Test system comprising stably cyp-transfected or transduced mammalian cells

EP4658767A1Pending Publication Date: 2025-12-10BRANDENBURGISCHE TECHN UNIV COTTBUS SENFTENBERG +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024704324
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-01-31
Filing Date
2024-01-31
Publication Date
2025-12-10

AI Technical Summary

Technical Problem

Current test systems for drug metabolism, particularly those using recombinant expression systems, face challenges due to non-specific CYP background activities and limitations in scalability and therapeutic use, as they are not mammal-based and have variable endogenous CYP activity, making it difficult to accurately identify and characterize CYP-specific metabolic reactions.

Method used

A mammalian cell or cell line with stably integrated polynucleotides encoding cytochrome P450 and NADPH-cytochrome P450 oxidoreductase, grown as a suspension culture to provide high yields of microsomal fractions with minimal endogenous CYP background activity, allowing for specific detection and characterization of CYP-specific metabolites.

Benefits of technology

This approach enables sensitive detection of CYP-specific enzyme activity and metabolite formation, facilitating the identification of responsible CYP enzymes in drug metabolism, and allows for long-term studies simulating human liver biotransformation processes, thereby aiding in the development and toxicity assessment of drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2024052305_08082024_PF_FP
    Figure EP2024052305_08082024_PF_FP
Patent Text Reader

Abstract

The present invention relates to a mammalian cell or cell line, preferably CHO cell, containing, after transformation, polynucleotides that are stably integrated into the genome and encode at least one P450 cytochrome (CYP) and NADPH-P450 cytochrome (CPR, POR), the use thereof and a test system obtainable therefrom, preferably by providing microsome (fractions) or suspension cells.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Test system comprising stable CYP-transfected or transduced mammalian cells

[0002] Description

[0003] The invention relates to a mammalian cell or cell line, preferably CHO cell, containing, after transfection or transduction, polynucleotides coding for at least one cytochrome P450 (CYP) and NADPH-cytochrome P450 oxidoreductase (CPR, POR) stably integrated into the genome, the use thereof and a test system obtainable therefrom, preferably by providing microsome (fractions) or suspension cells.

[0004] The liver is a central detoxification organ of metabolism. Liver cells (hepatocytes) represent 70-80% of all cells in the liver and perform important physiological liver functions (Elaut et al. (2006)).

[0005] The liver uses biotransformation or metabolism to excrete or detoxify ingested substances (e.g., medications, toxins, natural products). The phase I enzymes of the cytochrome P450 (CYP450) system are particularly important for biotransformation. CYP450 enzymes are oxidoreductases that cause the oxidative breakdown or metabolism of numerous substances, including pharmaceuticals. Of the numerous CYP450 isoenzymes with varying substrate specificity that exist in humans, the isoenzymes CYP1A2, 2C9, 2C19, 2D6, 2E1, and 3A4 alone are responsible for approximately 90% of all oxidative metabolism of medications. In many cases, a large number of drugs only acquire their curative efficacy through these biochemical changes or even cause toxic metabolites with undesirable drug effects.The metabolism of foreign substances predominantly takes place via biotransformation mechanisms involving corresponding enzyme and transport systems in the liver. Metabolism reactions of active / foreign substances in phase 1 biotransformation, which are the subject of the described invention, are predominantly carried out by enzymes of the cytochrome P450 family (CYPs), which are located in the endoplasmic reticulum (ER). All metabolism reactions catalyzed by CYPs depend on NADPH cytochrome P450 oxidoreductase (CPR, POR), which is also located in the ER and acts as an essential cofactor to transfer the required electrons sequentially from NADPH to CYPs.

[0006] Elucidating which CYPs are involved in the metabolism of an active substance, which metabolites are formed by the respective CYP, and how these are further metabolized by other CYP-dependent reactions is always one of the initial steps in the development of new drugs. For the precise elucidation of metabolites and their provision in sufficient quantities for further analysis, ADME (absorption, distribution, metabolism, excretion) test systems are particularly required, as they provide reliable information on CYP-specific metabolic reactions. Due to the complexity of these processes, the identification of the CYPs involved, and thus the prediction of metabolic processes and interactions in the human liver, is sometimes difficult.

[0007] Current technology in toxicological in vitro drug studies primarily uses human test systems such as cell cultures of primary cells and cancer cell lines with various modifications in order to simulate processes in the human liver as closely as possible to the patient. Subcellular isolates of the ER, so-called microsomes, are also important for phase I studies, as most CYPs (including the cofactor CPR, POR) are localized in this cellular compartment. A major disadvantage of these systems with regard to the identification and characterization of specific CYP metabolizations is the lack of specificity, since in liver cells the physiological CYP population, consisting of several different CYPs, is expressed and active.Furthermore, the activity of some relevant CYPs towards potential drug candidates may be too low, so that metabolites formed by them cannot be detected, let alone sufficient quantities can be produced for further studies.

[0008] Microsomes from recombinant expression systems are currently predominantly used in ADME studies to elucidate the CYPs involved in drug metabolism. Established models include recombinant microsomes with human CYPs (including cofactors) from baculovirus-infected insect cells (so-called "Supersomes" or "BACULOSOMES" - BD Biosciences, Corning, ThermoFisher, Merck), from E. coli-based expression systems (so-called Cypex Bactosomes, "Classic Bactosomes" and "EasyCYPs" - Sekisui XenoTech), and dried preparations of the yeast Pichia pastoris (so-called "CypExpress" from Oxford Biomedical Research or "EZCyp" from BioVision). In addition, preparations of the recombinant expression of microbial CYPs from actinomycetes in E . coli are also commercially marketed (so-called PolyCYPs - Hypha Discovery).In particular, the insect model based on baculovirus infection is characterized by a high enzyme activity that depends on the respective CYP expressed and can be regarded as the current gold standard. All of the expression systems described have in common that the cell models used for the expression of human enzymes are not mammalian-based, and thus relevant differences between the recombinantly expressed CYPs and human enzymes and their function cannot be ruled out. Furthermore, it has not been definitively clarified from the relevant literature whether the cell models used for recombinant CYP expression display non-specific background (CYP) activities at the cellular and microsomal level that are relevant for the metabolism of an active substance. One example here is the insect cell model, for which scientific opinion is divided. Brandon et al.point out in a review published in 2003 that insect cells do not exhibit endogenous CYP activity. In contrast, Nauen et al. describe the presence of endogenous background CYP activity in the baculovirus insect cell expression system in a review article published in 2021. Sf 9 cells, in particular, exhibit basal detoxification activity for some substance classes. This is said to be the case in the High Five insect cell line (ovary cells of the cabbage grasshopper).

[0009] Cell line: BTI-TN-5B1-4) can be significantly lower. This shows either a non-specific CYP background activity of the control supersomes (EDA study NL0060848 from 2005 on the metabolism of asenapine) or significant differences in the conversion kinetics of active substances when comparing insect cell-based CYP3A4 microsomes (CYP3A4 supersomes) with microsomes produced from human liver epithelial cells (with recombinant CYP3A4 expression) (Christensen et al.

[0010] 2009 ) . Furthermore, the established insect cell models offer only limited possibilities for long-term cultures at the cellular level due to the lytic culture system after baculovirus infection.

[0011] Recombinant expression systems of human CYPs using mammalian cell models have been described, for example studies with heterologous expression of human CYPs (including co-factors) in human HEK293FT kidney epithelial cells (Kumondai et al. 2020) as well as in lung (V79 cells: Jacob et al. 1996; Krebsfänger et al. 2003; Scheuenpflug et al. 2005) and Chinese hamster ovary cells (CHO-DUKX-Bll cell line: Ding et al. 1997 & 2001, Deeni et al. 2013 and a trade fair poster CXR Biosciences, Deeni 2009). In none of the described mammalian models were the human CYP genes and cofactors specifically integrated into the genome, so that, for example, after transfection or infection with modified adenoviruses, they are present in the nucleus as an episomal recombinant viral genome. Furthermore, the mammalian cell lines modified with human CYPs are adherent and serum-dependent cell culture models.Both factors limit the possibilities for upscaling and pharmaceutical / therapeutic use of metabolites.

[0012] There is therefore a great need for a test system with no or very low endogenous CYP background for testing substances, especially xenobiotics, drug candidates and medicinal products as test substances, in particular the interaction of a test substance with at least one CYP.

[0013] Therefore, the following objects of the invention exist, in particular in the provision of a suitable test system which a.) provides cytochrome P450 (CYP) and NADPH cytochrome P450 oxidoreductase (CPR, POR) in sufficient quantity and quality in overexpression, and b.) has as little or no endogenous CYP background activity as possible in an expression system.

[0014] The problems are essentially solved by at least one patent claim.

[0015] Therefore, the invention relates to a mammalian cell or a cell line obtainable therefrom containing, after transfection or transduction, polynucleotides coding for at least one cytochrome P450 and NADPH-cytochrome P450 oxidoreductase which are stably integrated into the genome, wherein the polynucleotides are preferably introduced into the mammalian cell with at least one expression vector.

[0016] In a preferred embodiment of the invention, the test system comprises mammalian cell lines with at least one cytochrome P450 and NADPH-cytochrome P450 oxidoreductase, which are grown as a suspension culture in high cell density of on average 5 xl 0 6 Cells / mL at >80% viability are provided. The methods for measuring cell counts and viability are known to the person skilled in the art. Microsomal fractions are obtained from the mammalian cells according to the invention using methods known to the person skilled in the art, which, based on Ixl O 7Starting lines advantageously have a protein yield of at least 100 pg (protein amount or .

[0017] enzyme quantity) and more, in particular at least 200 pg (protein quantity or enzyme quantity) or at least 300 pg (protein quantity or enzyme quantity). Due to the high protein yield, a very well measurable conversion of CYP enzyme activity or the formed metabolites is possible. For example, a conversion with the substance phenacetin in a mammalian cell with CYP1A2 and CPR shows a phenacetin

[0018] Metabolite production of 17 pg after 2 h and 101 pg after 48 h.

[0019] The sensitivity limit of the test system according to the invention for CYP-specific enzyme activity when reacted with microsomes from mammalian cells according to the invention containing at least one cytochrome P450 and NADPH-cytochrome P450 oxidoreductase is a maximum of 1-10 pg of microsomal protein in a 50 pL reaction and 10 min reaction time using a P450 Glo assay. This assay, known to those skilled in the art (e.g., P450 Gio Assays from Promega), provides a substrate specific for the respective CYP, and the CYP enzyme activity can be detected using a luminescence reaction. The detection of a metabolite formed via CYP (e.g., a metabolite of a drug) can be carried out, for example, using the HPLC analytical method known to those skilled in the art. The sensitivity limit for the formation of such a metabolite in the test system according to the invention is preferably 30-300 pg total microsomal protein in a 200 pL test reaction and 30 min reaction time.

[0020] It is further preferred that the mammalian cell is not a liver cell or non-hepatic cell and is selected from the group of HEK293 cells, CHO cells, HeLa cells, BHK cells, L929 cells or respective cell lines as well as mammalian cell lines of the ZKBS list that do not originate from hepatocytes (Cell line list of the Central Commission for Biological Safety: https: / / zag.bvl.bund.de / zelllinien / index.jsf;jsessionid=af9u6C dFQWhIMTatr j eI47SX_vzdBRAe8bzcchSe.subs208?dswid=l187&dsrid=42

[0021] According to the invention, CHO (Chinese hamster ovary cells) cells and cell lines obtainable therefrom are particularly preferred, since they advantageously exhibit little or no endogenous CYP background activity, and consequently, the at least one cytochrome P450 (CYP) introduced by stable transfection or transduction is present without any relevant background activity of endogenous CYPs. The enzyme activity is advantageously enhanced by the further introduced CPR.

[0022] A low or non-existent background activity of endogenous CYPs is present if, using the HPLC method for detection of formed metabolites, this is below the detection limit and / or is at most 1 - 5%, preferably 1% of the specific activity in pmol / mg / min for at least one introduced cytochrome P450 and NADPH-cytochrome P450 oxidoreductase.

[0023] The background activity of endogenous CYPs in the parent mammalian cells can be determined prior to stable introduction of the CYP / CPR complex into the mammalian cell according to the invention. The parent mammalian cells can serve as a negative control.

[0024] It is further preferred that mammalian cells or the corresponding cell line are obtained as suspension cells or as microsomes.

[0025] The term "microsome" also encompasses microsome fractions and can be obtained by processing the provided mammalian cell or the corresponding cell line. Microsome and microsome fraction are therefore synonymous.

[0026] Within the scope of this invention, the polynucleotides for cytochrome P450 and NADPH-cytochrome P450 oxidoreductase can be taken from the usual databases. For example, gene sequences can be taken from databases of the National Center for Biotechnology (NCBI) and the National Library of Medicine (NLM). Human cytochrome P450 and NADPH-cytochrome P450 oxidoreductase polynucleotide sequences are particularly preferred. The aforementioned databases contain, for example, cDNA sequences for CPR (NM_000941.2), CYP1A2 (BC067428.1), CYP2B6 (BC067430.1), or CYP3A4 (NM_017460.6), but also for the other CYPs relevant for biotransformation, which can be introduced into an expression vector.

[0027] Table 1: mRNA IDs and primer sequences of human target genes

[0028] Gene mRNA ID primer sequences

[0029] Target genes fw AAGGGCGGTGCCCACATCTAC

[0030] CPR NM_000941.2 rev TAGCGGCCCTTGGTCATCAG fw CTGGAGACCTTCCGACACTC

[0031] CYP1A2 BC067428.1 rev AGGGCTTGTTAATGGCAGTG fw CTCTCCATGACCCACACTAC

[0032] CYP2B6 BC067430.1 rev TGTTGGGGGTATTTTGCCCA fw GTGGGGCTTTTATGATGGTCA

[0033] CYP3A4 NM 017460.6 rev GCCTCAGATTTCTCACCAACACA

[0034] Within the scope of this invention, cytochrome P450 or CYPs can be used which are expressed in primary human liver cells and other cells, are relevant for the biotransformation of drugs and xenobiotics or will become relevant in the future, and are selected from the group CYP1A1, CYP1A2, CYP1B1, CYP2A6, CYP2A7, CYP2A13, CYP2B6, CYP2C8, CYP2C9, CYP2C18, CYP2C19, CYP2D6, CYP2E1, CYP2F1, CYP2J2, CYP2R1, CYP2S1, CYP2U1, CYP2W1, CYP3A4, CYP3A5, CYP3A7, CYP3A43, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, C YP4F12, CYP4F22, CYP4V2, CYP4X1, CYP4Z2, CYP5A1, CYP7A1, CYP7B 1, CYP8A1, CYP8B1, CYP11A1, CYP11B1, CYP11B2, CYP17A1, CYP19A1 , CYP20A1, CYP21A1, CYP21A2, CYP24A1, CYP26A1, CYP26B1, CYP26C 1, CYP27A1, CYP27B1, CYP27C1, CYP39A1, CYP46A1, CYP51A1.

[0035] The above-mentioned mammalian cells, cell lines, suspension cells or microsomes according to the invention can be mixed with at least one test substance, and the metabolites can be identified and characterized.

[0036] Therefore, the test system serves to detect metabolites, particularly based on the specific CYP-test substance interaction. Enzymatic conversion of the test substance with one or more CYP450 enzymes, which have been stably introduced via transfection or transduction, occurs, allowing specific metabolites to be obtained. The use of a test system with microsomes is particularly preferred.

[0037] A further advantage of the test system according to the invention is that, due to the low or completely lacking background enzyme activity of endogenous CYP450 enzymes, the test system is suitable for identifying or characterizing the responsibility or function of the CYP450 enzyme(s) that have been stably introduced via transfection or transduction for the metabolic conversion of chemical substances, xenobiotics or drugs.

[0038] Therefore, the invention relates to a test system for detecting an interaction of at least one test substance with at least one CYP450 enzyme.

[0039] The invention therefore relates to a test system for detecting the CYP450 enzyme(s) responsible for the biotransformation of at least one test substance, wherein an enzymatic conversion of at least one test substance with one or more CYP450 enzymes takes place.

[0040] A further advantage of the test system according to the invention is that the inhibition or activation of the CYP450 enzyme(s) that were stably introduced via transfection or transduction can be investigated by at least one test substance without a background of endogenous CYP450 enzymes. This advantageously allows drug interactions with regard to metabolic conversion by a specific CYP450 enzyme and activation or inhibition of another CYP450 enzyme to be investigated.

[0041] The test system is particularly suitable for in vitro ADME testing (see above). ADME describes the processes the body exerts on the active substances contained in a drug after administration, particularly with regard to toxicology.

[0042] Therefore, the invention also relates to a method for carrying out the above-mentioned test systems according to the invention or to the use of such a test system according to the invention for carrying out a method, in particular wherein an enzymatic conversion of at least one test substance takes place with one or more CYP450 enzymes which have been stably introduced via transfection or transduction.

[0043] Therefore, the invention also relates to a screening method for detecting a test substance, wherein an enzymatic conversion of at least one test substance with one or more CYP450 enzymes, which were stably introduced via transfection or transduction, takes place. The test system according to the invention can be used particularly advantageously for long-term studies, since it achieves an almost complete simulation of the human liver with regard to biotransformation. Based on the identified metabolites, for example, side effects of a drug can be determined by producing the formed metabolite in a suitable amount and testing it toxicologically on target cells or organs.

[0044] The test substance contains at least one chemical substance, a mixture of substances, in particular at least one medicinal or active ingredient or a xenobiotic. The chemical substances are preferably an organic molecule which, in addition to carbon (C) and hydrogen (H), may contain heteroatoms, such as oxygen (O), nitrogen (N), sulfur (S) or phosphorus (P). The chemical substances may have linear and / or cyclic carbon chains including heteroatoms. Preference is given to organic molecules with less than 1,500 g / mol, in particular less than 750 g / mol, less than 500 g / mol, less than 250 g / mol. Furthermore, it is preferred that at least one chemical substance contains at least one chiral carbon atom.

[0045] The substances obtained from the test substances or metabolites obtained in the presence of one or more enzymes can be adequately analyzed, for example, by means of combined analytical methods such as GC / LC-MS, IR, NMR, and in particular can be routinely subjected to structural elucidation.

[0046] An "enzyme" within the meaning of this invention is a protein, namely at least one selected cytochrome P450 (CYP) or a complex of cytochrome P450 (CYP) and NADPH-cytochrome P450 oxidoreductase (CPR, POR), which can catalyze one or more biochemical reactions. An enzyme according to the invention is capable of obtaining a first (enzyme) product or products, namely metabolites, from a test substance (substrate). In particular, a metabolite profile can be created.

[0047] The "specific activity" of an enzyme, for the purposes of this invention, is the amount of a substrate metabolite formed by an enzyme (in pmol) per protein used (mg) in a specific time (minute). In the case of cells or microsomes, if no specific purified protein is available, the total protein is used as the reference value.

[0048] The invention also encompasses transgenic mammalian cells produced using viral vectors (e.g., lentiviruses, e.g., DE 69830663 T2). The production of such mammalian cells is known to the person skilled in the art.

[0049] Preferred suitable promoters for expression vectors are, but are not limited to, EF-1, SV-40, CMV, RSV, GAG, and many more, also conditionable, i.e. inducible promoters such as TET on, - off, cumate-inducible promoter, dexamethasone-inducible promoter, ecdysone-inducible promoter, T7 RNA polymerase inducible promoter, light-dependent promoters or stress-inducible promoters (e.g. temperature) as well as with the help of the use of auxiliary sequences such as IRES (internal ribosome entry site), sequences for antibody detection and protein purification such as V5-tag, Flag-tag, c-myc tag, His-tag, GST-tag, Strep-tag, GFP, LacZ, luciferase, etc., sequences for protein cleavage of such tags as picornavirus 2A protease, sequences for thrombin-mediated cleavage Such promoters and auxiliary sequences are known to the person skilled in the art.

[0050] Exemplary expression vectors are shown in Figure 8. The test system can comprise a conventional medium, culture medium, or culture fluid, and in particular can contain additional cofactors. Suitable cell cultures and culture media are known to those skilled in the art and are commercially available. Preferably, a cell suspension can be provided according to the invention.

[0051] The test system can be fixed in vitro on a solid support. It can also be referred to as an assay.

[0052] The following examples and figures serve to explain the invention in more detail, without, however, limiting the invention to these examples and figures.

[0053] Examples and figures:

[0054] Example 1 :

[0055] Generation of mono-CYP CHO cell lines

[0056] The generation of mono-CYP CHO cell lines was carried out in a two-step modification process. Initially, the CHO-Kl parental cell line (serum-free suspension culture) was stably genetically modified by lentiviral gene transfer with the human cDNA for NADPH cytochrome P450 oxidoreductase (CPR, POR) under the control of a CMV promoter. CPR represents an essential cofactor for CYP enzyme activity, as it exclusively enables the sequential electron transport from NADPH to CYP enzymes. The increased expression and activity of human CPR in selected CHO-CPR clones was characterized, and the most suitable clone 12 was selected for further genetic modification with human CYP enzymes (Figure 1). In the second step of the modification process, the most suitable CHO-CPR clone 12 was again equipped with the human CYP cDNA of CYP1A2, CYP2B6, CYP3A4, CYP2D6 or CYP2C19 by lentiviral gene transfer.These cDNAs are regulated by a CMV promoter, similar to CPR. To enable comparative experiments on the CPR dependence of various CYPs, the CHO-K1 parental cell line without increased CPR activity was also equipped with the respective CYP cDNAs. The subsequent characterization and selection of the best-performing cell clones showed the expected specific CYP expression compared to the parental cell lines CHO-K1 and CHO-CPR (Figure 2). Only for CYP2B6 and CYP2D6 was a weak protein band also detected in the parental cell lines.

[0057] Example 2 :

[0058] Specific CYP activity of mono-CYP CHO cell clones in cellular suspension culture mode 11

[0059] Commercial CYP activity assays (Glo-Assays - Promega)

[0060] Initial enzyme activity studies with the selected mono-CYP CHO cell lines (with and without artificial human CPR) using commercial kits indicated specific mono-CYP activity in all CHO-CYP clones. No background activity was detected for any of the CYPs tested in the parental cell lines CHO-K1 and CHO-CPR clone 12 (Figure 3).

[0061] Example 3 :

[0062] Conversion studies with prototypical substances Metabolism studies to demonstrate CYP-specific conversion of prototypical substances have so far been conducted using the mono-CYP CHO cell clones CHO-CPR / CYP1A2 K9 (phenacetin) and CHO-CPR / CYP3A4 K1 (testosterone) in comparison with the parental cell lines on a laboratory scale (suspension cultures up to 10 mL) over a maximum period of 48 hours. The cells were pretreated according to the currently optimized culture model, and metabolism was carried out in cell culture medium. The results of the corresponding supernatant analysis using HPLC are shown in Figure 4. Based on the normalization to measured standards of the respective main metabolite, yields achieved in the suspension cultures after 48 h of reaction time could be extrapolated on a pg scale (CYP1A2 : mAcetamnophen = 101 ± 4 pg; CYP3A4 : m6ß-oH- = 17.3 ± 1.4 pg).At the same time, initial detailed insights into enzyme kinetics were obtained, which will be incorporated into further optimizations of the cell culture model and the implementation protocol.

[0063] Example 4 a :

[0064] Specific Mono-CYP Enzyme Activity in Mono-CYP CHO Microsomes Commercial Glo Assays (Promega)

[0065] Enzyme activity studies were performed to optimize cell pretreatment with co-factors and the microsome isolation protocol ( Figure 5 ).

[0066] Example 4 b :

[0067] Implementation studies with prototype substances

[0068] The microsomes of the

[0069] Mono-CYP CHO clones (CHO-CPR / CYP1A2 K9, CHO-CPR / CYP3A4 K1 and

[0070] CHO-CPR / CYP2D6 (Cl, C9 & C18) were also used for the metabolism of the prototypical substances phenacetin (CYP1A2), testosterone (CYP3A4), and luciferin-ME EGE (CYP2D6) to gain insights into enzyme activity and yields of the main metabolites formed (Figure 6). The yields determined using standards of the main metabolites of phenacetin and testosterone in the 200 pL metabolism mixtures were in the range of 100-200 ng and were partly of a comparable order of magnitude to HLM.

[0071] The direct comparison of mono-CYP CHO microsomes for CYP1A2, CYP3A4, and CYP2D6 with microsomes from the parental cell lines CHO-K1 and / or CHO-CPR K12 showed no detectable CYP-based background conversion in the parental microsomes based on conversion studies with prototypical substrates ( Figure 7 ). The yields of the main metabolites of phenacetin (acetaminophen) and testosterone (6ß-hydroxytestosterone) in the mono-CYP microsomes in the 200 pL preparations were, as before, in the range of up to 100 ng.

[0072] Example 5 :

[0073] Example of a demonstration of the involvement of a specific CYP450 enzyme in the metabolism of a test substance or active ingredient (CYP screening using the example of bupropion metabolism)

[0074] In order to determine whether a test substance, e.g. bupropion (BUP), is metabolized via a specific CYP450 enzyme, conversion studies are carried out using isolated microsomes from CHO clones with recombinant CPR and different recombinant CYP activities (e.g. CYP3A4, CYP1A2, CYP2B6). Bupropion is a norepinephrine and dopamine reuptake inhibitor that is used to treat depression, seasonal affective disorders, and smoking cessation. The use of microsomes in this test system has the advantage that primary and secondary metabolisms apart from the CYP-dependent phase 1 biotransformation are avoided, since the corresponding phase 2 biotransformation enzymes are absent in this predominantly ER-based cell fraction. After the conversion reaction, the aqueous supernatant of each CYP450 sample is analyzed using appropriate analytics (HPLC, LC-MS, etc.).The decreasing amount of the test substance during metabolism by a specific CYP enzyme and the formation of metabolites are detected and their identity is clarified, if necessary, by mass spectrometric methods.

[0075] According to the standardized protocol, 30 pg of microsomes with specific CYP450 activity (total protein amount) are incubated together with an NADPH regeneration system (consisting of NADP+, glucose-6-phosphate and the enzyme glucose-6-phosphate dehydrogenase) and the test substance (final concentration of 0.5 mM) in a 200 pL mixture for 60 min at 37 °C. After the conversion reaction, the samples are mixed with ice-cold acetonitrile in a ratio of 1:1, shaken and the contained proteins are precipitated from the solution by centrifugation (15 min, 16,000 xg). This step stops further metabolism and removes proteinogenic components from the sample that could interfere with HPLC analysis.

[0076] The quantification of the test substance remaining in a sample and the creation of metabolite profiles are carried out by subsequent HPLC analysis, initially with DAD detection. The HPLC setup consists of a modular (U) HPLC system from the Nexera series (LC-40, SHIMADZU, Kyoto, Japan) with a ZORBAX SB-C18 column (Agilent Technologies, Santa Clara, CA, US), which is equilibrated to 25 °C. To detect the remaining test substance BUP and possible metabolites, 20 pL of sample are separated isocratically in the mobile phase consisting of 45% methanol and 55% KH2PO4 buffer (50 mM, pH 5.5) at a flow rate of 0.8 mL / min for 25 minutes. Bupropion (BUP) and the most prominent CYP450-derived metabolite hydroxybupropion (HBUP) are detected by their elution time at 254 and 214 nm, respectively.In this example, the detected substances are quantified using standard solutions of commercially available references in the range of 0.1-1 mM for BUP and 1-75 pM for HBUP. To prepare the stock solutions, BUP and HBUP are dissolved in methanol. If unknown signals (peaks) occur in the chromatogram of the respective CYP450 microsomes, which would indicate the formation of additional metabolites, the samples are measured again using LC-MS, and the chemical identity of unknown signals is elucidated based on their fragmentation pattern in correlation with theoretical predictions of the fragmentation of chemically possible metabolites.

[0077] In the case of the test substance bupropion, a reduction in the original amount of the substance in the sample and the formation of HBUP are detectable exclusively in microsomes with specific CYP2B6 activity. Microsomes with specific CYP1A2 or CYP3A4 activity show neither a reduction in the original amount of bupropion nor the formation of metabolites of this test substance.

[0078] Example 6 :

[0079] Example example for the detection of active ingredient interactions with the CYP450 enzyme system. The example given describes the detection of a drug interaction through inhibition of CYP3A4 enzyme activity using ketoconazole. Ketoconazole is a drug which is used, among other things, to treat or prevent fungal infections such as blastomycosis, candidiasis, coccidioidomycosis, histoplasmosis, chromomycosis and paracoccidioidomycosis. One of the interactions of this drug is that it is a strong inhibitor of CYP3A4 enzyme activity. In the human organism, this can result in the biotransformation of drugs primarily metabolized by CYP3A4 being inhibited, which leads to an increased and / or prolonged effect of these drugs. Conversely, prodrugs activated by CYP3A4 (e.g., tamoxifen) may have a reduced and / or slowed effect when used with ketoconazole.The example of ketoconazole demonstrates the great benefit of in-vitro test systems, such as the system according to the invention, in clarifying such drug interactions at an early stage.

[0080] To investigate the influence of ketoconazole on CYP3A4 activity, conversion studies are conducted using isolated microsomes from CHO clones with recombinant CPR and specific recombinant CYP3A4 activity (e.g., CHO-CPR / CYP3A4 CI) in the presence and absence of ketoconazole. Differences in CYP3A4 activity are investigated either using commercially available enzyme activity assays (e.g., Promega's CYP3A4-G1O assay) or by analyzing the aqueous supernatants using appropriate analytical techniques (HPLC, LC-MS, etc.). The latter is described in the following example.

[0081] Analogous to example 5, 30 pg of microsomes (total protein amount) from the cell clone CHO-CPR / CYP3A4 CI with specific CYP3A4 activity are incubated together with an NADPH regeneration system (consisting of NADP+, glucose-6-phosphate and the enzyme glucose-6-phosphate dehydrogenase), the prototypical CYP3A4 substrate testosterone (final concentration of 0.5 mM) and various concentrations of the test substance ketoconazole (range between 5 and 100 pM) in a 200 pL mixture for 60 min at 37 °C. After the reaction, the samples are mixed with ice-cold acetonitrile in a ratio of 1:1, shaken and the proteins contained are precipitated from the solution by centrifugation (15 min, 16,000 xg).

[0082] The quantification of the amount of testosterone remaining in a sample as well as the detection of the main metabolite 6ß-hydroxytestosterone (6ß-OH-T) formed by CYP3A4 is carried out by subsequent HPLC analysis with DAD detection. The HPLC setup consists of a modular (U) HPLC system from the Nexera series (LC-40, SHIMADZU, Kyoto, Japan) with a ZORBAX SB-C18 column (Agilent Technologies, Santa Clara, CA, US), which is equilibrated to 25 °C. For the quantitative detection of remaining substrate and formed 6ß-OH-T, 20 pL of sample are separated in a gradient of KH2PO4 buffer (10 mM, pH 3, mobile phase A) and acetonitrile (mobile phase B) at a flow rate of 1 mL / min. Metabolites are detected based on the elution time with DAD (SPD-M10AvP) at 245 nm. The gradient is as follows: 0-3 min 30% B, 20.5 min 55% B, 22.5 min 55% B, 23 min 95% B, 26 min 95% B, 26.5 min 20% B, 29 min 20% B, 30 min 30% B.In this embodiment, the quantification of analytes is carried out using standard solutions of commercially available references in the range of 0.1 - 1 mM for testosterone and 1 - 75 pM for 6ß-OH-T. The signals (peaks) for testosterone and 6ß-OH-T are quantitatively evaluated from the chromatograms of the measured samples using the standard lines, and the decreasing CYP3A4 activity with increasing ketoconazole concentration is demonstrated. It can be seen that with increasing ketoconazole concentrations, the amount of 6ß-OH-T formed via CYP3A4 decreases. This exemplifies that there is a drug interaction between ketoconazole and testosterone, in that the CYP3A4 metabolism of testosterone is inhibited by ketoconazole.

[0083] Figure 1: Recombinant CPR expression and activity in selected CHO-CPR cell clones. CPR expression was analyzed at the mRNA level by RT-qPCR (A) and at the protein level by Western blotting (B). Increased CPR expression was further confirmed by indirect immunofluorescence (CPR in red, nuclei in blue) (D). CPR activity was determined from isolated microsomal fractions of recombinant CPR-expressing CHO clones compared to HepG2, HHM and parental CHO (C) (HHM = human hepatocytic microsomes; mRNA expression with n = 6 and CPR activity data with n = 11 presented as mean ± standard deviation; p < 0.05 with * compared to CHO; * compared to HHM; * compared to HepG2; * in comparison between CPR clones).

[0084] Figure 2: Recombinant CYP and CPR / CYP gene and protein expression in modified CHO clones. Shown are selected CHO clones with CYP1A2, CYP2B6, CYP3A4 and CYP2D6 modification, which express the respective CYP most strongly at the mRNA (A) and protein level (B). In all clones, a clear and specific overexpression of the respective transfected CYP enzyme was detected. Overexpression of CPR was also detectable in all CHO-CPR / CYP clones (mRNA expression data shown as mean ± standard deviation; n = 3). Figure 3: Mono-CYP activity in modified CHO clones with artificial phase 1 enzyme expression.

[0085] (A) Comparative analysis of the specific CYP activity of generated mono-CYP CHO clones for CYP1A2, CYP2B6 and CYP3A4 with and without overexpression of CPR, compared with the parental cell lines CHO-K1 and CHO-CPR clone 12 (data presented as mean ± standard deviation; * p < 0.05 compared to CHO; # in comparison between CYP clones; n = 12 for CHO-based clones; n = 6 for HepG2-CYP overexpressing positive controls).

[0086] (B) Comparative analysis of the specific CYP activity of generated mono-CYP CHO clones for CYP2D6 and CYP2C19 overexpressing CPR, compared to the parental cell lines CHO-K1 and CHO-CPR clone 12 (data presented as mean ± standard deviation; n = 3; for HepG2-CYP overexpressors as positive control).

[0087] Figure 4: Metabolism of prototypical substrates in mono-CYP CHO suspension cultures. Comparative analysis of the specific CYP activity of generated mono-CYP CHO clones with CPR overexpression compared to the parental cell lines CHO-K1 and CHO-CPR clone 12 (data shown as mean ± standard deviation; BG = reaction mixture without cells, CHO = parental cell line CHO-K1, CPR = parental cell line CHO-CPR clone 12; HPLC analysis with n = 4 based on duplicate quantification of two independent metabolism experiments).

[0088] Figure 5: Mono-CYP activity in modified CHO clones after pretreatment of the cells with cofactors. Comparative analysis of the specific CYP activity of generated mono-CYP CHO clones with CPR overexpression after pretreatment of the cells with hemin (vehicle: DMSO). Untreated HHM served as a physiological positive control (reactions with 1 pg protein for 10 min in 50 pL; data presented as mean ± standard deviation; n = 6 from two independent experiments).

[0089] Figure 6: Mono-CYP activity in modified CHO clones after pretreatment of the cells with cofactors. Comparative analysis of the specific CYP activity of generated mono-CYP CHO microsomes with CPR overexpression after pretreatment of the cells with DMSO and combinations of DMSO with hemin. Untreated HLM served as a physiological positive control (reactions with 30 pg protein for 30 min in 200 pL; data presented as mean ± standard deviation; n = 2).

[0090] Figure 7: (A) Mono-CYP activity in CPR as well as CYP1A2 and CYP3A4 transfected CHO clones compared with parental cell lines. Comparative analysis of the specific CYP activity of generated mono-CYP CHO microsomes with parental cell lines (CHO and CHO-CPR C12) after pretreatment of the cells with DMSO. Untreated HLM served as a physiological positive control (reactions with 30 pg protein for 30 min in 200 pL; data presented as mean ± standard deviation; n = 6). (B) Mono-CYP activity in CPR and CYP2D6 transfected CHO clones compared with the parental cell line CHO-CPR C12 to select suitable clones with CYP2D6 activity. Untreated HLM served as a physiological positive control (reactions with 1 pg protein for 10 min in

[0091] 50 pL in a G1O-CYP2D6 assay; data presented as

[0092] Mean ± standard deviation; n = 12 )

[0093] Figur 8 zeigt einen beispielhaften Expressionsvektor . Zit . Literatur :

[0094] 1. Elaut G, Henkens T, Papeleu P, Snykers S, Vinken M, Vanhaecke T, Rogiers V (2006): Molecular mechanisms underlying the dedifferentiation process of isolated hepatocytes and their cultures. Current drug metabolism 7 (6): 629-60;

[0095] 2. Brandon EF, Raap CD, Meijerman I, Beijnen JH, Schellens JH. An update on in vitro test methods in human hepatic drug biotransformation research: pros and cons. Toxicology and applied pharmacology. 2003;189(3):233-46.

[0096] 3. Nauen R, Zimmer CT, Vontas J. Heterologous expression of insect P450 enzymes that metabolize xenobiotics. Current Opinion in Insect Science. 2021;43:78-84.

[0097] 4. Christensen H, Mathiesen L, Postvoll LW, Winther B, Molden E. Different enzyme kinetics of midazolam in recombinant CYP3A4 microsomes from human and insect sources. Drug metabolism and pharmacokinetics. 2009;24(3):261-8.

[0098] 5. Kumondai M, Hishinuma E, Rico EMG, Ito A, Nakanishi Y, Saigusa D, et al. Heterologous expression of high- activity cytochrome P450 in mammalian cells. Scientific reports. 2020;10(l):l-13.

[0099] 6. Jacob J, Raab G, Soballa V, Schmalix WA, Grimmer G, Greim H, et al. Cytochrome P450-mediated activation of phenanthrene in genetically engineered V79 Chinese hamster cells. Environmental toxicology and pharmacology. 1996;1(1):1-11.

[0100] 7. Krebsfaenger N, MürdterTE, Zanger UM, Eichelbaum MF, Doehmer J. V79 Chinese hamster cells genetically engineered for polymorphic cytochrome P450 2D6 and their predictive value for humans. ALTEX-Alternatives to animal experimentation. 2003;20(3):143-54.

[0101] 8. Scheuenpflug J, Krebsfänger N, Doehmer J. Heterologous co-expression of human cytochrome P450 1A2 and polymorphic forms of N-acetyltransferase 2 for studies on aromatic amines in V79 Chinese hamster cells. Alternatives To Laboratory Animals. 2005;33(6):561-77.

[0102] 9. Ding S, Yao D, Burchell B, Wolf CR, Friedberg T. High levels of recombinant CYP3A4 expression in Chinese hamster ovary cells are modulated by coexpressed human P450 reductase and hemin supplementation. Archives of Biochemistry and Biophysics. 1997;348(2):403-10.

[0103] 10. Ding S, Yao D, Deeni YY, Burchell B, Wolf CR, Friedberg T. Human NADPH-P450 oxidoreductase modulates the level of cytochrome P450 CYP2D6 holoprotein via haem oxygenase-dependent and-independent pathways. Biochemical Journal. 2001;356(2):613-9.

[0104] 11. Deeni YY, Ibbotson SH, Woods JA, Wolf CR, Smith G. Cytochrome P450 CYP1B1 interacts with 8- methoxypsoralen (8-MOP) and influences psoralen-ultraviolet A (PUVA) sensitivity. Pios one. 2013;8(9):e75494. Deeni YY, Ibbotson SH, Woods JA, Wolf CR, Smith G. Cytochrome P450 CYP1B1 interacts with 8- methoxypsoralen (8-MOP) and influences psoralen-ultraviolet A (PUVA) sensitivity. Pios one. 2013;8(9):e75494.

Claims

Patent claims 1 . Mammalian cell containing, after transfection or transduction, polynucleotides encoding at least one cytochrome P450 and NADPH-cytochrome P450 oxidoreductase stably integrated into the genome.

2. Mammalian cell according to claim 1 having no or low background activity of endogenous cytochrome P450 for the at least one cytochrome P450 and NADPH-cytochrome P450 oxidoreductase.

3. Mammalian cell according to claim 2, wherein the low background activity of endogenous cytochrome P450 is either below the detection limit for formed metabolites using the HPLC method and / or is a maximum of 5% of the specific activity in pmol / mg / min for the at least one cytochrome P450 and NADPH-cytochrome P450 oxidoreductase.

4. Cell line containing a mammalian cell according to any one of claims 1-3. 5 . Microsome obtained from a mammalian cell according to any one of claims 1 to 3 or from a cell line according to claim 4 . 6 . Microsome according to claim 5 , wherein 10 7 mammalian cells contain at least 100 pg of protein.

7. Suspension cells obtained from a mammalian cell according to any one of claims 1-3 or from a cell line according to claim 4.

8. A test system comprising cytochrome P450 (CYP) and NADPH cytochrome P450 oxidoreductase (CPR, POR) from one or more mammalian cells according to any one of claims 1-3 or from a cell line according to claim 4 or in or from a microsome according to any one of claims 5-6 and / or in or from suspension cells according to claim 7.

9. Test system according to claim 8 for the detection of metabolites from substances, in particular xenobiotics, active ingredients, pharmaceuticals.

10. Test system according to claim 8 for detecting the at least one CYP450 enzyme(s) responsible for the biotransformation of at least one test substance, wherein an enzymatic conversion of at least one test substance takes place with one or more CYP450 enzymes.

11. Test system according to claim 8 for detecting an interaction of at least one test substance with at least one CYP450 enzyme.

12. Mammalian cell according to one of claims 1-3 selected from the group of non-hepatic cells, in particular HEK2 93 cells, CHO cells, HeLa cells, BHK cells, L929 cells.

13. A mammalian cell according to any one of claims 1-3, wherein the cytochrome P450 is selected from the group CYP1A1, CYP1A2, CYP1B1, CYP2A6, CYP2A7, CYP2A13, CYP2B6, CYP2C8, CYP2C9, CYP2C18, CYP2C19, CYP2D6, CYP2E1, CYP2F1, CYP2J2, CYP2R1, CYP2S1, CYP2U1, CYP2W1, CYP3A4, CYP3A5, CYP3A7, CYP3A43, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3 , CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4V2, CYP4X1, CYP4 Z2, CYP5A1, CYP7A1, CYP7B1, CYP8A1, CYP8B1, CYP11A1, CYP1 1B1, CYP11B2, CYP17A1, CYP19A1, CYP20A1, CYP21A1, CYP21A2 , CYP24A1, CYP26A1, CYP26B1, CYP26C1, CYP27A1, CYP27B1, C YP27C1, CYP39A1, CYP46A1, CYP51A1.

14. A mammalian cell according to any one of claims 1-3, wherein cytochrome P450 and NADPH-cytochrome P450 oxidoreductase are overexpressed.

15. A mammalian cell according to any one of claims 1-3, wherein the polynucleotides integrated into the mammalian cell genome encoding at least one cytochrome P450 and NADPH-cytochrome P450 oxidoreductase are contained in an expression vector and are controlled by at least one promoter.