretome of mice fed a HFD for 15 weeks, showed no difference in the expression of both TNF-a and IL-6 in the livers of Dupdl' / ' mice compared to their corresponding Dupdl+ / +littermates (Figure 17D). Taken together, these results suggest that absence of DUPD1 reduces HFD-induced liver inflammation.
[0149] Improved metabolism in Dupdl' / ' mice fed a high fat western diet.
[0150] Based on the identified role of DUPD1 in HFD-induced obesity, T2D, and NAFLD, this study further investigated if a basic difference in energy metabolism existsbetween Dupdl+ / +and Dupdl ^ mice. To investigate this, mice were subjected to metabolic energy cage studies using a Comprehensive Laboratory Animal Monitoring System (Columbus Instruments). Experimental parameters such as food and water intake, VO2, respiratory exchange ratio (RER), physical activity and body temperature were assessed. To measure energy expenditure, mice were separately housed in this system with free access to food and water and results were collected 24 hours after acclimatization to the apparatus. Although no major differences were observed in terms of food and water intake (Figure 18A), Dupdl ^ male mice displayed lower oxygen consumption (VO2) and reduced heat generation suggesting reduced energy expenditure compared to Dupdl+ / +mice during dark cycles (Figure 18B) without any obvious changes in respiratory exchange ratio (RER) (Figure 18B right panels). Physical activity between Dupdl+ / +and Dupdl ^ male mice were found to be largely similar (Figure 18C). Compared to littermate controls, Dupdl ^ females demonstrated no significant differences in food and water intake (Figure 19A), body temperature, oxygen consumption and respiratory exchange ratio (Figure 19B) and physical activity (Figure 19C). These findings suggest that reduced obesity, T2D, and NAFLD in Dupdl~ mice was not likely influenced by reduced food / water consumption or increased physical activity in the Dupdl ^ mice and further validated a role of DUPD1 in promoting these metabolic diseases.
[0151] Discussion
[0152] Obesity and related metabolic diseases are on the rise globally and require new therapeutic strategies. In addition, overweight and obese individuals with T2D represent a major risk factor for developing NAFLD, NASH, and hepatocellular carcinoma. Although, metformin still serves as one of the primary standard of care for patients with T2D, treatment options for obesity and obesity associated metabolic diseases such NAFLD / NASH is limited. In this study, a novel role for a dual specificity phosphatase called DUPD1 has been identified in mediating HFD-induced obesity and associated metabolic diseases, thus providing one of the few druggable targets for treatment of metabolic diseases. Although a previous study
[0059] suggested a potential involvement of DUPD1 in T2D, further evidence was required to provide validation of this claim especially in the context of pre-clinical mouse models. The present study identifies DUPD1 as a major metabolic regulator that orchestrates several metabolic processes and result in obesity,T2D, and NAFLD. The present data further demonstrates that DUPD1 exerts a sex-specific effect on some of these metabolic disorders as HFD-fed Dupdl' / ' female mice, but not Dupdl' / ' male mice, are resistant to weight gain (Figure 13E-F). As previous studies suggest that sex plays a key role in metabolic diseases, especially in T2D [63,64], the results shown in this study illustrate that DUPD1 is a central player in sex-specific metabolic abnormalities.
[0153] Irrespective of sex, Dupdl' ' mice were protected from developing HFD- induced glucose intolerance, a parameter that suggests that mice are resistant to T2D. However, no difference in insulin and pyruvate tolerance was observed between Dupdl' / ' mice and controls (Figure 14). This result was not surprising as previous studies suggest a crucial involvement of sexual dimorphism in insulin sensitivity [65,66], The present study therefore demonstrates a mechanism by which DUPD1 promotes HFD-induced obesity and glucose intolerance without improving insulin sensitivity.
[0154] In addition to the involvement of DUPD1 in obesity and glucose intolerance, this study identified DUPD1 as a mediator of NAFLD and NASH (Figures 16 and 17), which may have a significant clinical impact. Since NASH is a primary cause of liver failure and a leading cause of liver cancer with limited treatment options, identification of DUPD1 as a key regulator of these disorders represents a new therapeutic target for patients with NASH. Without wishing to be limited by theory, reduced inflammation in the livers of Dupdl' / ' mice suggests that recruitment of immune infiltrates plays a key role in DUPD1 mediated NAFLD / NASH.
[0155] In conclusion, this study defines DUPD1 as a major mediator of obesity- associated metabolic diseases. Since DUPD1 is a phosphatase, its catalytic activity may be involved in promoting these metabolic syndromes. Specific inhibitors for DUPD1 provide therapeutic options to target obesity-associated metabolic diseases.
[0156] EXAMPLE 3: DUPD1 directly regulates colitis and obesity associated metabolic diseases
[0157] Inflammatory bowel disease (IBD), comprising of Crohn's disease and ulcerative colitis, is a debilitating inflammatory disease of the gastrointestinal tract with no known cause. Although extensive work has linked numerous genetic loci to IBD, most ofthese associations remain poorly understood. Some studies have associated IBD to metabolic diseases such as diabetes [70 - 74], although the precise molecular and pathophysiological mechanisms behind this association is unknown. The present Example demonstrates that DUPD1 mechanistically links both IBD and metabolic disease. Specifically, Di / pdl’ / female mice were protected from high fat diet (HFD)-induced obesity, and nonalcoholic fatty liver disease (NAFLD) and both male and female mice showed improved glucose intolerance. Dupdl' / ' mice were also protected from dextran sodium sulfate (DSS) and Helicobacter hepaticus induced colitis, as well as DSS / azoxymethane (AOM) induced colitis-associated colon cancer (CAC). Consistent with the highest expression of DUPD1 in skeletal muscle, it is shown herein that DUPD1 exerts its colitogenic effects from the skeletal muscle and mechanistically plays a key role in autophagy, a pathway whose dysfunction is known to play a role in IBD. The results shown in this Example indicate that IBD is, at least in part, a metabolic disease and identify DUPD1 as a new therapeutic target in IBD and obesity-associated metabolic diseases.
[0158] Methods
[0159] Mice: All mice were on the C57BL / 6J background. Dupell' / ' mice were generated using CRISPR / Cas9 mutagenesis at The Centre For Phenogenomics (Molecular Biology Core, 25 Orde Street, Toronto, ON M5T 3H7). In brief, Dupdl exon 2 was analyzed for the presence of appropriate (guide-RNA) gRNA protospacer sequences. These gRNA sequences were scored for specificity according to Hsu et al.,
[0034] and using this prediction algorithm, two gRNAs were identified to have good specificity (no off targets with less than 3 mismatches), one of which was further screened to validate in a cultured B cell line in vitro (CH12). CRISPR editing was performed in the C57BL / 6J background. Founders were identified and validated based on sequence based genotyping analysis and PCR. These mice were backcrossed to the C57BL / 6 mice for 6 generations to minimize off-target editing by Cas9. The approximate amplicon size for DUPD1 is 150 bp. The primer sequences for genotyping are provided in Table 3.Table 3 : Oligonucleotides for genotyping PCR
[0160] Dupdl ''' mice did not exhibits any signs of health issues, or abnormalities, and experimental animals were generated by following a normal breeding strategy (i.e., breeding Dupdl+ / ~ males with Dupdl+ / ~ females) under the specific guidelines of University of Toronto, University Animal Care Committee. In addition to the gastrointestinal tract, gross pathology in most of the other organs studied including skeletal muscle, liver, spleen and adipose tissues were normal in Dupdl ''' mice. However, a detailed pathology was not investigated in organs other than the ones mentioned in this study. The IHCT / ~ mice were provided by Dr. Kenneth Croitoru from the University of Toronto.Dupdl ''' mice were generated by breeding Dupdl+ / ~ mice with HlCT / ~ mice in a specific pathogen free facility (SPF). IIIC ''- mice do not develop intestinal pathology in our mouse facility under normal conditions unless infected by pathogens such as Helicobacter. Dupdl floxed mice (Dupdl conditional allele, Dupdl W) mice were generated using CRISPR / Cas9 mutagenesis at The Centre For Phenogenomics (Molecular Biology Core, 25 Orde Street, Toronto, ON M5T 3H7). In brief, the annotated full-length protein coding DUPD1 transcripts were assessed to identify one or more critical regions. Exon 2 was designated as the "critical region" because deletion of this exon shifts the frame of the full-length protein-coding transcript and will delete most of the annotated "atypical dual specificity phosphatase" domain. Thus, the critical region (exon 2) was flanked with loxP sites to enable conditional inactivation of the Dupdl gene when breed with a tissue specific Cre line. The sequences upstream and downstream of exon 2 were analyzed for Cas9 protospacer sequences and the cognategRNA sequences were assessed to identify off-target sites and scored for specificity
[0036] , One specific gRNA on each side of the critical region was selected. CRISPR editing was performed in the C57BL / 6J background and founders were identified and validated based on sequence based genotyping analysis and PCR. To specifically delete DUPD1 in the skeletal muscle, Dupell^ mice were crossed with Myf6Cre(a skeletal muscle specific Cre line) mice that were obtained from Jackson laboratories (E>6;129-Myf6tm2<cre)Mrc / ], Strain #:010528)
[0028] , Lepobmice refer to as ob / ob , were obtained from Jackson laboratories (B6.Cg- / .epob / J Strain #:000632). Ob / ob^ Dupd / ' mice were generated by crossing Ob / ob+ / ~ mice with Dupdl+ / ~ mice . Ob / ob^ Dupdl+ / ~ mice were used as controls. Controls and Ob / ob^ Dupdl ^ were fed a normal chow diet and body weights were recorded weekly. All mice were raised under specific pathogen-free conditions and fed a Teklad Global 18% protein rodent chow (Harlan, Wl, USA) except the high fat diet experiments. Mice were assessed routinely at the Terrence Donnelly Centre for Cellular and Biomolecular Research (CCBR) and were negative for the presence of any pathogens. All experimental animal procedures were approved by University of Toronto, University Animal Care Committee.
[0161] DSS induced colitis: For DSS-induced colitis model, Dupdl+ / +and Dupdl ^ mice were treated with 2% (w / v) DSS (molecular weight ranges from 36-50 kDa; MP Biomedicals) in the drinking water for five days followed by normal drinking water for an additional two days. Mice were observed every day and body weights were recorded. To measure colitis, each of the following parameters was given a value of either 0 or 1: stool with excreted mucus, rectal inflammation, rectal prolapse, bloody stool, over 15% weight loss, and a moribund state, leading to a maximum grade of 6. Mice were sacrificed on day eight and colon, caecum were collected, and the length or weight was measured. For the DSS and AOM induced CAC model, mice were injected intraperitoneally (single injection) with 10 mg / kg AOM on day 0 and then treated with three cycles (1 cycle = 7 days) of 1% DSS. Mice were given normal water between DSS cycles. AOM and DSS treated mice were sacrificed after 9 weeks and colons were harvested, washed with PBS and polyps were counted using a dissection light microscope (Plan Apo Nikon, SMZ 800). Colon length and caecum weight were measured, and tissues were processed for further analysis. Dupdl^!Myf6Cremice were given 2% (w / v) DSS in the drinking water for five days followed by normal drinking water for an additional two days.
[0162] Helicobacter hepaticus infection induced colitis: H. hepaticus strain 3B1 (ATCC 51449) was obtained from ATCC and was grown on brucella agar supplemented with 5% defibrinated sheep's blood at 37°C in a microaerobic environment (85% N2, 10% CO2, and 5% O2). H. hepaticus was harvested after 4 days of growth and resuspended in PBS. Four weeks old H10' / 'Dupdl+ / ' and H10' / 'Dupd / ' mice were administered with water containing 500 mg / L cefoxitin for 48 hours and then switched to normal water for at least 24 hours before orally inoculating them with a mixture containing 2xl08cfu of H. hepaticus in 0.2 mL of PBS. To monitor infection status throughout the experiment, fecal pellets were collected once a week and the presence or absence of H. hepaticus were assessed by qPCR (Genomic DNA from soil Kit, Macherey-Nagel) using primers described here
[0026] , Body weights and clinical parameters associated with disease severity were collected once every three days. To measure colitis, similar parameters described for DSS was used except over 5% weight loss was considered.
[0163] a-CD3 induced small intestinal acute enteropathy: 4 to 5 weeks old Dupdl+ / +and Dupdl ^ mice were treated either with a 50 pg dose of a monoclonal antibody to CD3 (UltraLEAF™ purified a-mouse CD3e, clone 145-2C11, Bio Legend Cat No:100340) diluted in PBS or by an isotype control antibody by intraperitoneal injection (i.p.). Mice were monitored for weight loss, diarrhea, other clinical parameters and were sacrificed 24 hours after antibody treatment and small intestine length and caecum weights were recorded and tissues were collected for further analysis.
[0164] Western diet and metabolic studies in vivo: In metabolic studies, mice were fed either with normal chow diet (NCD 15% fat) or irradiated high fat western diet (HFD) with a composition of 40% fat and 43% carbohydrate (Research Diet: D12079B). Glucose tolerance, insulin tolerance and pyruvate tolerance tests were performed based on the principles and protocols originally established by Winer et al, 2009 and Ghazarian et al. 2017 [67,68], Briefly, mice were fed a HFD for 15 orl8 weeks. After 10 weeks of HFD, mice were tested for glucose tolerance (GTT)while insulin tolerance test (ITT) and / or pyruvate tolerance (PTT) was performed after 12 and 18 weeks respectively. GTTs was performed by adding lg / kg of glucose in sterile PBS and injected intraperitoneally with 26-gauge needle. Mice were fasted for overnight in GTTs (2g D-glucose / kg body weight), 6 hours in ITTs (0.75U insu lin / kg body weight) and 18 hours for PTT. Glucose levels were measured in bloodfrom a small nick on the distal tip of the tail every 15 minutes for 120 minutes using glucose test strip (Contour Next™ test trips, Diabetes Express). ITT and PTT were performed in a similar fashion, using 0.75 U / kg of human regular insulin (Eli Lilly) and 1.5 g / kg pyruvate (Sigma) in a single intraperitoneal injection. Following insulin and pyruvate injection, blood glucose was measured similarly as described for GTT.
[0165] Metabolic caging studies using Comprehensive Laboratory Animal Monitoring System (CLAMS): Metabolic caging experiments were performed according to the protocols established by Shi et al. previously
[0069] with some modifications. Male and female mice fed a high fat Western diet were analyzed after seven weeks. This timeline was determined based on the changes in body weight in Dupdl / ' female mice compared to their wild type littermates. Mice were singly housed for 48 hours, and different metabolic parameters including physical activity and food intake were recorded. No data points within the first 12 hours of acclimatization period were included in the analysis.
[0166] Tissue culture, transfections, and treatments: C2C12 myoblasts were cultured and maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum in a humidified incubator with 5% CO2. Cells were passaged using Trypsin once they reached 75%-85% confluency and were differentiated using 2% FBS for 5 days when they became confluent. All experiments were performed using differentiated C2C12 cells. HEK293T cells were obtained from Open Biosystems (Cat No: HCL4517), cultured and maintained in Dulbecco's Modified Eagle's Medium (DMEM). Upon reaching to a confluency of 65-70%, cells were transfected with 3 pg of murine DUPD1 plasmid cloned into a pcDNA 3.1+ backbone using lipofectamine 2000 (Invitrogen) in absence of any serum. Transfected cells were provided with DMEM supplemented with 10% FBS 6 hours after transfection. All transient transfections were performed for 48 hours. For the autophagy experiments, differentiated wild type and Dupdl / ' C2C12 myotubes were either amino acid starved (HBSS) or treated with Bafilomycin (100 nM), Torin 1 (3.3 pM) and Rapamycin (1 pM) for indicated time points mentioned in the figure legends. All cells were tested negative for mycoplasma.
[0167] Generation ofDupdl ^ C2C12 cells using CRISPR: For the generation of DupdT / _C2C12 cells Dupdl-spec\f\c CRISPR guide (single-guide RNA against exon 2 of Du pdlTGAGAGGCTGTCCGTGCGGG) was designed using an online tool. The Dupdl specific CRISPR guide was cloned into the pX459 (Cas9-2A-puro) vector and confirmed by sequencing. The CRISPR construct was electroporated into C2C12 myoblasts. C2C12 cells were cultured a day before electroporation at a cell density of 8xl05cells / 100 mm dish. On the day of electroporation, lxlO6cells were resuspended in 600 pL ZAP buffer (25 mM HEPES, 0.75 mM Na2HPO4, 140 mM KCL, 5 mM NaCI, 2 mM MgCL and 0.5% w / v Ficoll) and mixed with 3 pg of DUPD1 CRISPR construct (mouse). The mixture was added to a 4 mm electroporation cuvette and electroporated using the BioRad GenePulser Xcell™ (voltage= 500 V, capacity= 500 uF, resistance= ~). Electroporated cells were placed on ice for 5 minutes and then plated onto a 100 mm dish containing C2C12 culture media (lx DMEM, 1% P / S, 10% FBS) and incubated at 37°C / 5% CO2 for 72 hours. To select single clones, lpg / mL of puromycin was added into 10 mL culture media. Medium was replaced with fresh puromycin- containing media every 2-3 days. 10 days after puromycin selection, transfected cells were serially diluted into 96 well flat bottom plates at a concentration of 0.5 cells / well in 10% conditioned media (IX DMEM, 1% P / S, 10% filter-sterilized conditioned media, 10% FBS). After 10 days, single C2C12 clones were passaged into 96 well plates, where a fraction of each clone was collected for further screening. Clones were screened by T7EI mismatch cleavage, and all candidate mutant clones were subsequently sequenced. Briefly, genomic DNA (gDNA) was isolated using proteinase K digestion, amplified and confirmed using PCR and by gel electrophoresis. PCR products were used for T7EI mismatch cleavage assay and potential candidate mismatch-cleavage positive clones were sent for sequencing. Bia I lei ic mutations were confirmed using TIDE (Tracking of Indels by Decomposition) and Synthego.
[0168] Histology, immunohistochemistry, and immunofluorescence studies: For histology, colons or small intestines were processed either as frozen tissues or as formalin fixed paraffin embedded tissues following the Swiss roll method. Once harvested, tissues were washed with IX PBS (twice), external fats were removed and fixed in 4% formalin+lX PBS for 3-5 days and were embedded in paraffin and processed. For the preparation of frozen blocks, tissues were washed with lx PBS (twice) and then submerged into an O.C.T solution (Fisher Healthcare). 10 pm cut sections were stained with hematoxylin and eosin. For immunohistochemistry using frozen tissues, 10 pm colonic sections were processed using a cryostat and sections were stained using antibodies against CD45 (1 / 200), Ly6Gclone:lA8 (Biolegend, Cat No: 127601) (1 / 300), F4 / 80 clone: BM8 (eBioscience, Cat No: 14- 4801-82) (1 / 100), Ki67 (1 / 100), iNOS (Novus Biologicals, Cat No: NB300-605SS) (1 / 100) p70 S6 kinase antibody # 9202s (Cell Signaling Technology) phospho-p70S6 kinase (Thr309) antibody #9205s (Cell Signaling Technology). For DUPD1 immunohistochemistry on mouse tissues, two independent antibodies were used for most of the experiments. In-house developed anti-mouse DUPD1 (clone: 6b9) and a commercially available DUPD1 antibody (Sigma) were used for immunohistochemistry. For some studies, clone: 6b9 was conjugated with biotin (Thermo Scientific) according to manufactures instruction and an HRP (horseradish peroxidase) conjugated streptavidin (Abeam) was used to amplify the biotinstreptavidin interaction. A 1 / 100 concentration was determined to be optimal for both DUPD1 antibodies. For the majority of the immunohistochemistry studies, sections were first incubated with primary antibodies either conjugated with biotin / flurophore or unconjugated for 1 hour at room temperature followed by either a horse radish peroxidase or a fluorophore conjugated secondary antibody or only HRP conjugated streptavidin for 30 minutes at room temperature. 3,3'-diaminobenzidine tetrahydrochloride (DAB) (Dako) was used to for the detection of HRP-conjugated secondary antibodies. 30% hydrogen peroxide was used to block endogenous peroxidase activity. For antigen retrieval, sodium citrate (pH: 6) was used for 10 minutes at 95°C. For LC3 A / B immunohistochemistry on paraffin embedded mouse tissues, sections were heated with sodium citrate (pH: 6) in a hot water bath for 30 minutes at 85-90°C and blocked using 2% BSA+10% FBS. Sections were incubated overnight with LC3 A / B antibody at 4°C. Masson Trichrome staining on frozen colon tissues were performed according to manufactures instructions (Abeam).
[0169] Oil Red O staining in liver: Frozen liver sections (5 pm) were fixed with 4% formaldehyde, immersed into 60% alcohol and stained with Oil Red O (Sigma Cat #00625) for 15 minutes at room temperature. Sections were counterstained with Giel's hematoxylin and mounted using paramount.
[0170] Immunocytochemistry in vitro: In the immunocytochemistry experiments using C2C12 myotubes, cells grown on rounded coverslips were fixed with 4% formaldehyde at room temperature for 10 minutes. 0.5% Triton X-100 in IX PBS was used for permeabilization at room temperature for 5 minutes. Cells were blocked using 2% BSA+10% FBS and incubated with primary antibodies (1 / 100 dilution of LC3, DUPD1) for 1 hour atroom temperature. Alexa fluorophore conjugated secondary antibodies (Alexa flour 488, Alexa flour 555) and FITC were used, and cells were incubated for 30 minutes at room temperature. DAPI was used to visualize the nucleus. Similar experimental procedures were used for the immunocytochemistry experiments in HEK293T cells.
[0171] Microscopy: For the visualization of immunohistochemistry and immunofluorescence slides, a Zeiss fluorescence IHC microscope and a light microscope (Axiocam 105 Color, Scope Al) equipped with ZEN software was used. An Axio scan slide scanner system (Axio Scan. Zl) was used to image the colonic swiss roll under 40X objective.
[0172] RNA isolation and Quantitative PC / ?: Total RNA was extracted from the proximal part of colonic tissues and ileum (S.l), skeletal muscle, liver and white adipose tissue using TRIzol® (Life Technologies) following manufacturer's instructions. A total of either 1 or 2 pg of DNA free RNA was used for cDNA synthesis using Maxima H Minus reverse transcriptase (Thermo Fisher). For qPCR, gene-specific mRNA transcripts were amplified from cDNA in CFX384 Touch™ Real-Time PCR Detection System (BioRad) using SYBR FAST qPCR master mix (Kapa Biosystems) and specific primers. The specificity of PCR products was verified by melting curve analysis. Relative quantitation was performed by a comparative CT method.
[0173] Myeloperoxidase assay: Myeloperoxidase (MPO) activity in the ileum (S.l) was performed as described previously
[0038] , Samples were measured in a 96-well microtiter plate and the absorbance was recorded at 530 nm using SoftMax PRO™ software. Values are expressed as absorbance units / mg of tissues.
[0174] Flow cytometry: HEK293T cells were transfected with murine DUPD1 pcDNA 3.1 or an empty vector control using a Lipofectamine 2000 (Thermo fisher). Cells were harvested 48 hours after transfection and stained with fixable viability dye 780 (Thermofisher) before fixation and permeabilization using a FoxP3 transcription factor staining kit (Thermofisher). Cells were then incubated either with anti-sera or with mouse anti-DUPDl monoclonal primary antibody (clone: 6B9, generated in lab) before staining with anti-mouse AF568 or AF647 (Thermofisher). Stained samples were run on a LSR Fortessa™ (BD Biosciences) and analyzed using FlowJo™ (BD Biosciences).
[0175] Immunoblot analysis: Cells were lysed with RIPA (radioimmunoprecipitation assay) lysis buffer containing protease and phosphatase inhibitor cocktails on ice and then centrifuged at 13,000 rpm. Protein samples were resuspended in Laemmli sample buffer, boiled, and ran on acrylamide gels and transferred onto PVDF membranes. Membranes were blocked with 5% milk in TBST and incubated with primary antibodies: mouse monoclonal anti-Tubulin (#T5168, Sigma, 1:10,000 dilution), LC3-A / B (#4108, Cell Signaling Technology, 1 / 1000), Phospho p70-S6 Kinase and Total p70-S6 Kinase (Cell Signaling Technology). For the detection of purified DUPD1 protein or DUPD1 in murine DUPD1 transfected HEK293T cells, anti-sera (1 / 1000) from DUPD1 immunized mice were used.
[0176] Generation ofDUPDl antibodies in mice: For the generation of DUPD1 specific monoclonal antibodies in mice similar principles and protocols were used as established originally by Aguilar et al.
[0030] , Briefly, Dupdl ^ mice were first immunized with 25pg of purified DUPD1 protein (murine) in CFA by intraperitoneal injection. Mice were boosted after 14 days and 3 days prior to sacrifice using 25 pg of purified DUPD1 protein in IFA (i.p.). Mice were sacrificed six weeks later, and serum was isolated by cardiac puncture and spleens were harvested for the isolation of splenocytes and subsequent processing and generation of hybridomas for monoclonal antibodies exactly as described by Aguilar et al.
[0030] , The polyclonal antisera were used for the detection of DUPD1 on Western blot and immunofluorescence studies. Hybridoma supernatants were screened for the detection of DUPD1 using ELISA. Three independent monoclonal antibody clones specific to DUPD1 was generated (6b9, la3, 2h6). Unless otherwise stated, all the experiments in this study used the 6B9 clone of DUPD1 antibody.
[0177] Generation ofDUPDl specific bone-marrow chimeras: Bone marrow transplantation studies were performed exactly as described by Li et al., previously
[0084] , Briefly, 8-10 weeks old Dupdl+ / +(C57BL / 6; CD45.2) male recipient mice were irradiated and injected with lxlO6bone marrow derived cells from either Dupdl+ / +or Dupdl ^ male mice by tail vein (i.v). Mice were fed with neomycin (2 g / liter) in drinking water for two weeks. 8 weeks after reconstitution, mice were treated with 2% DSS in drinking water for 8 days and then with normal water for 2 days. Body weights were collected daily, and mice were sacrificed on day 11 to harvest organs. Chimerism was confirmed in FACS sorted spleen B cells using DUPD1 specific genotyping primers described in Table 4.Table 4: Oligonucleotides for real-time PCR
[0178] RNA Sequencing: Total RNA was isolated from the skeletal muscle according to the manufacturer's instructions (Invitrogen). RNA sequencing was performed at the Princess Margaret Genomics Centre (101 College Street, Toronto, Ontario, M5G 1L7) using Illumina Novaseq™ 6000. Quality assessment of samples was performed using Bioanalyzer, TapeStation™ and qPCR. Sample library was prepared using Illumina Stranded Total RNA Ligation Ribo Zero Plus™ Kit. For sequencing, 100 bp paired-end protocol and multiplexing was used to obtain ~40 million reads / sample. Quality control of sequencing data was performed, and libraries were generated and converted to FASTQ files. Differentially expressed genes were identified using DSeq2. Hierarchical cluster analysis was performed to assess transcript expression.
[0179] Magnetic Resonance Imaging: MRI analysis was performed by the Spatio- Temporal Targeting and Amplification of Radiation Response (STTAR) program (Toronto, ON, Canada) in accordance with the Toronto General Research Institute Animal Care Protocol as described previously [85,86],
[0180] Quantification and statistical analysis: Data were analyzed using GraphPad Prism™ version 8.0 and 9.0. Unless otherwise indicated, all data were analyzed using oneway ANOVA with Sidak's multiple comparison's test, two-way ANOVA with Sidak's multiple comparison's test, an unpaired student's (two tailed) t-test or a Mann-Whitney t-test (for comparing two groups). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
[0181] Discussion and Results
[0182] IBD is characterized by chronic and recurrent mucosal inflammation of the digestive tract and is associated with periods of abdominal pain, rectal bleeding, diarrhea, and loss of body weight
[0075] , The cause of IBD is unknown, but the leading hypothesis is that the local gut immune response to microbial and / or other environmental factors are exacerbated in genetically susceptible hosts leading to mucosal inflammation and damage [76, 77], Emerging evidence from Genome Wide Association Studies (GWAS) and epidemiological studies suggests that IBD and metabolic diseases may share common pathways [75, 76]; however, the molecular processes underlying this association remains unclear. Dysfunction of the intestinal barrier (often caused by obesity) which increases intestinal permeability and deregulates the interaction of the microbiota with the intestinal immune system and endocrine-metabolic crosstalk has been postulated as common risk factors in both IBD and metabolic diseases [76 - 81], A previous GWAS suggested the involvement of 10q22 locus in IBD
[0013] , and a gene within the cytogenetic region of 10q22 called Dupdl (also called DUSP29) was found to be associated with disease in a cohort of ~1500 Polish IBD patients [5], Importantly, a second independent GWAS has linked the Dupdl gene to obesity
[0060] suggesting a role of Dupdl in metabolic diseases. DUPD1 is a member of the non-receptor atypical class of dual specificity phosphatases and while it is expressed primarily in the skeletal muscle, it has no known physiological function
[0014] , These studies suggest that DUPD1 may mechanistically link both IBD and metabolic disease.
[0183] Since GWAS linked the Dupdl loci to female weight gain
[0060] , the present study investigated the involvement of DUPD1 in high fat western diet (HFD)-induced obesity and associated metabolic diseases. Dupdl' / ' mice were generated by CRISPR / Cas9 mutagenesis (Fig. 20a and see Methods). Dupdl' / ' female mice fed a HFD displayed a significant protection from body weight gain compared to controls (Fig. 21a-c). However,this difference was not evident in Dupdl' / ' male mice (Fig. 20b-d). Importantly, Dupdl' / female mice demonstrated a similar phenotype when crossed with Lepob / obmice, a genetic model of obesity (Fig. 20e-f). Irrespective of sex, both Dupdl' / ' female and male mice showed improved glucose tolerance (Fig. 21d-i). These differences in body weight and glucose tolerance were not evident in Di / pdl’ / female mice fed a normal chow diet (Fig. 20g- j). Compared to the wild type littermates, Dupdl' / ' male and female mice did not show any differences in insulin and pyruvate tolerance (Fig. 20k-r). Since NAFLD is highly associated with obesity
[0044] , the livers of HFD-fed mice were assessed. Dupdl' / ' female, but not Dupdl' male mice, had reduced liver weights and decreased accumulation of fat in the livers revealed by histology and oil red o staining compared to controls (Fig. 21j-m, Fig. 20s). Consistent with these results, metabolic caging experiments also suggested strong trends towards increased physical activity in Dupdl' / ' mice compared to their littermate controls, without any differences in food intake (Fig. 22a). There was no difference in the weight of skeletal muscle in Dupdl' / ' mice compared to their wild type littermates (Fig. 22c). Together, these data suggest a role of DUPD1 in obesity-associated metabolic diseases.
[0184] Since GWAS suggested a role for Dupdl to IBD, and as metabolic diseases and IBD may share common mechanisms [71, 77], the present study further investigated whether Dupdl impacts colitis. To induce colitis, Dupdl' / ' mice and Dupdl+ / +littermate controls were treated with 2% DSS (Fig. 23a). DSS-treated Dupdl ''' mice exhibited a less pronounced shortening of the colon compared to littermate controls (Fig. 24a-b). In addition, DSS treatment did not cause a decrease in caecum weight in Dupdl ''' mice compared to controls (Fig. 23b). Dupdl ''' mice exhibited reduced colitis-associated disease severity (Fig. 24c) and did not display any signs of severe sickness, hunched posture or defective grooming compared to littermate controls. Consistent with these results, Dupdl ''' mice lost less body weight post-DSS treatment compared to controls (Fig. 23c). Histological analysis showed reduced damage and shortening of colonic crypts and epithelium in Dupdl' mice compared to controls (Fig. 24d,e, and Fig. 23d). Furthermore, Masson Trichrome staining of the colon showed reduced deposition of collagen in DSS-treated Dupdl' ' mice (Fig. 23e), suggesting decreased fibrosis. Pro-inflammatory cytokines and inflammatory infiltrates are critical in colitis and are associated with disease progression and severity [20- 22], Post-DSS treatment, Dupdl' ' mice had reduced expression of Tnf-a, 11-16, and 11-6 (Fig.24f), as well as reduced CD45+ cells in the colon compared to littermate controls (Fig. 24g). While Ly6G+ neutrophils and F4 / 80+ macrophages were similar in the colon of Dupdl ^and Dupdl+ / +mice treated with DSS (Fig. 23f-g), classically activated (polarized) Ml macrophages that produce Tnf-a, 11-16, and 11-6
[0023] , were reduced in the colon of Du pdl ^ mice (Fig. 23 h) . In addition, there was a substantial reduction in the aberrant proliferation of cells within the base and walls of colonic crypts in Dupdl ^ mice revealed by ki67 immunohistochemistry (Fig. 23i). These data show that DUPD1 facilitates DSS-induced colitis.
[0185] Helicobacter hepaticus, a microaerobic bacterium, induces colitis in various mouse models [24,25], including mice deficient in 11-10 [25,26], To test whether DUPD1 promotes colitis after Helicobacter hepaticus exposure, four-week-old H10r / ~Dupd / ~ and H10r / ~Dupdl+ / ~ mice were infected with Helicobacter hepaticus (Fig. 25a-b). Helicobacter hepaticus infection caused shorter colons and worsened clinical outcomes in H10' / 'Dupdl+ / ' mice compared to 1110^ Dupdl ^ mice (Figure 24h-i). Helicobacter infected IHO^Dupdl^ mice also exhibited decreased caecum weight and reduced stool consistency compared to 1110^ Dupdl ^ mice (Fig. 25c-d). In addition, Helicobacter hepaticus infection induced severe colonic inflammation with increased Ly6G+ neutrophils, but not macrophages, in IHO' / ~ Dupdl+ / ~ mice compared to 1110^ Dupdl ^ mice (Fig. 24k-l, Fig. 25e-g). The body weight between 1110^ Dupdl ^ and controls were similar post-infection (Fig. 25h). Conversely, no involvement of DUPD1 was found in acute small intestinal enteropathy using anti-CD3 (Fig. 26). Collectively, these results show that DUPD1 promotes colitis in two different models of IBD.
[0186] Since IBD is a major risk factor for the development of colon cancer, the present Example further studied whether absence of DUPD1 led to reduced colitis- associated colon cancer (CAC). Mice were treated with a single dose of AOM (10 mg / kg) followed by three cycles of 1% DSS. Dupdl ^ mice did not lose body mass during any cycle of DSS (Fig. 27a) and displayed longer colons and improved caecum weights compared to littermate controls (Fig. 27 b-d). Strikingly, Dupdl ^ mice developed fewer colonic polyps compared to littermate controls (Fig. 27e) and displayed reduced medium to large size colonic polyps and decreased tubular and mild to moderate adenomas as revealed by histology (Fig. 27f-g). In addition, expression of various inflammatory cytokines (i.e., Tnf-a,11-16, 11-6, 11-17, and Ifn-y) were reduced in the colons of AOM / DSS-treated Dupdl ''' mice compared to controls (Fig. 27h). Together, these results indicate a crucial role for DUPD1 in CAC.
[0187] To gain insights into the mechanism by which DUPD1 promotes colitis, the expression of DUPD1 in mouse tissues was first assessed by qPCR and by immunohistochemistry using in-house developed anti-DUPDl monoclonal antibodies
[0030] (Fig. 28), as well as commercially available anti-DUPDl antibodies. Strong expression of DUPD1 was found in the skeletal muscle and white adipose tissue, with reduced expression in the liver (Fig. 29a, b and Fig. 30a-c). However, no expression of DUPD1 was found in the colon (Fig. 29a). Strong protein expression of DUPD1 was also observed in differentiated C2C12 myotubes (Fig. 29b).
[0188] Although these results support previous findings that DUPD1 is largely expressed in metabolic tissues
[0014] , it also raises the question as to how DUPD1 can impact inflammation in the colon. To test whether DUPD1 acts at the level of non-hematopoietic cells or in hematopoietic cells to promote colitis, bone-marrow chimeric mice were developed and examined (Fig. 29c). Dupdl^ recipients that were reconstituted with Dupdl' Dupdl+ / +bone marrow showed that Dupdl' ' hematopoietic cells did not prevent DSS- induced colitis, despite the fact that ~100% of B cells (and by proxy all hematopoietic cells) harboured the Dupdl' / ' genotype (Fig. 29d-e and Fig. 30d-f). These results suggest an extra hematopoietic role for DUPD1 in colitis. To more precisely assess the tissue that exerts its effects in colitis in a DUPDl-dependent manner, Dupdl floxed mice (Dupdl^1) were generated (Fig. 30g). As DUPD1 is largely expressed in skeletal muscle, Dupdl mice were crossed with Myf6Cre mice to specifically delete DUPD1 in skeletal muscle (Fig. 30h)
[0082] , Strikingly, knocking out DUPD1 in the skeletal muscle protected mice from DSS-induced colitis as evidenced by longer colon length, reduced expression of inflammatory cytokines and improved histopathology (Fig. 29f-h). Collectively, these results show that DUPD1 expressed in the skeletal muscle promotes DSS-induced colitis.
[0189] DUPD1 substrates are largely unknown. However, a BiolD interaction analysis indicated that DUPD1 was in proximity with FIP200 (also called RB1CC1)
[0015] and FIP200 functions in autophagy and interacts with ATG16L1 [16,17], a known albeit ill-defined riskfactor in IBD
[0018] , Thus, DUPD1 may modulate autophagy through the FIP200-ATG16L1 axis. To determine whether DUPD1 affects autophagy, Dupdl' / ' C2C12 cells were generated by CRISPR / Cas9 mutagenesis (Fig. 31a) and were assessed for expression of autophagy specific proteins by Western blot analysis and immunofluorescence. Treatment of differentiated C2C12 myotubes with either Torinl or Rapamycin, two known inhibitors of mTOR, showed an impairment of microtubule-associated protein 1A / 1 B-light chain-3 (LC3) lipidation in Dupdl' / ' C2C12 cells (Fig. 29i-j). These results suggest that DUPD1 conveys autophagic induction downstream of mTOR. Furthermore, amino acid starvation showed a reduction in LC3 lipidation in Dupell' / ' C2C12 cells (Fig. 29k and Fig. 31b). A reduction in LC3 lipidation was also observed in the skeletal muscle of DSS-treated Dupell' / ' mice compared to littermate controls (Fig. 291). However, no difference in the lipidation of LC3 was seen when Dupell' / ' C2C12 cells were treated with Bafilomycin Al (BafAl) in the absence of Hank's Balanced Salt Solution (HBSS) (Fig. 29k). These results indicate that DUPD1 is important for starvation-induced autophagy but does not affect the autophagic flux at homeostasis and is dispensable for homeostatic autophagy when cells are not under metabolic stress.Collectively, these results demonstrated a crucial involvement of DUPD1 in autophagy in the skeletal muscle and suggests a mechanism by which the skeletal muscle can mediate colitis.
[0190] Mechanisms that associate IBD with metabolic diseases are unknown. The identification of Dupdl as a novel gene that facilitates both colitis, CAC, and obesity associated metabolic diseases thus provides a mechanistic link between IBD and metabolic diseases. The fact that DUPD1 is highly expressed in the skeletal muscle
[0014] (Fig. 29a-b) and its skeletal muscle expression regulates colitis (Fig. 29f-h), suggests that IBD is at least in part, a metabolic disease. The present data also demonstrated that DUPD1 regulates autophagy in skeletal muscle cells (Fig. 29i-l), a result that provides mechanistic insights towards DUPD1 function and its role in IBD. From a clinical standpoint, targeting the catalytic activity of DUPD1 with pharmacologically potent inhibitors provides new therapeutic options to improve DUPDl-mediated inflammatory and metabolic diseases. In conclusion, the present Example shows that DUPD1, a phosphatase of previously unknown function and that is expressed primarily in the skeletal muscle, links IBD and obesity- associated metabolic diseases.
[0191] References1. Dahlhamer, J.M., et al., Prevalence of Inflammatory Bowel Disease Among AdultsAged >18 Years - United States, 2015. MMWR Morb Mortal Wkly Rep, 2016. 65(42): p. 1166-1169.2. Nguyen, G.C., C.A. Chong, and R.Y. Chong, National estimates of the burden of inflammatory bowel disease among racial and ethnic groups in the United States. J Crohns Colitis, 2014. 8(4): p. 288-95.3. The global, regional, and national burden of inflammatory bowel disease in 195 countries and territories, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet Gastroenterol Hepatol, 2020. 5(1): p. 17-30.4. Ng, S.C., et al., Worldwide incidence and prevalence of inflammatory bowel disease in the 21st century: a systematic review of population-based studies. Lancet, 2017. 390(10114): p. 2769-2778.5. Ostrowski, J., et al., Genetic architecture differences between pediatric and adultonset inflammatory bowel diseases in the Polish population. Sci Rep, 2016. 6: p. 39831.6. Kappelman, M.D., et al., Recent trends in the prevalence of Crohn's disease and ulcerative colitis in a commercially insured US population. Dig Dis Sci, 2013. 58(2): p. 519-25.7. Grivennikov, S.L, F.R. Greten, and M. Karin, Immunity, inflammation, and cancer. Cell, 2010. 140(6): p. 883-99.8. Rubin, D.C., A. Shaker, and M.S. Levin, Chronic intestinal inflammation: inflammatory bowel disease and colitis-associated colon cancer. Front Immunol, 2012. 3: p. 107.9. Herszenyi, L., et al., Colorectal Cancer in Patients with Inflammatory Bowel Disease: The True Impact of the Risk. Digestive Diseases, 2015. 33(1): p. 52-57.10. Eaden, J. A., K.R. Abrams, and J.F. Mayberry, The risk of colorectal cancer in ulcerative colitis: a meta-analysis. Gut, 2001. 48(4): p. 526-35.11. Hugot, J.P., et al., Mapping of a susceptibility locus for Crohn's disease on chromosome 16. Nature, 1996. 379(6568): p. 821-3.12. Rodriguez-Bores, L., et al., Novel genetic markers in inflammatory bowel disease. World J Gastroenterol, 2007. 13(42): p. 5560-70.13. I miel inski, M., et al., Common variants at five new loci associated with early-onset inflammatory bowel disease. Nat Genet, 2009. 41(12): p. 1335-40.14. Friedberg, I., et al., Identification and characterization ofDUSP27, a novel dualspecific protein phosphatase. FEBS Lett, 2007. 581(13): p. 2527-33.15. St-Denis, N., et al., Phenotypic and Interaction Profiling of the Human Phosphatases Identifies Diverse Mitotic Regulators. Cell Rep, 2016. 17(9): p. 2488-2501.16. Gammoh, N., et al., Interaction between FIP200 and ATG16L1 distinguishes ULK1 complex-dependent and -independent autophagy. Nat Struct Mol Biol, 2013. 20(2): p. 144-9.17. Nishimura, T., et al., FIP200 regulates targeting ofAtglBLl to the isolation membrane. EMBO Rep, 2013. 14(3): p. 284-91.18. Lassen, K.G. and RJ. Xavier, Genetic control of autophagy underlies pathogenesis of inflammatory bowel disease. Mucosal Immunol, 2017. 10(3): p. 589-597.19. Okayasu, L, et al., A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology, 1990. 98(3): p. 694-702.20. Neurath, M.F., Cytokines in inflammatory bowel disease. Nature Reviews Immunology, 2014. 14(5): p. 329-342.21. Silva, F.A., et al., The Immunological Basis of Inflammatory Bowel Disease. Gastroenterol Res Pract, 2016. 2016: p. 2097274.22. Backer, V., et al., Knockdown of myeloid cell hypoxia-inducible factor-lalpha ameliorates the acute pathology in DSS-induced colitis. PLoS One, 2017. 12(12): p. e0190074.23. Martinez, F.O. and S. Gordon, The Ml and M2 paradigm of macrophage activation: time for reassessment. FlOOOprime reports, 2014. 6: p. 13-13.24. Fox, J.G., et al., Helicobacter hepaticus infection in mice: models for understanding lower bowel inflammation and cancer. Mucosal Immunol, 2011. 4(1): p. 22-30.25. Kullberg, M.C., et al., Helicobacter hepaticus-induced colitis in interleukin-10-deficient mice: cytokine requirements for the induction and maintenance of intestinal inflammation. Infect Immun, 2001. 69(7): p. 4232-41.26. Irrazabal, T., et al., Limiting oxidative DNA damage reduces microbe-induced colitis- associated colorectal cancer. Nat Commun, 2020. 11(1): p. 1802.27. Forster, K., et al., An oral CD3-specific antibody suppresses T-cell-induced colitis and alters cytokine responses to T-cell activation in mice. Gastroenterology, 2012. 143(5): p. 1298-1307.28. Merger, M., et al., Defining the roles of perforin, Fas / FasL, and tumour necrosis factor alpha in T cell induced mucosal damage in the mouse intestine. Gut, 2002. 51(2): p. 155-63.29. Zanello, G., et al., The Cytosolic Microbial Receptor Nod2 Regulates Small Intestinal Crypt Damage and Epithelial Regeneration following T Cell-Induced Enteropathy. J Immunol, 2016. 197(1): p. 345-55.30. Aguilar, O.A., et al., Tetramer Immunization and Selection Followed by CELLISA Screening to Generate Monoclonal Antibodies against the Mouse Cytomegalovirus ml2 Immunoevasin. J Immunol, 2020. 205(6): p. 1709-1717.31. Yaffe, D. and O. Saxel, Serial passaging and differentiation of myogenic cells isolated from dystrophic mouse muscle. Nature, 1977. 270(5639): p. 725-7.32. Singh, S.S., et al., Dual role of autophagy in hallmarks of cancer. Oncogene, 2018. 37(9): p. 1142-1158.33. Levy, J., et al., Intestinal inhibition ofAtg7 prevents tumour initiation through a microbiome-influenced immune response and suppresses tumour growth. Nat Cell Biol, 2015. 17(8): p. 1062-73.34. Tonks, N.K., Protein tyrosine phosphatases: from genes, to function, to disease.Nature Reviews Molecular Cell Biology, 2006. 7(11): p. 833-846.35. Barr, A.J., Protein tyrosine phosphatases as drug targets: strategies and challenges of inhibitor development. Future Med Chem, 2010. 2(10): p. 1563-76.36. Hsu, P.D., et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nature Biotechnology, 2013. 31(9): p. 827-832.37. Guo, J., et al., Pharmacology and antitumor activity of a guinolinedione Cdc25 phosphatase inhibitor DA3003-1 (NSC 663284). Anticancer Res, 2007. 27(5A): p. 3067-73.38. Krawisz, J.E., P. Sharon, and W.F. Stenson, Quantitative assay for acute intestinal inflammation based on myeloperoxidase activity. Assessment of inflammation in rat and hamster models. Gastroenterology, 1984. 87(6): p. 1344-50.39. Hu, F.B., Globalization of diabetes: the role of diet, lifestyle, and genes. Diabetes care, 2011. 34(6): p. 1249-1257.40. Goodwin, PJ. and V. Stambolic, Impact of the obesity epidemic on cancer. Annual review of medicine, 2015. 66: p. 281-296.41. The Emerging Risk Factors, C., Diabetes mellitus, fasting blood glucose concentration, and risk of vascular disease: a collaborative meta-analysis of 102 prospective studies. The Lancet, 2010. 375(9733): p. 2215-2222.42. Hales, C.M., et al., Prevalence of Obesity Among Adults and Youth: United States, 2015-2016. NCHS Data Brief, 2017(288): p. 1-8.43. Froguel, P. and G. Velho, Genetic determinants of type 2 diabetes. Recent Prog Horm Res, 2001. 56: p. 91-105.44. Younes, R. and E. Bugianesi, Should we undertake surveillance for HCC in patients with NAFLD? J Hepatol, 2018. 68(2): p. 326-334.45. Calle, E.E., et al., Overweight, obesity, and mortality from cancer in a prospectively studied cohort of U.S. adults. N Engl J Med, 2003. 348(17): p. 1625-38.46. Mittal, S. and H.B. El-Serag, Epidemiology of hepatocellular carcinoma: consider the population. J Clin Gastroenterol, 2013. 47 Suppl: p. S2-6.47. Shaker, M., et al., Liver transplantation for nonalcoholic fatty liver disease: new challenges and new opportunities. World J Gastroenterol, 2014. 20(18): p. 5320-30.48. Anderson, E.J., et al., Mitochondrial H2O2 emission and cellular redox state link excess fat intake to insulin resistance in both rodents and humans. J Clin Invest, 2009. 119(3): p. 573-81.49. Bettaieb, A., et al., Hepatocyte Nicotinamide Adenine Dinucleotide Phosphate Reduced Oxidase 4 Regulates Stress Signaling, Fibrosis, and Insulin Sensitivity During Development of Steatohepatitis in Mice. Gastroenterology, 2015. 149(2): p. 468-80 elO.50. Satapati, S., et al., Mitochondrial metabolism mediates oxidative stress and inflammation in fatty liver. J Clin Invest, 2015. 125(12): p. 4447-62.51. Perry, R.J., et al., Controlled-release mitochondrial protonophore reverses diabetes and steatohepatitis in rats. Science, 2015. 347(6227): p. 1253-6.52. Tanaka, H., et al., Hepatic oxidative DNA damage is associated with increased risk for hepatocellular carcinoma in chronic hepatitis C. Br J Cancer, 2008. 98(3): p. 580-6.53. Gurzov, E.N., et al., Hepatic oxidative stress promotes insulin-STAT-5 signaling and obesity by inactivating protein tyrosine phosphatase N2. Cell Metab, 2014. 20(1): p. 85-102.54. Ganz, M. and G. Szabo, Immune and inflammatory pathways in NASH. Hepatol Int, 2013. 7 Suppl 2: p. 771-81.55. Bhattacharjee, J., et al., Role of immunodeficient animal models in the development of fructose induced NAFLD. J Nutr Biochem, 2014. 25(2): p. 219-26.56. Koren, S. and LG. Fantus, Inhibition of the protein tyrosine phosphatase PTP1B: potential therapy for obesity, insulin resistance and type-2 diabetes mellitus. Best Practice & Research Clinical Endocrinology & Metabolism, 2007. 21(4): p. 621-640.57. Zhang, Z.-Y. and S.-Y. Lee, PTP1B inhibitors as potential therapeutics in the treatment of type 2 diabetes and obesity. Expert opinion on investigational drugs, 2003. 12(2): p. 223-233.58. Besse-Patin, A. and J.L. Estall, An Intimate Relationship between ROS and Insulin Signalling: Implications for Antioxidant Treatment of Fatty Liver Disease. Int J Cell Biol, 2014. 2014: p. 519153.59. Geng, T., et al., H19 IncRNA Promotes Skeletal Muscle Insulin Sensitivity in Part by Targeting AMPK. Diabetes, 2018. 67(11): p. 2183-2198.60. Johansson, A., et al., Linkage and genome-wide association analysis of obesity- related phenotypes: association of weight with the MGAT1 gene. Obesity (Silver Spring), 2010. 18(4): p. 803-8.61. Heydemann, A., An Overview of Murine High Fat Diet as a Model for Type 2 Diabetes Mellitus. J Diabetes Res, 2016. 2016: p. 2902351.62. Christ, A., M. Lauterbach, and E. Latz, Western Diet and the Immune System: An Inflammatory Connection. Immunity, 2019. 51(5): p. 794-811.63. Kautzky-Willer, A., J. Harreiter, and G. Pacini, Sex and Gender Differences in Risk, Pathophysiology and Complications of Type 2 Diabetes Mellitus. Endocr Rev, 2016. 37(3): p. 278-316.64. T ramunt, B., et al., Sex differences in metabolic regulation and diabetes susceptibility. Diabetologia, 2020. 63(3): p. 453-461.65. Macotela, Y., et al., Sex and depot differences in adipocyte insulin sensitivity and glucose metabolism. Diabetes, 2009. 58(4): p. 803-12.66. Millstein, R.J., et al., Sex-specific differences in insulin resistance in type 1 diabetes: The CACTI cohort. J Diabetes Complications, 2018. 32(4): p. 418-423.67. Ghazarian, M., et al., Type I Interferon Responses Drive Intrahepatic T cells to Promote Metabolic Syndrome. Sci Immunol, 2017. 2(10).68. Winer, S., et al., Normalization of obesity-associated insulin resistance through immunotherapy. Nat Med, 2009. 15(8): p. 921-9.69. Shi, S.Y., et al., DJ-1 links muscle ROS production with metabolic reprogramming and systemic energy homeostasis in mice. Nat Commun, 2015. 6: p. 7415.70. Wang, K., et al., Comparative genetic analysis of inflammatory bowel disease and type 1 diabetes implicates multiple loci with opposite effects. Hum Mol Genet, 2010. 19(10): p. 2059-67.71. Maconi, G., et al., Glucose intolerance and diabetes mellitus in ulcerative colitis: pathogenetic and therapeutic implications. World J Gastroenterol, 2014. 20(13): p. 3507-15.72. Hailing, M.L., et al., Patients with inflammatory bowel disease have increased risk of autoimmune and inflammatory diseases. World J Gastroenterol, 2017. 23(33): p. 6137-6146.73. Kappelman, M.D., et al., Association of paediatric inflammatory bowel disease with other immune-mediated diseases. Arch Dis Child, 2011. 96(11): p. 1042-6.74. Abrahami, D., et al., Dipeptidyl peptidase-4 inhibitors and incidence of inflammatory bowel disease among patients with type 2 diabetes: population based cohort study. BMJ, 2018. 360: p. k872.75. Zietek, T. and E. Rath, Inflammation Meets Metabolic Disease: Gut Feeling Mediated by GLP-1. Front Immunol, 2016. 7: p. 154.76. Harper, J.W. and T.L. Zisman, Interaction of obesity and inflammatory bowel disease. World J Gastroenterol, 2016. 22(35): p. 7868-81.77. Thaiss, C.A., et al., Hyperglycemia drives intestinal barrier dysfunction and risk for enteric infection. Science, 2018. 359(6382): p. 1376-1383.78. Chao, C.Y., et al., Co-existence of non-alcoholic fatty liver disease and inflammatory bowel disease: A review article. World J Gastroenterol, 2016. 22(34): p. 7727-34.79. Winer, D.A., et al., The Intestinal Immune System in Obesity and Insulin Resistance. Cell Metab, 2016. 23(3): p. 413-26.80. Tilg, H., et al., The intestinal microbiota fuelling metabolic inflammation. Nat Rev Immunol, 2020. 20(1): p. 40-54.81. Michalak, A., P. Mosinska, and J. Fichna, Common links between metabolic syndrome and inflammatory bowel disease: Current overview and future perspectives. Pharmacol Rep, 2016. 68(4): p. 837-46.82. Kim, M.J., et al., Distinct roles of UVRAG and EGFR signaling in skeletal muscle homeostasis. Mol Metab, 2021. 47: p. 101185.83. Wei, H., et al., Suppression of autophagy by FIP200 deletion inhibits mammary tumorigenesis. Genes Dev, 2011. 25(14): p. 1510-27.84. Li, C., et al., Early-life programming of mesenteric lymph node stromal cell identity by the lymphotoxin pathway regulates adult mucosal immunity. Sci Immunol, 2019. 4(42).85. Desai, H.R., et al., Macrophage JAK2 deficiency protects against high-fat diet-induced inflammation. Sci Rep, 2017. 7(1): p. 7653.86. Wang, L., et al., Pten deletion in RIP-Cre neurons protects against type 2 diabetes by activating the anti-inflammatory reflex. Nat Med, 2014. 20(5): p. 484-92.
[0192] All publications, patents and patent applications mentioned in this Specification are indicative of the level of skill of those skilled in the art to which this invention pertains and are herein incorporated by reference to the same extent as if each individual publication, patent, or patent applications was specifically and individually indicated to be incorporated by reference.
[0193] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.
Claims
WE CLAIM:
1. A method of treating or preventing inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis), colitis-associated colon cancer, a metabolic disorder (e.g., obesity or an obesity-associated metabolic disorder) or a DUPD-l-mediated inflammatory disorder, or for glucose regulation in a subject, comprising inhibiting or reducing DUPD1 activity in the subject.
2. The method according to claim 1, wherein the reducing DUPD1 activity comprises reducing or abolishing expression of DUPD1 in the subject.
3. The method according to claim 1, wherein the inhibiting of DUPD1 activity comprises administering an inhibitor of DUPD1 to the subject.
4. The method according to claim 3, wherein the inhibitor is a non-specific inhibitor of protein phosphatases.
5. The method according to claim 4, wherein the inhibitor is PTP Inhibitor IV, SHP1 / 2 PTPase Inhibitor (NSC-87877), NSC-95397, NSC-663284 or the like.
6. The method according to claim 4 or 5, wherein the inhibitor is an inhibitor of dual specificity phosphatases.
7. The method according to claim 6, wherein the inhibitor is NSC-663284.
8. The method according to any one of claims 1 - 7, for treating or preventing inflammatory bowel disease (e.g., colitis) or colitis-associated colon cancer in the subject.
9. The method according to any one of claims 1 - 7, for treating or preventing a metabolic disorder in the subject, wherein the metabolic disorder is obesity or an obesity-associated metabolic disorder, such as non-alcoholic fatty liver disease or non-alcoholic steatohepatitis.
10. The method according to claim 9, wherein the subject is female.
11. A pharmaceutical composition comprising an inhibitor of DUPD1 and a pharmaceutically acceptable diluent, excipient, carrier, or combination thereof.
12. The pharmaceutical composition according to claim 11, for treatment and / or prevention of inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis), colitis-associated colon cancer, or a metabolic disorder in a subject.
13. The pharmaceutical composition according to claim 11, for glucose regulation in a subject.
14. A method for identifying a compound capable of a therapeutic treatment, wherein the therapeutic treatment is: (i) treating and\or preventing inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis) and / or colitis-associated colon cancer, (ii) treating and\or preventing metabolic syndromes, and / or (iii) regulating glucose in a subject, which method comprises:(a) providing a test compound; and(b) comparing under comparable reaction conditions the activity of the polypeptide, which polypeptide is DUPD1 or a variant or active portion thereof, in the presence and absence of the test compound, wherein the compound is capable of the therapeutic treatment if the comparison in step (b) shows that the activity of the polypeptide is reduced in the presence of the test compound in comparison to its absence.
15. The method of claim 14, further comprising comparing the activity of the polypeptide in the presence of the test compound with a control value obtained using a known inhibitor of DUPD1.
16. The method of claim 14 or 15, wherein the activity of the polypeptide is obtained using a labelled substrate for the polypeptide.
17. The method of claim 16, wherein the labelled substrate comprises a spectrophotometrically detectable label, and is 6,8-difluoro-4-methylumbelliferyl phosphate, p-nitrophenyl phosphate (pNPP), or the like.
18. The method of any one of claims 14 to 17, further comprising formulating the test compound as a pharmaceutical composition for (i) treating and\or preventing inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis) and / or colitis-associated colon cancer, (ii) treating and\or preventing metabolic syndromes,and / or (iii) regulating glucose, if, in step (b), the activity of the polypeptide is found to decreased in the presence of the test compound in comparison to the activity of the polypeptide in the absence of the test compound.
19. A pharmaceutical composition prepared by the method of claim 18.