Assay for prediction of aggressiveness of cercospora beticola in beta vulgaris varieties

EP4658808A2Pending Publication Date: 2025-12-10KWS SAAT SE & CO KGAA +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024711621
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-02-02
Filing Date
2024-02-02
Publication Date
2025-12-10

AI Technical Summary

Technical Problem

Cercospora beticola strains have been identified that can overcome the major resistance gene BvCR4, leading to uncontrolled Cercospora leaf spot disease in sugar beet fields, and existing methods cannot visually determine the presence of virulent strains, necessitating an assay to detect these strains for effective control measures.

Method used

The development of specific markers and methods to identify virulent C. beticola strains by detecting highly diagnostic SNP alleles or deletions on chromosome 1, allowing for the detection of strains that can overcome the resistance conferred by BvCR4, using PCR-based assays and oligonucleotide primers, enabling the identification and management of virulent populations.

Benefits of technology

Enables the accurate detection of virulent C. beticola strains, allowing for timely application of fungicides or alternative cropping strategies, thereby reducing crop losses and maintaining sustainable agricultural practices.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000044_0001
    Figure IMGF000044_0001
  • Figure IMGF000045_0001
    Figure IMGF000045_0001
  • Figure IMGF000046_0001
    Figure IMGF000046_0001
Patent Text Reader

Abstract

The present invention relates to the field of determining whether at least one virulent Cercospora beticola strain is present in a sample of plant material, wherein a C. beticola strain is considered to be virulent if it is able to overcome the resistance conferred to a plant of the genus Beta by the resistance gene BvCR4. Specific markers are provided which allow to distinguish between avirulent and virulent C. beticola strains. Assays, methods and means for detecting virulent C. beticola strains are also provided. The invention finally allows to apply methods to deal with the presence of virulent C. beticola strains in a field of plants of the genus Beta.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]245761.000234 ASSAY FOR PREDICTION OF AGGRESSIVENESS OF CERCOSPORA BETICOLA IN BETA VULGARIS VARIETIES CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Application No.63 / 442,799, filed February 2, 2023. The entire contents of this application is incorporated herein by reference in its entirety. TECHNICAL FIELD The present invention relates to the field of determining whether at least one virulent Cercospora beticola strain is present in a sample of plant material, wherein a C. beticola strain is considered to be virulent if it is able to overcome the resistance conferred to a plant of the genus Beta by the resistance gene BvCR4. Specific markers are provided which allow to distinguish between avirulent and virulent C. beticola strains. Assays, methods and means for detecting virulent C. beticola strains are also provided. The invention finally allows to apply methods to deal with the presence of virulent C. beticola strains in a field of plants of the genus Beta. BACKGROUND Cercospora leaf spot disease is one of the most important, globally prevalent leaf diseases of different plants including the species Beta vulgaris and Spinacia oleracea. It is caused by the fungus Cercospora beticola. Plants infested by this disease typically form small, relatively round leaf spots (2–3 mm) that are light gray in the middle and are surrounded by a red-brown border. In a severe infestation, the leaf spots overlap, so that entire portions of the leaf blade dry out. Small black dots (pseudostromata) are visible within the fully formed spots, and a gray, felt-like covering (conidia bearers with conidia) forms under damp conditions - predominantly, on the leaf underside. Severely infested leaves first turn yellow, then turn brown and die. New leaf growth occurs in parallel, wherein the leaves become diseased again and die, however. At first, damage symptoms only on individual plants are visible; however, with spread of the disease, formation of persistent infestation nests often occurs. Further propagation over the entire field takes place via rain and wind. In sugar beet infection with Cercospora leads to severe yield reduction. In the case that chard plants are infested, even the damaged leaves are not accepted by the consumers and already a low disease pressure can lead to severe crop shortfall. The pathogen Cercospora beticola was first described in the second half of the 19th century, in Italy. Up to 40% crop losses may occur due to a severe infestation, which may be triggered by humid weather, early row closure, a high infection potential from previous years, or strong 245761.000234 irrigation. These losses result from a reduced beet crop and reduced sugar content; see Holtschulte, 2000. To fight back against the disease, intercropping or fungicides are often used. A chemical control of Cercospora beticola via fungicides, however, incurs costs to the farmer and pollutes the environment. Moreover, the treatment of the edible chard leaves with chemicals reduces consumer acceptance. Repeated applications of fungicides additionally increase the selection pressure on fungicide-resistant Cercospora beticola strains. This is contrary to a sustainable agricultural practice. It is worth mentioning that during the last few years strains of Cercospora beticola occurred which showed resistance against one or more fungicides; see, for example, Trkulja et al., 2017. The problem became such severe that the German Federal Office of Consumer Protection and Food Safety (BVL) approved the exemptional admission of copper- based fungicides for combating Cercospora. However, copper-based fungicides are generally regarded (depending on the dosage) as harmful for humans and environment. Copper is a heavy metal which may accumulate in the soil. Indirect control of Cercospora beticola is done via the selection of beet cultivars with healthy leaves and cultivation of the beets with at least a 3-year crop rotation. Markedly better control of the infestation may be achieved with a combination of resistant cultivars. Less susceptible Cercospora-resistant beet cultivars have been offered on the market since 2000 (Steinrücken, 1997). These cultivars are furnished with a quantitative resistance to Cercospora beticola. The resistance of these cultivars is based upon several genes and is quantitatively passed down, wherein the exact number of the genes that are responsible for the resistance is not known; see Weiland and Koch, 2004. While until recently only Cercospora resistance genes with small or moderate effects have been employed in sugar beet breeding, the identification of a major resistance gene named BvCR4 allowed the development of sugar beet hybrids with very high levels of resistance by combining major gene and quantitative resistance sources (see, for example, International patent applications WO2020 / 169178 and WO2022 / 037967, respectively, for further details). PROBLEM TO BE SOLVED Recently, Cercospora beticola strains have been identified on sugar beet fields which are able to overcome the major resistance gene BvCR4 that confers to sugar beet a high level of resistance to Cercospora leaf spot disease. Such virulent Cercospora strains cannot be controlled by this resistance gene. Instead, the additional application of chemical control agents may be required. Further, for a farmer it is impossible to determine visually whether one or more of the new virulent Cercospora strains is present on a given field and accordingly whether additional Cercospora control measures are needed to protect the plants growing on this field against the damage caused by the Leaf spot disease. Thus, an assay is needed to determine whether a virulent Cercospora strain is present in a sample, e.g. a leaf sample, from a given field, which most likely cannot be controlled by only planting Cercospora resistant sugar beet varieties. Such 245761.000234 knowledge would allow to counter the infection by such virulent strains by either additional chemical disease control or alternative cropping technologies. The aim of the present invention therefore consists in the provision of means to determine whether a virulent C. beticola strain is present in a sample, e.g. a plant sample from a given field. One or more marker sequences can be such means and can be used to detect a virulent C. beticola strain in a sample which is able to overcome the resistance conferred by the sugar beet resistance gene BvCR4. Such one or more marker sequences can also be used to determine whether C. beticola is the disease-causing microorganism in a sample, e.g. plant sample from a given field. The present invention further aims at providing an assay method which allows to detect differences in the genomes of the C. beticola strains present in the sample which in turn can be used to detect and predict the ability of local Cercospora populations to be virulent towards BvCR4. The aim is also to provide oligonucleotide sequences which can be used as primers in these methods. A further aim of the invention is to provide methods to deal with the presence of such virulent C. beticola strains, which for example include (further) application of fungicides on top of the growing crops, the inclusion of further phytosanitary steps in preparation of the coming cropping season, the application of alternative cropping schemes or the switch to a different cultivar, the use of further fungicide applications as preparation for the next sowing. SOLUTION TO THE PROBLEM These aims are achieved by the embodiments of the present invention as described in the claims and in the specification below. SUMMARY OF INVENTION In a first aspect, there is provided a marker for the identification of at least one virulent C. beticola strain in a sample, which strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4, wherein the marker is detecting a) one or more highly diagnostic SNP alleles on chromosome 1 of C. beticola which is tightly linked to virulence of at least one C. beticola strain, or b) one or more deletion of genomic sequence on chromosome 1 of C. beticola in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola, and thereby allows to identify a virulent C. beticola strain. In one embodiment of the first aspect, the marker is also used to determine whether at least one C. beticola strain is present in the sample. 245761.000234 In a further embodiment of the first aspect, the one or more highly diagnostic SNP allele and / or the one or more deletion is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp, preferably the sequence between positions 4,085,502 bp and 4,109,180 bp. In a further embodiment, the one or more highly diagnostic SNP allele and / or the one or more deletion which is detected by the marker is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,087,634 bp and 4,094,364 bp. In another embodiment of the first aspect, the one or more highly diagnostic SNP allele and / or the one or more deletion is located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola and 1000 bp upstream or 1000 bp downstream of that genomic sequence of the AvrCR4 gene of C. beticola which is located on chromosome 1 of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,088,424 bp and 4,090,764 bp. In a further preferred embodiment, one or more highly diagnostic SNP allele and / or the one or more deletion is located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,089,424 bp and 4,089,764bp. The sequence of the avirulent haplotype of the gene AvrCR4 which is known to be necessary for full functionality of the C. beticola resistance mediated by BvCR4 is provided as SEQ ID NO: 12. In a second aspect, there is provided a method of detecting the presence of one or more virulent C. beticola strains in a sample, wherein said one or more virulent C. beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4, and wherein said method detects one or more of the markers of the present invention. In one embodiment of the second aspect, the method also comprises the determination by marker whether at least one C. beticola strain is present in the sample. In a further embodiment of the second aspect, the sample is selected from the group comprising one or more soil sample, one or more sample of plant material taken from one or more plants growing in a field, or one or more DNA sample extracted from one or more soil sample or from one or more sample of plant material taken from one or more plants growing in a field. In one preferred embodiment of the second aspect, the one or more soil sample is taken from one or more fields where plants of the genus Beta are grown, or wherein the one or more sample of plant material is taken from one more or more plant of the genus Beta growing in one or more fields. 245761.000234 In another embodiment of the second aspect, the method further comprises the step of extracting DNA, preferably genomic DNA, from the C. beticola strains present in the one or more samples. In a third aspect, there is provided a method of controlling, preventing, or reducing the development of one or more virulent strains of C. beticola in a field in which plants of the genus Beta are grown, wherein said one or more virulent C. beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4, said method comprising the steps of (a) planting C. beticola-resistant plants of the genus Beta carrying the resistance gene BvCR4 in a field, (b) prior to or after the planting of step (a) analyze one or more samples from that field for the presence of one or more virulent strains of C. beticola which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4 by employing one or more of the markers of the present invention and / or the method of the present invention, and (c) applying fungicides for at least one time over the top of the plants of the genus Beta in the field after emergence if the presence of one or more virulent strains of C. beticola which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4 is detected in the sample in step (b). In a fourth aspect, there is provided a use of at least one marker, preferably at least two, at least three, at least four, or at least five, or more marker of the present invention for the identification of one or more virulent C. beticola strains in a sample, wherein the one or more C. beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4. In one embodiment of the fourth aspect, the at least one marker of the present invention is used for the identification of one or more virulent C. beticola strains in a sample, wherein the one or more C. beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4 on the basis of differences in the genomic DNA on chromosome 1 of C. beticola, preferably on the basis of one or more highly diagnostic SNP allele and / or one or more deletion, wherein the one or more highly diagnostic SNP allele and / or the one or more deletion is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp, preferably the sequence between positions 4,085,502 bp and 4,109,180 bp, preferably located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,087,634 bp and 4,094,364 bp, more preferably located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola and 1000 bp upstream or 1000 bp downstream of that genomic sequence of the AvrCR4 gene of C. beticola which is located on chromosome 1 of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,088,424 bp and 245761.000234 4,090,764 bp, and even more preferably located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,089,424 bp and 4,089,764bp. The sequence of the avirulent haplotype of the gene AvrCR4 which is known to be necessary for full functionality of the C. beticola resistance mediated by BvCR4 is provided as SEQ ID NO: 12. In a fifth aspect, there is provided a set of at least two, preferable three, oligonucleotides suitable for use as primers in a PCR which are able to hybridize to the genomic sequence of chromosome 1 of C. beticola and which are able to identify the haplotype of at least one C. beticola in a sample which is characterized by (a) one or more highly diagnostic SNP alleles which is tightly linked to virulence of at least one C. beticola strain, or (b) one or more deletion of genomic sequence in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola, and thereby allow to identify in a sample at least one virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4. In one embodiment of the fifth aspect, the set of oligonucleotides is a set of two oligonucleotides suitable for use as primer in a PCR which are able to identify the haplotype of at least one C. beticola in a sample which is characterized by (a) one or more highly diagnostic SNP alleles which are tightly linked to virulence of at least one C. beticola strain, or (b) one or more deletion of genomic sequence in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola, and thereby allow to identify in a sample at least one virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4. In a further embodiment of the fifth aspect, the set of oligonucleotides is a set of three oligonucleotides suitable for use as primer in a PCR involving two forward primers and a reverse primer wherein each primer has a different nucleotide sequence and wherein the reverse primer and only one of the two forward primers are able to identify the haplotype of at least one C. beticola in a sample which is characterized by (a) one or more highly diagnostic SNP alleles which are tightly linked to virulence of at least one C. beticola strain, or (b) one or more deletion of genomic sequence in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola, and thereby allow to identify in a sample at least one virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4. In a sixth aspect, there is provided a kit for detecting the presence of one or more virulent C. beticola strains in a sample, wherein said one or more virulent C. beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4, and wherein the kit comprises means to identify one or more of the markers of the present invention, preferably the set of oligonucleotides of the present invention. 245761.000234 Brief description of the FIGURES Designs and embodiments of the present invention are described by way of example with reference to the pending sequences and figures. Figure 1 (Fig. 1): Histogram of the count of the rating of the severity of Cercospora leaf spot disease on one of the sugar beet varieties carrying BvCR4 after inoculation with 56 Cercospora isolates collected from infection hot spots of two naturally infested test locations in Switzerland. Infection ratings differentiated most prominently when the fourth rating according to the KWS scale was done. For analysis the values of 66 isolates collected from one of the susceptible varieties not carrying BvCR4 were included. The score for the disease rating of these isolates has been set to 2 for further analysis. On the x axis of Figure 1 the results for 7 out of the 9 KWS scales are shown; ratings 1 to 3 on the left side represent infection with avirulent strains, ratings 4 to 7 on the right side represent infection with virulent strains. Figure 2 (Fig. 2): Manhattan plot showing the results of GWAS leveraging of the results of the phenotypic analysis and the analysis for variants in short read sequences of all 56 isolates. A clear association of a region on Linkage group I of Cercospora beticola with enhanced virulence towards BvCR4 (CB_CbHevensen-1_hq-v2.chr1:4087634 - 4094364) can be seen. DEFINITIONS The following definitions, descriptions, and methods are provided to better define the invention and to guide those of ordinary skill in the art in the practice of the invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. It must be noted that as used herein, the singular forms "a", "an", and "the", include plural references unless the context clearly indicates otherwise. Thus, for example, reference to "a strain" includes one or more of such different strains and reference to "the method" includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein. All publications and patents cited in this disclosure are incorporated by reference in their entirety. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material. Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention. 245761.000234 The term “about” means + / - 10% of the recited value, preferably + / - 5% of the recited value. The term "allele" as used herein refers to a nucleic acid sequence variant at a specific location, such as an allele of a single nucleotide polymorphism. Generally, an allele can be understood as any one of two or more genes and / or loci that may occur alternatively at a given site on a chromosome. Alleles may occur in pairs, or there may be multiple alleles affecting the expression (phenotype) of a particular trait. As used herein, the term “plant of the genus Beta” or “Beta vulgaris plants” refers to Beta vulgaris plants, including all Beta vulgaris subspecies and, in addition, includes all plant species that can be bred with Beta vulgaris. Plants of the genus Beta belong to the amaranth family (Amaranthaceae). Numbering among these plants are plants of the species Beta macrocarpa, Beta vulgaris, Beta lomatogona, Beta macrorhiza, Beta corolliflora, Beta trigyna, and Beta nana. A plant of the species Beta vulgaris is, in particular, a plant of the subspecies Beta vulgaris subsp. vulgaris. For example, numbering among these are Beta vulgaris subsp. vulgaris var. altissima (sugar beet in a narrower sense), Beta vulgaris ssp. vulgaris var. vulgaris (chard), Beta vulgaris ssp. vulgaris var. conditiva (beetroot / red beet), Beta vulgaris ssp. vulgaris var. crassa / alba (fodder beet). “Capable of being detected” refers to the ability of a particular DNA molecule, segment or sequence to be detected in a sample, such as by amplification and determining its presence, size or sequence such as by DNA sequence analysis, and / or binding of a probe to the target DNA molecule, segment or sequence. Cercospora leaf spot disease is one of the most important, globally prevalent leaf diseases of different plants including the species Beta vulgaris and Spinacia oleracea. It is caused by the fungus Cercospora beticola (C. beticola) which belongs to the genus of Ascomycete fungi. The genus Cercospora encompasses various species, e.g., the species Cercospora arachidicola, Cercospora ariminiensis, Cercospora asparagi, Cercospora bertoreae, Cercospora beticola, Cercospora bizzozeriana, Cercospora canescens, Cercospora carotae, Cercospora chenopodii, Cercospora cistinearum, Cercospora cladosporioides, Cercospora diazu, Cercospora dulcamarae, Cercospora erysimi, Cercospora hayii, Cercospora kikuchii, Cercospora malvacearum, Cercospora malvicola, Cercospora medicaginis, Cercospora oryzaem, Cercospora per sonata, Cercospora plantaginis, Cercospora ricinella, Cercospora setariae, Cercospora unamunoi, Cercospora violae, or Cercospora zeae-maydis. A “virulent Cercospora beticola strain” is able to overcome the major resistance gene BvCR4 that confers to a plant of the genus Beta, preferably to sugar beet plants, a high level of resistance to Cercospora leaf spot disease caused by the pathogen C. beticola. Such virulent Cercospora beticola strains cannot be controlled by this resistance gene alone. An “avirulent Cercospora beticola strain” is controlled by the major resistance gene BvCR4 that confers to plants of the genus Beta, preferably to sugar beet plants; plants infected with such an “avirulent Cercospora 245761.000234 beticola strain” do show no or only few symptoms of the Cercospora leaf spot disease caused by the pathogen C. beticola. The term “CB_CbHevensen-1_hq-v2” as used herein refers to the reference genome sequence of the Cercospora beticola isolate Cb Hevensen. The isolate was collected from field samples near the village Hevensen, Germany. DNA was extracted and sequenced using two sequencing platforms. Oxford Nanopore sequencing was used for primary genome assembly. Potential sequencing errors were corrected using sequencing results based on short read sequencing derived from Illumina based sequencing. Sequencing reads were assembled to chromosome size contigs and analyzed for open reading genes. The sequence of the reference genome has been deposited in the European Nucleotide Archive as described in Chen et al. (2023). The terms “chip” or “microarray” as used here refer to a marker chip which contains at least one oligonucleotide according to the invention that is suitable for detection. The marker chip is suitable for application in one or more methods according to the invention. As used herein, the term “comprising” means “including but not limited to”. The term “co-dominant marker” as used herein refers to a marker for which both alleles are expressed when co-occurring in an individual. Therefore, with co-dominant markers, heterozygotes can be distinguished from homozygotes, allowing the determination of genotypes and allele frequencies at loci. With co-dominant markers each allele of a marker can be clearly discriminated from the other resulting in a clear separation between homozygous and heterozygous individuals. In the context of the present invention the SNP markers described below are co-dominant markers where both alleles if present are detected as different florescence signals in a KASP assay. The term “dominant marker” as used herein refers to a marker for which only one of the alleles can be detected. Therefore, dominant markers do not allow a clear separation between homozygous and heterozygous individuals. In the context of the present invention such dominant marker are the deletion markers, which yield no amplification product if the deletion is present in the genome of C. beticola by which the primer binding site is removed. Phrased differently, if there is no deletion present in the areas of interest in the genome of C. beticola, then the primer binding sites are present and an amplification product (i.e., a detectable signal) is produced. However, when using dominant markers, the presence of a signal does not allow to distinguish between the “no deletion” allele in homozygous form and the “no deletion” allele in heterozygous form as in both cases the same amplification product is formed and detected. Accordingly, dominant markers have a tendency to lead to false-positive results when alleles are tested which do not result in a detectable signal, as the missing detectable signal could also be the results of a failed reaction or of missing or wrong DNA. To compensate for this, it is of highest importance to include proper controls which show that detectable DNA is present in the sample where the primer could bind if the primer binding site is present. In the context of the present 245761.000234 invention, this is achieved with the species-specific markers which allow to determine that C. beticola DNA is present in the sample. The term “deletion” as used herein refers to the physical position in a DNA sequence or a genomic sequence where a deletion (also called deletion mutation) removes one or more nucleotide base pair resulting in a shortening of the affected (mutated) sequence compared to the wildtype sequence. The term ”insertion” as used herein on the other hand refers to the physical position in a DNA sequence or a genomic sequence where an insertion (also called insertion mutation) adds one or more nucleotide base pairs resulting in an extension (lengthening) of the affected (mutated) sequence compared to the wildtype sequence. Deletions and insertions can however be used as molecular markers in case they represent a length polymorphism or as presence / absence polymorphism. As used herein, the terms “DNA” and “DNA molecule” refer to a deoxyribonucleic acid (DNA) molecule. A DNA molecule may be of genomic or synthetic origin and is by convention from the 5' (upstream) end to the 3' (downstream) end. As used herein, the term “DNA sequence” refers to the nucleotide sequence of a DNA molecule, i.e. the sequence of consecutive nucleotides in the DNA molecule. As used herein in reference to nucleotides of a polynucleotide or DNA sequence or molecule, the terms “consecutive” and “contiguous” are interchangeable and synonymous and refer to the 5' to 3' order of nucleotides in a polynucleotide or DNA sequence, strand or molecule without any gap or interruption between them. The nomenclature used is that required by Title 37 of the United States Code of Federal Regulations § 1.822 and set forth in the tables in WIPO Standard ST.25 (1998), Appendix 2, Tables 1 and 3. By convention, DNA sequences and fragments thereof are disclosed with reference to only one strand of the two complementary DNA sequence strands. By implication and intent, the complementary sequences of the sequences provided here (the sequences of the complementary strand), also referred to in the art as the reverse complementary sequences, are within the scope of the invention and are expressly intended to be within the scope of the subject matter claimed. Thus, as used herein references to SEQ ID NOs: 1 - 123 and fragments thereof include and refer to the sequence of the complementary strand and fragments thereof. The terms “fungicide” and “fungicidal agrochemical” are used interchangeably herein. Both terms refer to agrochemicals used to kill parasitic fungi or their spores in agriculture. The “fungicide” or “fungicidal agrochemical” preferably is an agrochemical which is effective against Cercospora wherein these agrochemicals may include those which contain one or more of the following fungicides: epoxiconazole, kresoxim-methyl, thiophanate methyl, mancozeb, thiram, hymexazol and / or other fungicides know to the person skilled in the art. Preferably, the “fungicide” and “fungicidal agrochemical” is causing no or only little harm to the crop to which is applied. The term "haplotype" refers to the genotype of an individual at a plurality of loci, i.e. a combination of more than one allele, e.g. more than one of the alleles defined in Table 1 below. 245761.000234 As used herein, the term “isolated” refers to separating a molecule from other molecules that are normally associated with it in its native or natural state. The term “isolated” thus may refer to one or more DNA molecules that has been separated from other DNA molecule(s) that it is associated with in its native or natural state. Thus, a DNA molecule removed from its natural state and fused to another DNA molecule with which it is not normally associated would be an isolated DNA molecule. Such an isolated DNA molecule could result from the use of biotechnology techniques, such as making recombinant DNA or integrating a foreign DNA molecule into the chromosome of a cell, plant, or seed. The term “mappable region” as used herein refers to a region of a DNA sequence or a genomic sequence which shows an average mappability value (computed with GenMap, Pockrandt et. al, 2020) larger than 0.5, indicating that this region does not belong to a highly repetitive region but instead likely represents a unique region. A “molecular marker” or “marker” is a nucleic acid that is polymorphic in a defined population and is used as a reference or orientation point. Depending on the technical context the term “marker” may be related to a specific genomic position which is detectable by a corresponding “molecular marker” wherein the “molecular marker” in most cases is sequentially compatible to the genomic position. A marker for the detection of a virulent C. beticola strain which is able to overcome the resistance conferred to a plant of the genus Beta by the Cercospora resistance gene BvCR4 should be suitable for monitoring differences or polymorphisms within a population of C. beticola strains. Such a marker is thus able to detect and differentiate between various allelic states (alleles). The term, “molecular marker,” also relates to nucleotide sequences which are complementary or at least largely complementary or homologous to genomic sequences - for example, nucleic acids which are used as probes or primers. These differences at the DNA level are to be found as markers and are, for example, polynucleotide sequence differences, e.g., SSR's (simple sequence repeats'), RFLP's (restriction fragment length polymorphisms), FLP's (fragment length polymorphisms) or SNP's (single nucleotide polymorphisms). The markers may be derived from genomic or expressed nucleic acids, e.g., spliced RNA, cDNA, or EST's, and may also relate to nucleic acids that are used as probes or primer pairs and as such are suitable for amplifying a sequence fragment using PCR-based methods. Markers that describe genetic polymorphisms (between parts of a population) may be detected using well-established methods from the prior art (Griffiths et al., 2000). For example, among these are DNA sequencing, PCR-based, sequence- specific amplification, verification of RFLP's, verification of polynucleotide polymorphisms by means of allele-specific hybridization (ASH), detection of amplified variable sequences of the plant genome, detection of a 3 SR (self-sustained sequence replication), detection of SSR's, SNP's, RFLP's, or AFLP's (amplified fragment length polymorphisms). Furthermore, the methods for detection of EST's (expressed sequence tags) and SSR markers derived from EST sequences and RAPD (randomly amplified polymorphic DNA) are also known. Depending upon the context, the 245761.000234 term, “marker,” in the description may also mean a specific chromosome position in the genome of a species where a specific marker (SNP, for example) may be found. Markers also include synthetic oligonucleotides that may be connected with one or more detection molecules, wherein the detection molecules may be used for a detection reaction or the generation of a signal within the scope of a verification method. Synthetic oligonucleotides also include labeled primers. Synthetic oligonucleotides and labeled primers are artificial compounds, do not occur in nature, and cannot be isolated from nature. The production of such compounds is explained further below. The term “oligonucleotides” as used herein relates to oligonucleotide sequences, in particular to primer oligonucleotides. These comprise a nucleic acid molecule of at least 15 nucleotides in length that specifically hybridizes with a nucleotide sequence defined herein. The term also refers to pairs or triplets of oligonucleotides or a kit containing these oligonucleotides which are suitable for hybridization as forward and reverse primers and for amplifying an amplicon in a polymerase chain reaction (PCR). The oligonucleotides may be connected with one or more detection molecules, wherein the detection molecules may be used for a detection reaction or the generation of a signal within the scope of a verification method. Synthetic oligonucleotides also include labeled primers. Synthetic oligonucleotides and labeled primers are artificial compounds, do not occur in nature, and cannot be isolated from nature. The production of such compounds is known to the person of skill in the art. “Plant material” or “plant parts” means, for example, complete plants, leaves, shoot, stem, roots, hypocotyl, vegetative buds, meristems, embryos, anthers, ovula, seeds, or fruits. Preferably, this plant material(s) or plant part(s) is / are taken from one or more of the plants of the genus Beta growing in the field from which a sample is taken for analysis according to the invention. A “primer” is a DNA molecule that is designed for use in annealing or hybridization methods that involve an amplification reaction. An amplification reaction is an in vitro reaction that amplifies template DNA to produce an amplicon. As used herein, an “amplification product” or “amplified DNA” or “amplicon” is a DNA molecule that has been synthesized using amplification techniques as further described herein, which is directed to a target nucleic acid or DNA molecule that is part of a template nucleic acid molecule. Amplification or amplifying refers to making multiple copies of a target DNA molecule or segment from a template DNA. The amplicon may range in length depending on the length of the intervening polynucleotide or DNA sequence between the two primer target sequences in the template DNA molecule. The use of the term “amplicon” specifically excludes primer dimers that may be formed in a DNA amplification reaction. Amplification and detection of such an amplicon is indictive or diagnostic for the presence of a virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4. A primer is typically designed to hybridize to a complementary target DNA strand to form a hybrid between the primer and the target DNA strand. The presence of a primer is a point of recognition 245761.000234 by a polymerase to begin extension of the primer polymerization of additional nucleotides into a lengthening nucleotide molecule) using as a template the target DNA strand. Primer pairs refer to use of two primers binding opposite strands of a double stranded nucleotide segment for the purpose of amplifying the polynucleotide segment between the positions targeted for binding by the individual members of the primer pair, typically in a thermal amplification reaction or other conventional nucleic-acid amplification methods. A primer may further comprise an oligo tail sequence such as those used in the Kompetitive Allele-Specific PCR (KASP™) method. The KASP assay is a particularly useful assay method for genotyping of single nucleotide polymorphism markers and is described, e.g., by He et al., 2014. The allele-specific primers each harbor a unique tail sequence that corresponds with a universal FRET (fluorescence resonant energy transfer) cassette; one labelled with FAM™ dye and the other with HEX™ dye. During thermal cycling, the relevant allele-specific primer binds to the template and elongates, thus attaching the tail sequence to the newly synthesized strand. The complement of the allele-specific tail sequence is then generated during subsequent rounds of PCR, enabling the FRET cassette to bind to the DNA. The FRET cassette is no longer quenched and emits fluorescence. Examples of primers comprising an oligo tail sequence are the primers of the present invention whose names end with “_A” (SEQ ID NOs: 40 to 62 and SEQ ID NO: 121) or “_B” (SEQ ID NOs: 63 to 85 and SEQ ID NO: 122), respectively. Examples of primers which do not contain an oligo tail sequence are the primers of the present invention whose names end with “_G” (SEQ ID NOs: 86 to 108 and SEQ ID NO: 123). The oligo tail sequence of the primers of the present invention whose names end with “_A” is found at the 5’ end and reads “GAAGGTGACCAAGTTCATGCT”, whereas the oligo tail sequence of the primers of the present invention whose names end with “_B” is found at the 5’ end and reads “GAAGGTCGGAGTCAACGGATT”. Primers may have complete sequence identity with the target sequence, although primers differing from the target sequence that retain the ability to hybridize preferentially to target sequences may be designed by conventional methods. In order for a nucleic acid molecule to serve as a primer it needs only be sufficiently complementary in sequence and / or of sufficient length to be able to form a stable double-stranded structure under the particular hybridization conditions or reaction conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence or absence of an avirulent or virulent C. beticola strain in a sample. Polynucleotide molecules referred to as “polynucleotide segment of sufficient length” or “sufficient length of contiguous nucleotides” therefore are capable of specifically hybridizing to a target DNA sequence under certain hybridization conditions or reaction conditions. As used herein, the term “of sufficient length” refers to any length that is sufficient to be useful in a detection method of choice. Primers are generally at least about 8 nucleotides, at least about 10 nucleotides, at least about 12 nucleotides, at least about 14 nucleotides, at least about 16 nucleotides, at least about 18 nucleotides, at least about 20 nucleotides, at least about 22 nucleotides, at least about 24 nucleotides, at least about 26 nucleotides, at least about 28 nucleotides, or at least about 30 nucleotides or more in length. Such primers hybridize specifically 245761.000234 to a target DNA sequence under stringent hybridization conditions. Conventional stringency conditions are described by MR Green and J Sambrook, Molecular cloning: a laboratory manual, 4thEdition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012). As used herein, two nucleic acid molecules are capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid structure. A nucleic acid molecule is the “complement” of another nucleic acid molecule if they exhibit complete complementarity. As used herein, two molecules exhibit “complete complementarity” if when aligned every nucleotide of the first molecule is complementary to every nucleotide of the second molecule. Two molecules are “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional “low-stringency” conditions. Similarly, the molecules are “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional “high-stringency” conditions. Departures from complete complementarity are therefore permissible, as long as such departures do not completely preclude the capacity of the molecules to form a double-stranded structure. As used herein, the term “percent sequence identity” or “% sequence identity” refers to the percentage of identical nucleotides or amino acids in a linear polynucleotide or polypeptide sequence of a reference (“query”) sequence (or its complementary strand) as compared to a test (“subject”) sequence (or its complementary strand) when the two sequences arc optimally aligned (with appropriate nucleotide or amino acid insertions, deletions, or gaps totaling less than 20 percent of the reference sequence over the window of comparison). Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and by computerized implementations of these algorithms such as GAP, BESTFTT, PASTA, and TFASTA available as part of the Sequence Analysis software package of the GCG® Wisconsin Package® (Accelrys Inc., San Diego, Calif.), MEGAlign (DNAStar Inc., 1228 S. Park St., Madison, Wis. 53715), and MUSCLE (version 3.6) (Edgar, 2004) for instance with default parameters. An “identity fraction” for aligned segments of a test sequence and a reference sequence is the number of identical components that are shared by the two aligned sequences divided by the total number of components in the portion of the reference sequence segment being aligned, that is, the entire reference sequence or a smaller defined part of the reference sequence. Percent sequence identity is represented as the identity fraction multiplied by 100. The comparison of one or more sequences may be to a full-length sequence or a portion thereof, or to a longer sequence. Primer sequences having a nucleotide sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full length of SEQ ID NO: 1 to 123 are within the scope of the present disclosure. 245761.000234 The term “resistance” is to be understood broadly and covers the range of the protection from a retardation up to a complete blocking of the development of the Cercospora leaf spot disease on plants of the genus Beta caused by the pathogen Cercospora beticola. A Cercospora resistant plant cell or resistant plant preferably shows resistance to the disease which this pathogen causes; for example, a resistance to Cercospora beticola is also a resistance to leaf spot disease. For example, an increase in the resistance can be measured via a reduced fungal biomass on the host plant; for this, the fungal DNA may be determined with the aid of quantitative PCR in comparison to the plant DNA in the infested plant tissue. An additional approach to the measurement of resistance is optical rating, wherein rating scores of 1 (not susceptible, healthy leaves and whole plant healthy) to 9 (very susceptible, dead leaves and plant with regrowth of new leaves) are awarded (Shane and Teng, 1992). The Cercospora resistance gene BvCR4 is a major resistance gene which confers high resistance to plants of the genus Beta, preferably sugar beet plants. The gene and its identification is described in International patent applications WO2020 / 169178 and WO2022 / 037967, respectively, the disclosure of which is incorporated herein in this entirety, and by Chen et al., 2023). A “sample” is intended to refer to any sample taken from a given field where a crop is grown, has been grown or will be grown. Preferably this crop is a plant of the genus Beta. The sample can be a soil sample, or a sample of plant material or plant parts taken from the crop grown in a given field. Preferably the sample of plant material is a leave sample or a sample of any other part of the crop plant. The sample of plant material can be a sample from a single plant or a sample with pooled plants material taken from several plants. Further, “sample” is intended to refer to any composition comprising or derived from, either directly or indirectly, a biological sample, source, or material. The sample may generally comprise DNA of a plant and / or fungal (preferably of Cercospora beticola) DNA and / or substantially or completely pure, purified, or isolated plant and / or fungal DNA (preferably of Cercospora beticola). A “biological sample” contains biological materials, including but not limited to DNA obtained or derived from, either directly or indirectly, the genome of a cell(s), tissue(s), seed(s), plant(s), plant part(s) found in the sample, which is preferable from plants of the genus Beta grown in the field and the fungus material growing in or on the plants of the genus Beta. In some embodiments, a sample or biological sample may comprise cell(s) of a plant of the genus Beta, tissue(s) of a plant of the genus Beta, seed(s) of a plant of the genus Beta, plant(s) of the genus Beta, and / or plant part(s) of one or more plant(s) of the genus Beta and / or the fungal (preferably Cercospora beticola) material growing thereon, whose cells or cellular membranes have been fractured (e.g., disrupted or opened) to release the contents of the cell(s) of one or more plant(s) of the genus Beta and / or the fungus (preferably Cercospora beticola) including genomic DNA and / or make the contents of the cell(s) of one or more plant(s) of the genus Beta and / or the fungus (preferably Cercospora beticola) including genomic DNA accessible or usable for assays or testing. “Directly” refers to directly obtaining DNA by a skilled artisan from the plant material of the genus Beta and / or fungal (preferably Cercospora beticola) genome by fracturing cells from material from plants of the genus Beta 245761.000234 and / or the fungus (preferably Cercospora beticola) (or by obtaining samples of material of a plant of the genus Beta and / or the fungus (preferably Cercospora beticola) that contain fractured cells from material of a plant of the genus Beta and / or the fungus (preferably Cercospora beticola) and exposing or using the genomic DNA from cells from material of a plant of the genus Beta and / or the fungus (preferably Cercospora beticola) for the purposes of detection. A “single nucleotide polymorphism” or SNP is a genetic variation between two samples of DNA wherein at least one nucleotide between the two samples is different. In most cases the samples belong to the same species and the comparison or alignment of the two samples is performed on the basis of homologues genomic regions. SNPs may cause allelic variations but not all SNPs need to occur within a functional genomic element like a gene. SNPs can be used two differentiate between for example different genotypes / haplotypes or may be used to screen and select for the presence of absence of a functional genomic element like for example a specific gene or its allelic variant. Due to genetic linkage SNPs need not to be within the functional genomic element which is to be selected. Examples for SNPs in the sense of the invention are given in Table 1 below. The detection or identification of SNPs may occur by a PCR involving two different forward primers and one common reverse primer. The technical details for such a detection or identification may be derived from passages below. As used herein, the term “tightly linked”, when used in the context of markers of the present invention (e.g., in the context of the polymorphisms which are genetically linked to the virulence of a given C. beticola strain), means that the markers are located on the same chromosome next to AvrCR4 such that they tend to be co-inherited and not independently assorted during meiosis. LIST OF SEQUENCES 1) Exemplary sequences for marker development in core genomic regions. SEQ ID NO. 1: >seq85720 …, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola. Region: CbHevensen 3870476..3870569 . This sequence marks the 5’ end of the relevant region. This region is detected via the marker assay sxcb001d01. SEQ ID NO. 2: >seq87992 …, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola. Region: CbHevensen 3950441..3950550. This region is detected via the marker assay sxcb002d01. SEQ ID NO.3: >seq57120, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola. Region: CbHevensen 3976640..3976715. This region is detected via the marker assay sxcb003d01. 245761.000234 SEQ ID NO.4: >seq89668, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola. Region: CbHevensen 4165155..4165235. This region is detected via the marker assay sxcb004d01. SEQ ID NO.5: >seq11413, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola. Region: CbHevensen 4165808..4165882. This region is detected via the marker assay sxcb005d01. SEQ ID NO.6: >seq67919, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola. Region: CbHevensen 4166613..4166683. This region is detected via the marker assay sxcb006d01. SEQ ID NO.7: >seq133971, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola. Region: CbHevensen 4172505..172578. This region is detected via the marker assay sxcb007d01. SEQ ID NO.8: >seq38543, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola. Region: CbHevensen 4178885..4178957. This region is detected via the marker assay sxcb008d01. SEQ ID NO.9: >seq89766, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola. Region: CbHevensen 4187806..4187927. This region is detected via the marker assay sxcb010d01. SEQ ID NO.10: >seq74531, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola. Region: CbHevensen 4192254..4192376 SEQ ID NO.11: >seq43197, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola. Region: CbHevensen 4192254..4192376. This sequence marks the 3’ end of the relevant region. This region is detected via the marker assay sxcb011d01. 2) Haplotype sequences of target gene used for assay development. SEQ ID NO. 12: Nucleotide sequence of avirulent haplotype of gene AvrCR4 known to be necessary for full functionality of BvCR4 mediated resistance. SEQ ID NO. 13: Nucleotide sequence of virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 176 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12. SEQ ID NO. 14: Nucleotide sequence of virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 73 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12. 245761.000234 SEQ ID NO. 15: Nucleotide sequence of virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 107 (C to T) compared to the avirulent haplotype of SEQ ID NO: 12. SEQ ID NO. 16: Nucleotide sequence of virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 11 (C to T), at position 289 (G to A), and at position 291 (G to A) compared to the avirulent haplotype of SEQ ID NO.12. SEQ ID NO. 17: Nucleotide sequence of virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 11 (C to T), at position 26 (C to T), at position 56 (G to A), at position 89 (C to T), at position 100 (G to A), at position 107 (C to T), at position 116 (G to A), at position 148 (C to T), at position 150 (C to T), at position 173 (C to A), at position 176 (G to A), at position 206 (C to T), at position 214 (C to T), at position 228 (G to A), at position 237 (G to A), at position 243 (C to T), at position 266 (C to T), at position 289 (G to A), at position 291 (G to A), and at position 307 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12. SEQ ID NO. 18: Nucleotide sequence of virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 268 (C to T) compared to the avirulent haplotype of SEQ ID NO: 12. SEQ ID NO. 19: Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 56 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12. SEQ ID NO. 20: Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 100 (G to A), at position 228 (G to A), at position 237 (G to A), and at position 291 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12. SEQ ID NO. 21: Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 116 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12. SEQ ID NO. 22: Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 11 (C to T), at position 26 (C to T), at position 56 (G to A), at position 89 (C to T), at position 100 (G to A), at position 107 (C to T), at position 116 (G to A), at position 148 (C to T), at position 150 (C to T), at position 173 (C to A), at position 176 (G to A), at position 187 (G to A), at position 206 (C to T), at position 214 (C to T), at position 228 (G to A), at position 237 (G to A), at position 243 (C to T), at position 266 (C to T), at position 268 (C to T), and at position 315 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12. SEQ ID NO. 23: Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 11 (C to T), at position 73 (G to 245761.000234 A), at position 206 (C to T), and at position 243 (C to T) compared to the avirulent haplotype of SEQ ID NO: 12. SEQ ID NO. 24: Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 11 (C to T), at position 26 (C to T), at position 100 (G to A), at position 107 (C to T), at position 116 (G to A), at position 214 (C to T), at position 243 (C to T), and at position 321 (C to T) compared to the avirulent haplotype of SEQ ID NO: 12. SEQ ID NO. 25: Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 31 (G to A), at position 58 (A to G), at position 59 (T to G), at position 61 (G to C), at position 80 (T to C), at position 100 (G to A), at position 102 (T to A), and at position 267 (A to C) compared to the avirulent haplotype of SEQ ID NO: 12. 3) Exemplary subsequences used for co-dominant SNP marker development. SEQ ID NO.26: >10037228@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb012s01. SEQ ID NO.27: >10037229@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb013s01. SEQ ID NO.28: >10037230@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb014s014. SEQ ID NO.29: >10037231@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb015s01. SEQ ID NO.30: >10037232@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb016s01. SEQ ID NO.31: >10037233@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay, sxcb017s01. SEQ ID NO.32: >10037234@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb018s01. SEQ ID NO.33: >10037235@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb019s01. SEQ ID NO.34: >10037236@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb020s01. SEQ ID NO.35: >10037237@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb021s01. 245761.000234 4) Exemplary subsequences used for dominant deletion marker development. SEQ ID NO.36: >1_4089400-4089528, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb022s01. SEQ ID NO. 37: 1_4089490-4089620, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb023s01. SEQ ID NO. 38: 1_4089617-4089738, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb024s01. SEQ ID NO.39: >1_4089640-4089761, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb025s01. 5) Primer sequences for assays SEQ ID NO: 40: Nucleotide sequence of primer sxcb012s01_A SEQ ID NO: 41: Nucleotide sequence of primer sxcb013s01_A SEQ ID NO: 42: Nucleotide sequence of primer sxcb014s01_A SEQ ID NO: 43: Nucleotide sequence of primer sxcb015s01_A SEQ ID NO: 44: Nucleotide sequence of primer sxcb016s01_A SEQ ID NO: 45: Nucleotide sequence of primer sxcb017s01_A SEQ ID NO: 46: Nucleotide sequence of primer sxcb018s01_A SEQ ID NO: 47: Nucleotide sequence of primer sxcb019s01_A SEQ ID NO: 48: Nucleotide sequence of primer sxcb021s01_A SEQ ID NO: 49: Nucleotide sequence of primer sxcb001d01_A SEQ ID NO: 50: Nucleotide sequence of primer sxcb002d01_A SEQ ID NO: 51: Nucleotide sequence of primer sxcb003d01_A SEQ ID NO: 52: Nucleotide sequence of primer sxcb004d01_A SEQ ID NO: 53: Nucleotide sequence of primer sxcb005d01_A SEQ ID NO: 54: Nucleotide sequence of primer sxcb006d01_A SEQ ID NO: 55: Nucleotide sequence of primer sxcb007d01_A SEQ ID NO: 56: Nucleotide sequence of primer sxcb008d01_A SEQ ID NO: 57: Nucleotide sequence of primer sxcb009d01_A 245761.000234 SEQ ID NO: 58: Nucleotide sequence of primer sxcb010d01_A SEQ ID NO: 59: Nucleotide sequence of primer sxcb011d01_A SEQ ID NO: 60: Nucleotide sequence of primer sxcb023d01_A SEQ ID NO: 61: Nucleotide sequence of primer sxcb024d01_A SEQ ID NO: 62: Nucleotide sequence of primer sxcb025d01_A SEQ ID NO: 63: Nucleotide sequence of primer sxcb012s01_B SEQ ID NO: 64: Nucleotide sequence of primer sxcb013s01_B SEQ ID NO: 65: Nucleotide sequence of primer sxcb014s01_B SEQ ID NO: 66: Nucleotide sequence of primer sxcb015s01_B SEQ ID NO: 67: Nucleotide sequence of primer sxcb016s01_B SEQ ID NO: 68: Nucleotide sequence of primer sxcb017s01_B SEQ ID NO: 69: Nucleotide sequence of primer sxcb018s01_B SEQ ID NO: 70: Nucleotide sequence of primer sxcb019s01_B SEQ ID NO: 71: Nucleotide sequence of primer sxcb021s01_B SEQ ID NO: 72: Nucleotide sequence of primer sxcb001d01_B SEQ ID NO: 73: Nucleotide sequence of primer sxcb002d01_B SEQ ID NO: 74: Nucleotide sequence of primer sxcb003d01_B SEQ ID NO: 75: Nucleotide sequence of primer sxcb004d01_B SEQ ID NO: 76: Nucleotide sequence of primer sxcb005d01_B SEQ ID NO: 77: Nucleotide sequence of primer sxcb006d01_B SEQ ID NO: 78: Nucleotide sequence of primer sxcb007d01_B SEQ ID NO: 79: Nucleotide sequence of primer sxcb008d01_B SEQ ID NO: 80: Nucleotide sequence of primer sxcb009d01_B SEQ ID NO: 81: Nucleotide sequence of primer sxcb010d01_B SEQ ID NO: 82: Nucleotide sequence of primer sxcb011d01_B SEQ ID NO: 83: Nucleotide sequence of primer sxcb023d01_B SEQ ID NO: 84: Nucleotide sequence of primer sxcb024d01_B 245761.000234 SEQ ID NO: 85: Nucleotide sequence of primer sxcb025d01_B SEQ ID NO: 86: Nucleotide sequence of primer sxcb012s01_G SEQ ID NO: 87: Nucleotide sequence of primer sxcb013s01_G SEQ ID NO: 88: Nucleotide sequence of primer sxcb014s01_G SEQ ID NO: 89: Nucleotide sequence of primer sxcb015s01_G SEQ ID NO: 90: Nucleotide sequence of primer sxcb016s01_G SEQ ID NO: 91: Nucleotide sequence of primer sxcb017s01_G SEQ ID NO: 92: Nucleotide sequence of primer sxcb018s01_G SEQ ID NO: 93: Nucleotide sequence of primer sxcb019s01_G SEQ ID NO: 94: Nucleotide sequence of primer sxcb021s01_G SEQ ID NO: 95: Nucleotide sequence of primer sxcb001d01_G SEQ ID NO: 96: Nucleotide sequence of primer sxcb002d01_G SEQ ID NO: 97: Nucleotide sequence of primer sxcb003d01_G SEQ ID NO: 98: Nucleotide sequence of primer sxcb004d01_G SEQ ID NO: 99: Nucleotide sequence of primer sxcb005d01_G SEQ ID NO: 100: Nucleotide sequence of primer sxcb006d01_G SEQ ID NO: 101: Nucleotide sequence of primer sxcb007d01_G SEQ ID NO: 102: Nucleotide sequence of primer sxcb008d01_G SEQ ID NO: 103: Nucleotide sequence of primer sxcb009d01_G SEQ ID NO: 104: Nucleotide sequence of primer sxcb010d01_G SEQ ID NO: 105: Nucleotide sequence of primer sxcb011d01_G SEQ ID NO: 106: Nucleotide sequence of primer sxcb023d01_G SEQ ID NO: 107: Nucleotide sequence of primer sxcb024d01_G SEQ ID NO: 108: Nucleotide sequence of primer sxcb025d01_G 6) SSRC primer from Table 2 SEQ ID NO: 109: Nucleotide sequence of forward primer SSRCb1-F for SSR loci SSRCb1 SEQ ID NO: 110: Nucleotide sequence of reverse primer SSRCb1-R for SSR loci SSRCb1 245761.000234 SEQ ID NO: 111: Nucleotide sequence of forward primer SSRCb21-F for SSR loci SSRCb21 SEQ ID NO: 112: Nucleotide sequence of reverse primer SSRCb21-R for SSR loci SSRCb21 SEQ ID NO: 113: Nucleotide sequence of forward primer SSRCb22-F for SSR loci SSRCb22 SEQ ID NO: 114: Nucleotide sequence of reverse primer SSRCb22-R for SSR loci SSRCb22 SEQ ID NO: 115: Nucleotide sequence of forward primer SSRCb25-F for SSR loci SSRCb25 SEQ ID NO: 116: Nucleotide sequence of reverse primer SSRCb25-R for SSR loci SSRCb25 SEQ ID NO: 117: Nucleotide sequence of forward primer SSRCb27-F for SSR loci SSRCb27 SEQ ID NO: 118: Nucleotide sequence of reverse primer SSRCb27-R for SSR loci SSRCb27 SEQ ID NO: 119: Nucleotide sequence of forward primer SSRCb3-F for SSR loci SSRCb3 SEQ ID NO: 120: Nucleotide sequence of reverse primer SSRCb3-R for SSR loci SSRCb3 SEQ ID NO: 121: Nucleotide sequence of primer sxcb022d01_A SEQ ID NO: 122: Nucleotide sequence of primer sxcb022d01_B SEQ ID NO: 123: Nucleotide sequence of primer sxcb022d01_G SEQ ID NO: 1 >seq85720 TCGAAGTTGCTCTCTTCTCCAATCGGACGTGCGGCGCGTTCAGATCGTCGCCGTCTGAATCGGTCTCGCT GTCTCGCGCGAAATACTCGTACTT^ SEQ ID NO: 2 >seq87992 CCCAAGTAACCAGTACCAAATCCATCGAGAGTGACTACAATGTATCCAAGGCTGCTTGCAACAAAAGAT TGGAAATCGACAGTGAACTGGCGGTCAACCTGTTGATATCC^ SEQ ID NO: 3 >seq57120 GATGCTACGCATGGAAGCCCTTCGAGTCCTTCTGGGAGACAGTCTATCGGAACCATGGAATCTGGATGG ACCGCAG^ SEQ ID NO: 4 >seq89668 245761.000234 CTGCCAGAATAAGCATTTTTGAAGTGACAGCCGCACAATGTTGGTCCACGATCTTCCCGTAATTGGGAGT CTGTCTCCAAA^ SEQ ID NO: 5 >seq11413 GGTCGATCTTCTCAAGTACTACAACTGTGAGTGAATCACATCCAACGCTACAGCTATCCACGAAACAGCT ACTGATCAGCATTT^ SEQ ID NO: 6 >seq67919 ATTCGTCCCCGAAGGAACCCAGATCGGCGTCCATCAACTCTCAACTTACCGCAACGAAGCGAATTTCAAG A^ SEQ ID NO: 7 >seq133971 AAATATGGTGAGCGATTCTTTTGCGATAATACATATGTCGAGAACGGTTTTTCTTGGGAGGAAGCTGTG CTTGG^ SEQ ID NO: 8 >seq38543 CGGACATCGTATGTTGTTGTTGGTCTTTGAAGGTGAAAGATGTCGTAGTCACGAAACAATTTGGATATGT TTG^ SEQ ID NO: 9 >seq89766 TTCGAGGCGTTTGGCGATTTTGGCGACGTCGTCTAGTGTTGCGGGCGTTGTTTTTGGTTCGTCGCTTTCT GATTGCGTGAGACTATCGAGCGTCCGGGGCTCGAGTCTTCGTGGTTCTAGCC^ SEQ ID NO: 10 >seq74531 CCCTCGAACAATTACTGACCCGTCAATACTAGCTACCGATGCATCACGAACTCAGAGAGAAGTGGGAGT ACAGTAATGTGCCTTACACGGCTGTAGCACACGCTGTGGAAACAGTAACTGGGG^ SEQ ID NO: 11 >seq43197 245761.000234 ATAATTATGTGTTTGATAACCGTAACCAATGCTCACACCTCTTACTCTTAGGGAATGCGTGGCCTAGGAA AATACTCCAAACGCGG^ SEQ ID NO: 12 >haplotype1 ATGCTCGCTTCAATATTCCTCCTTTCACTTGCTACTATTGCTTCTGCCGGTAACTGTATCGAAAGGGGCTA TGGTCTACTAGATTGCCCAAATCATACTGATAGATCATATTACTGGAGAGTAGGTACCGCAGATTTTTAG GACGCTCACAAGTGATTTCACTTTTTAGCGTGCTGATGATTTCTTGGCAGTGTCTGCCTTCCGCCAGAGA CCCAGCGAACAAAGATGGCCCTCCTGGTAATCAGTGTCGCTTTGTATCGCGCGACACAGACGGAACGAA GTATTACTGTGTATGTCTTGTTCCCTGCCCTATTGAAAGTCAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 13 >haplotype2 ATGCTCGCTTCAATATTCCTCCTTTCACTTGCTACTATTGCTTCTGCCGGTAACTGTATCGAAAGGGGCTA TGGTCTACTAGATTGCCCAAATCATACTAATAGATCATATTACTGGAGAGTAGGTACCGCAGATTTTTAG GACGCTCACAAGTGATTTCACTTTTTAGCGTGCTAATGATTTCTTGGCAGTGTCTGCCTTCCGCCAGAGAC CCAGCGAACAAAGATGGCCCTCCTGGTAATCAGTGTCGCTTTGTATCGCGCGACACAGACGGAACGAAG TATTACTGTGTATGTCTTGTTCCCTGCCCTATTGAAAGTCAAGCTAAGCAGTATACGTAG SEQ ID NO: 14 >haplotype3 ATGCTCGCTTCAATATTCCTCCTTTCACTTGCTACTATTGCTTCTGCCGGTAACTGTATCGAAAGGGGCTA TAGTCTACTAGATTGCCCAAATCATACTGATAGATCATATTACTGGAGAGTAGGTACCGCAGATTTTTAG GACGCTCACAAGTGATTTCACTTTTTAGCGTGCTGATGATTTCTTGGCAGTGTCTGCCTTCCGCCAGAGA CCCAGCGAACAAAGATGGCCCTCCTGGTAATCAGTGTCGCTTTGTATCGCGCGACACAGACGGAACGAA GTATTACTGTGTATGTCTTGTTCCCTGCCCTATTGAAAGTCAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 15 >haplotype4 ATGCTCGCTTCAATATTCCTCCTTTCACTTGCTACTATTGCTTCTGCCGGTAACTGTATCGAAAGGGGCTA TGGTCTACTAGATTGCCCAAATCATACTGATAGATTATATTACTGGAGAGTAGGTACCGCAGATTTTTAG GACGCTCACAAGTGATTTCACTTTTTAGCGTGCTGATGATTTCTTGGCAGTGTCTGCCTTCCGCCAGAGA 245761.000234 CCCAGCGAACAAAGATGGCCCTCCTGGTAATCAGTGTCGCTTTGTATCGCGCGACACAGACGGAACGAA GTATTACTGTGTATGTCTTGTTCCCTGCCCTATTGAAAGTCAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 16 >haplotype5 ATGCTCGCTTTAATATTCCTCCTTTCACTTGCTACTATTGCTTCTGCCGGTAACTGTATCGAAAGGGGCTA TGGTCTACTAGATTGCCCAAATCATACTGATAGATCATATTACTGGAGAGTAGGTACCGCAGATTTTTAG GACGCTCACAAGTGATTTCACTTTTTAGCGTGCTGATGATTTCTTGGCAGTGTCTGCCTTCCGCCAGAGA CCCAGCGAACAAAGATGGCCCTCCTGGTAATCAGTGTCGCTTTGTATCGCGCGACACAGACGGAACGAA GTATTACTATATATGTCTTGTTCCCTGCCCTATTGAAAGTCAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 17 >haplotype6 ATGCTCGCTTTAATATTCCTCCTTTTACTTGCTACTATTGCTTCTGCCGGTAACTATATCGAAAGGGGCTAT GGTCTACTAGATTGCCTAAATCATACTAATAGATTATATTACTAGAGAGTAGGTACCGCAGATTTTTAGG ACGCTTATAAGTGATTTCACTTTTTAGCGTACTAATGATTTCTTGGCAGTGTCTGCCTTCCGCTAGAGACC TAGCGAACAAAGATAGCCCTCCTAGTAATTAGTGTCGCTTTGTATCGCGCGATACAGACGGAACGAAGT ATTACTATATATGTCTTGTTCCCTACCCTATTGAAAGTCAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 18 >haplotype7 ATGCTCGCTTCAATATTCCTCCTTTCACTTGCTACTATTGCTTCTGCCGGTAACTGTATCGAAAGGGGCTA TGGTCTACTAGATTGCCCAAATCATACTGATAGATCATATTACTGGAGAGTAGGTACCGCAGATTTTTAG GACGCTCACAAGTGATTTCACTTTTTAGCGTGCTGATGATTTCTTGGCAGTGTCTGCCTTCCGCCAGAGA CCCAGCGAACAAAGATGGCCCTCCTGGTAATCAGTGTCGCTTTGTATCGCGCGACATAGACGGAACGAA GTATTACTGTGTATGTCTTGTTCCCTGCCCTATTGAAAGTCAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 19 >haplotype8 ATGCTCGCTTCAATATTCCTCCTTTCACTTGCTACTATTGCTTCTGCCGGTAACTATATCGAAAGGGGCTA TGGTCTACTAGATTGCCCAAATCATACTGATAGATCATATTACTGGAGAGTAGGTACCGCAGATTTTTAG GACGCTCACAAGTGATTTCACTTTTTAGCGTGCTGATGATTTCTTGGCAGTGTCTGCCTTCCGCCAGAGA 245761.000234 CCCAGCGAACAAAGATGGCCCTCCTGGTAATCAGTGTCGCTTTGTATCGCGCGACACAGACGGAACGAA GTATTACTGTGTATGTCTTGTTCCCTGCCCTATTGAAAGTCAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 20 >haplotype9 ATGCTCGCTTCAATATTCCTCCTTTCACTTGCTACTATTGCTTCTGCCGGTAACTGTATCGAAAGGGGCTA TGGTCTACTAGATTGCCCAAATCATACTAATAGATCATATTACTGGAGAGTAGGTACCGCAGATTTTTAG GACGCTCACAAGTGATTTCACTTTTTAGCGTGCTGATGATTTCTTGGCAGTGTCTGCCTTCCGCCAGAGA CCCAGCGAACAAAGATAGCCCTCCTAGTAATCAGTGTCGCTTTGTATCGCGCGACACAGACGGAACGAA GTATTACTGTATATGTCTTGTTCCCTGCCCTATTGAAAGTCAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 21 >haplotype10 ATGCTCGCTTCAATATTCCTCCTTTCACTTGCTACTATTGCTTCTGCCGGTAACTGTATCGAAAGGGGCTA TGGTCTACTAGATTGCCCAAATCATACTGATAGATCATATTACTAGAGAGTAGGTACCGCAGATTTTTAG GACGCTCACAAGTGATTTCACTTTTTAGCGTGCTGATGATTTCTTGGCAGTGTCTGCCTTCCGCCAGAGA CCCAGCGAACAAAGATGGCCCTCCTGGTAATCAGTGTCGCTTTGTATCGCGCGACACAGACGGAACGAA GTATTACTGTGTATGTCTTGTTCCCTGCCCTATTGAAAGTCAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 22 >haplotype11 ATGCTCGCTTTAATATTCCTCCTTTTACTTGCTACTATTGCTTCTGCCGGTAACTATATCGAAAGGGGCTAT GGTCTACTAGATTGCCTAAATCATACTAATAGATTATATTACTAGAGAGTAGGTACCGCAGATTTTTAGG ACGCTTATAAGTGATTTCACTTTTTAGCGTACTAATGATTTCTTAGCAGTGTCTGCCTTCCGCTAGAGACC TAGCGAACAAAGATAGCCCTCCTAGTAATTAGTGTCGCTTTGTATCGCGCGATATAGACGGAACGAAGT ATTACTGTGTATGTCTTGTTCCCTGCCCTATTAAAAGTCAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 23 >haplotype12 ATGCTCGCTTTAATATTCCTCCTTTCACTTGCTACTATTGCTTCTGCCGGTAACTGTATCGAAAGGGGCTA TAGTCTACTAGATTGCCCAAATCATACTGATAGATCATATTACTGGAGAGTAGGTACCGCAGATTTTTAG GACGCTCACAAGTGATTTCACTTTTTAGCGTGCTGATGATTTCTTGGCAGTGTCTGCCTTCCGCTAGAGA 245761.000234 CCCAGCGAACAAAGATGGCCCTCCTGGTAATTAGTGTCGCTTTGTATCGCGCGACACAGACGGAACGAA GTATTACTGTGTATGTCTTGTTCCCTGCCCTATTGAAAGTCAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 24 >haplotype13 ATGCTCGCTTTAATATTCCTCCTTTTACTTGCTACTATTGCTTCTGCCGGTAACTGTATCGAAAGGGGCTA TGGTCTACTAGATTGCCCAAATCATACTAATAGATTATATTACTAGAGAGTAGGTACCGCAGATTTTTAG GACGCTCACAAGTGATTTCACTTTTTAGCGTGCTGATGATTTCTTGGCAGTGTCTGCCTTCCGCCAGAGA CCTAGCGAACAAAGATGGCCCTCCTGGTAATTAGTGTCGCTTTGTATCGCGCGACACAGACGGAACGAA GTATTACTGTGTATGTCTTGTTCCCTGCCCTATTGAAAGTTAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 25 >haplotype14 ATGCTCGCTTCAATATTCCTCCTTTCACTTACTACTATTGCTTCTGCCGGTAACTGTGGCCAAAGGGGCTA TGGTCTACCAGATTGCCCAAATCATACTAAAAGATCATATTACTGGAGAGTAGGTACCGCAGATTTTTAG GACGCTCACAAGTGATTTCACTTTTTAGCGTGCTGATGATTTCTTGGCAGTGTCTGCCTTCCGCCAGAGA CCCAGCGAACAAAGATGGCCCTCCTGGTAATCAGTGTCGCTTTGTATCGCGCGACCCAGACGGAACGAA GTATTACTGTGTATGTCTTGTTCCCTGCCCTATTGAAAGTCAAGCTAAGCAGTATACGTAG^ SEQ ID NO: 26 >10037228@101 GCTTYAATATTCCTCCTTTYACTTGCTACTATTGCTTCTGCCGGTAACTRTATCGAAAGGGGCTATRGTCTA CTAGATTGCCYAAATCATACTRATAGATYATATTACTRGAGAGTAGGTACCGCAGATTTTTAGGACGCTN NNAAGTGATTTCACTTTTTAGCGTNNNNATGATTTCTTGGCAGTGTCTGCCTTCCGCYA^ SEQ ID NO: 27 >10037229@101 CACTACTYAATTACAAGTTGTCTAGATTATTACGTCTANNGAGACATGCTCGCTTYAATATTCCTCCTTTYA CTTGCTACTATTGCTTCTGCCGGTAACTRTATCGAAAGGGGCTATRGTCTACTAGATTGCCYAAATCATAC TRATAGATYATATTACTRGAGAGTAGGTACCGCAGATTTTTAGGACGCTNNNAAGTGA^ SEQ ID NO: 28 >10037230@101 245761.000234 TTCCTCCTTTYACTTGCTACTATTGCTTCTGCCGGTAACTRTATCGAAAGGGGCTATRGTCTACTAGATTG CCYAAATCATACTRATAGATYATATTACTRGAGAGTAGGTACCGCAGATTTTTAGGACGCTNNNAAGTG ATTTCACTTTTTAGCGTNNNNATGATTTCTTGGCAGTGTCTGCCTTCCGCYAGAGACCYAG^ SEQ ID NO: 29 >10037231@101 TTTAGGACGCTNNNAAGTGATTTCACTTTTTAGCGTNNNNATGATTTCTTGGCAGTGTCTGCCTTCCGCY AGAGACCYAGCGAACAAAGATRGCCCTCCTRGTAATYAGTGTCGCTTTGTATCGCGCGANNNAGACGGA ACGAAGTATTACTNNNTATGTCTTGTTCCCTRCCCTATTRAAAGTYAAGCTAAGCAGTATAC^ SEQ ID NO: 30 >10037232@101 ACGCTNNNAAGTGATTTCACTTTTTAGCGTNNNNATGATTTCTTGGCAGTGTCTGCCTTCCGCYAGAGAC CYAGCGAACAAAGATRGCCCTCCTRGTAATYAGTGTCGCTTTGTATCGCGCGANNNAGACGGAACGAAG TATTACTNNNTATGTCTTGTTCCCTRCCCTATTRAAAGTYAAGCTAAGCAGTATACGTAGTG^ SEQ ID NO: 31 >10037233@101 TATTGCACGTYATTTCCTGTTCTAGTAGACTAACCTTTTACGANNNACTACTYAATTACAAGTTGTCTAGA TTATTACGTCTANNGAGACATGCTCGCTTYAATATTCCTCCTTTYACTTGCTACTATTGCTTCTGCCGGTAA CTRTATCGAAAGGGGCTATRGTCTACTAGATTGCCYAAATCATACTRATAGATYATAT^ SEQ ID NO: 32 >10037234@101 CCGCAGATTTTTAGGACGCTNNNAAGTGATTTCACTTTTTAGCGTNNNNATGATTTCTTGGCAGTGTCTG CCTTCCGCYAGAGACCYAGCGAACAAAGATRGCCCTCCTRGTAATYAGTGTCGCTTTGTATCGCGCGANN NAGACGGAACGAAGTATTACTNNNTATGTCTTGTTCCCTRCCCTATTRAAAGTYAAGCTAA^ SEQ ID NO: 33 >10037235@101 TTGTCTAGATTATTACGTCTANNGAGACATGCTCGCTTYAATATTCCTCCTTTYACTTGCTACTATTGCTTC TGCCGGTAACTRTATCGAAAGGGGCTATRGTCTACTAGATTGCCYAAATCATACTRATAGATYATATTACT RGAGAGTAGGTACCGCAGATTTTTAGGACGCTNNNAAGTGATTTCACTTTTTAGCGTNNNN^ SEQ ID NO: 34 245761.000234 >10037236@101 TYATATTACTRGAGAGTAGGTACCGCAGATTTTTAGGACGCTNNNAAGTGATTTCACTTTTTAGCGTNNN NATGATTTCTTGGCAGTGTCTGCCTTCCGCYAGAGACCYAGCGAACAAAGATRGCCCTCCTRGTAATYAG TGTCGCTTTGTATCGCGCGANNNAGACGGAACGAAGTATTACTNNNTATGTCTTGTTCCCT^ SEQ ID NO: 35 >10037237@101 CATGCTCGCTTYAATATTCCTCCTTTYACTTGCTACTATTGCTTCTGCCGGTAACTRTATCGAAAGGGGCTA TRGTCTACTAGATTGCCYAAATCATACTRATAGATYATATTACTRGAGAGTAGGTACCGCAGATTTTTAG GACGCTNNNAAGTGATTTCACTTTTTAGCGTNNNNATGATTTCTTGGCAGTGTCTGCCT^ SEQ ID NO: 36 >1_4089400-4089528 CTAGATTATTACGTCTACGGAGACATGCTCGCTTCAATATTCCTCCTTTCACTTGCTACTATTGCTTCTGCC GGTAACTGTATCGAAAGGGGCTATGGTCTACTAGATTGCCCAAATCATACTGATAGA SEQ ID NO: 37 1_4089490-4089620 GGCTATGGTCTACTAGATTGCCCAAATCATACTGATAGATCATATTACTGGAGAGTAGGTACCGCAGATT TTTAGGACGCTCACAAGTGATTTCACTTTTTAGCGTGCTGATGATTTCTTGGCAGTGTCTG SEQ ID NO: 38 1_4089617-4089738 TCTGCCTTCCGCCAGAGACCCAGCGAACAAAGATGGCCCTCCTGGTAATCAGTGTCGCTTTGTATCGCGC GACACAGACGGAACGAAGTATTACTGTGTATGTCTTGTTCCCTGCCCTATTG SEQ ID NO: 39 >1_4089640-4089761 CGAACAAAGATGGCCCTCCTGGTAATCAGTGTCGCTTTGTATCGCGCGACACAGACGGAACGAAGTATT ACTGTGTATGTCTTGTTCCCTGCCCTATTGAAAGTCAAGCTAAGCAGTATACG SEQ ID NO: 40 sxcb012s01_A GAAGGTGACCAAGTTCATGCTGCGGTACCTACTCTCYAGTAATATG SEQ ID NO: 41 245761.000234 sxcb013s01_A GAAGGTGACCAAGTTCATGCTAGTAGACYATAGCCCCTTTCGATAT SEQ ID NO: 42 sxcb014s01_A GAAGGTGACCAAGTTCATGCTAAAAATCTGCGGTACCTACTCTCT SEQ ID NO: 43 sxcb015s01_A GAAGGTGACCAAGTTCATGCTAGCGAACAAAGATRGCCCTCCTA SEQ ID NO: 44 sxcb016s01_A GAAGGTGACCAAGTTCATGCTAGCGAACAAAGATRGCCCTCCTA SEQ ID NO: 45 sxcb017s01_A GAAGGTGACCAAGTTCATGCTAATAGTAGCAAGTRAAAGGAGGAATATTG SEQ ID NO: 46 sxcb018s01_A GAAGGTGACCAAGTTCATGCTAGAGACCYAGCGAACAAAGATA SEQ ID NO: 47 sxcb019s01_A GAAGGTGACCAAGTTCATGCTAGTATGATTTRGGCAATCTAGTAGACT SEQ ID NO: 48 sxcb021s01_A GAAGGTGACCAAGTTCATGCTGTCTACTAGATTGCCYAAATCATACTA SEQ ID NO: 49 sxcb001d01_A GAAGGTGACCAAGTTCATGCTGCGGCGCGTTCAGATCGTCA SEQ ID NO: 50 sxcb002d01_A GAAGGTGACCAAGTTCATGCTATCGAGAGTGACTACAATGTATCCAT 245761.000234 SEQ ID NO: 51 sxcb003d01_A GAAGGTGACCAAGTTCATGCTGAGTCCTTCTGGGAGACAGTCA SEQ ID NO: 52 sxcb004d01_A GAAGGTGACCAAGTTCATGCTAATTACGGGAAGATCGTGGACCAAA SEQ ID NO: 53 sxcb005d01_A GAAGGTGACCAAGTTCATGCTTTCGTGGATAGCTGTAGCGTTC SEQ ID NO: 54 sxcb006d01_A GAAGGTGACCAAGTTCATGCTCGTTGCGGTAAGTTGAGAGTTGC SEQ ID NO: 55 sxcb007d01_A GAAGGTGACCAAGTTCATGCTCCTCCCAAGAAAAACCGTTCTCC SEQ ID NO: 56 sxcb008d01_A GAAGGTGACCAAGTTCATGCTATGTTGTTGTTGGTCTTTGAAGGTGAT SEQ ID NO: 57 sxcb009d01_A GAAGGTGACCAAGTTCATGCTGGGCGTTGTTTTTGGTTCGTCGA SEQ ID NO: 58 sxcb010d01_A GAAGGTGACCAAGTTCATGCTGTACTCCCACTTCTCTCTGAGTC SEQ ID NO: 59 sxcb011d01_A GAAGGTGACCAAGTTCATGCTCCAATGCTCACACCTCTTACTCTTAT SEQ ID NO: 60 sxcb023d01_A 245761.000234 GAAGGTGACCAAGTTCATGCTAATCACTTGTGAGCGTCCTAAAAATCT SEQ ID NO: 61 sxcb024d01_A GAAGGTGACCAAGTTCATGCTCCTGGTAATCAGTGTCGCTTT SEQ ID NO: 62 sxcb025d01_A GAAGGTGACCAAGTTCATGCTCGCGCGACACAGACGGAAC SEQ ID NO: 63 sxcb012s01_B GAAGGTCGGAGTCAACGGATTGCGGTACCTACTCTCYAGTAATATA SEQ ID NO: 64 sxcb013s01_B GAAGGTCGGAGTCAACGGATTGTAGACYATAGCCCCTTTCGATAC SEQ ID NO: 65 sxcb014s01_B GAAGGTCGGAGTCAACGGATTAAAAATCTGCGGTACCTACTCTCC SEQ ID NO: 66 sxcb015s01_B GAAGGTCGGAGTCAACGGATTGCGAACAAAGATRGCCCTCCTG SEQ ID NO: 67 sxcb016s01_B GAAGGTCGGAGTCAACGGATTCGCGCGATACAAAGCGACACTA SEQ ID NO: 68 sxcb017s01_B GAAGGTCGGAGTCAACGGATTCAATAGTAGCAAGTRAAAGGAGGAATATTA SEQ ID NO: 69 sxcb018s01_B GAAGGTCGGAGTCAACGGATTAGAGACCYAGCGAACAAAGATG SEQ ID NO: 70 245761.000234 sxcb019s01_B GAAGGTCGGAGTCAACGGATTGTATGATTTRGGCAATCTAGTAGACC SEQ ID NO: 71 sxcb021s01_B GAAGGTCGGAGTCAACGGATTGTCTACTAGATTGCCYAAATCATACTG SEQ ID NO: 72 sxcb001d01_B GAAGGTCGGAGTCAACGGATTCGGCGCGTTCAGATCGTCG SEQ ID NO: 73 sxcb002d01_B GAAGGTCGGAGTCAACGGATTATCGAGAGTGACTACAATGTATCCAA SEQ ID NO: 74 sxcb003d01_B GAAGGTCGGAGTCAACGGATTGAGTCCTTCTGGGAGACAGTCT SEQ ID NO: 75 sxcb004d01_B GAAGGTCGGAGTCAACGGATTACGGGAAGATCGTGGACCAAC SEQ ID NO: 76 sxcb005d01_B GAAGGTCGGAGTCAACGGATTTCGTGGATAGCTGTAGCGTTG SEQ ID NO: 77 sxcb006d01_B GAAGGTCGGAGTCAACGGATTCGTTGCGGTAAGTTGAGAGTTGA SEQ ID NO: 78 sxcb007d01_B GAAGGTCGGAGTCAACGGATTCCTCCCAAGAAAAACCGTTCTCG SEQ ID NO: 79 sxcb008d01_B GAAGGTCGGAGTCAACGGATTATGTTGTTGTTGGTCTTTGAAGGTGAA 245761.000234 SEQ ID NO: 80 sxcb009d01_B GAAGGTCGGAGTCAACGGATTGGCGTTGTTTTTGGTTCGTCGC SEQ ID NO: 81 sxcb010d01_B GAAGGTCGGAGTCAACGGATTGTACTCCCACTTCTCTCTGAGTT SEQ ID NO: 82 sxcb011d01_B GAAGGTCGGAGTCAACGGATTCAATGCTCACACCTCTTACTCTTAG SEQ ID NO: 83 sxcb023d01_B GAAGGTCGGAGTCAACGGATTCACTTGTGAGCGTCCTAAAAATCG SEQ ID NO: 84 sxcb024d01_B GAAGGTCGGAGTCAACGGATTCTCCTGGTAATCAGTGTCGCTTA SEQ ID NO: 85 sxcb025d01_B GAAGGTCGGAGTCAACGGATTATCGCGCGACACAGACGGAAA SEQ ID NO: 86 sxcb012s01_G TCGAAAGGGGCTATRGTCTACTAGATT SEQ ID NO: 87 sxcb013s01_G CTTGCTACTATTGCTTCTGCCGGTA SEQ ID NO: 88 sxcb014s01_G TCGAAAGGGGCTATRGTCTACTAGATT SEQ ID NO: 89 sxcb015s01_G 245761.000234 CGCGCGATACAAAGCGACACTRAT SEQ ID NO: 90 sxcb016s01_G AGCGAACAAAGATRGCCCTCCT SEQ ID NO: 91 sxcb017s01_G AATTACAAGTTGTCTAGATTATTACGTCTA SEQ ID NO: 92 sxcb018s01_G GCGCGATACAAAGCGACACT SEQ ID NO: 93 sxcb019s01_G TTGCTTCTGCCGGTAACTRTATCGAAA SEQ ID NO: 94 sxcb021s01_G GCGTCCTAAAAATCTGCGGTACCTA SEQ ID NO: 95 sxcb001d01_G CGCGAGACAGCGAGACCGATT SEQ ID NO: 96 sxcb002d01_G CACTGTCGATTTCCAATCTTTTGTTGCAA SEQ ID NO: 97 sxcb003d01_G TCCATCCAGATTCCATGGTTCCGAT SEQ ID NO: 98 sxcb004d01_G GCATTTTTGAAGTGACAGCCGCACAA SEQ ID NO: 99 245761.000234 sxcb005d01_G CAAGTACTACAACTGTGAGTGAATCACAT SEQ ID NO: 100 sxcb006d01_G TCGTCCCCGAAGGAACCCAGAT SEQ ID NO: 101 sxcb007d01_G GGTGAGCGATTCTTTTGCGATAATACATA SEQ ID NO: 102 sxcb008d01_G CATATCCAAATTGTTTCGTGACTACGACAT SEQ ID NO: 103 sxcb009d01_G GCTCGATAGTCTCACGCAATCAGAA SEQ ID NO: 104 sxcb010d01_G CCGTCAATACTAGCTACCGATGCAT SEQ ID NO: 105 sxcb011d01_G GGAGTATTTTCCTAGGCCACGCATT SEQ ID NO: 106 sxcb023d01_G CTGATAGATCATATTACTGGAGAGTAGGTA SEQ ID NO: 107 sxcb024d01_G GGAACAAGACATACACAGTAATACTTCGTT SEQ ID NO: 108 sxcb025d01_G GGCAGGGAACAAGACATACACAGTA 245761.000234 SEQ ID NO: 109 SSRCb1-F TGCGATCTGGGCATAAATATC SEQ ID NO: 110 SSRCb1-R AGATTTGCATTTGCCCACAC SEQ ID NO: 111 SSRCb21-F GACTTTGGCATTCGAGAAGATGG SEQ ID NO: 112 SSRCb21-R CCACTAAACGTATCTCTTTGCTGT SEQ ID NO: 113 SSRCb22-F GCCACTTCATTACCACCTTGAAT SEQ ID NO: 114 SSRCb22-R TGAGCTGATGTGAAAGGTAGAGG SEQ ID NO: 115 SSRCb25-F GACGAGCATTCCATTGAGAAGTC SEQ ID NO: 116 SSRCb25-R TCGTCGTTTTGGTCCTCTTCTTC SEQ ID NO: 117 SSRCb27-F CGTCAAAGCAGTCCCTCGAT SEQ ID NO: 118 SSRCb27-R 245761.000234 AATTGAACAAGCGCCCAACC SEQ ID NO: 119 SSRCb3-F ATAGAGTCAAACCAAGCCAAG SEQ ID NO: 120 SSRCb3-R CCCGTTATAGCGCCCTTAG SEQ ID NO: 121 sxcb022d01_A GAAGGTGACCAAGTTCATGCTTTCGATACAGTTACCGGCAGAAG SEQ ID NO: 122 sxcb022d01_B GAAGGTCGGAGTCAACGGATTCTTTCGATACAGTTACCGGCAGAAA SEQ ID NO: 123 sxcb022d01_G GACATGCTCGCTTCAATATTCCTCCTT DETAILED DESCRIPTION OF THE INVENTION The present inventors were able to identify virulent Cercospora beticola (C. beticola) strains in sugar beet fields and to identify sequence differences between virulent C. beticola and avirulent C. beticola strains, respectively. Using GWAS it was possible to identify a clear association of a region on Linkage group I of C.beticola with enhanced virulence to the Cercospora resistance gene BvCR4. An analysis of that region for features which are linked to virulence allowed to identify a set of highly diagnostic SNP alleles as well as the identification of a deletion as well as an insertion in the genome of some virulent fungal C. beticola strains which turned out to be tightly linked to virulence of C. beticola. The variations found in the sequences of virulent C. beticola strains by the present inventors are essential for the detection of virulent C. beticola strains present in the local fungal populations which are able to overcome BvCR4. Typically, BvCR4 provides a high resistance level to C. beticola but the virulent C. beticola strains now identified by the present inventors with the genomic characteristics described herein are lacking a feature or functionality which is detected by the resistance gene BvCR4 to function properly. As a consequence thereof, the virulent C. beticola strains now identified are able to infect even Beta vulgaris plants carrying BvCR4. 245761.000234 Accordingly, the present invention relates to diagnostic markers which can be used for the detection of the presence of one or more virulent C. beticola strains in a sample. Such markers address the genomic variation in C. beticola which is causal for the virulence of some C. beticola strains towards BvCR4 and which are thus suitable to detect in a sample the presence of one or more such virulent C. beticola strains. In a first aspect, the present invention thus provides a marker for the identification of at least one virulent C. beticola strain in a sample, wherein the marker is detecting a) one or more highly diagnostic SNP alleles on chromosome 1 of C. beticola which is tightly linked to virulence of at least one C. beticola strain, or b) one or more deletion of genomic sequence on chromosome 1 in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola, and thereby allows to identify a virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4. In preferred embodiments of the first aspect, the marker is also used to determine whether at least one C. beticola strain is present in the sample. This aspect is important if null alleles are detected by the diagnostic markers to ensure that the lack of a signal is not due to the absence of C. beticola in the sample. In such embodiments, in a first phase the presence of one or more C. beticola strains in the sample is confirmed, whereas in a subsequent second phase it is determined whether one or more of the C. beticola strains in the sample are virulent. Such markers are preferably, for example, dominant markers able to detect presence or absence of non-polymorphic region(s) (referred to herein as “dominant species marker”) or “dominant AVR region / gene marker” which are tightly linked to virulence of C. beticola towards BvCR4) or co-dominant markers able to detect single nucleotide polymorphisms which are tightly linked to virulence of C. beticola towards BvCR4 (see for example in Tables 1and 3 below) (referred to herein as (co-dominant SNP marker” or “co-dominant sequence marker”), or a combination thereof. Preferably, such markers are KASP markers, markers for PCR assays (such as, ddPCR, RFLP marker, markers for chips or micro arrays, markers for TagMan or qPCR assays or the like. The person skilled in the art is aware of other types of markers which can be used to detect the genetic variation described herein. In a further embodiment, the one or more highly diagnostic SNP allele and / or the one or more deletion is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp, preferably the sequence between positions 4,085,502 bp and 4,109,180 bp. In a further embodiment, the one or more highly diagnostic SNP allele and / or the one or more deletion which is detected by the marker is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 245761.000234 4,087,634 bp and 4,094,364 bp. In another embodiment of the first aspect, the one or more highly diagnostic SNP allele and / or the one or more deletion is located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola and 1000 bp upstream or 1000 bp downstream of that genomic sequence of the AvrCR4 gene of C. beticola which is located on chromosome 1 of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,088,434 bp and 4,090,764 bp. In a further preferred embodiment, the one or more highly diagnostic SNP allele and / or one or more deletion on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,089,424 bp and 4,089,764 bp. The sequence of the avirulent haplotype of the gene AvrCR4 which is known to be necessary for full functionality of the C. beticola resistance medidated by BvCR4 is provided as SEQ ID NO: 12. The region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen- 1_hq-v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp is a region of about 54 kb which was found to be missing in a number of virulent C. beticola strains as result of recombination and thus rearrangement within the genome of chromosome 1 of C. beticola. The region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen- 1_hq-v2 which is spanning the sequence between positions 4,085,502 bp and 4,109,180 bp is a region of about 23.7 kb which was found to be missing in a number of virulent C. beticola strains as result of recombination and thus rearrangement within the genome of chromosome 1 of C. beticola. The region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen- 1_hq-v2 which is spanning the sequence between positions 4,088,434 bp and 4,090,764bp is the region of the GWS peak as detailed in Example 3. The region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen- 1_hq-v2 which is spanning the sequence between positions 4,088,434 bp and 4,090,764 bp is the genomic sequence of the AvrCR4 gene of C. beticola including 1000 bp upstream or 1000 bp downstream of that genomic sequence. The region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen- 1_hq-v2 which is spanning the sequence between positions 4,089,424 bp and 4,089,764 bp is the genomic sequence of the AvrCR4 gene of C. beticola also provided herein as SEQ ID NO: 12. The markers according to the invention preferably are markers derived from the sequences disclosed herein as SEQ ID NOs: 1 to 39 and as shown in Tables 1 and 3. 245761.000234 The markers described herein can also be used for the unambiguous identification of C. beticola as disease causing microorganism as such. This is particularly useful as the early symptoms of C. beticola are very similar to infections with bacteria of the genus Pseudomonas or of Rhizoctonia infections. The clear and early clarification of C. beticola as the symptom-causing organism will allow an early chemical countermeasure by traditional application or by precision spraying as used currently for weed control. These robot-assisted spraying devices could potentially also be fed with the information to spray on occurring hot spots of a certain pathogen. In the second aspect the present invention relates to diagnostic, marker-based methods which allow to screen biological samples for the presence of virulent C. beticola strains which are able to overcome the resistance conferred by BvCR4. Accordingly, a method of detecting the presence of one or more virulent C. beticola strains is provided, wherein said one or more virulent C. beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4, and wherein said method is based on the detection of one or more of the markers of the present invention described above in a biological sample. In one preferred embodiment, this method also comprises the determination by marker whether at least one C. beticola strain is present in the biological sample. As already outlined above, it is often important to determine in a first step that at least one C. beticola strain is present in the sample. This is even more important when the absence of a signal is detected by the diagnostic markers employed in the assay method. In such cases, it is confirmed in a first step or phase that one or more C. beticola strains is present in the sample before in a subsequent second step or phase it is determined whether one or more of the C. beticola strains in the sample are virulent. The biological sample which is analyzed in the methods of the present invention can be obtained from various sources. It is of course possible to examine single sample or a plurality of samples with the methods of the present invention. Preferably, the sample (or the plurality of samples) is a soil sample, a sample of plant material taken from one or more plants growing in the field to be examined, or a DNA sample extracted from a soil sample or from a sample of plant material taken from one or more plants growing in a field. The single sample or the plurality of samples can be obtained from one location or can be obtained from several individual locations in the same field or in different fields (in case of soil samples). The single sample or the plurality of samples of plant material can further be obtained from one plant only (in case of several samples these samples are preferably taken from different parts of the plant) or from several individual plants. The several individual plants from which a plurality of samples is taken can grow in the same field or in different fields. Preferably the samples are taken when sufficient C. beticola has grown to allow detection of the fungus in the sample(s) and / or the distinction between avirulent and virulent C. beticola strains can be achieved. The best timing for taking soil samples or plant samples for the detection of C. beticola in the sample are known to the person of skill in the art. In addition, the ideal points of 245761.000234 time for taking the samples can also be determined empirically by taking samples at different times in the life cycle of the fungus and determining the points of time when sufficient fungal DNA is present in the sample(s). The best timing for taking soil samples or plant samples is known to the person of skill in the art. Preferably, the sample is one or more soil sample obtained from one or more fields where plants of the genus Beta are grown. Alternatively, the one or more sample is preferably plant material obtained from one more or more plant of the genus Beta growing in one or more fields. Further, the soil of fields where the planting of plants of the genus Beta such as, for example, sugar beet is intended can also be sampled and tested in a method of the present invention. Most preferred, however, one or more samples are taken from one or more infected Beta vulgaris plants (in particular, sugar beet plants) plants (e.g., from individual infected plants, or from several or all plants from an infection hot spot in the field). In another preferred embodiment, the method of detecting the presence of one or more virulent C. beticola strains in a sample further comprises the step of extracting DNA, preferably genomic DNA, from the C. beticola strains present in the one or more sample. DNA extraction methods suitable for the extraction of DNA from the samples are known to the person skilled in the art. The assay methods of the present invention are based on the genomic differences amongst the isolates of the plant pathogen C. beticola which were identified by the present inventors. In particular, the assay methods of the present invention are addressing the one or more of the genomic variations in C. beticola which is or are causal for the virulence of certain C. beticola strains which are able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4. The markers employed in these assays are preferably dominant markers able to detect presence or absence of non-polymorphic region(s) (referred to herein as “dominant species marker”) or “dominant AVR region / gene marker” which are tightly linked to virulence of C. beticola towards BvCR4) or co-dominant markers able to detect single nucleotide polymorphisms which are tightly linked to virulence of C. beticola towards BvCR4 (see for example in Tables 1and 3 below) (referred to herein as (co-dominant SNP marker” or “co-dominant sequence marker”), or a combination thereof. Preferably, the markers employed in the assays of the present invention are SNP alleles provided in Tables 1 and 3 which can further be derived from SEQ ID NOs: 1 to 39. Table 1: Overview of the haplotype sequences of target gene AvrCR4 used for assay development and the SNP alleles located therein. Haplotype Description SEQ ID NO: SNP position(s) SNP allele 245761.000234 to haplotype 1 (SEQ ID NO: 12) avirulent haplotype SEQ ID NO: 12 None NA 245761.000234 9 virulence allele which SEQ ID NO: 20 100 G to A will overcome BvCR4 228 G to A resistance 237 G to A The assay methods preferably are PCR methods comprises (i) extracting a DNA sample from at least one plant or soil sample; (ii) contacting the DNA sample with at least one primer pair that is capable of producing an amplicon from the genomic DNA of C. beticola present in the sample 245761.000234 under conditions appropriate for DNA amplification; (iii) performing a DNA amplification reaction; and then (iv) detecting the amplicon molecule or the absence thereof and / or confirming that the nucleotide sequence of the amplicon comprises a nucleotide sequence specific for one or more of the genomic variations in C. beticola which is or are causal for the virulence of certain C. beticola strains. Primer pairs that are capable of producing an amplicon from the genomic DNA of C. beticola present in the sample under conditions appropriate for DNA amplification may be readily designed by one of skill in the art to produce an amplicon diagnostic for one or more of the genomic variations in C. beticola which is or are causal for the virulence of certain C. beticola strains. Detection of an amplicon could be based on any suitable method, such as sequencing, determining fragment size or migration of the amplicon in a matrix or gel, or a hybridization- based method. In other preferred embodiments, the assay methods of the present invention include KASP assays. The KASP assays are based on competitive allele-specific PCR and allows bi-allelic scoring of single-nucleotide polymorphisms (SNPs) and insertions and deletions (indels) at specific loci of the genome of C. beticola (Semagn et al., 2013). There are different types of KASP assays which can be used according to the invention: a first set of assays which employ co-dominant markers encoding single nucleotide polymorphisms (like those in Table 1 and Table 3 below), a second set of assays which employ dominant markers able to detect presence or absence of non- polymorphic regions. The latter assay preferably employs markers developed for regions within the GWAS peak as well as for region that were detected as universally present in all sequenced C. beticola isolates. A third set of in silico KASP assays employs the read out of both co-dominant and dominant markers into a single presence / absence determination. KASP assays are generally known to the person skilled in the art. These assays are preferably the combination of two dominant KASP assays for use in the detection of virulent C. beticola strains in a sample, wherein these assays are based on species- specific sequences and sequences of the AvrCR4 gene (see Example 5) and use dominant species and dominant AvrCR4 gene markers. One assay is used first for the determination of the presence of at least one C. beticola strain in the sample. This assay detects the reference allele, and if positive returns a readout indicating the presence of C. beticola in the sample. In a second step, the second assay is used for the determination of the presence of at least one avirulent C. beticola strain in the sample based on the detection of either a reference allele or the determination of virulence based on lack of amplification (deletion detection). The principle of the detection of virulent C. beticola strains in a sample with two dominant KASP assays (using dominant species and dominant AVR gene markers) is further explained in Table 4 in Example 5 below. Preferably these two assays are assay sxcb01d01 to confirm the presence at least one of C. beticola strain in the sample, and assay sxcb022d01 to determine the avirulence of the C. beticola strain(s) in the sample. 245761.000234 In another embodiment, these assays are preferably the combination of two KASP assays for detecting virulent Cercospora strains in a sample using dominant species and co-dominant SNP markers (see Example 6). One dominant KASP assay based on species-specific sequences is used first for the determination of the presence of at least one C. beticola strain in the sample. The assay detects the reference allele, and if positive returns a readout indicating the species presence. In a second step, a co-dominant SNP assay is used for the determination of the presence of at least avirulent C. beticola strain in the sample based on the detection of either an avirulent allele or the determination of virulence based on the detection of a virulent allele. The principle of the detection of virulent C. beticola strains in a sample using dominant species and co-dominant SNP markers is explained in Table 5 in Example 6 below. Preferably the two assays in this preferred embodiment are assay sxcb01d01 to confirm the presence at least one of C. beticola strain in the sample, and assay sxcb016s01 to determine the avirulence of the C. beticola strain(s) in the sample. In a further preferred embodiment, these assays are preferably the combination of two KASP assays for detecting virulent Cercospora strains in a sample using dominant species and co- dominant sequence markers. in this embodiment, one dominant KASP assay based on species- specific sequences whereas one co-dominant sequence assay covering both flanks of the insertion site of the AvrCR4 region / gene and an insertion sequence close to one border of the insertion can be used to detect the presence of at least one virulent C. beticola strain in the sample. For the latter one primer is designed for the inserted sequence close to the insertion site, and two primers are designed for the flanking sequences on both ends (one primer being located on the 5’ flanking sequence of the insertion site and one on the 3’ flanking sequence of the insertion site) close to the insertion site. The dominant species assay is first used for the determination of the presence of at least one C. beticola strain in the sample. The assay detects the reference allele, and if positive returns a readout indicating the species presence. In a second step, the co-dominant sequence assay is used for the determination of avirulence based on the detection of the avirulent insertion allele or for the determination of virulence based detection of the virulent deletion allele. In case, the dominant species assay determines the presence of at least one C. beticola strain in the sample, and the co-dominant sequence assay determines the avirulence of the C. beticola strain(s) in the sample, the readout of both assays is combined into an avirulent sample state (AVIR), which means that the sample does not contain a virulent C. beticola strain. In case, the dominant species assay confirms the presence of at least one C. beticola strain in the sample, and the co-dominant sequence assay determines the virulence of at least one of the C. beticola strain(s) in the sample, then the readout of both assays is combined into a virulent sample state (VIR), which means that the sample contains a virulent C. beticola strain. In case the dominant species assay does not confirm the presence of a C. beticola strain in the sample, then the readout of both assays (regardless of the readout from the co-dominant sequence assay) is combined into not determined sample state (N / D). 245761.000234 Preferred KASP methods comprise (i) extracting a DNA sample from at least one plant or soil sample; (ii) contacting the DNA sample with a set of three primers that is capable of producing signals (e.g. an amplicon or a signal which can be detected) from the genomic DNA of C. beticola present in the sample under conditions appropriate for DNA amplification with KASP primers; (iii) performing DNA amplification reaction(s); and then (iv) detecting an amplicon or a fluorescence signal (or the lack thereof), wherein the detection of an amplicon or a fluorescence signal is indicative for the presence of avirulent C. beticola strains in the sample only. The allele-specific primers used in KASP assays each harbor a unique tail sequence that corresponds with a universal FRET (fluorescence resonant energy transfer) cassette; one labelled with FAM™ dye and the other with HEX™ dye. During thermal cycling, the relevant allele-specific primer binds to the template and elongates, thus attaching the tail sequence to the newly synthesized strand. The complement of the allele-specific tail sequence is then generated during subsequent rounds of PCR, enabling the FRET cassette to bind to the DNA. The FRET cassette is no longer quenched and emits fluorescence. Examples of primers comprising an oligo tail sequence are the primers of the present invention whose names end with “_A” (SEQ ID NOs: 40 to 62 and SEQ ID NO: 121) or “_B” (SEQ ID NOs: 63 to 85 and SEQ ID NO: 122), respectively. Examples of primers which do not contain an oligo tail sequence are the primers of the present invention whose names end with “_G” (SEQ ID NOs: 86 to 108 and SEQ ID NO: 123). The oligo tail sequence of the primers of the present invention whose names end with “_A” is found at the 5’ end and reads “GAAGGTGACCAAGTTCATGCT”, whereas the oligo tail sequence of the primers of the present invention whose names end with “_B” is found at the 5’ end and reads “GAAGGTCGGAGTCAACGGATT”. The KASP Master mix used in such preferred KASP method contain the universal FRET cassettes, ROX passive reference dye, Taq polymerase, free nucleotides and MgCh in an optimized buffer solution. In KASP PCR, during thermal cycling, the relevant allele-specific primer binds to the template and elongates, thus attaching the tail sequence to the newly synthesized strand. The complement of the allele-specific tail sequence is then generated during subsequent rounds of PCR, enabling the FRET cassette to bind to the DNA. The FRET cassette is then no longer quenched and emits fluorescence. When a virulent C. beticola strain is present in a sample, no fluorescent signal was produced. However, when an avirulent C. beticola strain is present in a sample (but no virulent C. beticola strain), a fluorescent signal was produced. The present invention is based on genomic variation in C. beticola strains which is causal for the fungal isolate’s virulence towards BvCR4. The identified variants can also be used in alternative assays other than the KASP systems described above. For example, the full presence / absence variation can be used to establish ddPCR assays (to measure copy number variations (CNV) of non-polymorphic dominant marker within the presence / absence variation), RFLP marker assays (cut sites outside and inside the presence / absence variation), TagMan or qPCR assays using the variants within the presence / absence, High Resolution Melting Curves or PCR to measure the 245761.000234 deletion length, targeted or amplicon sequences as well as full genome sequencing. Such alternative assay methods are known to the person of skill in the art. The genomic variation in C. beticola strains can also be detected by sandwich ELISA assays in a lateral flow assay. A further embodiment of the assay methods of the present invention is the sequencing of the strains of C. beticola present in a sample and the determination on the basis of the sequences obtained thereby whether or not one or more of the C. beticola strains is present in the sample which is / are virulent and thus able to overcome the resistance conferred by the resistance gene BvCR4. The robust detection of virulent C. Beticola isolates in the field where plants of the genus Beta, for example, sugar beet plants are grown is essential for proper disease management. It helps farmers to apply countermeasures against the Cercospora leaf spot disease early and with high efficiency if it turns out that one or more virulent C. beticola strains is / are present in a given field. In such cases where at least one virulent C. beticola strain is present in a field, the Cercospora resistance gene BvCR4 present in selected commercial Beta vulgaris varieties most likely will not be sufficient to control the virulent C. beticola strain(s) and additional measures needs to be taken to control the resulting outbreak of Cercospora leaf spot disease. In that regard the present invention also relates to methods for controlling virulent strains of C. beticola in fields in which plants of the genus Beta, preferably sugar beet plants, are grown, wherein these virulent C. beticola strains are able to overcome the resistance conferred by the gene BvCR4. In a preferred embodiment such a method of controlling virulent strains of C. beticola in fields in which plants of the genus Beta, preferably sugar beet plants, are grown comprises the steps of (1) planting Cercospora-resistant plants of the genus Beta (carrying BvCR4) in a field, (2) prior to or after the planting of step (1) analyzing soil or plant samples from that field for the presence of one or more virulent strains of C. beticola which is able to overcome the resistance conferred by the gene BvCR4 by employing the markers of the present invention or one of the assays of the present invention, and (3) applying fungicides for at least one time over the top of the plants of the genus Beta in the field after emergence if one or more virulent strains of C. beticola is identified in step (b) in the sample. Other preferred means of controlling the one or more virulent strains of C. beticola in the field(s) where plants of the genus Beta, preferably sugar beet plants, are grown and which can be employed as part of above method of controlling virulent strains of C. beticola are intercropping (preferably with catch crops) or an adapted crop rotation to decrease the C. beticola occulum in the field over time. Further means of controlling fungal infection in a field where crops are grown include treatments with fungicidal agrochemicals or fungicides and are known the person of skill in the art. Such fungicidal agrochemical is an agrochemical which is effective against Cercospora wherein these agrochemicals may include, but are not limited to, those which contain one or more of the 245761.000234 following fungicides: epoxiconazole, kresoxim-methyl, thiophanate methyl, mancozeb, thiram, hymexazol and / or and other fungicides effective against C. beticola. The fungicide(s) used in the methods described herein can be applied alone or in combination with one or more fungicide(s) during the growing season. The fungicide(s) used in the methods described herein can be applied in combination with one or more fungicide(s) temporally (for example, as a tank mixture or in sequential applications), spatially (for example, at different times during the growing season after planting of Beta vulgaris seeds), or both. For example, the method for controlling virulent strains of C. beticola in the field where Beta vulgaris plants are growing may comprise applying a fungicidally effective amount post-emergence (any time after Beta vulgaris plants emerge). Multiple applications of one or more fungicides, or a combination of fungicides together or individually, may be used over a growing season, for example, two applications (such as at different times during the growing season of the Beta vulgaris plants) or three or more applications. Moreover, planting Beta vulgaris, preferably sugar beet, varieties that combine the resistance gene BvCR4 and a high level of quantitative background resistance are a further means to strengthen and control the overall CR resistance and thus virulent strains of C. beticola in the context of the above method of controlling virulent strains of C. beticola in fields in which plants of the genus Beta, preferably sugar beet plants, are grown. A further aspect of the present invention relates to methods for characterizing and diagnosing infestations of fields with one or more virulent, strains of C. beticola which is able to overcome the resistance conferred by the gene BvCR4, thereby allowing to estimate potential yield losses in the infected field of plants of the genus Beta by the growth and spread of the one or more virulent C. beticola strains. Another aspect of the present invention relates to methods which allow a farmer to save fungicides by the use of the Cercospora-resistant Beta vulgaris, preferably sugar beet, varieties that carry the resistance gene BvCR4, wherein the assay method of the present invention allows to determine and thus ensure that the Cercospora resistance present in the varieties is able to control all C. beticola strains present in the field. This is the case if no or only little infection with virulent C. beticola strains is detected in the field. The present invention also allows a farmer to monitor precisely if one or more of the virulent strains of C. beticola are present in a field at the end of the growing season. This allows the farmer to take further phytosanitary steps for the coming cropping season. These additional measures can consist of an alternative cropping scheme, of further fungicide applications as preparation for the next sowing and or for a switch to different cultivar. Furthermore, the present invention allows to precisely determine the frequency of virulent C. beticola strains which are able to overcome the resistance conferred by the gene BvCR4 within the whole population of C. beticola strains present in the field and further to predict the vitality 245761.000234 of those virulent C. beticola strains in relation to the avirulent C. beticola strains in rest of the C. beticola population. Another aspect of the present invention is the unambiguous identification of C. beticola as disease causing microorganism per se in infected plants of the genus Beta such as, for example, sugar beet plants. This is in particular useful as the early symptoms of infection with C. beticola are very similar to the symptoms of infections with bacteria of the genus Pseudomonas or of the genus Rhizoctonia. The clear and early identification of the symptom-causing organism or pest will allow an early chemical countermeasure by traditional application or by precision spraying as used currently for weed control. These robot-assisted spraying devices could potentially also be fed with the information to spray on occurring hot spots of a certain pathogen. In a fourth aspect, the use of at least one marker, preferably at least two, at least three, at least four, or at least five, or more marker of the present invention is provided for the identification of one or more virulent C. beticola strains in a sample. In a preferred embodiment, at least one marker of the present invention is used for the identification of one or more virulent C. beticola strains in a sample, wherein the one or more C. beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4 on the basis of differences in the genomic DNA on chromosome 1 of C. beticola, preferably on the basis of one or more highly diagnostic SNP allele and / or one or more deletion, wherein the one or more highly diagnostic SNP allele and / or the one or more deletion is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp, preferably the sequence between positions 4,085,502 bp and 4,109,180 bp, more preferably being located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions in the reference genome of C. beticola strain CB_CbHevensen- 1_hq-v2 which is spanning the sequence between positions 4,087,634 bp and 4,094,364 bp, and more preferably located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola and 1000 bp upstream or 1000 bp downstream of that genomic sequence of the AvrCR4 gene of C. beticola which is located on chromosome 1 of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,088,424 bp and 4,090,764bp, and even more preferably located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,089,424 bp and 4,089,764bp. The sequence of the avirulent haplotype of the gene AvrCR4 which is known to be necessary for full functionality of the C. beticola resistance medidated by BvCR4 is provided as SEQ ID NO: 12. The use of markers in detection assays is described above and is also generally known to the person of skill in the art. 245761.000234 In a fifth aspect, there is provided a set of at least two, preferable three, oligonucleotides suitable for use as primers in a PCR which are able to hybridize to the genomic sequence of chromosome 1 of C. beticola and which are able to identify the haplotype of at least one C. beticola in a sample which is characterized by (a) one or more highly diagnostic SNP alleles which are tightly linked to virulence of at least one C. beticola strain, or (b) one or more deletion of genomic sequence in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola, and thereby allow to identify in a sample at least one virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4. In one embodiment of the fifth aspect, the set of oligonucleotides is a set of two oligonucleotides suitable for use as primer in a PCR which are able to identify the haplotype of at least one C. beticola in a sample which is characterized by (a) one or more highly diagnostic SNP alleles which are tightly linked to virulence of at least one C. beticola strain, or (b) one or more deletion of genomic sequence in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola, and thereby allow to identify in a sample at least one virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4. In a further embodiment of the fifth aspect, the set of oligonucleotides is a set of three oligonucleotides suitable for use as primer in a PCR involving two forward primers and a reverse primer wherein each primer has a different nucleotide sequence and wherein the reverse primer and only one of the two forward primers are able to identify the haplotype of at least one C. beticola in a sample which is characterized by (a) one or more highly diagnostic SNP alleles which are tightly linked to virulence of at least one C. beticola strain, or (b) one or more deletion of genomic sequence in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola, and thereby allow to identify in a sample at least one virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4. In one embodiment the oligonucleotides of the present invention are oligonucleotides which allow the identify the dominant markers which are able to detect presence or absence of non- polymorphic region(s) (referred to herein as “dominant species marker”) which are tightly linked to virulence of C. beticola towards BvCR4. In another embodiment the oligonucleotides of the present invention are oligonucleotides which allow to identify the co-dominant markers able to detect single nucleotide polymorphisms which are tightly linked to virulence of C. beticola towards BvCR4 (see for example in Tables 1and 3 below) (referred to herein as (co-dominant SNP marker” or “c-dominant sequence marker”). The oligonucleotides for the identification of dominant markers and co-dominant markers can also be used together if assays of the present invention are combined. Provided are illustrative DNA molecules that can be used as primers (oligonucleotides) for detecting whether at least one virulent C. beticola strain is present in a sample which is able to 245761.000234 overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4. Such primers are specific for a target nucleic acid sequence and as such are useful for the identification of virulent C. beticola strains by the methods described herein. A primer can hybridize to a target polynucleotide sequence to allow for specific detection or amplification of a polynucleotide molecule that comprises, or is covalently linked and associated with, the target polynucleotide sequence. The target nucleotide sequence targeted by the oligonucleotides of the present invention may comprise all or part of the genomic DNA on chromosome 1 of C. beticola, preferably on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq- v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp, preferably the sequence between positions 4,085,502 bp and 4,109,180 bp, more preferably within an interval which on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to a region on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,087,634 bp and 4,094,364 bp, even more preferably within an interval located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola and 1000 bp upstream or 1000 bp downstream of that genomic sequence of the AvrCR4 gene of C. beticola which is located on chromosome 1 of C. beticola at a position which corresponds to a region on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,088,424 bp and 4,090,764 bp, and most preferably within an interval which corresponds to the genomic sequence of the AvrCR4 gene of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,089,424 bp and 4,089,764bp. The sequence of the avirulent haplotype of the gene AvrCR4 is provided as SEQ ID NO: 12 herein. The oligonucleotides (primers) according to the present disclosure may have (i) complete or 100% sequence complementarity (i.e., 100% complementary) to a target polynucleotide sequence or (ii) incomplete sequence complementarity to a target polynucleotide, such as at least 60% complementary, at least 65% complementary, at least 70% complementary, at least 75% complementary, at least 80% complementary, at least 85% complementary, at least 90% complementary, at least 95% complementary, or at least 99% complementary to the target polynucleotide sequence as long as the oligonucleotide (primer) has sufficient complementarity to the target polynucleotide sequence to hybridize to the target polynucleotide sequence under stringent hybridization conditions that are suitable and necessary for use of the primer in the relevant amplification or detection assay, reaction or method. As understood in the art, the percentage complementarity of a primer may be lower if the length of the primer is longer and depends on the stringency and use. Provided are illustrative oligonucleotide molecules that can be used as primers for detecting whether at least one virulent C. beticola strain is present in a sample which is able to overcome the resistance conferred to plants of the genus Beta by the 245761.000234 resistance gene BvCR4. This detection may be done by using methods known in the art, such as thermal or isothermal amplification of nucleic acid. Preferably, the oligonucleotides of the present invention can be used to detect the SNP alleles provided in Table 1 and Table 3. An oligonucleotide (primer) is typically designed to hybridize to a complementary target DNA strand to form a hybrid between the primer and the target DNA strand. The presence of a primer is a point of recognition by a polymerase to begin extension of the primer polymerization of additional nucleotides into a lengthening nucleotide molecule) using as a template the target DNA strand. Primer pairs refer to use of two primers binding opposite strands of a double stranded nucleotide segment for the purpose of amplifying the polynucleotide segment between the positions targeted for binding by the individual members of the primer pair, typically in a thermal amplification reaction or other conventional nucleic-acid amplification methods. Methods for designing and using primers are well known in the art. DNA molecules comprising fragments of SEQ ID NOs: 40 to 108 and of SEQ ID Nos: 121 to 123 are useful as primers for detecting whether at least one virulent C. beticola strain is present in a sample which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4 and can readily be designed by one of skill in the art using the sequences provided herein. DNA primers are generally ten (10) nucleotides or more in length, preferably at least 15, 16, 17, 18, 19, or 20, more preferably, at least 21, 22, 23, 24, or 25, particularly preferably, at least 30, 35, 40, 45, or 50, and, especially preferably, at least 100, 200, 300, 500 or 1,000 nucleotides in length. Such primers are selected to be of sufficient length to hybridize specifically to a target sequence under stringency hybridization conditions. The term “specific for” a target sequence indicates that primer hybridizes under stringent hybridization conditions only to the target sequence in a sample comprising the target sequence. Appropriate stringency conditions that promote DNA hybridization, for example, 6.0x sodium chloride / sodium citrate (SSC) at about 45° C., followed by a wash of 2.0xSSC at 50°C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. For example, the salt concentration in the wash step can be selected from a low stringency of about 2.0xSSC at 50°C to a high stringency of about 0.2xSSC at 50°C. In addition, the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22°C, to high stringency conditions at about 65°C. Both temperature and salt may be varied, or either the temperature or the salt concentration may be held constant while the other variable is changed. The method for the production of oligonucleotides initially includes: the comparison of the nucleotide sequence of chromosome 1 of virulent C. beticola strains and avirulent C. beticola strains; the identification of the sequence differences between the two nucleotide sequences; and the generation of nucleic acid molecules - here, meaning oligonucleotides - that specifically allow to the detect a marker for the identification of at least one virulent C. beticola strain in a 245761.000234 sample which strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4. Furthermore, the oligonucleotide according to the invention may be connected to a fluorescent dye in order to generate a fluorescence signal, e.g., under excitation via light of the corresponding wavelength. The fluorescent dye may be fluorochrome. The oligonucleotides according to the invention may be coupled with other compounds that are suitable for generating a signal. Such oligonucleotides do not occur in nature and also cannot be isolated from nature. The following is executed to produce such marked oligonucleotides: DNA may be marked bio-orthogonally. For this, DNA may be marked in vivo or in vitro with nucleoside analogs, which, for example, may subsequently be coupled with a fluorophore per Staudinger reaction. In addition to this, DNA may also be chemically provided with fluorophores. Oligonucleotides may be marked via a phosphoramidite synthesis with fluorophores that, for example, are used in QPCR, DNA sequencing, and in situ hybridization. Furthermore, DNA may be generated enzymatically in the course of a polymerase chain reaction with fluorescent nucleotides or be marked with a ligase or a terminal deoxynucleotidyl transferase. DNA may also be detected indirectly via a biotinylation and fluorescent avidin. For couplings, fluorescein, fluorescent lanthanides, gold nanoparticles, carbon nanotubes, or quantum dots, among other things, are used as fluorophores. One of the most commonly used fluorescent substances is FAM (carboxyfluorescein). Consequently, oligonucleotides and, in particular, primers that possess a FAM marking are encompassed by the invention. FAM is preferably present as 6-FAM, wherein - depending upon the desired wavelength of the emission and excitation - other FAM variants, e.g., 5-FAM, may, however, also be used. Examples of additional fluorescence markers are AlexaFluor, ATTO, Dabcyl, HEX, Rox, TET, Texas Red, and Yakima Yellow. Depending upon the field of use, the oligonucleotides may be furnished with modifications of the bases or of the sugar phosphate spine. Among these are, among others, amino-dT, azide-dT, 2-aminopurine,5-Br-dC, 2'-deoxyinosine (INO), 3'-deoxy-A, C, G, 5- Met-dC, 5-OH-Met-dCN6-Met-dA, and others. The allele-specific primers used in KASP assays as described hereinabove each harbor a unique tail sequence that corresponds with a universal FRET (fluorescence resonant energy transfer) cassette; one labelled with FAM™ dye and the other with HEX™ dye. During thermal cycling, the relevant allele-specific primer binds to the template and elongates, thus attaching the tail sequence to the newly synthesized strand. The complement of the allele-specific tail sequence is then generated during subsequent rounds of PCR, enabling the FRET cassette to bind to the DNA. The FRET cassette is no longer quenched and emits fluorescence. Examples of primers comprising an oligo tail sequence are the primers of the present invention whose names end with “_A” (SEQ ID NOs: 40 to 62 and SEQ ID NO: 121) or “_B” (SEQ ID NOs: 63 to 85 and SEQ ID NO: 122), respectively. Examples of primers which do not contain an oligo tail sequence are the primers of the present invention whose names end with “_G” (SEQ ID NOs: 86 to 108 and SEQ ID Nos: 123). The oligo tail sequence of the primers of the present invention whose names end with “_A” is found at the 5’ end and reads “GAAGGTGACCAAGTTCATGCT”, whereas the oligo tail sequence of 245761.000234 the primers of the present invention whose names end with “_B” is found at the 5’ end and reads “GAAGGTCGGAGTCAACGGATT”. Preferred sets of three oligonucleotides suitable according to the present invention are the sets of three oligonucleotides selected from the following group comprising: - oligonucleotides sxcb012s01_A (SEQ ID NO: 40), sxcb012s01_B (SEQ ID NO: 63) and sxcb012s01_G (SEQ ID NO: 86) in assay sxcb012s01, - oligonucleotides sxcb013s01_A (SEQ ID NO: 41), sxcb013s01_B (SEQ ID NO: 64) and sxcb013s01_G (SEQ ID NO: 87) in assay sxcb013s01, - oligonucleotides sxcb014s01_A (SEQ ID NO: 42), sxcb014s01_B (SEQ ID NO: 65) and sxcb014s01_G (SEQ ID NO: 88) in assay sxcb014s01, - oligonucleotides sxcb015s01_A (SEQ ID NO: 43), sxcb015s01_B (SEQ ID NO: 66) and sxcb015s01_G (SEQ ID NO: 89) in assay sxcb015s01, - oligonucleotides sxcb016s01_A (SEQ ID NO: 44), sxcb016s01_B (SEQ ID NO: 67) and sxcb016s01_G (SEQ ID NO: 90) in assay sxcb016s01, - oligonucleotides sxcb017s01_A (SEQ ID NO: 45), sxcb017s01_B (SEQ ID NO: 68) and sxcb017s01_G (SEQ ID NO: 91) in assay sxcb017s01, - oligonucleotides sxcb018s01_A (SEQ ID NO: 46), sxcb018s01_B (SEQ ID NO: 69) and sxcb018s01_G (SEQ ID NO: 92) in assay sxcb018s01, - oligonucleotides sxcb019s01_A (SEQ ID NO: 47), sxcb019s01_B (SEQ ID NO: 70) and sxcb019s01_G (SEQ ID NO: 93) in assay sxcb019s01, - oligonucleotides sxcb021s01_A (SEQ ID NO: 48), sxcb021s01_B (SEQ ID NO: 71) and sxcb021s01_G (SEQ ID NO: 94) in assay sxcb021s01, - oligonucleotides sxcb001d01_A (SEQ ID NO: 49), sxcb001d01_B (SEQ ID NO: 72) and sxcb001d01_G (SEQ ID NO: 95) in assay sxcb001d01, - oligonucleotides sxcb002d01_A (SEQ ID NO: 50), sxcb002d01_B (SEQ ID NO: 73) and sxcb002d01_G (SEQ ID NO: 96) in assay sxcb002d01, - oligonucleotides sxcb003d01_A (SEQ ID NO: 51), sxcb003d01_B (SEQ ID NO: 74) and sxcb003d01_G (SEQ ID NO: 97) in assay sxcb003d01, - oligonucleotides sxcb004d01_A (SEQ ID NO: 52), sxcb004d01_B (SEQ ID NO: 75) and sxcb004d01_G (SEQ ID NO: 98) in assay sxcb004d01, - oligonucleotides sxcb005d01_A (SEQ ID NO: 53), sxcb005d01_B (SEQ ID NO: 76) and sxcb005d01_G (SEQ ID NO: 99) in assay sxcb005d01, - oligonucleotides sxcb006d01_A (SEQ ID NO: 54), sxcb006d01_B (SEQ ID NO: 77) and sxcb006d01_G (SEQ ID NO: 100) in assay sxcb006d01, - oligonucleotides sxcb007d01_A (SEQ ID NO: 55), sxcb007d01_B (SEQ ID NO: 78) and sxcb007d01_G (SEQ ID NO: 101) in assay sxcb007d01, - oligonucleotides sxcb008d01_A (SEQ ID NO: 56), sxcb008d01_B (SEQ ID NO: 79) and sxcb009d01_G (SEQ ID NO: 102) in assay sxcb008d01, - oligonucleotides sxcb009d01_A (SEQ ID NO: 57), sxcb009d01_B (SEQ ID NO: 80) and sxcb009d01_G (SEQ ID NO: 103) in assay sxcb009d01, 245761.000234 - oligonucleotides sxcb010d01_A (SEQ ID NO: 58), sxcb010d01_B (SEQ ID NO: 81) and sxcb010d01_G (SEQ ID NO: 104) in assay sxcb010d01, - oligonucleotides sxcb011d01_A (SEQ ID NO: 59), sxcb011d01_B (SEQ ID NO: 82) and sxcb011d01_G (SEQ ID NO: 105) in assay sxcb011d01, - oligonucleotides sxcb022d01_A (SEQ ID NO: 121), sxcb022d01_B (SEQ ID NO: 122) and sxcb022d01_G (SEQ ID NO: 123) in assay sxcb022d01, - oligonucleotides sxcb023d01_A (SEQ ID NO: 60), sxcb023d01_B (SEQ ID NO: 83) and sxcb023d01_G (SEQ ID NO: 106) in assay sxcb023d01, - oligonucleotides sxcb024d01_A (SEQ ID NO: 61), sxcb024d01_B (SEQ ID NO: 84) and sxcb024d01_G (SEQ ID NO: 107) in assay sxcb024d01, and - oligonucleotides sxcb025d01_A (SEQ ID NO: 62), sxcb025d01_B (SEQ ID NO: 85) and sxcb025d01_G (SEQ ID NO: 108) in assay sxcb025d01. Particularly preferred sets of three oligonucleotides suitable according to the present invention are the sets of oligonucleotides sxcb018s01_A (SEQ ID NO: 46), sxcb018s01_B (SEQ ID NO: 69) and sxcb018s01_G (SEQ ID NO: 92) in assay sxcb018s01 and oligonucleotides sxcb024d01_A (SEQ ID NO: 61), sxcb024d01_B (SEQ ID NO: 84) and sxcb024d01_G (SEQ ID NO: 107) in assay sxcb024d01. Alternative methods of PCR as well as methods for the detection of the amplification product are described in the literature and are known to the person skilled in the art. Finally, as the sixth aspect, kits for detecting the presence of DNA of one or more virulent C. beticola strains in a sample is provided. The kit comprises all means needed to identify one or more of the markers of the present invention. Such means preferably are oligonucleotides and the sets of oligonucleotides of the present invention as described herein above. One example of such a kit is a kit comprising any of the oligonucleotides, preferably the sets of oligonucleotides described herein. The kits provided herein are useful for, among other things, identifying DNA of one or more C. beticola strains in a sample, and / or distinguishing between avirulent and virulent C. beticola strains in a sample. Variations on such kits can also be developed using the compositions and methods disclosed herein and the methods well known in the art of nucleic acid detection for the detection of DNA of one or more virulent C. beticola strains. Such kits contain oligonucleotides (e.g. primers) which are specific to genomic DNA of C. beticola. Such oligonucleotides may comprise one or more of SEQ ID NOs: 1 – 123, more preferred one or more of SEQ ID Nos: 40 to 108 and SEQ ID Nos: 121 to 123. The kits can also contain instructions for using the oligonucleotides for identifying DNA of one or more C. beticola strains in a sample and / or for distinguishing between avirulent and virulent C. beticola strains in a sample. Kits may optionally also comprise reagents for performing the detection reactions described herein. 245761.000234 The following examples explain the invention, but without limiting the subject matter of the invention. Unless indicated otherwise, standard molecular biology methods have been used; see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001, Fritsch et al., Cold Spring Harbor Laboratory Press: 1989; Mayer et al., Immunochemical Methods in Cell and Molecular Biology, eds., Academic Press, London, 1987, and Weir et al., Handbook of Experimental Immunology, Volumes I-IV, Blackwell, eds., 1986. EXAMPLES Example 1: Sampling Four sugarbeet cultivars with different levels of resistance were planted at two field sites in Switzerland (Rudolfingen, Hendschiken) which are 60km apart. The four cultivars varied in their resistance to Cercospora leaf spot disease (CLS), a disease caused by C. beticola; two cultivars represented highly resistant cultivars carrying the Cercospora resistance gene BvCR4 whereas the other two cultivars lacking BvCR4. In Hendschiken, 12 rows of each cultivar were planted, and in Rudolfingen, 18 rows of each cultivar were planted. Sugar beets were sown in March and harvested in early November. No fungicide was applied to either field site. At both test sites infection hot spots of the pathogen Cercospora beticola were identified in planted the sugar beet plants, labelled and the position recorded via GPS. An infection hot spot is defined as a group of at least 5 neighboring infected plants. From these hot spots Cercospora beticola was sampled, single-spore isolates were extracted and cultivated on petri dishes containing potato dextrose agar (PDA). In total 475 of such isolates were sampled. The genomes of these isolates were characterized for duplicates and genetic diversity groups determined using a set of 6 Single- Sequence-Repeat (SSR). Liquid cultures were made for all isolates by scraping mycelia from C. beticola colonies on PDA into 100 mL flasks with 50 ml potato dextrose broth (PDB) with 0.1 mg / L kanamycin. DNA was extracted from hyphae in liquid culture using DNeasy Plant Mini Kit (Qiagen). The quantity of the DNA was assessed using a Qubit fluorometer (Thermo Fisher Scientific) and quality assessed with nanodrop. Isolates were genotyped with 6 simple sequence repeats (SSR) (SSRCb1, SSRCb3, SSRCb21 SSRCb22, SSRCb25, SSRCb27, (Groenewald et al.2007, Vaghefi et al.2017), see Table 2 below). The PCR amplifications were conducted with Qiagen Type-it kit (Qiagen) in a total volume of 11 μL. The reaction mixture contained 20 ng of template DNA, 0.4μM of each forward and reverse primers, 4 μL Type-it mix (with buffer and MgCl2), 1 μL Q-solution (1 U Taq polymerase), 2ul deionized water. The initial denature was conducted at 95 °C for 5 mins, then followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 58 °C or 56°C for 90 s, elongation at 72°C for 245761.000234 30 s and final extension at 60 °C for 30 min. The PCR amplicons were analysed on an ABI 3730xl. Based on the length polymorphism of the microsatellite alleles for the six SSR loci were scored and binned using R package Fragman (Covarrubias-Pazaran et al. 2016) and MsatAllele v 1.05 (Alberto 2009). The R package poppr v.2.9.3 (Kamvar et al.2014) was used to determine multi- locus genotypes (MLGs) for all isolates by combining the alleles of the six loci. Table 2: Description of simple sequence repeats (SSRs) used in Example 1 including flanking PCR primers. Based on the copy number of the repeat a length polymorphism can be scored as alleles for the specific SSR locus. Repeat No. alleles No.alleles Name Primer_Sequence motif (Hen) (Rud) The combination of multiple loci (here six) allowed the genotypic characterization of the C. beticola isolates and strains. The results of this analysis were used to select a diverse set of isolates for the phenotyping reported in Example 2. 245761.000234 Example 2: Phenotypic assessment of the virulence 56 selected isolates (collected from infection hot spots of the two naturally infested test locations in Switzerland described in Example 1) were both sequenced and then phenotyped under inoculated field conditions near Einbeck, Germany. 53 of those isolates were derived from the two varieties carrying BvCR4, whereas 3 isolates were included that had been isolated from one of the two varieties lacking BvCR4, respectively. The fungal isolates were multiplied and tested on a differential set consisting of the same 4 varieties as in the field trials from 2020. The varieties were planted on April 7, 2022, in 6 row plots (5m length) following a randomized block design, in which each block (including all 4 varieties) was exposed to one of the 56 Cercospora isolates. Cercospora inoculation was performed manually on July 14, 2022, by applying 10g of ground leaf inoculum + 50g of semolina flour (as carrier) on the 3rd row of each plot. Inoculation rows had been sprayed with water prior to inoculation, so that the inoculum would stick to the leaves. No fungicide was applied to the trial. Isolate specific resistance / virulence was assessed by regular visual ratings of the inoculated plots over the course of 39 days. Plots were rated 6 times on a weekly basis for Cercospora disease severity following the KWS rating scale [1-9, rating of 1 = healthy leaves and healthy plants as a whole up to rating of 9 = dead leaves and plants with regrowth of new leaves, Shane and Teng, 1992] where one rating was given per plot. The first rating of infection with Cercospora was taken on August 21 (38 dpi) after initial symptoms were observed. The last and 6th rating of infection with Cercospora was taken on September 28th. Histograms of the Cercospora ratings [KWS scale, Shane and Teng, 1992] of the 56 isolates on one of the two tested varieties carrying BvCR4 are shown in Figure 1. Infection ratings differentiated most prominently at the fourth rating. From Fig.1 it is obvious that in the histogram two peaks of scores for the infection rating were identified. Therefore, it was concluded that in the chosen population, isolates with virulence (leading to higher scorings) and isolates without the virulence (leading to lower scorings) could be identified. This data was used to identify relevant genomic regions in the genome of the fungus. Further, timepoint 4 approximately 4 weeks after inoculation was identified as the one with the best differentiation between the genotypes used in the experiments. Accordingly, mainly the data from this timepoint was used for the subsequent genome wide association analysis (GWAS) in Example 3. Example 3: Genome-wide Association Study All 56 isolates from Example 2 plus 66 isolates collected from susceptible sugar beet varieties where further used to extract DNA for whole genome short read sequencing on the Illumina NextSeq6000 platform. Additionally, a single Cercospora beticola isolate (CbHevensen-1) was used to extract high-molecular weight DNA and subsequent long read sequencing on the Oxford 245761.000234 Nanopore Promethion platform. Long and short reads from the latter isolates were used to assemble a high-quality reference genome comprising full length chromosomes. Short read data from all 56 isolates were mapped to this reference genome and resulting mappings were used for variant calling. A high-quality genome with a total length of 35,275,258 bp was assembled into 11 linkage groups. A subsequent genome annotation resulted in 13,882 annotated genes. Short read mapping and variant calling of 56 strains using the high-quality genome as reference, resulted in 952,112 unfiltered variants. Of those, 783,327 were SNPs, 219,257 MSNPs, 17,804 InDels and 9813 other types of variants. A GWAS leveraging above mentioned phenotypes and variant call resulted in a clear association of a region on Linkage group I of Cercospora beticola with enhanced virulence towards BvCR4 (CB_CbHevensen-1_hq-v2.chr1: 4087634 –4094364). This is clearly shown by the Manhattan plot in Figure 2. Within the peak region a single predicted gene was found (ID = Hevensen_hq-v2.G01679, SEQ ID NO: 12). This gene encodes for small (89 amino acids long) cysteine-rich protein carrying a secretion signal peptide with no significant match using a BLAST search against the publicly available reference genome. Within the so far analyzed Cercospora beticola population a presence–absence polymorphism was observed where the absence allele was associated with a gain in virulence. Bioinformatic analysis with the software EffectorP (v.3.0) (https: / / effec torp. csiro. au / ;Sperschneider & Dodds, 2022) indicates the gene as an effector gene. These findings together lead to the conclusion that the gene within the detected peak region codes for an effector protein which was named AvrCR4 (Chen et al., 2023). Example 4: Marker Development The reference position 4087634–4094364 identified in Example 3 was analyzed for potential marker sequences linked to virulence of the C. beticola. The identified region contained a single gene later named AvrCR4 as it has many characteristics of an effector gene (Chen et al., 2023) that showed multiple variants as well as a complete absence in virulent strains. Accordingly, a set of highly diagnostic SNP alleles (see Table 3 below) was identified as well as a deletion of the parts or the whole coding sequence of the putative effector gene in the genome of some strains which turned out to be tightly linked to virulence towards BvCR4. Table 3: Examples of highly diagnostic SNP alleles which were identified in the reference position 4089434 to 4089744 (see Example 4 above). Due to their tight linkage to the virulence these SNPs are tightly diagnostic for the presence of one or more virulent C. beticola strains in a sample which are able to overcome BvCR4. ID NameSEQ. 245761.000234 CB_CbHevensen-1_hq-v2.chr1 4089434 C T10037233 sxcb017s01 31CB CbHevensen-1 hq-v2.chr1 4089449 C T Example 5: Assay for detecting virulent Cercospora strains in a sample using dominant species and dominant AVR gene markers. 245761.000234 DNA was extracted using the silica-membrane technology kit “NucleoSpin® 96 Plant II” from company Machery-Nagel (Düren, Germany), following the manufacturer instructions. Two dominant KASP assays based on species-specific sequences (assay sxcb01d01 with primer sxcb001d01_A (SEQ ID NO: 49), sxcb001d01_B (SEQ ID NO: 72) and sxcb001d01_G (SEQ ID NO: 95)) and sequences of the AvrCR4 gene (assay sxcb22s01 with primer sxcb022d01_A (SEQ ID NO: 121), sxcb022d01_B (SEQ ID NO: 122) and sxcb022d01_G (SEQ ID NO: 123)) were used to detect virulent C. beticola strains in a sample. KASP-reaction master mix was used according to the manufacturer’s instructions (LGC, Berlin (Germany)). The reaction consisted of 1,5µl dried DNA ,1,5µl reaction mixture, 20 nl Primer-mix (total volume 1,52 µl). The thermal cycling conditions were 1 minute 94°C, 10 cycles of 10 seconds 94 °C and 1 minute 61-55°C (with decrement of 0,6°C / cycle), followed by another 26 cycles of 10 seconds 94 °C and 1 minute 61-55°C. The final product was analyzed and scored following standard protocols by LGC (Teddington, UK; https: / / www.lgcgroup.com / ). Assay sxcb01d01 was used first for the determination of the presence of at least one C. beticola strain in the sample. The assay detects the reference allele, and if positive returns a readout indicating the species presence. In a second step, assay sxcb022s01 was used for the determination of the presence of at least one avirulent C. beticola strain in the sample based on the detection of either a reference allele or the determination of virulence based on lack of amplification (deletion detection). The principle of the detection of virulent C. beticola strains in a sample using dominant species and dominant AVR gene markers is explained and shown in Table 4 below. In case assay sxcb01d01 confirmed the presence at least one of C. beticola strain in the sample, and assay sxcb022d01 determined the avirulence of the C. beticola strain(s) in the sample, the readout of both assays was combined into an avirulent sample state (AVIR), which meant that the sample does not contain a virulent C. beticola strain. In case, assay sxcb01d01 confirmed the presence of at least one C. beticola strain in the sample, and assay sxcb022d01 determined the virulence of at least one of the C. beticola strain(s) in the sample, the readout of both assays was combined into a virulent sample state (VIR), which meant that the sample contained a virulent C. beticola strain. In case, assay sxcb01d01 did not confirm the presence of a C. beticola strain in the sample, the readout of both assays (regardless of the readout from assay sxcb022d01) was combined into not determined sample state (N / D). Table 4: Principle of the detection of virulent C. beticola strains in a sample using dominant species and dominant AVR gene markers. Dominant Sequence Marker for AvrCR4 Gene 245761.000234 seice d Example 6: Assay for detecting virulent Cercospora strains in a sample using dominant species and co-dominant SNP markers. DNA was extracted using the silica-membrane technology kit “NucleoSpin® 96 Plant II” from company Machery-Nagel (Düren, Germany), following the manufacturer instructions. One dominant KASP assay based on species-specific sequences (assay sxcb01d01 with primer sxcb001d01_A (SEQ ID NO: 49), sxcb001d01_B (SEQ ID NO: 72) and sxcb001d01_G (SEQ ID NO: 95)) and one co-dominant SNP assay (assay sxcb016s01 with primer sxcb016s01_A (SEQ ID NO: 44), sxcb016s01_B (SEQ ID NO: 67) and sxcb016s01_G (SEQ ID NO: 90)) was used to detect virulent C. beticola strains in a sample. KASP-reaction master mix was used according to the manufacturer’s instructions (LGC, Berlin (Germany)). The reaction consisted of 1,5µl dried DNA ,1,5µl reaction mixture, 20 nl Primer-mix (total volume 1,52 µl). The thermal cycling conditions were 1 minute 94°C, 10 cycles of 10 seconds 94 °C and 1 minute 61-55°C (with decrement of 0,6°C / cycle), followed by another 26 cycles of 10 seconds 94 °C and 1 minute 61-55°C. The final product was analyzed and scored following standard protocols by LGC (Teddington, UK; https: / / www.lgcgroup.com / ). Assay sxcb01d01 was used first for the determination of the presence of at least one C. beticola strain in the sample. The assay detects the reference allele, and if positive returns a readout indicating the species presence. In a second step, assay sxcb016s01 was used for the determination of the presence of at least avirulent C. beticola strain in the sample based on the detection of either an avirulent allele or the determination of virulence based on the detection of a virulent allele. The principle of the detection of virulent C. beticola strains in a sample using dominant species and co-dominant SNP markers is explained and shown in Table 5 below. In case, sxcb01d01 confirmed the presence of at least one C. beticola strain in the sample, and sxcb016s01 determined the avirulence of at least one of the C. beticola strain(s) in the sample, 245761.000234 the readout of both assays was combined into an avirulent sample state (AVIR) which meant that the sample does not contain a virulent C. beticola strain. In case, sxcb01d01 confirmed the presence of at least one C. beticola strain in the sample, and sxcb016s01 determined the virulence of at least one of the C. beticola strain(s) the sample, the readout of both assays was combined into a virulent sample state (VIR), which meant that the sample contained a virulent C. beticola strain. In case, sxcb01d01 did not confirm the presence of a C. beticola strain in the sample, the readout of both assays (regardless of the readout from assay sxcb016s01) was combined into undetermined sample state (N / D). Table 5: Principle of the detection of virulent C. beticola strains in a sample using dominant species and co-dominant SNP markers. Co-Dominant SNP Marker for AvrCR4 Gene REFERENCES Alberto (2009), MsatAllele_1.0: An R package to visualize the binning of microsatellite alleles, J. Hered., 100(3) doi: 10.1093 / jhered / esn110. Epub 2009 Jan 6. Chen et al. (2023), GWAS reveals a rapidly evolving candidate avirulence effector in the Cercospora leaf spot pathogen, Mol Plant Pathol, 25: e13407 https: / / doi.org / 10.1111 / mpp.13407 245761.000234 Covarrubias-Pazaran (2016), Genome-Assisted Prediction of Quantitative Traits Using the R Package sommer, PLoS One, 11(6) doi: 10.1371 / journal.pone.0156744. eCollection 2016 Edgar (2004), MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Research 32(5):1792-1 Griffiths et al. (2000), An Introduction to Genetic Analysis, Biologia Plantarum 45, 50. https: / / doi.org / 10.1023 / A:1015187026471 He et al. (2014), SNP genotyping: the KASP assay, Methods Mol Biol;1145:75-86 doi: 10.1007 / 978-l-4939-0446-4_7. Holtschulte (2000), Cercospora beticola – worldwide distribution and incidence, in “Cercospora beticola Sacc. Biology, Agronomic Influence and Control Measures in Sugar Beet,” vol.2 (M.J.C. Asher, B. Holtschulte, M.R. Molard, F. Rosso, G. Steinrücken, R. Beckers, eds.). International Institute for Beet Research, Brussels, Belgium), pp.5-16. Kamvar et al. (2014), Poppr: a R package for genetic analysis of populations with clonal, partially clonal, and / or sexual reproduction, Peer J., 4:2 doi: 10.7717 / peerj.281. eCollection 2014. Semagn et al. (2014), Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): overview of the technology and its application in crop improvement, Molecular Breeding 33(1): 1-14. Shane and Teng (1992), Impact of Cercospora Leaf spot on Root Weight, Sugar Yield and Purity of Beta vulgaris, Plant Dis.76: 812-820. Sperschneider, J. & Dodds, P.N. (2022), EffectorP 3.0: prediction of apoplastic and cytoplasmic effectors in fungi and oomycetes. Molecular Plant-Microbe Interactions 35, 146–156. Steinrücken (1997), Die Züchtung von Cercospora-resistenten Zuckerrüben. (The breeding of Cercospora-resistant sugar beets.), Vorträge für Pflanzenzüchtung (Lectures on Plant Breeding), Volume 37, Lecture symposium, March 4-5, 1997, Kiel Trkulja et al. (2017), Molecular and experimental evidence of multi-resistance of Cercospora beticola field populations to MBC, DMI and QoI fungicides, European Journal of Plant Pathology 149.4 (2017): 895-910. Vaghefi et al. (2017), Genetic structure of Cercospora beticola populations on Beta vulgaris in New York and Hawaii, Sci. Rep., 7(1): 1726, doi: 10.1038 / s41598-017-01929-4 Weiland and Koch (2004), Sugarbeet leaf spot disease (Cercospora beticola Sacc.), The Plant Journal, 5(3), 157-166.

Claims

245761.000234 CLAIMS 1. Marker for the identification of at least one virulent C. beticola strain in a sample which strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4, wherein the marker is detecting a) one or more highly diagnostic SNP alleles on chromosome 1 of C. beticola which is tightly linked to virulence of at least one C. beticola strain, or b) one or more deletion of genomic sequence on chromosome 1 of C. beticola in the genome of at least one virulent fungal C. beticola strain wherein the one or more deletion of genomic sequence is tightly linked to virulence of C. beticola, or and thereby allows to identify such a virulent C. beticola strain.

2. Marker according to claim 1, wherein the marker is also used to determine whether at least one C. beticola strain is present in the sample.

3. Marker according to claim 1 or 2, wherein the one or more highly diagnostic SNP allele and / or the one or more deletion is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp, preferably the sequence between positions 4,085,502 bp and 4,109,180 bp.

4. Marker according to any one of claims 1 to 3, wherein the one or more highly diagnostic SNP allele and / or the one or more deletion is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to a region in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,087,634 bp and 4,094,364 bp.

5. Marker according to any one of claims 1 to 4, wherein the one or more highly diagnostic SNP allele, the one or more deletion and / or the one or more insertion is located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola and 1000 bp upstream or 1000 bp downstream of that genomic sequence of the AvrCR4 gene of C. beticola which is located on chromosome 1 of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,088,424 bp and 4,090,764bp.245761.000234 6. Method of detecting the presence of one or more virulent C. beticola strains in a sample, wherein said one or more virulent C. beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4, and wherein said method detects one or more of the markers of any one of claims 1 to 5.

7. Method of detecting the presence of one or more virulent C. beticola strains in a sample, wherein method also comprises the determination by marker whether at least one C. beticola strain is present in the sample.

8. Method according to claim 6 or 7, wherein the sample is selected from the group comprising one or more soil sample, one or more sample of plant material taken from one or more plants growing in a field, or one or more DNA sample extracted from one or more soil sample or from one or more sample of plant material taken from one or more plants growing in a field.

9. Method according to any one of claims 6 to 8, wherein the one or more soil sample is taken from one or more fields where plants of the genus Beta are grown, or wherein the one or more sample of plant material is taken from one or more plant of the genus Beta growing in one or more fields.

10. Method according to any one of claims 6 to 9, wherein the method further comprises the step of extracting DNA, preferably genomic DNA, from the C. beticola strains present in the one or more sample.

11. Method of controlling, preventing, or reducing the development of one or more virulent strains of C. beticola in a field in which plants of the genus Beta are grown, wherein said one or more virulent C. beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4, said method comprising the steps of - planting C. beticola-resistant plants of the genus Beta carrying the resistance gene BvCR4 in a field, - prior to or after the planting of step (a) analyze one or more samples from that field for the presence of one or more virulent strains of C. beticola which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4 by employing one or more markers according to any one of claims 1 to 5 and / or the method according to any one of claims 6 to 10, and245761.000234 - applying fungicides for at least one time over the top of the plants of the genus Beta in the field after emergence if the presence of one or more virulent strains of C. beticola which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4 is detected in the sample in step (b).

12. Use of at least one marker, preferably at least two, at least three, at least four, or at least five, or more marker according to any one of claims 1 to 5 for the identification of one or more virulent C. beticola strains in a sample, wherein the one or more C. beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4.

13. Use of at least one marker according to claim 12 for the identification of one or more virulent C. beticola strains in a sample on the basis of differences in the genomic DNA on chromosome 1 of C. beticola, preferably on the basis of one or more highly diagnostic SNP allele and / or one or more deletion located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp, preferably the sequence between positions 4,085,502 bp and 4,109,180 bp more preferably being located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to a region on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen- 1_hq-v2 which is spanning the sequence between positions 4,087,634 bp and 4,094,364 bp, and even more preferably being located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola and 1000 bp upstream or 1000 bp downstream of that genomic sequence of the AvrCR4 gene of C. beticola which is located on chromosome 1 of C. beticola at a position which corresponds to a region on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,088,424 bp and 4,090,764bp.

14. A set of at least two, preferable three, oligonucleotides suitable for use as primers in a PCR which are able to hybridize to the genomic sequence of chromosome 1 of C. beticola and which are able to identify the haplotype of at least one C. beticola in a sample which is characterized by a) one or more highly diagnostic SNP alleles on chromosome 1 of C. beticola which is tightly linked to virulence of at least one C. beticola strain, or b) one or more deletion of genomic sequence on chromosome 1 of C. beticola in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola245761.000234 and thereby allow to identify in a sample at least one virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4.

15. A set of oligonucleotides according to claim 14, which is a set of three oligonucleotides suitable for use as primer in a PCR involving two forward primers and a reverse primer wherein each primer has a different nucleotide sequence and wherein the reverse primer and only one of the two forward primers are able to identify the haplotype of at least one C. beticola in a sample which is characterized by a) one or more highly diagnostic SNP alleles on chromosome 1 of C. beticola which is tightly linked to virulence of at least one C. beticola strain, or b) one or more deletion of genomic sequence on chromosome 1 of C. beticola in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola and thereby allow to identify in a sample at least one virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4.