Cish compositions and methods for immunotherapy

Abstract

Compositions and methods for editing, e.g., altering a DNA sequence, within a CISH gene are provided. Compositions and methods for immunotherapy are provided.

Description

CISH COMPOSITIONS AND METHODS FOR IMMUNOTHERAPY RELATED APPLICATION

[0001] This application claims the benefit of priority to U.S. Provisional Patent Application serial number 63 / 450,538, filed March 7, 2023, which is hereby incorporated by reference in its entirety. BACKGROUND

[0002] Cytokine-inducible SH2-containing protein (CISH) is a member of the suppressor of cytokine signaling (SOCS) protein family. Each SOCS protein carries a SOCS box sequence motif, enabling the SOCS protein to function as an adaptor for an E3 ubiquitin ligase complex and enabling proteins that interact directly with SOCS to undergo proteasomal degradation. CISH has been shown to be induced by TCR stimulation in CD8 T cells and inhibits their immune function against tumors by physically interacting with the TCR intermediate PLC- ^1 and targeting it for proteasomal degradation. In natural killer (NK) cells, CISH has been reported to inhibit JAK-STAT signaling activation induced by cytokines by binding directly to JAK1 and to reduce cellular metabolic fitness, which is mediated by the mTOR signaling pathway. SUMMARY

[0003] In certain aspects, provided herein are compositions and methods related to the preparation of engineered cells with one or more genetic modifications (e.g., insertions, deletions, substitutions) in a CISH gene sequence using the CRISPR / Cas system, as well as cells with one or more genetic modifications (e.g., insertions, deletions, substitutions) in the CISH gene sequence and their use in various methods, including, but not limited to, adoptive cell transfer therapy for cancers. In various embodiments, one or more genetic modifications in a CISH gene sequence reduce or eliminate CISH expression by the cells,

[0004] In some embodiments, the engineered cells provided herein are genetically modified T cells or natural killer (NK) cells. In certain embodiments, the engineered cells are cells that have been modified to express a chimeric antigen receptor (CAR), such as a CAR specific for a cancer antigen (e.g., a full-length CAR protein or a fragment thereof). In certain embodiments, the engineered cells express a recombinant T cell receptor (TCR), such as a recombinant TCR specific for a cancer antigen. In some embodiments, the engineered cells may include other genetic modifications in additional genomic sequences including, at the T-cell receptor (TCR) loci, e.g., TRAC or TRBC loci, to reduce or eliminate TCR expression; at genomic loci that reduce or eliminate expression of one or more MHC class I molecules, e.g., B2M and HLA-A loci; genomic loci that reduce or eliminate expression of one or more MHC class II molecules, e.g., CIITA loci; or at one or more checkpoint inhibitor loci, e.g., CD244 (2B4) loci, TIM3 loci, LAG3, and PD-1 loci. In some embodiments, such cells are used to treat a cancer in a subject. In some embodiments, such genetically modified cells are used in a combination therapy that also includes administration of an additional therapeutic agent (e.g., a chemotherapy, hormone therapy, immunotherapy, radiation therapy, or a targeted therapy) to the subject.

[0005] In some embodiments, the present disclosure relates to populations of cells, including cells with genetic modification of their CISH gene sequence, and optionally other genomic loci disclosed herein. In certain embodiments, such populations of cells may be used in adoptive cell (e.g., T cell, NK cell) transfer therapies. In some embodiments, the present disclosure relates to compositions and uses of the cells with genetic modification of the CISH sequence for use in therapy, e.g., cancer therapy and immunotherapy.

[0006] In certain aspects, provided herein is an engineered cell comprising a genetic modification in a human CISH sequence, such as a genetic modification within the genomic coordinates of chr3: 50606489-50611774. In some embodiments, the genetic modification is within genomic coordinates of chr3: 50607593-50608517, optionally within chr3: 50607665- 50608153, optionally within chr3: 50607665-50607868.

[0007] Also disclosed is the use of a composition or formulation of a cell of any of the foregoing embodiments for the preparation of a medicament for treating a subject. The subject may be human or animal (e.g. human or non-human animal, e.g., cynomolgus monkey). In certain embodiments, the subject is human.

[0008] In some aspects, disclosed are any of the foregoing compositions or formulations for use in producing a genetic modification (e.g., an insertion, a substitution, or a deletion) within a CISH gene sequence, e.g., using a CRISPR / Cas system. In some embodiments, provided herein are gRNA molecules, CRISPR systems, cells, and methods useful for genome editing of cells. In certain embodiments, the genetic modification within the CISH gene sequence results in a change in the nucleic acid sequence that prevents translation of a full-length CISH protein, e.g., by forming a frameshift or nonsense mutation, such that translation is terminated prematurely. In some embodiments, the genetic modification can include insertion, substitution, or deletion at a splice site, i.e., a splice acceptor site or a splice donor site, such that the abnormal splicing results in a frameshift mutation, nonsensemutation, or truncated mRNA, such that translation is terminated prematurely. In some embodiments, genetic modifications can also disrupt translation or folding of the encoded protein resulting in premature translation termination. In certain embodiments, compositions and methods provided herein for use in producing a genetic modification within a CISH sequence that results in reduced expression of a CISH protein.

[0009] In certain aspects, provided herein are methods of providing an immunotherapy to a subject, the method including administering to the subject an effective amount of a cell as described herein (e.g., a genetically modified T cell or NK cell described herein). In some embodiments, the immunotherapy is for the treatment of a cancer in a subject.

[0010] In embodiments, the immunotherapy method includes lymphodepletion prior to administering a cell or population of cells described herein. In some embodiments, the method includes administering a lymphodepleting agent or immunosuppressant prior to administering to the subject an effective amount of the cell as described herein, for example, a cell of any of the aforementioned cell aspects and embodiments. In certain embodiments, the therapeutic method includes preparing cells (e.g., a population of cells) using a method provided herein such that they have reduced or eliminated CISH expression prior to administration to the subject.

[0011] In another aspect, provided herein is a method of preparing cells (e.g., a population of cells, such a T cells or NK cells) for immunotherapy, the method including: (a) modifying cells by reducing or eliminating expression of CISH protein and, optionally, one or more or all components of an endogenous T-cell receptor (TCR), for example, by introducing into said cells a gRNA molecule (as described herein), or more than one gRNA molecule, as disclosed herein; and (b) expanding said cells. Cells provided herein are suitable for further engineering, e.g., by introduction of a heterologous sequence or heterologous sequences coding for a targeting receptor, e.g., a protein that mediates TCR / CD3 zeta chain signalling. In some embodiments, the protein is a targeting receptor selected from a non- endogenous TCR or CAR sequence (e.g., sequences encoding TCRs or CARs specific for cancer antigens). In some embodiments, the protein is a wild-type or variant TCR. Cells provided herein may also be suitable for further engineering by introduction of a heterologous sequence coding for an alternative antigen binding moiety, e.g., by introduction of a heterologous sequence coding for an alternative (non-endogenous) T cell receptor, e.g., a chimeric antigen receptors (CAR) engineered to target a specific protein (e.g., a cancer antigen). CARs are also known as chimeric immunoreceptors, chimeric T cell receptors orartificial T cell receptors). In some embodiments, cells provided herein may be further engineered to express a TCR or a CAR that is specific for a cancer antigen, e.g., CD38.

[0012] In another aspect, provided herein is a method of treating a subject that includes administering cells (e.g., a population of cells, such as a population of T cells or NK cells) prepared by a method described herein (e.g., a method that results in a reduction or elimination of CISH protein expression). In some embodiments, the method further comprises administering an additional therapeutic agent to the subject. The additional therapeutic agent can be a cancer therapy (e.g., a chemotherapy, a hormone therapy, an immunotherapy, a radiation therapy, or a targeted therapy). In some embodiments, the subject is treated for a cancer or an infection. The cancer can be a solid tumor or a hematological cancer.

[0013] Further embodiments are provided throughout and described in the claims and Figures. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Fig.1 is a graph of the percentage CISH protein knockdown in edited T cells as detected by Western assay.

[0015] Figs.2A, 2B, and 2C are graphs of the mean percentage of indel formation after editing T cells with guide RNAs targeting CISH, as shown in cells of Donor 1 (Fig.2A), Donor 2 (Fig.2B), and Donor 3 (Fig.2C).

[0016] Fig.3 is a graph of the percent CISH protein knockdown as detected by Western assay in T cells edited with various concentrations of lipid nanoparticles.

[0017] Figs.4 A-C show mean percent indels in natural killer cells edited in donors CB15, CB54, and CB58, respectively.

[0018] Figs.5A-B show the percent CISH protein knockdown in natural killer cells in donors CB58 and CB54, respectively.

[0019] Fig.6 shows mean percent editing after base editing.

[0020] Figs.7A-B show the percent indels in natural killer cells edited with G032588 in donors CB16 and CB73, respectively.DETAILED DESCRIPTION

[0021] Reference will now be made in detail to certain embodiments disclosed herein. The present teaching also encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.

[0022] Before describing the present teachings in detail, it is to be understood that the disclosure is not limited to specific compositions or process steps, as such may vary. It should be noted that, as used in this specification and the appended claims, the singular form “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, reference to “a conjugate” includes a plurality of conjugates and reference to “a cell” includes a plurality of cells (e.g., a population of cells) and the like.

[0023] Numeric ranges are inclusive of the numbers defining the range. Measured and measurable values are understood to be approximate, taking into account significant digits and the error associated with the measurement. In some embodiments a population of cells refers to a population of at least 103, 104, 105or 106cells, preferably 107, 2 x 107, 5 x 107, or 108cells.

[0024] The use of “comprise,” “comprises,” “comprising,” “contain,” “contains,” “containing,” “include,” “includes,” and “including” are not intended to be limiting. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the teachings. Unless specifically noted in the specification, embodiments in the specification that recite “comprising” various components are also contemplated as “consisting of” or “consisting essentially of” the recited components; embodiments in the specification that recite “consisting of” various components are also contemplated as “comprising” or “consisting essentially of” the recited components; and embodiments in the specification that recite “consisting essentially of” various components are also contemplated as “consisting of” or “comprising” the recited components (this interchangeability does not apply to the use of these terms in the claims).

[0025] The term “or” is used in an inclusive sense in the specification, i.e., equivalent to “and / or,” unless the context clearly indicates otherwise.

[0026] The term “about”, when used before a list, modifies each member of the list. The term “about” is understood to encompass tolerated variation or error within the art, e.g., 2 standard deviations from the mean, or the sensitivity of the method used to take a measurement. When “about” is present before the first value of a series, it can be understood to modify each value in the series.

[0027] Ranges are understood to include the numbers at the end of the range and all logical values therebetween. For example, 5-10 nucleotides is understood as 5, 6, 7, 8, 9, or 10 nucleotides, whereas 5-10% is understood to contain 5% and all possible values through 10%.

[0028] At least 17 nucleotides of a 20 nucleotide sequence is understood to include 17, 18, 19, or 20 nucleotides of the sequence provided, thereby providing a upper limit even if one is not specifically provided as it would be clearly understood. Similarly, up to 3 nucleotides would be understood to encompass 0, 1, 2, or 3 nucleotides, providing a lower limit even if one is not specifically provided. When “at least,” “up to,” or other similar language modifies a number, it can be understood to modify each number in the series.

[0029] As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex region of “no more than 2 nucleotide base pairs” has a 2, 1, or 0 nucleotide base pairs. When “no more than” or “less than” is present before a series of numbers or a range, it is understood that each of the numbers in the series or range is modified.

[0030] As used herein, ranges include both the upper and lower limit.

[0031] In the event of a conflict between a sequence in the application and an indicated accession number or position in an accession number, the sequence in the application predominates.

[0032] In the event of a conflict between a chemical name and a structure, the structure predominates.

[0033] As used herein, “detecting an analyte” and the like is understood as performing an assay in which the analyte can be detected, if present, wherein the analyte is present in an amount above the level of detection of the assay.

[0034] As used herein, it is understood that when the maximum amount of a value is represented by 100% (e.g., 100% inhibition or 100% encapsulation) that the value is limited by the method of detection. For example, 100% inhibition is understood as inhibition to a level below the level of detection of the assay, and 100% encapsulation is understood as no material intended for encapsulation can be detected outside the vesicles.

[0035] As used herein, “eliminate” is understood to mean reducing a level to below the detection threshold of an assay.

[0036] The section headings used herein are for organizational purposes only and are not to be construed as limiting the desired subject matter in any way. In the event that anymaterial incorporated by reference contradicts any term defined in this specification or any other express content of this specification, this specification controls. Definitions

[0037] Unless stated otherwise, the following terms and phrases as used herein are intended to have the following meanings:

[0038] “Polynucleotide” and “nucleic acid” are used herein to refer to a multimeric compound comprising nucleosides or nucleoside analogs which have nitrogenous heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof. A nucleic acid “backbone” can be made up of a variety of linkages, including one or more of sugar- phosphodiester linkages, peptide-nucleic acid bonds (“peptide nucleic acids” or PNA; PCT No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. Sugar moieties of a nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2’ methoxy or 2’ halide substitutions. An RNA may comprise one or more deoxyribose nucleotides, e.g. as modifications, and similarly a DNA may comprise one or more ribonucleotides. Nitrogenous bases can be conventional bases (A, G, C, T, U), analogs thereof (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine, or others); inosine; derivatives of purines or pyrimidines (e.g., N4-methyl deoxyguanosine, deaza- or aza-purines, deaza- or aza- pyrimidines, pyrimidine bases with substituent groups at the 5 or 6 position (e.g., 5- methylcytosine), purine bases with a substituent at the 2, 6, or 8 positions, 2-amino-6- methylaminopurine, O6-methylguanine, 4-thio-pyrimidines, 4-amino-pyrimidines, 4- dimethylhydrazine-pyrimidines, and O4-alkyl-pyrimidines; US Pat. No.5,378,825 and PCT No. WO 93 / 13121). For general discussion see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11thed., 1992). Nucleic acids can include one or more “abasic” residues where the backbone includes no nitrogenous base for position(s) of the polymer (US Pat. No. 5,585,481). A nucleic acid can comprise only conventional RNA or DNA sugars, bases, and linkages or can include both conventional components and substitutions (e.g., conventional nucleosides with 2’ methoxy substituents or polymers containing both conventional nucleosides and one or more nucleoside analogs). Nucleic acids include “locked nucleic acids” (LNA) and analogues containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation, which enhance hybridization affinity toward complementary RNA and DNA sequences (Vester and Wengel,2004, Biochemistry 43(42):13233-41). RNA and DNA have different sugar moieties and can differ by the presence of uracil or analogs thereof in RNA and thymine or analogs thereof in DNA.

[0039] “Guide RNA,” “gRNA,” and simply “guide” are used herein interchangeably to refer to, for example, either a single guide RNA or the combination of a crRNA and a trRNA (also known as tracrRNA). The crRNA and trRNA may be associated as a single RNA molecule (as a single guide RNA, sgRNA) or, for example, in two separate RNA strands (dual guide RNA, dgRNA). “Guide RNA” or “gRNA” refers to each type. The trRNA may be a naturally-occurring sequence or a trRNA sequence with modifications or variations.

[0040] As used herein, a “guide sequence” refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct a guide RNA to a target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binding agent. A “guide sequence” may also be referred to as a “targeting sequence,” or a “spacer sequence.” A guide sequence can be 20 base pairs in length, e.g., in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs. Shorter or longer sequences can also be used as guides, e.g., 15-, 16-, 17-, 18-, 19-, 21-, 22-, 23-, 24-, or 25-nucleotides in length. For example, in some embodiments, the guide sequence comprises at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-111. In some embodiments, the target sequence is in a gene or on a chromosome, for example, and is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence is at least 75%, 80%, 85%, 90%, 95%, or 100%. For example, in some embodiments, the guide sequence comprises a sequence with at least 75%, 80%, 85%, 90%, 95%, or 100% identity to at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-111. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch, i.e., one nucleotide that is not identical or not complementary, depending on the reference sequence. For example, the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, where the total length of the target sequence is 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and the target region may contain 1-4 mismatches where the guide sequence comprises at least 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and the target region may contain 1, 2, 3, or 4 mismatches where the guide sequence comprises 20 nucleotides. That is, the guide sequence and the target region may form a duplex region having 17, 18, 19, 20 or more basepairs. In certain embodiments, the duplex region may include 1, 2, 3, or 4 mismatches such that guide strand and target sequence are not fully complementary. For example, a guide strand and target sequence may be complementary over a 20 nucleotide region, including 2 mismatches, such that the guide sequence and target sequence are 90% complementary providing a duplex region of 18 base pairs out of 20.

[0041] Target sequences for RNA-guided DNA binding agents include both the positive and negative strands of genomic DNA (i.e., the sequence given and the reverse compliment of the sequence), as a nucleic acid substrate for an RNA-guided DNA binding agent is a double stranded nucleic acid. Accordingly, where a guide sequence is said to be “complementary to a target sequence,” it is to be understood that the guide sequence may direct a guide RNA to bind to the sense or antisense strand (e.g. reverse complement) of a target sequence. Thus, in some embodiments, where the guide sequence binds the reverse complement of a target sequence, the guide sequence is identical to certain nucleotides of the target sequence (e.g., the target sequence not including the PAM) except for the substitution of U for T in the guide sequence. Unless otherwise indicated, nucleotides in guide RNA sequences provided herein that are identified using a capital letter are RNA nucleotide wit a 2'-OH.

[0042] As used herein, an “RNA guided DNA binding agent” means a polypeptide or complex of polypeptides having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA binding activity is sequence-specific and depends on the sequence of the RNA. Exemplary RNA-guided DNA binding agents include Cas cleavases / nickases and inactivated forms thereof (“dCas DNA binding agents”). “Cas nuclease,” as used herein, encompasses Cas cleavases, Cas nickases, and dCas DNA binding agents. The dCas DNA binding agent may be a dead nuclease comprising non-functional nuclease domains (RuvC or HNH domain). In some embodiments the Cas cleavase or Cas nickase encompasses a dCas DNA binding agent modified to permit DNA cleavage, e.g. via fusion with a FokI domain. Cas cleavases / nickases and dCas DNA binding agents include a Csm or Cmr complex of a type III CRISPR system, the Cas10, Csm1, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases. As used herein, a “Class 2 Cas nuclease” is a single-chain polypeptide with RNA-guided DNA binding activity. Class 2 Cas nucleases include Class 2 Cas cleavases / nickases (e.g., H840A, D10A, or N863A variants), which further have RNA-guided DNA cleavases or nickase activity, and Class 2 dCas DNA binding agents, in which cleavase / nickase activity is inactivated. Class 2 Cas nucleases include, for example, Cas9,Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof. Cpf1 protein, Zetsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like nuclease domain. Cpf1 sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables S1 and S3. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0043] As used herein, the term “editor” refers to an agent comprising a polypeptide that is capable of making a modification within a DNA sequence. In some embodiments, the editor is a cleavase, such as a Cas9 cleavase. In some embodiments, the editor is capable of deaminating a base within a DNA molecule. In some embodiments, the editor is capable of deaminating a cytosine (C) in DNA. In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to a cytidine deaminase. In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to an APOBEC3A deaminase (A3A). In some embodiments, the editor comprises a Cas9 nickase fused to an APOBEC3A deaminase (A3A). In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to a cytidine deaminase and a uracil glycosylase inhibitor (UGI). In some embodiments, the editor lacks a UGI.

[0044] As used herein, a “cytidine deaminase” means a polypeptide or complex of polypeptides that is capable of cytidine deaminase activity; that is catalyzing the hydrolytic deamination of cytidine or deoxycytidine, typically resulting in uridine or deoxyuridine. Cytidine deaminases encompass enzymes in the cytidine deaminase superfamily, and in particular, enzymes of the APOBEC family (APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups of enzymes), activation-induced cytidine deaminase (AID or AICDA) and CMP deaminases (see, e.g., Conticello et al., Mol. Biol. Evol.22:367-77, 2005; Conticello, Genome Biol.9:229, 2008; Muramatsu et al., J. Biol. Chem.274: 18470-6, 1999); Carrington et al., Cells 9:1690 (2020)).

[0045] As used herein, the term “APOBEC3” refers to a APOBEC3 protein, such as an APOBEC3 protein expressed by any of the seven genes (A3A-A3H) of the human APOBEC3 locus. The APOBEC3 may have catalytic DNA or RNA editing activity. An amino acid sequence of APOBEC3A has been described (UniPROT accession ID: p31941). In some embodiments, the APOBEC3 protein is a mammalian, e.g., human wild-type APOBEC3 protein or a variant protein. Variants include proteins having a sequence that differs from wild-type APOBEC3 protein by one or several mutations (i.e., substitutions, deletions, insertions), such as one or several single point substitutions. For instance, a shortened APOBEC3 sequence could be used, e.g. by deleting several N-term or C-term amino acids, preferably one to four amino acids at the C-terminus of the sequence. As used herein, the term “variant” refers to allelic variants, splicing variants, and natural or artificial mutants, which are homologous to a APOBEC3 reference sequence. The variant is “functional” in that it shows a catalytic activity of DNA or RNA editing. In some embodiments, an APOBEC3 (such as a human APOBEC3A) has a wild-type amino acid position 57 (as numbered in the wild-type sequence). In some embodiments, an APOBEC3 (such as a human APOBEC3A) has an asparagine at amino acid position 57 (as numbered in the wild-type sequence).

[0046] As used herein, a “nickase” is an enzyme that creates a single-strand break (also known as a “nick”) in double strand DNA, i.e., cuts one strand but not the other of a DNA double helix. As used herein, an “RNA-guided DNA nickase” means a polypeptide or complex of polypeptides having DNA nickase activity, wherein the DNA nickase activity is sequence- specific and depends on the sequence of the RNA. Exemplary RNA-guided DNA nickases include Cas nickases. Cas nickases include nickase forms of a Csm or Cmr complex of a type III CRISPR system, the Cas10, Csm1, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases. Class 2 Cas nickases include variants in which only one of the two catalytic domains is inactivated, which have RNA-guided DNA nickase activity. Class 2 Cas nickases include, for example, Cas9 (e.g., H840A, D10A, or N863A variants of SpyCas9), Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof. Cpf1 protein, Zetsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like protein domain. Cpf1 sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables S1 and S3. “Cas9” encompasses S. pyogenes (Spy) Cas9, the variants of Cas9 listed herein, and equivalents thereof. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0047] As used herein, the term “fusion protein” refers to a hybrid polypeptide which comprises protein domains from at least two different proteins. One protein may be located at the amino-terminal (N-terminal) portion of the fusion protein or at the carboxy-terminal (C- terminal) protein thus forming an “amino-terminal fusion protein” or a “carboxy-terminal fusion protein,” respectively. Any of the proteins provided herein may be produced by anymethod known in the art. For example, the proteins provided herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker. Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), the entire contents of which are incorporated herein by reference.

[0048] The term “linker,” as used herein, refers to a chemical group or a molecule linking two adjacent molecules or moieties. Typically, the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond. In some embodiments, the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein) such as a 16-amino acid residue “XTEN” linker or a variant thereof (see, e.g., the Examples and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 432), SGSETPGTSESA (SEQ ID NO: 433), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 434).

[0049] As used herein, the term “uracil glycosylase inhibitor” or “UGI” refers to a protein that is capable of inhibiting a uracil-DNA glycosylase (UDG) base-excision repair enzyme.

[0050] Exemplary nucleotide and polypeptide sequences of Cas9 molecules are provided below. Methods for identifying alternate nucleotide sequences encoding Cas9 polypeptide sequences, including alternate naturally occurring variants, are known in the art. Sequences with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to any of the Cas9 nucleic acid sequences, amino acid sequences, or nucleic acid sequences encoding the amino acid sequences provided herein are also contemplated.

[0051] Exemplary open reading frame for Cas9 (SEQ ID NO: 430)

[0052] Exemplary amino acid sequence for Cas9 (SEQ ID NO: 420)

[0053] Exemplary open reading frame for Cas9 (SEQ ID NO: 431)

[0054] As used herein, “ribonucleoprotein” (RNP) or “RNP complex” refers to a guide RNA together with an RNA-guided DNA binding agent, such as a Cas nuclease, e.g., a Cas cleavase, Cas nickase, or dCas DNA binding agent (e.g., Cas9). In some embodiments, the guide RNA guides the RNA-guided DNA binding agent such as Cas9 to a target sequence, and the guide RNA hybridizes with and the agent binds to the target sequence; in cases where the agent is a cleavase or nickase, binding can be followed by cleaving or nicking.

[0055] As used herein, a “target sequence” refers to a sequence of nucleic acid in a target gene that has complementarity to the guide sequence of the gRNA, i.e., that is sufficiently complementary to the guide sequence to permit specific binding of the guide sequence. The interaction of the target sequence and the guide sequence directs an RNA-guided DNA binding agent to bind, and potentially nick or cleave (depending on the activity of the agent), within the target sequence.

[0056] As used herein, a first sequence is considered to be “identical” or have “100% identity” with a second sequence if an alignment of the first sequence to the second sequence shows that all of the positions of the second sequence in its entirety are matched by the first sequence. For example, the sequence AAG has 100% identity to the sequence AAGA because an alignment would give 100% identity in that there are matches, without gaps, to all three positions of the first sequence. Less than 100% identity can be calculated using routine methods. For example ACG would have 67% identity with AAGA as two of the threepositions of the first sequence are matches to the second sequence (2 / 3 = 67%). The differences between RNA and DNA (generally the exchange of uridine for thymidine or vice versa) and the presence of nucleoside analogs such as modified uridines do not contribute to differences in identity or complementarity among polynucleotides as long as the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as a complement). Thus, for example, the sequence 5’-AXG where X is any modified uridine, such as pseudouridine, N1-methyl pseudouridine, or 5-methoxyuridine, is considered 100% identical to AUG in that both are perfectly complementary to the same sequence (5’-CAU). Exemplary alignment algorithms are the Smith–Waterman and Needleman–Wunsch algorithms, which are well-known in the art. One skilled in the art will understand what choice of algorithm and parameter settings are appropriate for a given pair of sequences to be aligned; for sequences of generally similar length and expected identity >50% for amino acids or >75% for nucleotides, the Needleman-Wunsch algorithm with default settings of the Needleman-Wunsch algorithm interface provided by the EBI at the www.ebi.ac.uk web server is generally appropriate.

[0057] Similarly, as used herein, a first sequence is considered to be “fully complementary” or 100% complementary” to a second sequence when all of the nucleotides of a first sequence are complementary to a second sequence, without gaps. For example, the sequence UCU would be considered to be fully complementary to the sequence AAGA as each of the nucleobases from the first sequence base pair with the nucleotides of the second sequence, without gaps. The sequence UGU would be considered to be 67% complementary to the sequence AAGA as two of the three nucleobases of the first sequence base pair with nucleobases of the second sequence. One skilled in the art will understand that algorithms are available with various parameter settings to determine percent complementarity for any pair of sequences using, e.g., the NCBI BLAST interface (blast.ncbi.nlm.nih.gov / Blast.cgi) or the Needleman-Wunsch algorithm.

[0058] “mRNA” is used herein to refer to a polynucleotide that comprises an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by a ribosome and amino-acylated tRNAs). mRNA can comprise a phosphate- sugar backbone including ribose residues or analogs thereof, e.g., 2’-methoxy ribose residues. In some embodiments, the sugars of an mRNA phosphate-sugar backbone consist essentially of ribose residues, 2’-methoxy ribose residues, or a combination thereof.

[0059] Exemplary guide sequences useful in the guide RNA compositions and methods described herein are shown in Table 1a and 1b and throughout the application. For example, Table 1a and 1b show a guide sequence that may be used in a guide RNA to direct a RNA- guided DNA binding agent, e.g., a nuclease, such as a Cas nuclease, such as Cas9, to a target sequence. Target sequences are provided in Table 1a and 1b as genomic coordinates, and include both the positive and negative strands of genomic DNA (i.e., the sequence given and the sequence’s reverse complement). In some embodiments, where the guide sequence binds the reverse complement of a target sequence, the guide sequence is identical to certain nucleotides of the target sequence (e.g., the target sequence not including the PAM) except for the substitution of U for T in the guide sequence.

[0060] As used herein, “indels” refer to insertion / deletion mutations consisting of a number of nucleotides that are either inserted or deleted at the site of double-stranded breaks (DSBs) in a target nucleic acid.

[0061] As used herein, a method or composition canbe said to “inhibit expression”, “reduce expression”, or the like if it causes or contributes to a decrease in expression of a particular gene product (e.g., protein, mRNA, or both). Expression of a protein (i.e., gene product) can be measured by detecting total cellular amount of the protein from a tissue or cell population of interest by detecting expression of a protein as individual members of a population of cells, e.g., by cell sorting to define percent of cells expressing a protein, or expression of a protein in cells in aggregate, e.g., by ELISA or western blot. Inhibition of expression can result from genetic modification of a gene sequence, e.g., a genomic sequence, such that the full-length gene product, or any gene product, is no longer expressed, e.g. knockdown of the gene. Certain genetic modifications can result in the introduction of frameshift or nonsense mutations that prevent translation of the full-length gene product. Genetic modifications at a splice site, e.g., at a position sufficiently close to a splice acceptor site or a splice donor site to disrupt splicing, can prevent translation of the full-length protein. Inhibition of expression can result from a genetic modification in a regulatory sequence within the genomic sequence required for the expression of the gene product, e.g., a promoter sequence, a 3’ UTR sequence, e.g., a capping sequence, a 5’ UTR sequence, e.g., a poly A sequence. Inhibition of expression may also result from disrupting expression or activity of regulatory factors required for translation of the gene product, e.g., production of no gene product. For example, a genetic modification in a transcription factor sequence, inhibiting expression of the full-length transcription factor, can have downstream effects and inhibit expression of the expression of one or more gene products controlled by the transcriptionfactor. Therefore, inhibition of expression can be predicted by changes in genomic or mRNA sequences. Therefore, mutations expected to result in inhibition of expression can be detected by known methods including sequencing of mRNA isolated from a tissue or cell population of interest. Inhibition of expression can be determined as the percent of cells in a population having a predetermined level of expression of a protein, i.e., a reduction of the percent or number of cells in a population expressing a protein of interest at least a certain level. Inhibition of expression can also be assessed by determining a decrease in overall protein level, e.g., in a cell or tissue sample, e.g., a biopsy sample. In certain embodiments, inhibition of expression of a secreted protein can be assessed in a fluid sample, e.g., cell culture media or a body fluid. Proteins may be present in a body fluid, e.g., blood or urine, to permit analysis of protein level. In certain embodiments, protein level may be determined by protein activity or the level of a metabolic product, e.g., in urine or blood. In some embodiments, “inhibition of expression” may refer to some loss of expression of a particular gene product, for example a decrease in the amount of mRNA transcribed or a decrease in the amount of protein expressed by a population of cells. In some embodiments, “inhibition” may refer to some loss of expression of a particular gene product, for example a CISH gene product. It is understood that the level of knockdown is relative to a starting level in the same type of subject sample. For example, routine monitoring of a protein level is more easily performed in a fluid sample from a subject, e.g., blood or urine, than in a tissue sample, e.g., a biopsy sample. It is understood that the level of knockdown is for the sample being assayed. Similarly, in animal studies where serial tissue samples may be obtained, e.g., liver tissue, the knockdown target may be expressed in other tissues. Therefore, the level of knockdown is not necessarily the level of knockdown systemically, but within the tissue, cell type, or fluid being sampled.

[0062] As used herein, a “genetic modification” is a change at the DNA level, e.g. a change induced by a CRISPR / Cas9 gRNA and Cas9 system. A genetic modification may comprise an insertion, deletion, or substitution (i.e., base sequence substitution, i.e., mutation), typically within a defined sequence or genomic locus. A genetic modification changes the nucleic acid sequence of the DNA. A genetic modification may be at a single nucleotide position. A genetic modification may be at multiple nucleotides, e.g., 2, 3, 4, 5 or more nucleotides, typically in close proximity to each other, e.g., contiguous nucleotides. A genetic modification can be in a coding sequence, e.g., an exon sequence. A genetic modification can be at a splice site, i.e., sufficiently close to a splice acceptor site or a splice donor site to disrupt splicing. A genetic modification can include insertion of a nucleotidesequence not endogenous to the genomic locus, e.g., insertion of a coding sequence of a heterologous open reading frame or gene. As used herein, preferably a genetic modification prevents translation of a full-length protein having an amino acid sequence of the full-length protein prior to genetic modification of the genomic locus. Prevention of translation of a full- length protein or gene product includes prevention of translation of a protein or gene product of any length. Translation of a full-length protein can be prevented, for example, by a frameshift mutation that results in the generation of a premature stop codon or by generation of a nonsense mutation. Translation of a full-length protein can be prevented by disruption of splicing.

[0063] As used herein, a “heterologous coding sequence” refers to a coding sequence that has been introduced as an exogenous source within a cell (e.g., inserted at a genomic locus such as a safe harbor locus including a TCR gene locus). That is, the introduced coding sequence is heterologous with respect to at least its insertion site. A polypeptide expressed from such heterologous coding sequence gene is referred to as a “heterologous polypeptide.” The heterologous coding sequence can be naturally-occurring or engineered and can be wild- type or a variant. The heterologous coding sequence may include nucleotide sequences other than the sequence that encodes the heterologous polypeptide (e.g., an internal ribosomal entry site). The heterologous coding sequence can be a coding sequence that occurs naturally in the genome, as a wild-type or a variant (e.g., mutant). For example, although the cell contains the coding sequence of interest (as a wild-type or as a variant), the same coding sequence or variant thereof can be introduced as an exogenous source, e.g., for expression at a locus that is highly expressed. The heterologous coding sequence can also be a coding sequence that is not naturally occurring in the genome, or that expresses a heterologous polypeptide that does not naturally occur in the genome. “Heterologous coding sequence,” “exogenous coding sequence,” and “transgene” are used interchangeably. In some embodiments, the heterologous coding sequence or transgene includes an exogenous nucleic acid sequence, e.g., a nucleic acid sequence is not endogenous to the recipient cell. In some embodiments, the heterologous coding sequence or transgene includes an exogenous nucleic acid sequence, e.g., a nucleic acid sequence that does not naturally occur in the recipient cell. For example, a heterologous coding sequence may be heterologous with respect to its insertion site and with respect to its recipient cell.

[0064] A “safe harbor” locus is a locus within the genome wherein a gene may be inserted without significant deleterious effects on the cell. Non-limiting examples of safe harbor loci that are targeted by nuclease(s) for use herein include AAVS1 (PPP1 R12C),TCR, B2M, or albumin. In some embodiments, insertions at a locus or loci targeted for knockdown such as a TCR gene, e.g., TRAC gene, is advantageous for cells. Other suitable safe harbor loci are known in the art.

[0065] As used herein, “targeting receptor” refers to a receptor present on the surface of a cell, e.g., a T cell, to permit binding of the cell to a target site, e.g., a specific cell or tissue in an organism. Targeting receptors include, but are not limited to a chimeric antigen receptor (CAR), a T-cell receptor (TCR), and a receptor comprising a binder for a target (e.g., cell surface molecule or a ligand) operably linked through at least a transmembrane domain in an internal signalling domain capable of activating a T cell upon binding of the extracellular receptor portion of a protein. As used herein, a “receptor” and “ligand” pair includes any binding pair, including an antigen and an antibody that specifically binds the antigen.

[0066] As used herein, a “chimeric antigen receptor” refers to an extracellular target recognition domain, e.g., an scFv, VHH, nanobody; operably linked to an intracellular signaling domain, which activates the T cell when a target is bound. CARs are composed of four regions: an target recognition domain, an extracellular hinge region, a transmembrane domain, and an intracellular T-cell signalling domain. Such receptors are well known in the art (see, e.g., WO2020092057, WO2019191114, WO2019147805, WO2018208837, the corresponding portions of the contents of each of which are incorporated herein by reference). A reversed universal CAR that promotes binding of an immune cell to a target cell through an adaptor molecule (see, e.g., WO2019238722, the contents of which are incorporated herein in their entirety) is also contemplated. CARs can be targeted to any target (e.g., antigen) to which a binder (e.g., antibody) can be developed and are typically directed to molecules displayed on the surface of a cell or tissue to be targeted.

[0067] As used herein, “treatment” refers to any administration or application of a therapeutic for disease or disorder in a subject, and includes inhibiting the disease, arresting its development, relieving one or more symptoms of the disease, curing the disease, preventing one or more symptoms of the disease, or preventing reoccurrence of one or more symptoms of the disease. Treating an autoimmune or inflammatory response or disorder may comprise alleviating the inflammation associated with the specific disorder resulting in the alleviation of disease-specific symptoms. Treatment with the engineered T cells described herein may be used before, after, or in combination with additional therapeutic agents, e.g., the standard of care for the indication to be treated.

[0068] The human wild-type CISH sequence is available at NCBI Gene ID: 1154 (www.ncbi.nlm.nih.gov / gene / 1154, in the version available on the date of filing the instantapplication); Ensembl: ENSG00000114737, chr3:50,606,489-50,611,774 (GRCh38 / hg38). Cytokine inducible SH2 containing protein (CISH) is a member of the suppressor of cytokine signaling (SOCS) family, inhibits JAK-STAT and T cell receptor (TCR) signaling in T and natural killer (NK) cells. CISH contains a SH2 domain and a SOCS box domain, and thus belongs to the cytokine-induced STAT inhibitor (CIS), also known as suppressor of cytokine signaling (SOCS) or STAT-induced STAT inhibitor (SSI), protein family. CIS family members are cytokine-inducible negative regulators of cytokine signaling. The expression of CISH gene can be induced by IL2, IL3, GM-CSF and EPO in hematopoietic cells. Proteasome-mediated degradation of CISH has been shown to be involved in the inactivation of the erythropoietin receptor. Multiple transcript variants encoding different isoforms have been found for CISH gene. For example, there are at least two transcript variants for human CISH gene. The transcript variant 1 (NM_013324.7) represents a longer transcript with 4 exons and encodes CISH isoform 1 (NP_037456.5) with a distinct N-terminus. The transcript variant 2 (NM_145071.4) contains 3 exons and lacks a segment in the 5' UTR and coding region compared to the transcript variant 1. The translation begins at an in-frame upstream start codon, and results in CISH isoform 2 (NP_659508.1) with a different N-terminus, as compared to CISH isoform 1. Diseases associated with CISH include bacteremia 2 and malaria.

[0069] As used herein, “T cell receptor” or “TCR” refers to a receptor in a T cell. In general, a TCR is a heterodimer receptor molecule that contains two TCR polypeptide chains, α and β. α and β chain TCR polypeptides can complex with various CD3 molecules and elicit immune response(s), including inflammation and autoimmunity, after antigen binding. As used herein, a knockdown of TCR refers to a knockdown of any TCR gene in part or in whole, e.g., deletion of part of the TRBC1 gene, alone or in combination with knockdown of other TCR gene(s) in part or in whole.

[0070] “TRAC” is used to refer to the T cell receptor α chain. A human wild-type TRAC sequence is available at NCBI Gene ID: 28755; Ensembl: ENSG00000277734. T-cell receptor Alpha Constant, TCRA, IMD7, TRCA and TRA are gene synonyms for TRAC.

[0071] “TRBC” is used to refer to the T-cell receptor β-chain, e.g., TRBC1 and TRBC2. “TRBC1” and “TRBC2” refer to two homologous genes encoding the T-cell receptor β- chain, which are the gene products of the TRBC1 or TRBC2 genes.

[0072] A human wild-type TRBC1 sequence is available at NCBI Gene ID: 28639; Ensembl: ENSG00000211751. T-cell receptor Beta Constant, V_segment Translation Product, BV05S1J2.2, TCRBC1, and TCRB are gene synonyms for TRBC1.

[0073] A human wild-type TRBC2 sequence is available at NCBI Gene ID: 28638; Ensembl: ENSG00000211772. T-cell receptor Beta Constant, V_segment Translation Product, and TCRBC2 are gene synonyms for TRBC2.

[0074] A “T cell” plays a central role in the immune response following exposure to an antigen. T cells can be naturally occurring or non-natural, e.g., when T cells are formed by engineering, e.g., from a stem cell or by transdifferentiation, e.g., reprogramming a somatic cell. T cells can be distinguished from other lymphocytes by the presence of a T cell receptor on the cell surface. Included in this definition are conventional adaptive T cells, which include helper CD4+ T cells, cytotoxic CD8+ T cells, memory T cells, and regulatory CD4+ T cells, and innate-like T cells including natural killer T cells, mucosal associated invariant T cells, and gamma delta T cells. In some embodiments, T cells are CD4+. In some embodiments, T cells are CD3+ / CD4+.

[0075] As used herein, “MHC” or “MHC protein” refers to a major histocompatibility complex molecule (or plural), and includes e.g., MHC class I molecules (e.g., HLA-A, HLA- B, and HLA-C in humans) and MHC class II molecules (e.g., HLA-DP, HLA-DQ, and HLA- DR in humans).

[0076] “CIITA,” “CIITA,” or “C2TA,” as used herein, refer to the nucleic acid sequence or protein sequence of “class II major histocompatibility complex transactivator.” The human CIITA gene has accession number NC_000016.10 (range 10866208..10941562), reference GRCh38.p13. The CIITA protein in the nucleus acts as a positive regulator of MHC class II gene transcription and is required for MHC class II protein expression.

[0077] “β2M” or “B2M,” as used herein, refers to nucleic acid sequence or protein sequence of “β-2 microglobulin.” The human B2M gene has accession number NC_000015 (range 44711492..44718877), reference GRCh38.p13. The B2M protein is associated with MHC class I molecules as a heterodimer on the surface of nucleated cells and is required for MHC class I protein expression.

[0078] The term “HLA-A,” as used herein in the context of HLA-A protein, refers to the MHC class I protein molecule, which is a heterodimer consisting of a heavy chain (encoded by the HLA-A gene) and a light chain (i.e., beta-2 microglobulin). The term “HLA-A” or “HLA-A gene,” as used herein in the context of nucleic acids refers to the gene encoding the heavy chain of the HLA-A protein molecule. The HLA-A gene is also referred to as “HLA class I histocompatibility, A alpha chain.;” The human HLA-A gene has accession number NC_000006.12 (29942532..29945870). The HLA-A gene is known to have thousands of different versions (also referred to as “alleles”) across the population (and an individual mayreceive two different alleles of the HLA-A gene). A public database for HLA-A alleles, including sequence information, may be accessed at IPD-IMGT / HLA: www.ebi.ac.uk / ipd / imgt / hla / . All alleles of HLA-A are encompassed by the terms “HLA-A” and “HLA-A gene.”

[0079] As used herein, the term “within the genomic coordinates” includes the boundaries of the genomic coordinate range given. For example, if chr6:29942854- chr6:29942913 is given, the coordinates chr6:29942854-chr6:29942913 are encompassed. Throughout this application, the referenced genomic coordinates are based on genomic annotations in the GRCh38 (also referred to as hg38) assembly of the human genome from the Genome Reference Consortium, available at www.ncbi.nlm.nih.gov (the National Center for Biotechnology Information website). Tools and methods for converting genomic coordinates between one assembly and another are known in the art and can be used to convert the genomic coordinates provided herein to the corresponding coordinates in another assembly of the human genome, including conversion to an earlier assembly generated by the same institution or using the same algorithm (e.g., from GRCh38 to GRCh37), and conversion of an assembly generated by a different institution or algorithm (e.g., from GRCh38 to NCBI33, generated by the International Human Genome Sequencing Consortium). Available methods and tools known in the art include, but are not limited to, NCBI Genome Remapping Service, available at the National Center for Biotechnology Information website, UCSC LiftOver, available at the UCSC Genome Brower website, and Assembly Converter, available at the Ensembl.org website.

[0080] A “splice site,” as used herein, refers to the three nucleotides that make up an acceptor splice site or a donor splice site (defined below), or any other nucleotides known in the art that are part of a splice site. See e.g., Burset et al., Nucleic Acids Research 28(21):4364-4375 (2000) (describing canonical and non-canonical splice sites in mammalian genomes). The three nucleotides that make up an “acceptor splice site” are two conserved residues (e.g., AG in humans) at the 3’ of an intron and a boundary nucleotide (i.e., the first nucleotide of the exon 3’ of the AG). The “splice site boundary nucleotide” of an acceptor splice site is designated as “Y” in the diagram below and may also be referred to herein as the “acceptor splice site boundary nucleotide,” or “splice acceptor site boundary nucleotide.” The terms “acceptor splice site,” “splice acceptor site,” “acceptor splice sequence,” or “splice acceptor sequence” may be used interchangeably herein.

[0081] The three nucleotides that make up a “donor splice site” are two conserved residues (e.g., GT (gene) or GU (in RNA such as pre-mRNA) in human) at the 5’ end of anintron and a boundary nucleotide (i.e., the first nucleotide of the exon 5’ of the GT). The “splice site boundary nucleotide” of a donor splice site is designated as “X” in the diagram below and may also be referred to herein as the “donor splice site boundary nucleotide,” or “splice donor site boundary nucleotide.” The terms “donor splice site,” “splice donor site,” “donor splice sequence,” or “splice donor sequence” may be used interchangeably herein. Compositions Comprising Guide RNA (gRNAs)

[0082] Provided herein are compositions useful for altering a DNA sequence, e.g., inducing a single-stranded (SSB) or double-stranded break (DSB), within a CISH gene, e.g., using a guide RNA with an RNA-guided DNA binding agent (e.g., a CRISPR / Cas system). Guide sequences targeting a CISH gene are shown in Table 1a and 1b at SEQ ID NOs: 1-111, as are the genomic coordinates that such guide RNA targets.

[0083] Each of the guide sequences shown in Table 1a and 1b at SEQ ID NOs: 1-111 may further comprise additional nucleotides to form a crRNA, e.g., with the following exemplary nucleotide sequence following the guide sequence at its 3’ end: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO:404) in 5’ to 3’ orientation.

[0084] In the case of a sgRNA, the above guide sequences may further comprise additional nucleotides to form a sgRNA, e.g., with the following exemplary nucleotide sequence following the 3’ end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 415) in 5’ to 3’ orientation.

[0085] In the case of a sgRNA, the above guide sequences may further comprise additional nucleotides to form a sgRNA, e.g., with the following exemplary nucleotide sequence following the 3’ end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 416) in 5’ to 3’ orientation.

[0086] In the case of a sgRNA, the above guide sequences may further comprise additional nucleotides to form a sgRNA, e.g., with the following exemplary nucleotide sequence following the 3’ end of the guide sequence:

[0087] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAU CACGAAAGGGCACCGAGUCGGUGCU (SEQ ID NO: 413) in 5’ to 3’ orientation.

[0088] In some embodiments, the sgRNA may comprise a sequence of any one of SEQ ID NOs: 112-237 (Table 1a).

[0089] In the case of a sgRNA, the guide sequences may be integrated into the following modified motif. mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAm AmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 409), or mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCG GmU*mG*mC*mU (SEQ ID NO: 414), where “N” may be any natural or non-natural nucleotide, preferably an RNA nucleotide; sugar moieties of the nucleotide can be ribose, deoxyribose, or similar compounds with substitutions; m is a 2’-O-methyl modified nucleotide, and * is a phosphorothioate linkage between nucleotide residues; and wherein the N’s are collectively the nucleotide sequence of a guide sequence.

[0090] In some embodiments, the sgRNA may comprise a sequence of any one of SEQ ID NO: 238-363 (Table 1b), where “N” may be any natural or non-natural nucleotide, preferably an RNA nucleotide; sugar moieties of the nucleotide can be ribose, deoxyribose, or similar compounds with substitutions; m is a 2’-O-methyl modified nucleotide, and * is a phosphorothioate linkage between nucleotide residues; and wherein the N’s are collectively the nucleotide sequence of a guide sequence.

[0091] In the case of a sgRNA, the guide sequences may further comprise a SpyCas9 sgRNA sequence. An example of a SpyCas9 sgRNA sequence is SEQ ID NO: 415 (GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGC - Exemplary SpyCas9 sgRNA-1), which can be included at the 3’ end of the guide sequence, as exemplifiedin the table(s) below. A guide can include the following domains: LS (lower stem), B (bulge), US (upper stem), and H1 and H2 (hairpin 1 and hairpin 2, respectively). Collectively H1 and H2 are referred to as the hairpinregion. A model of the structure is provided in Figure 10A of WO2019237069 which is incorporated herein by reference.

[0092] The nucleotide sequence of Exemplary SpyCas9 sgRNA-1 may serve as a template sequence for specific chemical modifications, sequence substitutions and truncations.

[0093] In certain embodiments, the gRNA is an sgRNA or a dgRNA, for example, and it optionally comprises a chemical modification. In some embodiments, the modified sgRNA comprises a guide sequence and a SpyCas9 sgRNA sequence, e.g., Exemplary SpyCas9 sgRNA-1. A gRNA, such as an sgRNA, may include modifications on the 5’ end of the guide sequence or on the 3’ end of the SpyCas9 sgRNA sequence, such as, e.g., Exemplary SpyCas9 sgRNA-1 at one or more of the terminal nucleotides, e.g., at 1, 2, 3, or 4 of the nucleotides at the 3’ end or at the 5’ end. In certain embodiments, the modified nucleotide selected from a 2’-O-methyl (2’-OMe) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O- moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-OMe modified nucleotide. In certain embodiments, the modified nucleotide includes a PS linkage. In certain embodiments, the modified nucleotide includes a 2’-OMe modified nucleotide and a PS linkage.

[0094] In certain embodiments, using SEQ ID NO: 415 (“Exemplary SpyCas9 sgRNA- 1”) as an example, (see WO2019237069, the contents of which are incorporated herein by reference) the Exemplary SpyCas9 sgRNA-1 further includes one or more of: A. a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein 1. at least one of the following pairs of nucleotides are substituted in hairpin 1 with Watson-Crick pairing nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, and the hairpin 1 region optionally lacks a. any one or two of H1-5 through H1-8, b. one, two, or three of the following pairs of nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or c. 1-8 nucleotides of hairpin 1 region; or 2. the shortened hairpin 1 region lacks 4-8 nucleotides, preferably 4-6 nucleotides; anda. one or more of positions H1-1, H1-2, or H1-3 is deleted or substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 415) or b. one or more of positions H1-6 through H1-10 is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 415); or 3. the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 415); or B. a shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include less than or equal to 4 substitutions relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 415); or C. a substitution relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 415) at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2 and H2-14, wherein the substituent nucleotide is neither a pyrimidine that is followed by an adenine, nor an adenine that is preceded by a pyrimidine; or D. Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 415) with an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US1-US12 in the upper stem region, wherein 1. the modified nucleotide is optionally selected from a 2’-O-methyl (2’- OMe) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or a combination thereof; or 2. the modified nucleotide optionally includes a 2’-OMe modified nucleotide.

[0095] In certain embodiments, Exemplary SpyCas9 sgRNA-1, or an sgRNA, such as an sgRNA comprising Exemplary SpyCas9 sgRNA-1, further includes a 3’ tail, e.g., a 3’ tail of 1, 2, 3, 4, or more nucleotides. In certain embodiments, the tail includes one or more modified nucleotides. In certain embodiments, the modified nucleotide is selected from a 2’- O-methyl (2’-OMe) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, and an inverted abasic modified nucleotide, or a combination thereof. In certainembodiments, the modified nucleotide includes a 2’-OMe modified nucleotide. In certain embodiments, the modified nucleotide includes a PS linkage between nucleotides. In certain embodiments, the modified nucleotide includes a 2’-OMe modified nucleotide and a PS linkage between nucleotides.

[0096] In certain embodiments, the hairpin region includes one or more modified nucleotides. In certain embodiments, the modified nucleotide is selected from a 2’-O-methyl (2’-OMe) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide; or a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-OMe modified nucleotide.

[0097] In certain embodiments, the upper stem region includes one or more modified nucleotides. In certain embodiments, the modified nucleotide selected from a 2’-O-methyl (2’-OMe) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide; or a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-OMe modified nucleotide.

[0098] In certain embodiments, the Exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, wherein Y is a pyrimidine, wherein the YA dinucleotide includes a modified nucleotide. In certain embodiments, the modified nucleotide selected from a 2’-O- methyl (2’-OMe) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-OMe modified nucleotide.

[0099] In certain embodiments, the Exemplary SpyCas9 sgRNA-1 comprises, one or more YA dinucleotides, wherein Y is a pyrimidine, wherein the YA dinucleotide includes a substituted nucleotide, i.e., sequence substituted nucleotide, wherein the pyrimidine is substituted for a purine. In certain embodiments, when the pyrimidine forms a Watson-Crick base pair in the single guide, the Watson-Crick based nucleotide of the substituted pyrimidine nucleotide is substituted to maintain Watson-Crick base pairing.Exemplary spyCas9 sgRNA-1 (SEQ ID NO: 415)Table la: CISH guide sequences and chromosomal coordinatesTable lb: CISH guide sequences and chromosomal coordinates

[0100] In some embodiments, provided herein is a composition comprising one or more guide RNAs (gRNAs) comprising guide sequences that direct an RNA-guided DNA binding agent, which can be a nuclease (e.g., a Cas nuclease such as Cas9), to a target DNA sequence in CISH. The gRNA may comprise a crRNA comprising a guide sequence shown in Table 1a or 1b, optionally SEQ ID NO: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; or SEQ ID NO: 34, 35, 37, 38, 42, 45, 4, 47, 2, 48, 8, 53, 11, 16, 58, 59, 19, 60, 61, 15, 66, 68, 7, 70, 72, 18, 73, 74, 20, 17, 78, 79, 14, 9, and 23; or SEQ ID NO: 4, 47, 2, 11, 16, 58, 59, and 19; or SEQ ID NO: 47, 16, and 19; or SEQ ID NO: 47; or SEQ ID NO: 16; or SEQ ID NO: 19. The gRNA may comprise a crRNA comprising 17, 18, 19, or 20 contiguous nucleotides of a guide sequence shown in Table 1a or 1b. In some embodiments, the gRNA comprises a crRNA comprising a sequence with at least 75%, 80%, 85%, 90%, or 95%, or 100% identity to at least 17, 18, 19, or 20 contiguous nucleotides of a guide sequence shown in Table 1a or 1b, optionally SEQ ID NO: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; or SEQ ID NO: 34, 35, 37, 38, 42, 45, 4, 47, 2, 48, 8, 53, 11, 16, 58, 59, 19, 60, 61, 15, 66, 68, 7, 70, 72, 18, 73, 74, 20, 17, 78, 79, 14, 9, and 23; or SEQ ID NO: 4, 47, 2, 11, 16, 58, 59, and 19; or SEQ ID NO: 47, 16, and 19; or SEQ ID NO: 47; or SEQ ID NO: 16; or SEQ ID NO: 19. In some embodiments, the gRNA comprises a crRNA comprising a sequence with at least 75%, 80%, 85%, 90%, or 95%, or 100% identity to a guide sequence shown in Table 1a or 1b, optionally SEQ ID NO: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; or SEQ ID NO: 34, 35, 37, 38, 42, 45, 4, 47, 2, 48, 8, 53, 11, 16, 58, 59, 19, 60, 61, 15, 66, 68, 7, 70, 72, 18, 73, 74, 20, 17, 78, 79, 14, 9, and 23; or SEQ ID NO: 4, 47, 2, 11, 16, 58, 59, and 19; or SEQ ID NO: 47, 16, and 19; or SEQ ID NO: 47; or SEQ ID NO: 16; or SEQ ID NO: 19. The gRNA may further comprise a trRNA. In each embodiment described herein, the crRNA and trRNA may be associated as a single RNA (sgRNA) or may be on separate RNAs (dgRNA). In the context of sgRNAs, the crRNA and trRNA components may be covalently linked, e.g., via a phosphodiester bond or other covalent bond.

[0101] In certain embodiments described herein, the guide RNA may comprise two RNA molecules as a “dual guide RNA” or “dgRNA.” The dgRNA comprises a first RNA molecule comprising a crRNA comprising, e.g., a guide sequence shown in Table 1a or 1b, and asecond RNA molecule comprising a trRNA. The first and second RNA molecules may not be covalently linked, but may form an RNA duplex via the base pairing between portions of the crRNA and the trRNA.

[0102] In some embodiments, the guide RNA may comprise a single RNA molecule as a “single guide RNA” or “sgRNA”. The sgRNA may comprise a crRNA (or a portion thereof) comprising a guide sequence shown in Table 1a or 1b, optionally SEQ ID NOs: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; or SEQ ID NOs: 34, 35, 37, 38, 42, 45, 4, 47, 2, 48, 8, 53, 11, 16, 58, 59, 19, 60, 61, 15, 66, 68, 7, 70, 72, 18, 73, 74, 20, 17, 78, 79, 14, 9, and 23; or SEQ ID NOs: 4, 47, 2, 11, 16, 58, 59, and 19; or SEQ ID NOs: 47, 16, and 19; or SEQ ID NO: 47; or SEQ ID NO: 16; or SEQ ID NO: 19, covalently linked to a trRNA. The sgRNA may comprise 17, 18, 19, or 20 contiguous nucleotides of a guide sequence shown in Table 1a or 1b, optionally SEQ ID NOs: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; or SEQ ID NOs: 34, 35, 37, 38, 42, 45, 4, 47, 2, 48, 8, 53, 11, 16, 58, 59, 19, 60, 61, 15, 66, 68, 7, 70, 72, 18, 73, 74, 20, 17, 78, 79, 14, 9, and 23; or SEQ ID NOs: 4, 47, 2, 11, 16, 58, 59, and 19; or SEQ ID NOs: 47, 16, and 19; or SEQ ID NO: 47; or SEQ ID NO: 16; or SEQ ID NO: 19. In some embodiments, the crRNA and the trRNA are covalently linked via a linker. In some embodiments, the sgRNA forms a stem-loop structure via the base pairing between portions of the crRNA and the trRNA. In some embodiments, the crRNA and the trRNA are covalently linked via one or more bonds that are not a phosphodiester bond. In some embodiments, the sgRNA may comprise (e.g., consist of) a nucleotide sequence selected from SEQ ID NOs: 127, 237, 130, 234, 253, 363, 256, and 360. In some embodiments, the guide RNA comprises (e.g., consists of) a nucleotide sequence of SEQ ID NO: 127. In some embodiments, the guide RNA comprises (e.g., consists of) a nucleotide sequence of SEQ ID NO: 237. In some embodiments, the guide RNA comprises (e.g., consists of) a nucleotide sequence of SEQ ID NO: 130. In some embodiments, the guide RNA comprises (e.g., consists of) a nucleotide sequence of SEQ ID NO: 234. In some embodiments, the guide RNA comprises (e.g., consists of) a nucleotide sequence of SEQ ID NO: 253. In some embodiments, the guide RNA comprises (e.g., consists of) a nucleotide sequence of SEQ ID NO: 363. In some embodiments, the guide RNA comprises (e.g., consists of) a nucleotide sequence of SEQ ID NO: 256. In some embodiments, the guide RNA comprises (e.g., consists of) a nucleotide sequence of SEQ ID NO: 360.

[0103] In some embodiments, the trRNA may comprise all or a portion of a trRNA sequence derived from a naturally-occurring CRISPR / Cas system. In some embodiments, the trRNA comprises a truncated or modified wild type trRNA. The length of the trRNA depends on the CRISPR / Cas system used. In some embodiments, the trRNA comprises or consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides. In some embodiments, the trRNA may comprise certain secondary structures, such as, for example, one or more hairpin or stem-loop structures, or one or more bulge structures.

[0104] In some embodiments, provided herein is a composition comprising one or more guide RNAs comprising a guide sequence of any one of SEQ ID NOs: 1-111 , preferably SEQ ID NOs: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; or SEQ ID NOs: 34, 35, 37, 38, 42, 45, 4, 47, 2, 48, 8, 53, 11, 16, 58, 59, 19, 60, 61, 15, 66, 68, 7, 70, 72, 18, 73, 74, 20, 17, 78, 79, 14, 9, and 23; or SEQ ID NOs: 4, 47, 2, 11, 16, 58, 59, and 19; or SEQ ID NOs: 47, 16, and 19; or SEQ ID NO: 47; or SEQ ID NO: 16; or SEQ ID NO: 19.

[0105] In some embodiments, provided herein is a composition comprising one or more sgRNAs comprising any one of SEQ ID NOs: 145, 146, 230, 148, 228, 149, 150, 153, 154, 155, 156, 115, 158, 235, 113, 159, 119, 161, 162, 163, 164, 122, 167, 168, 127, 237, 169, 236, 170, 130, 234, 171, 172, 126, 173, 176, 177, 178, 117, 179, 118, 180, 181, 182, 183, 129, 184, 185, 131, 128, 186, 187, 189, 221, 190, 218, 125, 203, 121, 120, 134, 135, and 198; or 145, 146, 230, 148, 228, 149, 153, 156, 115, 158, 235, 113, 159, 119, 164, 122, 127, 237, 169, 236, 170, 130, 234, 171, 172, 126, 177, 179, 118, 181, 183, 129, 184, 185, 131, 128, 189, 221, 190, 218, 125, 203, 120, and 134; or 115, 158, 235, 113, 122, 127, 237, 169, 236, 170, 130, and 234; or 158, 235, 127, 237, 130, and 234; or 158 and 235; or 127 and 237; or 130 and 234.

[0106] In some embodiments, provided herein is a composition comprising one or more sgRNAs comprising any one of SEQ ID NOs: 271, 272, 356, 274, 354, 275, 276, 279, 280, 281, 282, 241, 284, 361, 239, 285, 245, 287, 288, 289, 290, 248, 293, 294, 253, 363, 295, 362, 296, 256, 360, 297, 298, 252, 299, 302, 303, 304, 243, 305, 244, 306, 307, 308, 309, 255, 310, 311, 257, 254, 312, 313, 315, 347, 316, 344, 251, 329, 247, 246, 260, 261, and 324; or 271, 272, 356, 274, 354, 275, 279, 282, 241, 284, 361, 239, 285, 245, 290, 248, 253, 363, 295, 362, 296, 256, 360, 297, 298, 252, 303, 305, 244, 307, 309, 255, 310, 311, 257, 254, 315, 347, 316, 344, 251, 329, 246, and 260; or 241, 284, 361, 239, 248, 253, 363, 295, 362,296, 256, and 360; or 284, 361, 253, 363, 256, and 360; or 284 and 361; or 253 and 363; or 256 and 360.

[0107] In one aspect, provided herein is a composition comprising a gRNA that comprises a guide sequence that is 100% or at least 95% or 90% identical to any of the nucleic acids of SEQ ID NOs: 1-111, preferably SEQ ID NOs: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; or SEQ ID NOs: 34, 35, 37, 38, 42, 45, 4, 47, 2, 48, 8, 53, 11, 16, 58, 59, 19, 60, 61, 15, 66, 68, 7, 70, 72, 18, 73, 74, 20, 17, 78, 79, 14, 9, and 23; or SEQ ID NOs: 4, 47, 2, 11, 16, 58, 59, and 19; or SEQ ID NOs: 47, 16, and 19; or SEQ ID NO: 47; or SEQ ID NO: 16; or SEQ ID NO: 19.

[0108] In other embodiments, the composition comprises at least one, e.g., at least two gRNA’s comprising guide sequences or guides selected from any two or more of the guide sequences or guides of SEQ ID NOs: 1-111 , preferably SEQ ID NOs: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; or SEQ ID NOs: 34, 35, 37, 38, 42, 45, 4, 47, 2, 48, 8, 53, 11, 16, 58, 59, 19, 60, 61, 15, 66, 68, 7, 70, 72, 18, 73, 74, 20, 17, 78, 79, 14, 9, and 23; or SEQ ID NOs: 4, 47, 2, 11, 16, 58, 59, and 19; or SEQ ID NOs: 47, 16, and 19; or SEQ ID NO: 47; or SEQ ID NO: 16; or SEQ ID NO: 19. In some embodiments, the composition comprises at least two gRNA’s that each comprise a guide sequence 100%, or at least 95% or 90% identical to any of the nucleic acids of SEQ ID NOs: 1-111 , preferably SEQ ID NOs: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; or SEQ ID NOs: 34, 35, 37, 38, 42, 45, 4, 47, 2, 48, 8, 53, 11, 16, 58, 59, 19, 60, 61, 15, 66, 68, 7, 70, 72, 18, 73, 74, 20, 17, 78, 79, 14, 9, and 23; or SEQ ID NOs: 4, 47, 2, 11, 16, 58, 59, and 19; or SEQ ID NOs: 47, 16, and 19; or SEQ ID NO: 47; or SEQ ID NO: 16; or SEQ ID NO: 19.

[0109] In certain embodiments, the guide RNA compositions provided herein are designed to recognize (e.g., hybridize to) a target sequence in a CISH gene. For example, the CISH target sequence may be recognized and cleaved by a provided Cas cleavase comprising a guide RNA. In some embodiments, an RNA-guided DNA binding agent, such as a Cas cleavase, may be directed by a guide RNA to a target sequence of a CISH gene, where the guide sequence of the guide RNA hybridizes with the target sequence and the RNA-guided DNA binding agent, such as a Cas cleavase, cleaves the target sequence.

[0110] In some embodiments, the selection of the one or more guide RNAs is determined based on target sequences within a CISH gene.

[0111] Without being bound by any particular theory, mutations (e.g., frameshift mutations resulting from indels, i.e., insertions or deletions, occurring as a result of a nuclease-mediated DSB) in certain regions of the gene may be less tolerable than mutations in other regions of the gene, thus the location of a DSB is an important factor in the amount or type of protein knockdown that may result. In some embodiments, a gRNA complementary or having complementarity to a target sequence within CISH is used to direct the RNA-guided DNA binding agent to a particular location in the appropriate CISH gene. In some embodiments, gRNAs are designed to have guide sequences that are complementary or have complementarity to target sequences in exon 1, exon 2, exon 3, or exon 4 of CISH.

[0112] In some embodiments, the guide sequence is 100% or at least 95% or 90% identical to a target sequence present in a human CISH gene. In some embodiments, the target sequence may be complementary to the guide sequence of the guide RNA. In some embodiments, the degree of complementarity or identity between a guide sequence of a guide RNA and its corresponding target sequence may be at least 80%, 85%, 90%, or 95%; or 100%. In some embodiments, the target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In other embodiments, the target sequence and the guide sequence of the gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, where the total length of the guide sequence is 20. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1-4 mismatches where the guide sequence is 20 nucleotides.

[0113] In some embodiments, a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA binding agent, such as a Cas nuclease as described herein. In some embodiments, an mRNA comprising an ORF encoding an RNA-guided DNA binding agent, such as a Cas nuclease, is provided, used, or administered. Modified gRNAs and mRNAs

[0114] In some embodiments, the gRNA is chemically modified. A gRNA comprising one or more modified nucleosides or nucleotides is called a “modified” gRNA or “chemically modified” gRNA, to describe the presence of one or more non-naturally or naturally occurring components or configurations that are used instead of or in addition to thecanonical A, G, C, and U residues. In some embodiments, a modified gRNA is synthesized with a non-canonical nucleoside or nucleotide, is here called “modified.” Modified nucleosides and nucleotides can include one or more of: (i) alteration, e.g., replacement, of one or both of the non-linking phosphate oxygens or of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage (an exemplary backbone modification); (ii) alteration, e.g., replacement, of a constituent of the ribose sugar, e.g., of the 2' hydroxyl on the ribose sugar (an exemplary sugar modification); (iii) wholesale replacement of the phosphate moiety with “dephospho” linkers (an exemplary backbone modification); (iv) modification or replacement of a naturally occurring nucleobase, including with a non- canonical nucleobase (an exemplary base modification); (v) replacement or modification of the ribose-phosphate backbone (an exemplary backbone modification); (vi) modification of the 3' end or 5' end of the oligonucleotide, e.g., removal, modification or replacement of a terminal phosphate group or conjugation of a moiety, cap or linker (such 3' or 5' cap modifications may comprise a sugar or backbone modification); and (vii) modification or replacement of the sugar (an exemplary sugar modification).

[0115] Chemical modifications such as those listed above can be combined to provide modified gRNAs or mRNAs comprising nucleosides and nucleotides (collectively “residues”) that can have two, three, four, or more modifications. For example, a modified residue can have a modified sugar and a modified nucleobase. In some embodiments, every base of a gRNA is modified, e.g., all bases have a modified phosphate group, such as a phosphorothioate group. In certain embodiments, all, or substantially all, of the phosphate groups of a gRNA molecule are replaced with phosphorothioate groups. In some embodiments, modified gRNAs comprise at least one modified residue at or near the 5' end of the RNA. In some embodiments, modified gRNAs comprise at least one modified residue at or near the 3' end of the RNA.

[0116] In some embodiments, the gRNA comprises one, two, three or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%) of the positions in a modified gRNA are modified nucleosides or nucleotides.

[0117] Unmodified nucleic acids can be prone to degradation by, e.g., intracellular nucleases or those found in serum. For example, nucleases can hydrolyze nucleic acid phosphodiester bonds. Accordingly, in one aspect the gRNAs described herein can containone or more modified nucleosides or nucleotides, e.g., to introduce stability toward intracellular or serum-based nucleases. In some embodiments, the modified gRNA molecules described herein can exhibit a reduced innate immune response when introduced into a population of cells, both in vivo and ex vivo. The term “innate immune response” includes a cellular response to exogenous nucleic acids, including single stranded nucleic acids, which involves the induction of cytokine expression and release, particularly the interferons, and cell death.

[0118] In some embodiments of a backbone modification, the phosphate group of a modified residue can be modified by replacing one or more of the oxygens with a different substituent. Further, the modified residue, e.g., modified residue present in a modified nucleic acid, can include the wholesale replacement of an unmodified phosphate moiety with a modified phosphate group as described herein. In some embodiments, the backbone modification of the phosphate backbone can include alterations that result in either an uncharged linker or a charged linker with unsymmetrical charge distribution.

[0119] Examples of modified phosphate groups include, phosphorothioate, phosphoroselenates, borano phosphates, borano phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates, and phosphotriesters. The phosphorous atom in an unmodified phosphate group is achiral. However, replacement of one of the non- bridging oxygens with one of the above atoms or groups of atoms can render the phosphorous atom chiral. The stereogenic phosphorous atom can possess either the “R” configuration (herein Rp) or the “S” configuration (herein Sp). The backbone can also be modified by replacement of a bridging oxygen, (i.e., the oxygen that links the phosphate to the nucleoside), with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylenephosphonates). The replacement can occur at either linking oxygen or at both of the linking oxygens.

[0120] The phosphate group can be replaced by non-phosphorus containing connectors in certain backbone modifications. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties which can replace the phosphate group can include, without limitation, e.g., methyl phosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino.

[0121] Scaffolds that can mimic nucleic acids can also be constructed wherein the phosphate linker and ribose sugar are replaced by nuclease resistant nucleoside or nucleotidesurrogates. Such modifications may comprise backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by a surrogate backbone. Examples can include, without limitation, the morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.

[0122] The modified nucleosides and modified nucleotides can include one or more modifications to the sugar group, i.e. at sugar modification. For example, the 2' hydroxyl group (OH) can be modified, e.g. replaced with a number of different “oxy” or “deoxy” substituents. In some embodiments, modifications to the 2' hydroxyl group can enhance the stability of the nucleic acid since the hydroxyl can no longer be deprotonated to form a 2'- alkoxide ion.

[0123] Examples of 2' hydroxyl group modifications can include alkoxy or aryloxy (OR, wherein “R” can be, e.g., an alkyl, cycloalkyl, aryl, aralkyl, heteroaryl group, or a sugar); polyethyleneglycols (PEG), O(CH2CH2O)nCH2CH2OR wherein R can be, e.g., H or optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20). In some embodiments, the 2' hydroxyl group modification can be 2'-O-Me. In some embodiments, the 2' hydroxyl group modification can be a 2'-fluoro modification, which replaces the 2' hydroxyl group with a fluoride. In some embodiments, the 2' hydroxyl group modification can include “locked” nucleic acids (LNA) in which the 2' hydroxyl can be connected, e.g., by a C1-6alkylene or C1-6heteroalkylene bridge, to the 4' carbon of the same ribose sugar, where exemplary bridges can include methylene, propylene, ether, or amino bridges; O-amino (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy, O(CH2)n-amino, (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, the 2' hydroxyl group modification can include "unlocked" nucleic acids (UNA) in which the ribose ring lacks the C2'-C3' bond. In some embodiments, the 2' hydroxyl group modification can include the methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).

[0124] “Deoxy” 2' modifications can include hydrogen (i.e. deoxyribose sugars, e.g., at the overhang portions of partially dsRNA); halo (e.g., bromo, chloro, fluoro, or iodo); amino (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino,diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CH2CH2NH)nCH2CH2- amino (wherein amino can be, e.g., as described herein), - NHC(O)R (wherein R can be, e.g., an alkyl, cycloalkyl, aryl, aralkyl, heteroaryl group, or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, which may be optionally substituted with e.g., an amino as described herein.

[0125] The sugar modification can comprise a sugar group which may also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a modified nucleic acid can include nucleotides containing e.g., arabinose, as the sugar. The modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms. The modified nucleic acids can also include one or more sugars that are in the L form, e.g. L- nucleosides.

[0126] The modified nucleosides and modified nucleotides described herein, which can be incorporated into a modified nucleic acid, can include a modified base, also called a nucleobase. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or wholly replaced to provide modified residues that can be incorporated into modified nucleic acids. The nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine analog, or pyrimidine analog. In some embodiments, the nucleobase can include, for example, naturally-occurring and synthetic derivatives of a base.

[0127] In embodiments employing a dual guide RNA, each of the crRNA and the tracr RNA can contain modifications. Such modifications may be at one or both ends of the crRNA or tracr RNA. In embodiments comprising an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or internal nucleosides may be modified, or the entire sgRNA may be chemically modified. Certain embodiments comprise a 5' end modification. Certain embodiments comprise a 3' end modification. Additional embodiments comprise a 5’ end modification and a 3’ end modification.

[0128] In some embodiments, the guide RNAs disclosed herein comprise one of the modification patterns disclosed in WO2018 / 107028 A1, titled “Chemically Modified Guide RNAs” or WO2021119275 titled “Modified Guide RNAs for Gene Editing,” the contents of each are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of the structures / modification patterns disclosed in US20170114334, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of thestructures / modification patterns disclosed in WO2017 / 136794, the contents of which are hereby incorporated by reference in their entirety.

[0129] In some embodiments, the sgRNA comprises any of the modification patterns shown herein, where N is any natural or non-natural nucleotide, and wherein the totality of the N’s comprise a CISH guide sequence as described herein in Table 1a or 1b. In some embodiments, the modified sgRNA comprises the following sequence: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAm AmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 409) or mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCG GmU*mG*mC*mU (SEQ ID NO: 414), where “N” may be any natural or non-natural nucleotide, and wherein the totality of N’s comprise an CISH guide sequence as described in Table 1a or 1b. For example, where the N’s are replaced with any of the guide sequences disclosed herein in Table 1a or 1b, optionally wherein the N’s are replaced with SEQ ID NOs: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; or SEQ ID NOs: 34, 35, 37, 38, 42, 45, 4, 47, 2, 48, 8, 53, 11, 16, 58, 59, 19, 60, 61, 15, 66, 68, 7, 70, 72, 18, 73, 74, 20, 17, 78, 79, 14, 9, and 23; or SEQ ID NOs: 4, 47, 2, 11, 16, 58, 59, and 19; or SEQ ID NOs: 47, 16, and 19; or SEQ ID NO: 47; or SEQ ID NO: 16; or SEQ ID NO: 19. In some embodiments, the sgRNA listed in Table 1a or 1b are modified according to the modification pattern of SEQ ID NO: 409 or SEQ ID NO: 414. In some embodiments, the sgRNA may comprise a sequence of any one of SEQ ID NO: 238- 363 (Table 1b), where “N” may be any natural or non-natural nucleotide, preferably an RNA nucleotide; sugar moieties of the nucleotide can be ribose, deoxyribose, or similar compounds with substitutions; m is a 2’-O-methyl modified nucleotide, and * is a phosphorothioate linkage between nucleotide residues; and wherein the N’s are collectively the nucleotide sequence of a guide sequence.

[0130] Any of the modifications described below may be present in the gRNAs and mRNAs described herein.

[0131] The terms “mA,” “mC,” “mU,” or “mG” may be used to denote a nucleotide that has been modified with 2’-O-Me.

[0132] Modification of 2’-O-methyl can be depicted as follows:

[0133] Another chemical modification that has been shown to influence nucleotide sugar rings is halogen substitution. For example, 2’-fluoro (2’-F) substitution on nucleotide sugar rings can increase oligonucleotide binding affinity and nuclease stability.

[0134] In this application, the terms “fA,” “fC,” “fU,” or “fG” may be used to denote a nucleotide that has been substituted with 2’-F.

[0135] Substitution of 2’-F can be depicted as follows:

[0136] Phosphorothioate (PS) linkage or bond refers to a bond where a sulfur is substituted for one non-bridging phosphate oxygen in a phosphodiester linkage, for example in the bonds between nucleotides bases. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides may also be referred to as S-oligos.

[0137] A “*” may be used to depict a PS modification. In this application, the terms A*, C*, U*, or G* may be used to denote a nucleotide that is linked to the next (e.g., 3’) nucleotide with a PS bond.

[0138] In this application, the terms “mA*,” “mC*,” “mU*,” or “mG*” may be used to denote a nucleotide that has been substituted with 2’-O-Me and that is linked to the next (e.g., 3’) nucleotide with a PS bond.

[0139] The diagram below shows the substitution of S- into a non-bridging phosphate oxygen, generating a PS bond in lieu of a phosphodiester bond:

[0140] Abasic nucleotides refer to those which lack nitrogenous bases. The figure below depicts an oligonucleotide with an abasic (also known as apurinic) site that lacks a base:

[0141] Inverted bases refer to those with linkages that are inverted from the normal 5’ to 3’ linkage (i.e., either a 5’ to 5’ linkage or a 3’ to 3’ linkage). For example:

[0142] An abasic nucleotide can be attached with an inverted linkage. For example, an abasic nucleotide may be attached to the terminal 5’ nucleotide via a 5’ to 5’ linkage, or an abasic nucleotide may be attached to the terminal 3’ nucleotide via a 3’ to 3’ linkage. An inverted abasic nucleotide at either the terminal 5’ or 3’ nucleotide may also be called an inverted abasic end cap.

[0143] In some embodiments, one or more of the first three, four, or five nucleotides at the 5' terminus and one or more of the last three, four, or five nucleotides at the 3' terminus are modified. In some embodiments, the modification is a 2’-O-Me, 2’-F, inverted abasic nucleotide, PS bond, or other nucleotide modification well known in the art to increase stability or performance.

[0144] In some embodiments, the first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus are linked with phosphorothioate (PS) bonds.

[0145] In some embodiments, the first three nucleotides at the 5' terminus and the last three nucleotides at the 3' terminus comprise a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the first three nucleotides at the 5' terminus, and the last three nucleotides at the 3' terminus comprise a 2'-fluoro (2'-F) modified nucleotide. In some embodiments, the first three nucleotides at the 5' terminus and the last three nucleotides at the 3' terminus comprise an inverted abasic nucleotide.

[0146] In some embodiments, the guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification pattern shown in mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAm AmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 409) ormN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCG GmU*mG*mC*mU (SEQ ID NO: 414), where N is any natural or non-natural nucleotide, and where the totality of the N’s comprise a guide sequence that directs a nuclease to a target sequence in CISH, e.g., the genomic coordinates shown in Table 1a or 1b. In some embodiments, the sgRNA may comprise a sequence of any one of SEQ ID NO: 238-363 (Table 1b), where “N” may be any natural or non-natural nucleotide, preferably an RNA nucleotide; sugar moieties of the nucleotide can be ribose, deoxyribose, or similar compounds with substitutions; m is a 2’-O-methyl modified nucleotide, and * is a phosphorothioate linkage between nucleotide residues; and wherein the N’s are collectively the nucleotide sequence of a guide sequence.

[0147] In some embodiments, the guide RNA comprises a sgRNA comprising any one of the guide sequences of SEQ ID NOs: 1-111 and a conserved portion of an sgRNA, for example, the conserved portion of sgRNA shown as Exemplary SpyCas9 sgRNA-1 or the conserved portions of the gRNAs shown in Table 1a or 1b and throughout the specification. In some embodiments, the guide RNA comprises a sgRNA comprising any one of the guide sequences of SEQ ID NOs: 1-111 and the nucleotides of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 416), wherein the nucleotides are on the 3’ end of the guide sequence, and wherein the sgRNA may be modified as shown herein or in the sequence mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAm AmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 409). In some embodiments, the guide RNA comprises a sgRNA comprising any one of the guide sequences of SEQ ID NOs: 1-111 and the nucleotides of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAA AGGGCACCGAGUCGGUGCU (SEQ ID NO: 413), wherein the nucleotides are on the 3’ end of the guide sequence, and wherein the sgRNA may be modified as shown herein or in the sequence mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCG GmU*mG*mC*mU (SEQ ID NO: 414). In some embodiments, the sgRNA comprises Exemplary SpyCas9 sgRNA-1 or the modified versions thereof provided herein, or a versionas provided in Table 7 below, where the totality of the N’s comprise a guide sequence that directs a nuclease to a target sequence. “N” may be any natural or non-natural nucleotide, preferably an RNA nucleotide; sugar moieties of the nucleotide can be ribose, deoxyribose, or similar compounds with substitutions; m is a 2’-O-methyl modified nucleotide, and * is a phosphorothioate linkage between nucleotide residues; and wherein the N’s are collectively the nucleotide sequence of a guide sequence. Each N is independently modified or unmodified. In certain embodiments, in the absence of an indication of a modification, the nucleotide is an unmodified RNA nucleotide residue, i.e., a ribose sugar and a phosphodiester backbone. In some embodiments, the sgRNA may comprise a sequence of any one of SEQ ID NO: 238-363 (Table 1b), where “N” may be any natural or non-natural nucleotide, preferably an RNA nucleotide; sugar moieties of the nucleotide can be ribose, deoxyribose, or similar compounds with substitutions; m is a 2’-O-methyl modified nucleotide, and * is a phosphorothioate linkage between nucleotide residues; and wherein the N’s are collectively the nucleotide sequence of a guide sequence.

[0148] As noted above, in some embodiments, a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA- guided DNA binding agent, such as a Cas nuclease, e.g. Cas9 nuclease, as described herein. In some embodiments, an mRNA comprising an ORF encoding an RNA-guided DNA binding agent, such as a Cas nuclease, e.g. Cas9 nuclease, is provided, used, or administered. In some embodiments, the ORF encoding an RNA-guided DNA nuclease is a “modified RNA-guided DNA binding agent ORF” or simply a “modified ORF,” which is used as shorthand to indicate that the ORF is modified.

[0149] In some embodiments, the mRNA or modified ORF may comprise a modified uridine at least at one, a plurality of, or all uridine positions. In some embodiments, the modified uridine is a uridine modified at the 5 position, e.g., with a halogen or a methyl or ethyl group. In some embodiments, the modified uridine is a pseudouridine modified at the 1 position, e.g., with a halogen or a methyl or ethyl group. The modified ORF comprises one or more modified uridines that can be, for example, pseudouridine, N1-methyl-pseudouridine, 5- methoxyuridine, 5-iodouridine, or a combination thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In someembodiments, the modified uridine is a combination of N1-methyl pseudouridine and 5- methoxyuridine. In some embodiments, the modified uridine is a combination of 5- iodouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.

[0150] In some embodiments, an mRNA disclosed herein comprises a 5’ cap, such as a Cap0, Cap1, or Cap2. A 5’ cap is generally a 7-methylguanine ribonucleotide (which may be further modified, as discussed below e.g. with respect to ARCA) linked through a 5’- triphosphate to the 5’ position of the first nucleotide of the 5’-to-3’ chain of the mRNA, i.e., the first cap-proximal nucleotide. In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2’-hydroxyl. In Cap1, the riboses of the first and second transcribed nucleotides of the mRNA comprise a 2’-methoxy and a 2’-hydroxyl, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2’-methoxy. See, e.g., Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30; Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115. Most endogenous higher eukaryotic mRNAs, including mammalian mRNAs such as human mRNAs, comprise Cap1 or Cap2. Cap0 and other cap structures differing from Cap1 and Cap2 may be immunogenic in mammals, such as humans, due to recognition as “non-self” by components of the innate immune system such as IFIT-1 and IFIT-5, which can result in elevated cytokine levels including type I interferon. Components of the innate immune system such as IFIT-1 and IFIT-5 may also compete with eIF4E for binding of an mRNA with a cap other than Cap1 or Cap2, potentially inhibiting translation of the mRNA.

[0151] A cap can be included co-transcriptionally. For example, ARCA (anti-reverse cap analog; Thermo Fisher Scientific Cat. No. AM8045) is a cap analog comprising a 7- methylguanine 3’-methoxy-5’-triphosphate linked to the 5’ position of a guanine ribonucleotide which can be incorporated in vitro into a transcript at initiation. ARCA results in a Cap0 cap in which the 2’ position of the first cap-proximal nucleotide is hydroxyl. See, e.g., Stepinski et al., (2001) “Synthesis and properties of mRNAs containing the novel ‘anti- reverse’ cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG,” RNA 7: 1486–1495. The ARCA structure is shown below.

[0152] CleanCapTMAG (m7G(5')ppp(5')(2'OMeA)pG; TriLink Biotechnologies Cat. No. N-7113) or CleanCapTMGG (m7G(5')ppp(5')(2'OMeG)pG; TriLink Biotechnologies Cat. No. N-7133) can be used to provide a Cap1 structure co-transcriptionally. 3’-O-methylated versions of CleanCapTMAG and CleanCapTMGG are also available from TriLink Biotechnologies as Cat. Nos. N-7413 and N-7433, respectively. The CleanCapTMAG structure is shown below.

[0153] Alternatively, a cap can be added to an RNA post-transcriptionally. For example, Vaccinia capping enzyme is commercially available (New England Biolabs Cat. No. M2080S) and has RNA triphosphatase and guanylyltransferase activities, provided by its D1 subunit, and guanine methyltransferase, provided by its D12 subunit. As such, it can add a 7- methylguanine to an RNA, so as to give Cap0, in the presence of S-adenosyl methionine and GTP. See, e.g., Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479. Poly-A tail

[0154] In some embodiments, the mRNA further comprises a poly-adenylated (poly-A) tail. In some embodiments, the poly-A tail sequence comprises 100-400 nucleotides. In some embodiments, the poly-A tail comprises at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines. In some embodiments, the polyA sequence comprises non-adenine nucleotides. In some instances, the poly-A tail is “interrupted” with one or more non-adenine nucleotide“anchors” at one or more locations within the poly-A tail. The poly-A tails may comprise at least 8 consecutive adenine nucleotides, but also comprise one or more non-adenine nucleotide. As used herein, “non-adenine nucleotides” refer to any natural or non-natural nucleotides that do not comprise adenine. Guanine, thymine, and cytosine nucleotides are exemplary non-adenine nucleotides. Thus, the poly-A tails on the mRNA described herein may comprise consecutive adenine nucleotides located 3’ to nucleotides encoding a polypeptide disclosed herein. In some instances, the poly-A tails on mRNA comprise non- consecutive adenine nucleotides located 3’ to nucleotides encoding an RNA-guided DNA- binding agent or a sequence of interest, wherein non-adenine nucleotides interrupt the adenine nucleotides at regular or irregularly spaced intervals.

[0155] In some embodiments, the poly-A tail is encoded in the plasmid used for in vitro transcription of mRNA and becomes part of the transcript. The poly-A sequence encoded in the plasmid, i.e., the number of consecutive adenine nucleotides in the poly-A sequence, may not be exact, e.g., a 100 poly-A sequence in the plasmid may not result in a precisely 100 poly-A sequence in the transcribed mRNA. In some embodiments, the poly-A tail is not encoded in the plasmid, and is added by PCR tailing or enzymatic tailing, e.g., using E. coli poly(A) polymerase.

[0156] In some embodiments, the one or more non-adenine nucleotides are positioned to interrupt the consecutive adenine nucleotides so that a poly(A) binding protein can bind to a stretch of consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotide(s) is located after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides. In some embodiments, the one or more non-adenine nucleotide is located after at least 8-50 consecutive adenine nucleotides. In some embodiments, the one or more non-adenine nucleotide is located after at least 8-100 consecutive adenine nucleotides. In some embodiments, the non-adenine nucleotide is after one, two, three, four, five, six, or seven adenine nucleotides and is followed by at least 8 consecutive adenine nucleotides.

[0157] The poly-A tail of the present disclosure may comprise one sequence of consecutive adenine nucleotides followed by one or more non-adenine nucleotides, optionally followed by additional adenine nucleotides.

[0158] In some embodiments, the poly-A tail comprises or contains one non-adenine nucleotide or one consecutive stretch of 2-10 non-adenine nucleotides. In some embodiments, the non-adenine nucleotide(s) is located after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides. In some instances, the one or more non-adenine nucleotides are located after at least 8-50 consecutive adenine nucleotides. In some embodiments, the one or more non-adenine nucleotides are located after at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 consecutive adenine nucleotides.

[0159] In some embodiments, the non-adenine nucleotide is guanine, cytosine, or thymine. In some instances, the non-adenine nucleotide is a guanine nucleotide. In some embodiments, the non-adenine nucleotide is a cytosine nucleotide. In some embodiments, the non-adenine nucleotide is a thymine nucleotide. In some instances, where more than one non- adenine nucleotide is present, the non-adenine nucleotide may be selected from: a) guanine and thymine nucleotides; b) guanine and cytosine nucleotides; c) thymine and cytosine nucleotides; or d) guanine, thymine and cytosine nucleotides. Ribonucleoprotein complexes

[0160] In some embodiments, a composition provided herein is encompassed comprising one or more gRNAs comprising one or more guide sequences from Table 1a or 1b or one or more sgRNAs from Table 1a or 1b and an RNA-guided DNA binding agent, e.g., a nuclease, such as a Cas nuclease, such as Cas9. In some embodiments, the RNA-guided DNA-binding agent has cleavase activity, which can also be referred to as double-strand endonuclease activity. In some embodiments, the RNA-guided DNA-binding agent comprises a Cas nuclease. Examples of Cas9 nucleases include those of the type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotes (see, e.g., the list in the next paragraph), and modified (e.g., engineered or mutant) versions thereof. See, e.g., US20160312198; US 20160312199. Other examples of Cas nucleases include a Csm or Cmr complex of a type III CRISPR system or the Cas10, Csm1, or Cmr2 subunit thereof; and a Cascade complex of a type I CRISPR system, or the Cas3 subunit thereof. In some embodiments, the Cas nuclease may be from a Type-IIA, Type-IIB, or Type-IIC system. For discussion of various CRISPR systems and Cas nucleases see, e.g., Makarova et al., NAT. REV. MICROBIOL.9:467-477 (2011); Makarova et al., NAT. REV. MICROBIOL, 13: 722-36 (2015); Shmakov et al., MOLECULAR CELL, 60:385-397 (2015).

[0161] Non-limiting exemplary species that the Cas nuclease can be derived from include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomycesviridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp., Lachnospiraceae bacterium ND2006, and Acaryochloris marina.

[0162] In some embodiments, the Cas nuclease is the Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease is the Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nuclease is the Cas9 nuclease from Neisseria meningitidis. In some embodiments, the Cas nuclease is the Cas9 nuclease is from Staphylococcus aureus. In some embodiments, the Cas nuclease is the Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nuclease is the Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nuclease is the Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nuclease is the Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In certain embodiments, the Cas nuclease is a Cpf1 nuclease from an Acidaminococcus or Lachnospiraceae.

[0163] In some embodiments, the gRNA together with an RNA-guided DNA binding agent is called a ribonucleoprotein complex (RNP). In some embodiments, the RNA-guided DNA binding agent is a Cas nuclease. In some embodiments, the gRNA together with a Cas nuclease is called a Cas RNP. In some embodiments, the RNP comprises Type-I, Type-II, orType-III components. In some embodiments, the Cas nuclease is the Cas9 protein from the Type-II CRISPR / Cas system. In some embodiment, the gRNA together with Cas9 is called a Cas9 RNP.

[0164] Wild type Cas9 has two nuclease domains: RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 protein comprises more than one RuvC domain or more than one HNH domain. In some embodiments, the Cas9 protein is a wild type Cas9. In each of the composition, use, and method embodiments, the Cas induces a double strand break in target DNA.

[0165] In some embodiments, chimeric Cas nucleases are used, where one domain or region of the protein is replaced by a portion of a different protein. In some embodiments, a Cas nuclease domain may be replaced with a domain from a different nuclease such as Fok1. In some embodiments, a Cas nuclease may be a modified nuclease.

[0166] In other embodiments, the Cas nuclease may be from a Type-I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of the Cascade complex of a Type-I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas nuclease may be from a Type-III CRISPR / Cas system. In some embodiments, the Cas nuclease may have an RNA cleavage activity.

[0167] In some embodiments, the RNA-guided DNA-binding agent has single-strand nickase activity, i.e., can cut one DNA strand to produce a single-strand break, also known as a “nick.” In some embodiments, the RNA-guided DNA-binding agent comprises a Cas nickase. A nickase is an enzyme that creates a nick in dsDNA, i.e., cuts one strand but not the other of the DNA double helix. In some embodiments, a Cas nickase is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) in which an endonucleolytic active site is inactivated, e.g., by one or more alterations (e.g., point mutations) in a catalytic domain. See, e.g., US Pat. No.8,889,356 for discussion of Cas nickases and exemplary catalytic domain alterations. In some embodiments, a Cas nickase such as a Cas9 nickase has an inactivated RuvC or HNH domain.

[0168] In some embodiments, the RNA-guided DNA-binding agent is modified to contain only one functional nuclease domain. For example, the agent protein may be modified such that one of the nuclease domains is mutated or fully or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, a nickase is used having a RuvC domain with reduced activity. In some embodiments, a nickase is used having aninactive RuvC domain. In some embodiments, a nickase is used having an HNH domain with reduced activity. In some embodiments, a nickase is used having an inactive HNH domain.

[0169] In some embodiments, a conserved amino acid within a Cas protein nuclease domain is substituted to reduce or alter nuclease activity. In some embodiments, a Cas nuclease may comprise an amino acid substitution in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015) Cell Oct 22:163(3): 759-771. In some embodiments, the Cas nuclease may comprise an amino acid substitution in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB - A0Q7Q2 (CPF1_FRATN)).

[0170] In some embodiments, an mRNA encoding a nickase is provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to a target sequence and introduce a DSB by generating a nick on opposite strands of the target sequence (i.e., double nicking). In some embodiments, use of double nicking may improve specificity and reduce off-target effects. In some embodiments, a nickase is used together with two separate guide RNAs targeting opposite strands of DNA to produce a double nick in the target DNA. In some embodiments, a nickase is used together with two separate guide RNAs that are selected to be in close proximity to produce a double nick in the target DNA.

[0171] In some embodiments, the RNA-guided DNA-binding agent lacks cleavase and nickase activity. In some embodiments, the RNA-guided DNA-binding agent comprises a dCas DNA-binding polypeptide. A dCas polypeptide has DNA-binding activity while essentially lacking catalytic (cleavase / nickase) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, the RNA-guided DNA-binding agent lacking cleavase and nickase activity or the dCas DNA-binding polypeptide is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) in which its endonucleolytic active sites are inactivated, e.g., by one or more alterations (e.g., point mutations) in its catalytic domains. See, e.g., US 20140186958; US 20150166980.

[0172] In some embodiments, the RNA-guided DNA-binding agent comprises one or more heterologous functional domains (e.g., is or comprises a fusion polypeptide).

[0173] In some embodiments, the heterologous functional domain may facilitate transport of the RNA-guided DNA-binding agent into the nucleus of a cell. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA-binding agent may be fused with 1-10 NLS(s). In some embodiments, the RNA-guided DNA-binding agent may be fused with 1-5 NLS(s). In some embodiments, the RNA-guided DNA-binding agent may be fused with one NLS. Where one NLS is used, the NLS may be linked at the N-terminus or the C-terminus of the RNA-guided DNA-binding agent sequence. It may also be inserted within the RNA-guided DNA binding agent sequence. In other embodiments, the RNA-guided DNA-binding agent may be fused with more than one NLS. In some embodiments, the RNA-guided DNA-binding agent may be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the RNA-guided DNA-binding agent may be fused with two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the RNA-guided DNA-binding agent is fused to two SV40 NLS sequences linked at the carboxy terminus. In some embodiments, the RNA-guided DNA-binding agent may be fused with two NLSs, one linked at the N-terminus and one at the C-terminus. In some embodiments, the RNA-guided DNA-binding agent may be fused with 3 NLSs. In some embodiments, the RNA-guided DNA-binding agent may be fused with no NLS. In some embodiments, the NLS may be a monopartite sequence, such as, e.g., the SV40 NLS, PKKKRKV (SEQ ID NO: 417), or PKKKRRV (SEQ ID NO: 418). In some embodiments, the NLS may be a bipartite sequence, such as the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 419). In a specific embodiment, a single PKKKRKV (SEQ ID NO: 417) NLS may be linked at the C-terminus of the RNA-guided DNA-binding agent. One or more linkers are optionally included at the fusion site.

[0174] In some embodiments, the heterologous functional domain may be capable of modifying the intracellular half-life of the RNA-guided DNA binding agent. In some embodiments, the half-life of the RNA-guided DNA binding agent may be increased. In some embodiments, the half-life of the RNA-guided DNA-binding agent may be reduced. In some embodiments, the heterologous functional domain may be capable of increasing the stability of the RNA-guided DNA-binding agent. In some embodiments, the heterologous functional domain may be capable of reducing the stability of the RNA-guided DNA-binding agent. In some embodiments, the heterologous functional domain may act as a signal peptide for protein degradation. In some embodiments, the protein degradation may be mediated by proteolytic enzymes, such as, for example, proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain may comprise a PESTsequence. In some embodiments, the RNA-guided DNA-binding agent may be modified by addition of ubiquitin or a polyubiquitin chain. In some embodiments, the ubiquitin may be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neuronal- precursor-cell-expressed developmentally downregulated protein-8 (NEDD8, also called Rub1 in S. cerevisiae), human leukocyte antigen F-associated (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin fold-modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).

[0175] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1 ), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire,), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, Jred), and orange fluorescent proteins (mOrange, mKO, Kusabira- Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato) or any other suitable fluorescent protein. In other embodiments, the marker domain may be a purification tag or an epitope tag. Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, or fluorescent proteins.

[0176] In additional embodiments, the heterologous functional domain may target the RNA-guided DNA-binding agent to a specific organelle, cell type, tissue, or organ. In someembodiments, the heterologous functional domain may target the RNA-guided DNA-binding agent to mitochondria.

[0177] In further embodiments, the heterologous functional domain may be an effector domain. When the RNA-guided DNA-binding agent is directed to its target sequence, e.g., when a Cas nuclease is directed to a target sequence by a gRNA, the effector domain may modify or affect the target sequence. In some embodiments, the effector domain may be chosen from a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. In some embodiments, the heterologous functional domain is a nuclease, such as a FokI nuclease. See, e.g., US Pat. No.9,023,649. In some embodiments, the heterologous functional domain is a transcriptional activator or repressor. See, e.g., Qi et al., “Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression, “Cell 152:1173-83 (2013); Perez-Pinera et al., “RNA-guided gene activation by CRISPR-Cas9-based transcription factors,” Nat. Methods 10:973-6 (2013); Mali et al., “CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering,” Nat. Biotechnol.31:833-8 (2013); Gilbert et al., “CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes, “Cell 154:442-51 (2013). As such, the RNA-guided DNA-binding agent essentially becomes a transcription factor that can be directed to bind a desired target sequence using a guide RNA. In some embodiments, the heterologous functional domain is a deaminase, such as a cytidine deaminase or an adenine deaminase. In certain embodiments, the heterologous functional domain is a C to T base converter (cytidine deaminase), such as an apolipoprotein B mRNA editing enzyme (APOBEC) deaminase.

[0178] In some embodiments, the RNA-guided DNA binding agent is selected from one of: S. pyogenes Cas9, Neisseria meningitidis Cas9, e.g. an Nme2Cas9, S. thermophilus Cas9, S. aureus Cas9, Francisella novicida Cpf1, Acidaminococcus sp. Cpf1, Lachnospiraceae bacterium Cpf1, C-to-T base editor, A-to-G base editor, Cas12a, Mad7 nuclease, ARCUS nucleases, and CasX. In some embodiments, the RNA-guided DNA binding agent comprises a polypeptide selected from one of: S. pyogenes Cas9, Neisseria meningitidis Cas9, e.g. an Nme2Cas9, S. thermophilus Cas9, S. aureus Cas9, Francisella novicida Cpf1, Acidaminococcus sp. Cpf1, Lachnospiraceae bacterium Cpf1, C- to-T base editor, A-to-G base editor, Cas12a, and CasX.

[0179] In some embodiments, the RNA-guided DNA binding agent comprises an editor. An exemplary editor is BC22n, which includes an H. sapiens APOBEC3A fused to S.pyogenes-D10A Cas9 nickase by an XTEN linker, and mRNA encoding BC22n. An mRNA encoding BC22n is provided (SEQ ID NO: 424 or 425). Determination of efficacy of gRNAs

[0180] In some embodiments, the efficacy of a gRNA is determined when delivered or expressed together with other components forming an RNP. In some embodiments, the gRNA is expressed together with an RNA-guided DNA binding agent, such as a Cas protein, e.g., Cas9. In some embodiments, the gRNA is delivered to or expressed in a cell line that already stably expresses an RNA-guided DNA nuclease, such as a Cas nuclease or nickase, e.g., Cas9 nuclease or nickase. In some embodiments the gRNA is delivered to a cell as part of a RNP. In some embodiments, the gRNA is delivered to a cell along with a mRNA encoding an RNA-guided DNA nuclease, such as a Cas nuclease or nickase, e.g., Cas9 nuclease or nickase.

[0181] As described herein, use of an RNA-guided DNA nuclease and a guide RNA disclosed herein can lead to double-stranded breaks in the DNA which can produce errors in the form of insertion / deletion (indel) mutations upon repair by cellular machinery. Many mutations due to indels alter the reading frame or introduce premature stop codons and, therefore, produce a non-functional protein. In some embodiments, the efficacy of particular gRNAs is determined based on in vitro models. In some embodiments, the in vitro model is HEK293 cells stably expressing Cas9 (HEK293_Cas9). In some embodiments the in vitro model is a peripheral blood mononuclear cell (PBMC). In some embodiments, the in vitro model is a T cell, such as primary human T cells. In some embodiments, the in vitro model is a NK cell, such as primary human NK cells. With respect to using primary cells, commercially available primary cells can be used to provide greater consistency between experiments. In some embodiments, the number of off-target sites at which a deletion or insertion occurs in an in vitro model (e.g., in T cells or NK cells) is determined, e.g., by analyzing genomic DNA from transfected cells in vitro with Cas9 mRNA and the guide RNA. In some embodiments, such a determination comprises analyzing genomic DNA from the cells transfected in vitro with Cas9 mRNA, the guide RNA, and a donor oligonucleotide. Exemplary procedures for such determinations are provided in the working examples in which HEK293 cells, PBMCs, human CD3+T cells, and human NK cells are used.

[0182] In some embodiments, the efficacy of particular gRNAs is determined across multiple in vitro cell models for a gRNA selection process. In some embodiments, a cell linecomparison of data with selected gRNAs is performed. In some embodiments, cross screening in multiple cell models is performed.

[0183] In some embodiments, the efficacy of a guide RNA is measured by percent indels or percent genetic modifications of CISH. In some embodiments, the efficacy of a guide RNA is measured by percent indels or percent genetic modifications at a CISH locus. In some embodiments, the efficacy of a guide RNA is measured by percent indels or percent genetic modifications of CISH at genomic coordinates of Table 1a or 1b. In some embodiments, the percent editing of CISH is compared to the percent indels or genetic modifications necessary to achieve knockdown of the CISH protein products. In some embodiments, the efficacy of a guide RNA is measured by reduced or eliminated expression of CISH protein. In embodiments, said reduced or eliminated expression of CISH protein is as measured by flow cytometry, e.g., as described herein.

[0184] In some embodiments, the CISH protein expression is reduced or eliminated in a population of cells using the methods and compositions disclosed herein. In some embodiments, the population of cells is at least 55%, 60%, 65%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% CISH negative as measured by flow cytometry relative to a population of unmodified cells.

[0185] An “unmodified cell” (or “unmodified cells”) refers to a control cell (or cells) of the same type of cell in an experiment or test, wherein the “unmodified” control cell has not been contacted with a CISH guide. Therefore, an unmodified cell (or cells) may be a cell that has not been contacted with a guide RNA, or a cell that has been contacted with a guide RNA that does not target CISH.

[0186] In some embodiments, the efficacy of a guide RNA is measured by the number or frequency of indels or genetic modifications at off-target sequences within the genome of the target cell type, such as a T cell or NK cell. In some embodiments, efficacious guide RNAs are provided which produce indels at off target sites at very low frequencies (e.g., < 5%) in a cell population or relative to the frequency of indel creation at the target site. Thus, the disclosure provides for guide RNAs which do not exhibit off-target indel formation in the target cell type (e.g., a T cell or NK cell), or which produce a frequency of off-target indel formation of < 5% in a cell population or relative to the frequency of indel creation at the target site. In some embodiments, the disclosure provides guide RNAs which do not exhibit any off target indel formation in the target cell type (e.g., T cell or NK cell). In some embodiments, guide RNAs are provided which produce indels at less than 5 off-target sites, e.g., as evaluated by one or more methods described herein. In some embodiments, guideRNAs are provided which produce indels at less than or equal to 4, 3, 2, or 1 off-target site(s) e.g., as evaluated by one or more methods described herein. In some embodiments, the off- target site(s) does not occur in a protein coding region in the target cell (e.g., hepatocyte) genome.

[0187] In some embodiments, detecting gene editing events, such as the formation of insertion / deletion (“indel”) mutations and insertion or homology directed repair (HDR) events in target DNA utilize linear amplification with a tagged primer and isolating the tagged amplification products (herein after referred to as “LAM-PCR,” or “Linear Amplification (LA)” method). In some embodiments, the efficacy of a guide RNA is measured by the levels of functional protein complexes comprising the expressed protein product of the gene. In some embodiments, the efficacy of a guide RNA is measured by western blot analysis of CISH expression by which the lysate of the population of edited cells is analyzed for loss of the CISH. T Cell Receptors (TCR)

[0188] In some embodiments, the engineered cells or population of cells comprising a genetic modification, e.g., of an endogenous nucleic acid sequence encoding CISH, further comprise a modification, e.g., knockdown, of an endogenous nucleic acid sequence encoding TCR gene sequence(s), e.g., TRAC or TRBC.

[0189] In some embodiments, the engineered cells or population of cells comprising a genetic modification, e.g., knockdown, of an endogenous nucleic acid sequence encoding CISH and insertion into the cell of heterologous sequence(s) encoding a targeting receptor, further comprise a modification, e.g., knockdown, of an endogenous nucleic acid sequence encoding TCR gene sequence(s), e.g., TRAC or TRBC.

[0190] Generally, a TCR is a heterodimer receptor molecule that contains two TCR polypeptide chains, α and β. Suitable α and β genomic sequences or loci to target for knockdown are known in the art. In some embodiments, the engineered T cells comprise a modification, e.g., knockdown, of a TCR α-chain gene sequence, e.g., TRAC. See, e.g., NCBI Gene ID: 28755; Ensembl: ENSG00000277734 (T-cell receptor Alpha Constant), US 2018 / 0362975, and WO2020081613.

[0191] In some embodiments, the engineered cells or population of cells comprise a genetic modification of an endogenous nucleic acid sequence encoding CISH, a genetic modification, e.g., knockdown, of an endogenous nucleic acid sequence encoding TCR gene sequence(s), e.g., TRAC or TRBC; and modification, e.g., knockdown of an MHC class Igene, e.g., B2M or HLA-A. In some embodiments, an MHC class I gene is an HLA-B gene or an HLA-C gene.

[0192] In some embodiments, the engineered cells or population of cells comprise a genetic modification of an endogenous nucleic acid sequence encoding CISH and a genetic modification, e.g., knockdown, of an endogenous nucleic acid sequence encoding a TCR, e.g., TRAC or TRBC; and a genetic modification, e.g., knockdown of an MHC class II gene, e.g., CIITA.

[0193] In some embodiments, the engineered cells or population of cells comprise a modification of an endogenous nucleic acid sequence encoding CISH, a genetic modification, e.g., knockdown, of an endogenous nucleic acid sequence encoding a TCR, e.g., TRAC or TRBC; and a genetic modification, e.g. knockdown of a checkpoint inhibitor gene, e.g., TIM3, 2B4, LAG3, or PD-1.

[0194] In some embodiments, the engineered cells or population of cells comprise a genetic modification of a CISH gene as assessed by sequencing, e.g., NGS, wherein at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of cells comprise an insertion, deletion, or substitution in the endogenous CISH sequence. In some embodiments, at least 50% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence. In some embodiments, at least 55% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence. In some embodiments, at least 60% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence. In some embodiments, at least 65% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence. In some embodiments, at least 70% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence. In some embodiments, at least 75% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence. In some embodiments, at least 80% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence. In some embodiments, at least 85% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence. In some embodiments, at least 90% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenousCISH sequence. In some embodiments, at least 95% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence. In some embodiments, CISH is decreased by at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified. In some embodiments, expression of CISH is decreased by at least 50% or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified. In some embodiments, expression of CISH is decreased by at least 55% or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified. In some embodiments, expression of CISH is decreased by at least 60% or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified. In some embodiments, expression of CISH is decreased by at least 65% or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified. In some embodiments, expression of CISH is decreased by at least 70% or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified. In some embodiments, expression of CISH is decreased by at least 80% or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified. In some embodiments, expression of CISH is decreased by at least 90% or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified. In some embodiments, expression of CISH is decreased by at least 95% or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified. Assays for CISH protein and mRNA expression are known in the art. “Expression of CISH” refers to the expression of encoding transcript (e.g., CISH mRNA) or expression of a CISH protein or a portion thereof. Inhibiting expression of CISH can result in a decreased level of a CISH-encoding transcript (e.g., CISH mRAN) or a decreased level of a CISH protein or a portion thereof. Inhibition of CISH expression can be assessed by detecting or quantifying CISH-encoding transcripts (e.g., mRNA), CISH proteins, portions of CISH proteins, or CISH activity.

[0195] In some embodiments, the engineered cells or population of cells comprise a modification, e.g., knockdown, of a TCR gene sequence by gene editing, e.g., as assessed by sequencing, e.g., NGS, wherein at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of cells comprise an insertion, deletion, orsubstitution in the endogenous TCR gene sequence. In some embodiments, TCR is decreased by at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the TCR gene has not been modified. In certain embodiments, the TCR is TRAC or TRBC. Assays for TCR protein and mRNA expression are known in the art.

[0196] In some embodiments, the engineered cells or population of cells comprise an insertion of sequence(s) encoding a targeting receptor by gene editing, e.g., as assessed by sequencing, e.g., NGS.

[0197] In some embodiments, guide RNAs that specifically target sites within the TCR genes, e.g., TRAC gene, are used to provide a modification, e.g., knockdown, of the TCR genes.

[0198] In some embodiments, the TCR gene is modified, e.g., knocked down, in a T cell using a guide RNA with an RNA-guided DNA binding agent. In some embodiments, disclosed herein are T cells engineered by inducing a break (e.g., double-stranded break (DSB) or single-stranded break (nick)) within the TCR genes of a T cell, e.g., using a guide RNA with an RNA-guided DNA-binding agent (e.g., a CRISPR / Cas system). The methods may be used in vitro or ex vivo, e.g., in the manufacture of cell products for suppressing immune response.

[0199] In some embodiments, the guide RNAs mediate a target-specific cutting by an RNA-guided DNA-binding agent (e.g., Cas nuclease) at a site described herein within a TCR gene. It will be appreciated that, in some embodiments, the guide RNAs comprise guide sequences that bind to, or are capable of binding to, said regions. Methods and Uses Including Therapeutic Methods and Uses and Methods of Preparing Engineered Cells or Immunotherapy Reagents

[0200] In certain embodiments, the gRNAs and associated methods and compositions disclosed herein are useful for making cell therapy (e.g., immunotherapy) reagents, such as engineered cells (e.g., engineered T cells or engineered NK cells).

[0201] Immunotherapy is the treatment of disease by activating or suppressing the immune system. Immunotherapies designed to elicit or amplify an immune response are classified as activation immunotherapies. Cell-based immunotherapies have been demonstrated to be effective in the treatment of some cancers. Immune effector cells such as lymphocytes, macrophages, dendritic cells, natural killer cells (NK Cell), cytotoxic T lymphocytes (CTL) can be programmed to act in response to abnormal antigens expressed onthe surface of tumor cells. Thus, cancer immunotherapy allows components of the immune system to destroy tumors or other cancerous cells.

[0202] Immunotherapy can also be useful for the treatment of chronic infectious disease, e.g., hepatitis B and C virus infection, human immunodeficiency virus (HIV) infection, tuberculosis infection, and malarial infection. Immune effector cells comprising a targeting receptor such as a transgenic TCR or CAR are useful in immunotherapies, such as those described herein.

[0203] In some embodiments, gRNAs comprising guide sequences of Table 1a or 1b together with an RNA-guided DNA nuclease, such as a Cas nuclease, induce double-strand breaks (DSBs) and non-homologous ending joining (NHEJ) during repair leads to a modification, e.g., a mutation in a CISH gene. In some embodiments, NHEJ leads to a deletion or insertion of a nucleotide(s), which induces a frame shift or nonsense mutation in a CISH gene. In certain embodiments, gRNAs comprising guide sequences targeted to TCR sequences, e.g., TRAC and TRBC, are also delivered to the cell together with RNA-guided DNA nuclease such as a Cas nuclease, either together or separately, to make a genetic modification in a TCR sequence to inhibit the expression of a full-length TCR sequence. In certain embodiments, the gRNAs are sgRNAs.

[0204] In some embodiments, the subject is mammalian. In some embodiments, the subject is human. In some embodiments, the subject is a non-human primate. In some embodiments, the guide RNAs, compositions, and formulations are used to produce a cell ex vivo, e.g., an immune cell, e.g., a T cell with a genetic modification in a CISH gene. The modified T cell may be a natural killer (NK) T-cell. The modified T cell may express a T-cell receptor, such as a universal TCR or a modified TCR. The T cell may express a CAR or a CAR construct with a zeta chain signalling motif. In some embodiments, the CAR is specific for a cancer antigen, e.g., CD38. Delivery of gRNA Compositions

[0205] Lipid nanoparticles (LNPs) are a well-known means for delivery of nucleotide and protein cargo, and may be used for delivery of the guide RNAs and compositions disclosed herein ex vivo and in vitro. In some embodiments, the LNPs deliver nucleic acid, protein, or nucleic acid together with protein.

[0206] In some embodiments, provided herein is a method for delivering any one of the cells or populations of cells disclosed herein to a subject, wherein the gRNA is delivered viaan LNP. In some embodiments, the gRNA / LNP is also associated with a Cas9 or an mRNA encoding Cas9.

[0207] In some embodiments, provided herein is a composition comprising any one of the gRNAs disclosed and an LNP. In some embodiments, the composition further comprises a Cas9 or an mRNA encoding Cas9.

[0208] In some embodiments, LNPs associated with the gRNAs disclosed herein are for use in preparing cells as a medicament for treating a disease or disorder.

[0209] Electroporation is a well-known means for delivery of cargo, and any electroporation methodology may be used for delivery of any one of the gRNAs disclosed herein. In some embodiments, electroporation may be used to deliver any one of the gRNAs disclosed herein and Cas9 or an mRNA encoding Cas9.

[0210] In some embodiments, provided herein is a method for delivering any one of the gRNAs disclosed herein to an ex vivo cell, wherein the gRNA is associated with an LNP or not associated with an LNP. In some embodiments, the gRNA / LNP or gRNA is also associated with a Cas9 or an mRNA encoding Cas9.

[0211] In some embodiments, the guide RNA compositions described herein, alone or encoded on one or more vectors, are formulated in or administered via a lipid nanoparticle (see e.g., WO2017 / 173054 and PCT / US2021 / 29446, the contents of each are hereby incorporated by reference in their entirety).

[0212] In certain embodiments, provided herein are DNA or RNA vectors encoding any of the guide RNAs comprising any one or more of the guide sequences described herein. In some embodiments, in addition to guide RNA sequences, the vectors further comprise nucleic acids that do not encode guide RNAs. Nucleic acids that do not encode guide RNA include, but are not limited to, promoters, enhancers, regulatory sequences, and nucleic acids encoding an RNA-guided DNA nuclease, which can be a nuclease such as Cas9. In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, or a crRNA and trRNA. In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding a sgRNA and an mRNA encoding an RNA-guided DNA nuclease, which can be a Cas nuclease, such as Cas9 or Cpf1. In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, and an mRNA encoding an RNA-guided DNA nuclease, which can be a Cas protein, such as, Cas9. In one embodiment, the Cas9 is from Streptococcus pyogenes (i.e., SpyCas9). In some embodiments, the nucleotide sequence encoding the crRNA, trRNA, or crRNA and trRNA (which may be a sgRNA) comprises or consists of a guide sequence flanked by all or aportion of a repeat sequence from a naturally-occurring CRISPR / Cas system. The nucleic acid comprising or consisting of the crRNA, trRNA, or crRNA and trRNA may further comprise a vector sequence wherein the vector sequence comprises or consists of nucleic acids that are not naturally found together with the crRNA, trRNA, or crRNA and trRNA.

[0213] In some embodiments, the components can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or they can be delivered by viral vectors (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus). Methods and compositions for non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, LNPs, polycation or lipid:nucleic acid conjugates, naked nucleic acid (e.g., naked DNA / RNA), artificial virions, and agent-enhanced uptake of DNA. Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids.

[0214] This description and exemplary embodiments should not be taken as limiting. For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing quantities, percentages, or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about,” to the extent they are not already so modified. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Combination Therapies

[0215] The delivery of gRNAs together with an RNA-guided DNA nuclease that induces double-strand breaks (DSBs) and non-homologous ending joining (NHEJ) during repair resulting in a modification, e.g., a mutation, in a CISH gene, as described herein, can be combined with one or more additional therapies. In some embodiments, the additional therapy is a cancer therapy. In some embodiments, the additional therapy is a chemotherapy, a hormone therapy, an immunotherapy, a radiation therapy, or a targeted therapy.

[0216] In some embodiments, the additional cancer therapy is CAR-T cell therapy. Chimeric antigen receptors (CAR) are molecules combining antibody-based specificity for tumor-associated surface antigens with T cell receptor-activating intracellular domains withspecific anti-tumor cellular immune activity (Eshhar, 1997, Cancer Immunol Immunother 45(3-4) 131-136; Eshhar et al., 1993, Proc Natl Acad Sci USA 90(2):720-724; Brocker and Karjalainen, 1998, Adv Immunol 68:257-269). These CARs allow a T cell to achieve MHC- independent primary activation through single chain Fv (scFv) antigen-specific extracellular regions fused to intracellular domains that provide T cell activation and co-stimulatory signals. Second and third generation CARs also provide appropriate co-stimulatory signals via CD28 or CD137 (4-1BB) intracellular activation motifs, which augment cytokine secretion and anti-tumor activity in a variety of solid tumor and leukemia models (Pinthus, et al, 2004, J Clin Invest 114(12):1774-1781; Milone, et al., 2009, Mol Ther 17(8):1453-1464; Sadelain, et al., 2009, Curr Opin Immunol 21(2):215-223). Chimeric Antigen Receptor (CAR) T cell therapy involves genetic modification of patient's autologous T-cells to express a CAR specific for a tumor antigen, following by ex vivo cell expansion and re-infusion back to the patient. CARs are fusion proteins of a selected single-chain fragment variable from a specific monoclonal antibody and one or more T cell receptor intracellular signaling domains. This T cell genetic modification may occur either via viral-based gene transfer methods or nonviral methods, such as DNA-based transposons, CRISPR / Cas9 technology or direct transfer of in vitro transcribed-mRNA by electroporation. Indications

[0217] In some embodiments, the methods described herein may be used to treat any cancer, including any cancerous or pre-cancerous tumor. Cancers that may be treated by methods and compositions provided herein include, but are not limited to, cancer of the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. In addition, the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; bronchioloalveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma;oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometrioid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; mammary paget's disease; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w / squamous metaplasia; malignant thymoma; malignant ovarian stromal tumor; malignant thecoma; malignant granulosa cell tumor; and malignant roblastoma; sertoli cell carcinoma; malignant leydig cell tumor; malignant lipid cell tumor; malignant paraganglioma; malignant extra-mammary paraganglioma; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; malignant blue nevus; sarcoma; fibrosarcoma; malignant fibrous histiocytoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; malignant mixed tumor; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; malignant mesenchymoma; malignant brenner tumor; malignant phyllodes tumor; synovial sarcoma; malignant mesothelioma; dysgerminoma; embryonal carcinoma; malignant teratoma; malignant struma ovarii; choriocarcinoma; malignant mesonephroma; hemangiosarcoma; malignant hemangioendothelioma; kaposi's sarcoma; malignant hemangiopericytoma; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; malignant chondroblastoma; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; malignant odontogenic tumor; ameloblastic odontosarcoma; malignant ameloblastoma; ameloblastic fibrosarcoma; malignant pinealoma; chordoma; malignant glioma; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; malignant meningioma; neurofibrosarcoma; malignant neurilemmoma; malignant granular cell tumor; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; small lymphocytic malignant lymphoma; diffuse large cell malignant lymphoma; follicular malignant lymphoma; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma;immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.

[0218] In some embodiments, the cancer comprises a solid tumor. In some embodiments, the tumor is an adenocarcinoma, an adrenal tumor, an anal tumor, a bile duct tumor, a bladder tumor, a bone tumor, a blood born tumor, a brain / CNS tumor, a breast tumor, a cervical tumor, a colorectal tumor, an endometrial tumor, an esophageal tumor, an Ewing tumor, an eye tumor, a gallbladder tumor, a gastrointestinal, a kidney tumor, a laryngeal or hypopharyngeal tumor, a liver tumor, a lung tumor, a mesothelioma tumor, a multiple myeloma tumor, a muscle tumor, a nasopharyngeal tumor, a neuroblastoma, an oral tumor, an osteosarcoma, an ovarian tumor, a pancreatic tumor, a penile tumor, a pituitary tumor, a primary tumor, a prostate tumor, a retinoblastoma, a Rhabdomyosarcoma, a salivary gland tumor, a soft tissue sarcoma, a melanoma, a metastatic tumor, a basal cell carcinoma, a Merkel cell tumor, a testicular tumor, a thymus tumor, a thyroid tumor, a uterine tumor, a vaginal tumor, a vulvar tumor, or a Wilms tumor.

[0219] In certain embodiments, the cancer is Multiple myeloma, Chronic lymphocytic leukemia (CLL), the most common leukemia in adults, lung cancer, prostate cancer, or melanoma. EXAMPLES

[0220] The following examples are provided to illustrate certain disclosed embodiments and are not to be construed as limiting the scope of this disclosure in any way. Example 1. Materials and Methods 1.1 In vitro transcription ("IVT") of nuclease mRNA

[0221] Capped and polyadenylated mRNA containing N1-methyl pseudo-U was generated by in vitro transcription using a linearized plasmid DNA template and T7 RNA polymerase. The linearized plasmid DNA containing a T7 promoter, and a sequence for transcription was linearized by restriction endonuclease digestion followed by heat inactivation of the reaction mixture and purified from enzyme and buffer salts. Messenger RNA was synthesized and purified using standard techniques known in the art.

[0222] Streptococcus pyogenes (“Spy”) Cas9 mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID Nos: 421-428 (see sequences in Table 7). When the sequences cited in this paragraph are referred to below with respect to RNAs, it is understood that Ts should be replaced with Us (which can be modified nucleosides as described above). Messenger RNAs used in the Examples include a 5' cap and a 3' polyadenylation sequence e.g., up to 100 nts. Guide RNAs were chemically synthesized by commercial vendors or using standard in vitro synthesis techniques with modified nucleotides. 1.2 Lipid Nanoparticle Formulation

[0223] In general, the lipid nanoparticle (LNP) components were dissolved in 100% ethanol at various molar ratios. The RNA cargos (e.g., Cas9 mRNA and sgRNA) were dissolved in 25 mM citrate, 100 mM NaCl, pH 5.0, resulting in a concentration of RNA cargo of approximately 0.45 mg / mL. The LNPs used contained ionizable lipid ((9Z,12Z)-3-((4,4- bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate), also called herein Lipid A, cholesterol, distearoylphosphatidylcholine (DSPC), and 1,2- dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG2K-DMG) (catalog # GM- 020 from NOF, Tokyo, Japan) in a molar ratio of 35 Lipid A: 47.5 cholesterol: 15 DSPC: 2.5 PEG2k-DMG. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6 and a ratio of gRNA to SpyCas9 mRNA of 1:1 by weight.

[0224] The LNPs were prepared using a cross-flow technique utilizing impinging jet mixing of the lipid in ethanol with two volumes of RNA solution and one volume of water. First, the lipid in ethanol was mixed through a mixing cross with the two volumes of RNA solution. Then, a fourth stream of water was mixed with the outlet stream of the cross through an inline tee (See WO2016010840 FIG.2). The LNPs were held for at least 1 hour at room temperature, and further diluted with water (approximately 1:1 v / v). Diluted LNPs were buffer exchanged into 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) and concentrated as needed by methods known in the art. The resulting mixture was then filtered using a 0.2 μm sterile filter. The final LNPs were characterized to determine the encapsulation efficiency, polydispersity index, and average particle size. The final LNP was stored at 4°C or -80°C until further use.1.3 Next-generation sequencing (“NGS”) and analysis for editing efficiency

[0225] DNA was extracted using a commercial kit according to the manufacturer's protocol, for example QuickExtract™ DNA Extraction Solution (Lucigen, Cat. QE09050). To quantitatively determine the efficiency of editing at the target location in the genome, deep sequencing was utilized to identify the presence of insertions and deletions introduced by gene editing. PCR primers were designed around the target site within the gene of interest (e.g., CISH) and the genomic area of interest was amplified. Primer sequence design was done as is standard in the field. Additional PCR was performed according to the manufacturer's protocols (Illumina) to add chemistry for sequencing. The amplicons were sequenced on an Illumina MiSeq instrument. The reads were aligned to the reference genome (e.g., hg38) after eliminating those having low quality scores. Reads that overlapped the target region of interest were re-aligned to the local genome sequence to improve the alignment. 1.3.1 Indel Analysis

[0226] The number of wild-type reads versus the number of reads which contain indels was calculated. Insertions and deletions were scored in a 20 bp region centered on the predicted Cas9 cleavage site. Indel percentage is defined as the total number of sequencing reads with one or more base inserted or deleted within the 20 bp scoring region divided by the total number of sequencing reads, including wild type.   1.3.2 Base Editing Analysis

[0227] The number of wild type reads versus the number of reads which contain C-to-T mutations, or C-to-A / G mutations was calculated. C-to-T mutations or C-to-A / G mutations were scored in a 40 bp region including 10 bp upstream and 10 bp downstream of the 20 bp sgRNA target sequence. The C-to-T editing percentage is defined as the total number of sequencing reads with either one or more C-to-T mutations within the 40 bp region divided by the total number of sequencing reads, including wild type. The percentage of C-to-A / G mutations are calculated similarly.  1.4 T cell Preparation

[0228] T cells were isolated from commercially obtained donor apheresis and cryopreserved. Upon thaw, T cells were plated at a density of 1.0 x 10^6 cells / mL in T cell growth media (TCGM) composed of CTS OpTmizer T Cell Expansion SFM and T Cell Expansion Supplement (ThermoFisher Cat. A1048501) containing 5% human AB serum (GeminiBio, Cat.100-512), 1X Penicillin-Streptomycin (ThermoFisher, 15140122),1X Glutamax (ThermoFisher, 35050061), and 10 mM HEPES (ThermoFisher, 15630106) further supplemented with 200 U / mL recombinant human interleukin-2 (Peprotech, Cat.200- 02), 5 ng / ml recombinant human interleukin-7 (Peprotech, Cat.200-07), and 5 ng / ml recombinant human interleukin-15 (Peprotech, Cat.200-15). T cells were activated with TransAct™ (1:100 dilution, Miltenyi Biotec, Cat.130-111-160) prior to transfection. 1.5 Automated Western Assay

[0229] Cells were harvested and washed with 1X PBS. The cell pellets were stored at - 80C until further processing. The cells were thawed on ice and resuspended in 1X RIPA buffer with 1X protease inhibitor. The samples were lysed by sonication. Lysate total protein was measured by using the Pierce BCA Protein Assay Kit (Thermo Fisher, 23225) according to the manufacturer’s instructions. Samples containing 3 ug total protein were analyzed by automated western assays using 12-230 kDa Separation Module (Protein Simple, SM-W004), Anti-Rabbit Detection Module (Protein Simple, DM-001), and EZ standard pack (Protein Simple, PS-ST01EZ-8) on a WES instrument (Protein Simple) according to the manufacturer’s protocols.

[0230] Proteins of interest were identified with CISH (D4C10) Rabbit mAb (Cell Signal Technology, 8431S) at 1:50 dilution, β-Tubulin (D2N5G) Rabbit mAb (Cell Signal Technology, 15115S) at 1:200 dilution or α-Actinin (D6F6) XP® Rabbit mAb (Cell Signal Technology, 6487) at 1:100 dilution. Compass software (Protein Simple) was used to retrieve the quantitative values for the area of bands of interest, in relative light units (RLUs). CISH was identified as an approximately 37 kDa band. Tubulin was identified as an approximately 55 kDa band. Actinin was identified as an approximately 100 kDa band. The percentage of residual CISH protein was calculated using the following formula to quantify a sample’s CISH signal relative to the loading control (Actinin or Tubulin) signal for the same sample and normalized to the unedited control’s CISH and loading control signals on the same module. Where indicated, the calculation uses samples edited with a guide that targets a locus that is not the CISH gene for the “unedited” normalization. % residual CISH = 100 x Sample CISH RLU x unedited Loading RLU Sample Loading RLU unedited CISH RLU When the CISH light signal was below the level of detection, it was estimated as zero for calculation purposes. The percentage CISH knockdown was calculated as 100 – “% residual CISH.”Example 2. CISH guide screening

[0231] CISH guide RNAs were screened for editing efficacy in T cells by assessing editing frequency by NGS following lipid nanoparticle (LNP) delivery. T cells isolated from human donor apheresis were prepared and activated as described in Example 1. Messenger RNA and LNPs were prepared as described in Example 1.

[0232] Seventy-two hours post activation, T cells were centrifuged, resuspended and plated at 50,000 cells / well in 100 µl / well in TCGM with 2.5% human AB serum. LNPs were prepared as described in Example 1 with a molar ratio of lipids of 35 Lipid A: 47.5 cholesterol: 15 DSPC:2.5 PEG2k-DMG and a ratio of gRNA to SpyCas9 mRNA of 1:1 by weight. LNPs were incubated with 2.5 µg / ml ApoE (Peprotech, Cat. 350-02) in TCGM with 2.5% human AB serum at 37 ^C for about 5 minutes. LNP formulation containing Spy Cas9 mRNA and sgRNA targeting CISH were added to T cells at 100 ng RNA cargo / well. Three days post-editing, T cells were harvested for NGS analysis as described in Example 1. Table 2a shows the mean percent indel. Table 2a. Mean percent indels at CISH locus. “n.d.” indicates no data. “n.a.” indicates not applicable.

[0233] Seven days post transfection, automated Western blotting was performed as described in Example 1. Tubulin was used as a loading control. Table 2b shows relative CISH protein expression. Samples where CISH western signal was below the level of detection are labeled as “BLOD.” Within each run, CISH protein expression is normalized to the unedited sample on the same module. Table 2b. CISH protein as detected by Western assay.  Example 3. Western assay following editing with CISH Guides

[0234] CISH guide RNAs were screened for editing efficacy in T cells by assessing protein expression by Western assay. T cells isolated from human donor apheresis were prepared and activated as described in Example 1.

[0235] Solutions containing mRNA encoding Cas9 protein were prepared in sterile water. Guide RNAs were denatured for 2 minutes at 95°C and incubated at room temperature for about 5 minutes. Seventy-two hours post activation, T cells were harvested, centrifuged, and resuspended in P3 electroporation buffer (Lonza). For each well to be electroporated, 2.5 x 10^5T cells were mixed with 250 ng of mRNA encoding Sp Cas9, and 0.5 µM of sgRNA in a final volume of 50 µL of P3 electroporation buffer. This mix was transferred in duplicate to a 96-well Nucleofector™ plate and electroporated using the manufacturer’s pulse code. Electroporated T cells were immediately rested in TCGM media with 5% human serum and cytokines for about 5 minutes before being transferred to new flat-bottom 96-well plates with additional media. The resulting plates were incubated at 37ºC and media was changed every 2- 3 days. Seven days post transfection, the cells were washed with 1X PBS and pellets were stored at -80 ^C until further processing.

[0236] An automated Western assay was performed using the cell pellets as described in Example 1 using a 1:50 dilution of the anti-CISH antibody and 1:200 dilution of the anti-tubulin antibody. Table 3 shows relative CISH protein expression. Samples where CISH western signal was below the level of detection are labeled as “BLOD.” Within each run, CISH protein expression is normalized to the unedited sample on the same module. Fig. 1 shows the percentage of CISH protein knockdown.Table 3. CISH protein as detected by Western assay.Example 4. Off-Target Analysis 4.1 Biochemical Off-Target Analysis A biochemical method (See, e.g., Cameron et al., Nature Methods.6, 600-606; 2017) was used to determine potential off-target genomic sites cleaved by Cas9 using specific guides targeting CISH. Guide RNAs targeting human CISH shown in Table 4 were screened using NA24385 genomic DNA (Coriell Institute) alongside control guides with known off-target profiles. The number of on target and potential off-target cleavage sites were detected using aguide concentration of 192 nM gRNA and 64 nM Sp Cas9 protein in the biochemical assay for which results are shown in Table 4. Table 4: Biochemical Off-Target Analysis4.2 Targeted sequencing for validating potential off-target sites

[0237] Potential off-target sites predicted by detection assays such as the biochemical method used above, may be assessed in treated cells using targeted sequencing of the identified potential off-target sites to determine whether indels at that site are detected.

[0238] In one approach, Cas9 mRNA and a sgRNA of interest (e.g., a sgRNA having potential off-target sites for evaluation) are introduced to primary T cells. The T cells are then lysed and primers flanking the potential off-target site(s) are used to generate an amplicon for NGS analysis. Identification of indels at a certain level may validate a potential off-target site, whereas the lack of indels found at the potential off-target site may indicate a false positive from the off-target predictive assay that was utilized.   Example 5. Dose responsiveness analysis in T cells

[0239] CISH guide RNAs were screened for editing efficacy in T cells by assessing editing frequency by NGS following lipid nanoparticle (LNP) delivery. A dose response assay assessed the impact of increasing amounts of LNPs co-formulated with a fixed concentration of mRNA encoding SpyCas9 and a sgRNA.

[0240]

[0241] T cells isolated from human donor aphereses from three donors (Donor 1, Donor 2, and Donor 3) were prepared and activated as described in Example 1 with T cells activated for 72 hours prior to transfection. LNPs were formulated as described in Example 1.

[0242] Seventy-two hours post activation, T cells were centrifuged, resuspended and plated at 50,000 cells / well in 100 µl / well in TCGM with 2.5% human AB serum. LNPs were prepared as described in Example 1 with a molar ratio of lipids of 35 Lipid A: 47.5 cholesterol: 15 DSPC:2.5 PEG2k-DMG and a ratio of gRNA to SpyCas9 mRNA of 1:1 by weight. LNPs were incubated with 2.5 ug / ml ApoE (Peprotech, Cat.350-02) in TCGM with 2.5% human AB serum at 37 ^C for about 5 minutes. LNP formulation containing Spy Cas9 mRNA and sgRNA targeting CISH were added T cells at total RNA cargo / ml noted in Table 5a. Seventy-two hours post-editing, T cells were harvested for NGS analysis as described in Example 1. Table 5a and Figs.2A-2C show the mean percent indels in CISH in each donor. Table 5a. Mean percent indels at CISH in three donors.

[0243] Seven days post transfection, cells were harvested and frozen. An automated Western assay was performed using the cell pellets from Donor 1 as described in Example 1 using a 1:50 dilution of the anti-CISH antibody and 1:100 dilution of the anti-actinin antibody. Table 5b shows relative CISH protein expression. Samples where CISH western signal was below the level of detection are labeled as “BLOD.” Within each run, CISH protein expression is normalized to the TRAC edited sample on the same module that received the highest dose of LNP. Fig.3 shows the percentage of CISH protein knockdown.   Table 5b. CISH protein expression by Western analysis. “n.d.” indicates no appropriate data was available for analysis.Example 6. Dose-dependent editing in natural killer cells

[0244] CISH guide RNAs were screened for editing efficacy in natural killer cells from three donors by assessing editing frequency by NGS following lipid nanoparticle (LNP) delivery and protein expression by Western assay.

[0245] Natural killer cells were plated and transfected with LNPs comprising Cas9 mRNA and sgRNA. LNPs and RNAs were prepared as described in Example 1. Each cell plate was treated via single dose transfection. Cells were harvested for NGS analysis as described in Example 1. Table 8 and Figs.4A-C show mean percent indels following editing at total RNA doses shown. Table 8. Mean percent indel at CISH locus

[0246] Automated Western blotting was performed on samples from donors CB58 and CB54 as described in Example 1. Table 9 and Fig.5A-B show the relative fluorescence units (RFU) for CISH, identified as an approximately 37 kDa band, and for α-Actinin, identified as an approximately 100 kDa band. Samples where CISH western signal was below the level of detection are labeled as “BLOD.” Percent CISH protein knockdown was calculated as described in Example 1. For calculations, samples below the level of detection are scored as zero CISH RFUs. Table 9. Relative fluorescence units from Western assay on lysate from edited natural killer cells and calculated percent CISH protein knockdown (%KD)

[0247] The Pearson coefficient of determination (R^2) between the percent indels and percent knockdown was 0.85 for CB58 samples and 0.78 for CB54 samples. Example 7. Screening of Guide RNAs with SpyCas9 base editor

[0248] Guide RNAs were screened for base editing efficacy in T cells by assessing frequency by NGS. T cells from a single donor were isolated by methods known in the art and activated using TransAct (Miltenyi Biotec, 130-111-160). Forty-eight hours post T cell activation, T cells were harvested and resuspended at a concentration of 12.5 x 10^6 T cells / mL in P3 electroporation buffer (Lonza, V4SP-3960). T cells were electroporated with sgRNAs targeting CISH, mRNA encoding a SpyCas9 base editor (SEQ ID NO: 425) and mRNA encoding UGI (SEQ ID NO: 428) using Lonza shuttle 96w using manufacturer’s pulse code. Cells were transferred to T cell growth media and cultured. On day 3 or 4 post- electroporation, edited T cell samples were harvested and subjected to NGS analysis as described in Example 1. Table 10 and Fig.6 show the mean percent editing of CISH loci as a percent of total NGS reads. Table 10. Mean percent editing with base editorExample 8. Additional Off-Target Analysis Example 8.1. Biochemical Off Target Analysis

[0249] A biochemical method (See, e.g., Cameron et al., Nature Methods.6, 600-606; 2017) was used to determine potential off-target genomic sites cleaved by Cas9 using specific guides targeting CISH. Guide RNAs targeting human CISH shown in Table 11 were screened using NA24385 genomic DNA (Coriell Institute) alongside control guides with known off-target profiles. The number of on-target and potential off-target cleavage sites were detected using a guide concentration of 192 nM gRNA and 64 nM Sp Cas9 protein in the biochemical assay for which results are shown in Table 11. Table 11. Biochemical Off-Target AnalysisExample 8.2. Targeted sequencing for confirming potential off-target sites

[0250] Test guides were further evaluated for possible off-target indel formation using amplicon sequencing at potential off-target sites following editing in cells. Each guide’s respective potential off-target sites were identified by biochemical assay described above or by in silico prediction.

[0251] Guide RNAs targeting human CISH were evaluated in triplicate in natural killer cells from 2 donors. Natural killer cells were plated and transfected with LNPs comprising Cas9 mRNA and sgRNA. LNPs and RNAs were prepared as described in Example 1. Each cell plate was treated via single dose transfection to achieve dose saturation as required for further downstream off-target assays. DNA was isolated from the cells by lysing and subjected to NGS as described in Example 1. Repair structures were manually inspected at loci with statistically relevant indel rates at the off-target cleavage sites to confirm indel repair structures. Results of experiment are shown in Table 12. Table 12. Evaluation of potential off-target editing sitesExample 9. Dose-dependent editing in natural killer cells.

[0252] A CISH guide RNA was screened for editing efficacy in natural killer cells from two donors by assessing editing frequency by NGS following lipid nanoparticle (LNP) delivery. Natural killer cells were plated and transfected with LNPs comprising Cas9 mRNA and sgRNA G032588. LNPs and RNAs were prepared as described in Example 1. Each cell plate was treated via single dose transfection using an LNP dose with the total RNA cargo by weight as indicated in Table 13. Cells were harvested and subjected to NGS analysis asdescribed in Example 1. Table 13 and Figs.7A-B show mean percent indels following editing at total RNA doses shown. Table 13. Mean percent indels in natural killer cells from donors CB16 and CB73.s4 t525251 7 3 7 e1 7 828638649o N m Q o EOR73737373838383rS NgshcdnaseGG UU GA CC C A AG c CAU CCA CAA A CCC CU UCC CAA ec eneAGC UGC CGA C CC CCG UUU GG CCU GAA UAG C U UG C G A AG nediu CG AC A C G A uqA ACU GCA CCC CUA C U GAC G G AGA AC G C A C u U G UAA CUC CUC q GeS G G A A C G G A G G U C C G G C G A A G U esetdi egC1F grMA X G H H H u a2lR M EST B T E V AISCISCIC anoitiDI9 6 4 5 4 3de 2 8 4 4 4 443ddi500 6 6 0 6 0021000 1 4 1A u0 0 00020202: G G G0a G G G G G 6elbQ: 4 5 6 7 8 9 9aEDO SIN63636363630163TTable 6b: Additional guide sequences and chromosomal coordinatesTable 7. Additional Sequences

Claims

What is Claimed is:

1. An engineered cell comprising a genetic modification in a human CISH sequence, within genomic coordinates of chr3:50606489-50611774.

2. The engineered cell of claim 1, wherein the genetic modification is within genomic coordinates of chr3: 50607593-50608517, optionally within chr3: 50607665-50608153, optionally within chr3: 50607665-50607868.

3. The engineered cell of claim 1 or 2, wherein the genetic modification is selected from an insertion, a deletion, and a substitution.

4. The engineered cell of any one of claims 1-3, wherein the genetic modification inhibits expression of a CISH gene, function of a CISH gene product, or both.

5. The engineered cell of any one of claims 1-4, wherein the genetic modification comprises a modification of at least one nucleotide within genomic coordinates selected from the CISH Genomic Coordinates (hg38) provided in the below table:; or optionally the genomic coordinates selected from chr3:50607593-50607613, chr3:50607597-50607617, chr3:50607599-50607619, chr3:50607611-50607631, chr3:50607631-50607651, chr3:50607644-50607664, chr3:50607665-50607685, chr3:50607677-50607697, chr3:50607680-50607700, chr3:50607686-50607706, chr3:50607757-50607777, chr3:50607802-50607822, chr3:50607818-50607838,chr3:50607821-50607841, chr3:50607836-50607856, chr3:50607848-50607868, chr3:50607849-50607869, chr3:50607864-50607884, chr3:50607867-50607887, chr3:50607924-50607944, chr3:50607954-50607974, chr3:50607960-50607980, chr3:50607984-50608004, chr3:50607986-50608006, chr3:50607996-50608016, chr3:50608019-50608039, chr3:50608026-50608046, chr3:50608063-50608083, chr3:50608086-50608106, chr3:50608121-50608141, chr3:50608133-50608153, chr3:50608363-50608383, chr3:50608423-50608443, and chr3:50608469-50608489; or selected from chr3:50607665-50607685, chr3:50607677-50607697, chr3:50607680- 50607700, chr3:50607802-50607822, chr3:50607818-50607838, chr3:50607821-50607841, chr3:50607836-50607856, and chr3:50607848-50607868; or selected from chr3:50607677- 50607697, chr3:50607818-50607838, and chr3:50607848-50607868.

6. The engineered cell of any one of claims 1-5, wherein the cell has reduced expression of CISH protein.

7. The engineered cell of claim 6, wherein expression of CISH is below the level of detection.

8. The engineered cell of any one of the previous claims, wherein the genetic modification comprises an indel.

9. The engineered cell of any one the previous claims, wherein the genetic modification comprises an insertion of a heterologous coding sequence.

10. The engineered cell of any one the previous claims, wherein the genetic modification comprises a substitution.

11. The engineered cell of claim 10, wherein the substitution comprises a C to T substitution or an A to G substitution.

12. The engineered cell of any one of the previous claims, wherein the genetic modification results in a change in the nucleic acid sequence that prevents translation of a full-length protein having an amino acid sequence of the full-length protein prior to genetic modification.

13. The engineered cell of claim 12, wherein the genetic modification results in a change in the nucleic acid sequence that results in a premature stop codon in a coding sequence of the full-length protein.

14. The engineered cell of claim 12, wherein the genetic modification results in a change in the nucleic acid sequence that results in a change in splicing of a pre-mRNA from the genomic locus.

15. The engineered cell of any one of the previous claims, wherein the genetic modification results in reduced expression of a protein from the gene comprising a genetic modification.

16. The engineered cell of any one of the previous claims, wherein the genetic modification results in reduced expression of a protein regulated by the gene comprising a genetic modification.

17. The engineered cell of any one of the previous claims, wherein the cell comprises an exogenous nucleic acid encoding a targeting receptor that is expressed on the surface of the engineered cell.

18. The engineered cell of claim 17, wherein the targeting receptor is a CAR.

19. The engineered cell of claim 17, wherein the targeting receptor is a TCR.

20. The engineered cell of claim 18, wherein the targeting receptor is a CAR specific for a cancer antigen.

21. The engineered cell of any one of the previous claims, wherein the engineered cell is an immune cell.

22. The engineered cell of claim 21, wherein the engineered cell is a monocyte, macrophage, mast cell, dendritic cell, or granulocyte.

23. The engineered cell of claim 21, wherein the engineered cell is a lymphocyte.

24. The engineered cell of claim 23, wherein the engineered cell is a T cell.

25. The engineered cell of 21, wherein the engineered cell is a NK cell.

26. A pharmaceutical composition comprising the engineered cell of any one of claims 1- 25.

27. A population of cells comprising the engineered cell of any one of claims 1-25.

28. A pharmaceutical composition comprising a population of cells of claim 27.

29. A method of administering the engineered cell, population of cells, or pharmaceutical composition of any one of the preceding claims to a subject in need thereof.

30. A method of administering the engineered cell, population of cells, or pharmaceutical composition of any one of the preceding claims to a subject as an adoptive cell transfer (ACT) therapy.

31. An engineered cell, population of cells, or pharmaceutical composition of any one of the preceding claims, for use as an ACT therapy.

32. A CISH guide RNA that specifically hybridizes to a CISH sequence comprising a nucleotide sequence selected from:a. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; b. a guide sequence comprising a nucleotide sequence of at least 17, 18, 19, or 20 contiguous nucleotides of a nucleotide sequence selected from the sequence of SEQ ID NOs: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; c. a guide sequence comprising a nucleotide sequence at least 95% identical or at least 90% identical to a nucleotide sequence selected from SEQ ID NOs: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24; d. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 34, 35, 37, 38, 42, 45, 4, 47, 2, 48, 8, 53, 11, 16, 58, 59, 19, 60, 61, 15, 66, 68, 7, 70, 72, 18, 73, 74, 20, 17, 78, 79, 14, 9, and 23; e. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 4, 47, 2, 11, 16, 58, 59, and 19; f. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 47, 16, and 19; g. a guide sequence comprising a nucleotide sequence selected from SEQ ID NO: 47; h. a guide sequence comprising a nucleotide sequence selected from SEQ ID NO: 16; and i. a guide sequence comprising a nucleotide sequence selected from SEQ ID NO:

19.

33. A CISH guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to a chromosomal location within a human CISH sequence, wherein the guide sequence is selected from SEQ ID NOs: 34, 35, 37, 38, 39, 42, 43, 44, 45, 4, 47, 2, 48, 8, 50, 51, 52, 53, 11, 56, 57, 16, 58, 59, 19, 60, 61, 15, 62, 65, 66, 67, 6, 68, 7, 69, 70, 71, 72, 18, 73, 74, 20, 17, 75, 76, 78, 79, 14, 10, 9, 23, and 24, optionally wherein the guide sequence is selected from SEQ ID NOs: 34, 35, 37, 38, 42, 45, 4, 47, 2, 48, 8, 53, 11, 16, 58, 59, 19, 60, 61, 15, 66, 68, 7, 70, 72, 18, 73, 74, 20, 17, 78, 79, 14, 9, and 23, optionally wherein the guide sequence is selected from SEQ ID NOs: 4, 47, 2, 11, 16, 58, 59, and 19, optionallywherein the guide sequence is selected from y SEQ ID NOs: 47, 16, and 19, optionally wherein the guide sequence is SEQ ID NO: 47, optionally wherein the guide sequence is SEQ ID NO: 16, or optionally wherein the guide sequence is SEQ ID NO:

19.

34. The guide RNA of claim 32 or 33, wherein the guide RNA is a dual guide RNA (dgRNA).

35. The guide RNA of claim 32 or 33, wherein the guide RNA is a single guide RNA (sgRNA).

36. The guide RNA of claim 35, further comprising the nucleotide sequence of SEQ ID NO: 4153’ to the guide sequence, wherein the guide RNA comprises a 5’ end modification or a 3’ end modification.

37. The guide RNA of claim 35, further comprising 5’ end modification or a 3’ end modification and a conserved portion of a gRNA comprising one or more of: A. a shortened hairpin 1 region or a substituted and optionally shortened hairpin 1 region relative to SEQ ID NO: 415, wherein 1. at least one of the following pairs of nucleotides are substituted in the substituted and optionally shortened hairpin 1 with Watson-Crick pairing nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, and the hairpin 1 region optionally lacks a. any one or two of H1-5 through H1-8, b. one, two, or three of the following pairs of nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or c. 1-8 nucleotides of hairpin 1 region; or 2. the shortened hairpin 1 region lacks 4-8 nucleotides, preferably 4-6 nucleotides; and a. one or more of positions H1-1, H1-2, or H1-3 is deleted or substituted relative to SEQ ID NO: 415 or b. one or more of positions H1-6 through H1-10 is substituted relative to SEQ ID NO: 415; or 3. the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n is substituted relative to SEQ ID NO: 415; or B. a shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include less than or equal to 4 substitutions relative to SEQ ID NO: 415; orC. a substitution relative to SEQ ID NO: 415 at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2 and H2-14, wherein the substituent nucleotide is neither a pyrimidine that is followed by an adenine, nor an adenine that is preceded by a pyrimidine; or D. a SpyCas9 sgRNA-1 of SEQ ID NO: 415 with an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US1-US12 in the upper stem region.

38. The guide RNA of claim 35, further comprising the nucleotide sequence of GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 404) 3’ to the guide sequence.

39. The guide RNA of claim 35, further comprising the nucleotide sequence of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 415) 3’ to the guide sequence, GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 416) 3’ to the guide sequence, or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAA AGGGCACCGAGUCGGUGCU (SEQ ID NO: 413) 3’ to the guide sequence.

40. The guide RNA of claim 39, wherein the guide RNA comprises a nucleotide sequence selected from SEQ ID NOs: 127, 237, 130, and 234, optionally wherein the guide RNA comprises a nucleotide sequence of SEQ ID NO: 127, optionally wherein the guide RNA comprises a nucleotide sequence of SEQ ID NO: 237, optionally wherein the guide RNA comprises a nucleotide sequence of SEQ ID NO: 130, or optionally wherein the guide RNA comprises a nucleotide sequence of SEQ ID NO:

234.

41. The guide RNA of claim 39 or 40, wherein the guide RNA is modified according to the pattern mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAm AmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 409) or mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCG GmU*mG*mC*mU (SEQ ID NO: 414), where “N” may be any natural or non-natural nucleotide, m is a 2’-O-methyl modified nucleotide, and * is a phosphorothioate linkagebetween nucleotide residues; and wherein the N’s are collectively the nucleotide sequence of a guide sequence of any preceding claim.

42. The guide RNA of claim 41, wherein each N is independently any natural or non- natural nucleotide and the guide sequence targets Cas9 to the CISH gene.

43. The guide RNA of claim 41 or 42, wherein the guide RNA comprises a nucleotide sequence selected from SEQ ID NOs: 253, 363, 256, and 360, optionally wherein the guide RNA comprises a nucleotide sequence of SEQ ID NO: 253, optionally wherein the guide RNA comprises a nucleotide sequence of SEQ ID NO: 363, optionally wherein the guide RNA comprises a nucleotide sequence of SEQ ID NO: 256, or optionally wherein the guide RNA comprises a nucleotide sequence of SEQ ID NO:

360.

44. The guide RNA of any one of claims 35-43, wherein the guide RNA comprises a modification.

45. The guide RNA of claim 44, wherein the modification comprises a 2’-O-methyl (2’- O-Me) modified nucleotide or a 2’-F modified nucleotide.

46. The guide RNA of claim 44 or 45, wherein the modification comprises a phosphorothioate (PS) bond between nucleotides.

47. The guide RNA of any one of claims 44-46, wherein the guide RNA is a sgRNA and the modification, comprises a modification at one or more of the five nucleotides at the 5’ end of the guide RNA.

48. The guide RNA of any one of claims 44-47, wherein the guide RNA is a sgRNA and the modification, comprises a modification at one or more of the five nucleotides at the 3’ end of the guide RNA.

49. The guide RNA of any one of claims 44-48, wherein the guide RNA is a sgRNA and the modification, comprises a PS bond between each of the four nucleotides at the 5’ end of the guide RNA.

50. The guide RNA of any one of claims 44-49, wherein the guide RNA is a sgRNA and the modification, comprises a PS bond between each of the four nucleotides at the 3’ end of the guide RNA.

51. The guide RNA of any one of claims 44-49, wherein the guide RNA is a sgRNA and the modification, comprises a 2’-O-Me modified nucleotide at each of the first three nucleotides at the 5’ end of the guide RNA.

52. The guide RNA of any one of claims 44-51, wherein the guide RNA is a sgRNA and the modification, comprises a 2’-O-Me modified nucleotide at each of the last three nucleotides at the 3’ end of the guide RNA.

53. A composition comprising a guide RNA of any one of claims 33-52 and an RNA guided DNA binding agent wherein the RNA guided DNA binding agent is a polypeptide RNA guided DNA binding agent or a nucleic acid encoding an RNA guided DNA binding agent polypeptide, optionally the RNA guided DNA-binding agent is a Cas9 nuclease.

54. The composition of claim 53, wherein the RNA guided DNA binding agent is a polypeptide capable of making a modification within a DNA sequence.

55. The composition of claim 54, wherein the RNA guided DNA binding agent is a S. pyogenes Cas9 nuclease.

56. The composition of any one of claims 53-55, wherein the nuclease is selected from the group of cleavase, nickase, and dead nuclease.

57. The composition of claim 53, wherein the nucleic acid encoding an RNA guided DNA binding agent is selected from: a. a DNA coding sequence; b. an mRNA with an open reading frame (ORF); c. a coding sequence in an expression vector; and d. a coding sequence in a viral vector.

58. The guide RNA of any one of claims 32-52 or the composition of any one of any one of claims 53-57, wherein the composition further comprises a pharmaceutically acceptable excipient.

59. The guide or composition of claim 58, wherein the composition is non-pyrogenic.

60. The guide RNA of any one of claims 32-52 or composition of any one of claims 53- 57, wherein the guide RNA is associated with a lipid nanoparticle (LNP).

61. A method of making a genetic modification in a CISH sequence within a cell, comprising contacting the cell with the guide RNA or composition of any one of claims 32- 60.

62. A method of preparing a population of cells for immunotherapy comprising: a. making a genetic modification in a CISH sequence in the cells in the population with a CISH guide RNA or composition of any one of claims 32-60; and b. expanding the population of cells in culture.

63. The method of claim 62, further comprising contacting the cells with an LNP composition comprising a CISH guide RNA.

64. The method of claim 63, comprising contacting the cells with a second LNP composition comprising a guide RNA.

65. A population of cells made by the method of any one of claims 61-64.

66. The population of cells of claim 65, wherein the population of cells is altered ex vivo.

67. A pharmaceutical composition comprising a population of cells of claim 65 or 66.

68. A method of administering the population of cells of claim 65 or 66, or pharmaceutical composition of claim 67 to a subject in need thereof.

69. A method of administering the population of cells of claim 65 or 66, or pharmaceutical composition of claim 67 to a subject as an adoptive cell transfer (ACT) therapy.

70. A population of cells of claim 65 or 66, or pharmaceutical composition of claim 67, for use as an ACT therapy.

71. A population of cells comprising a genetic modification of a CISH gene, wherein at least 40%, 45%, 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, or 95% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence.

72. The populations of cells of claim 71, wherein the genetic modification is as defined in any of claims 1-5.

73. The population of cells of claim 71 or 72, wherein expression of CISH is decreased by at least 40%, 45%, 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified.

74. The population of cells of any one of claims 71-73, wherein the population comprises at least 103, 104, 105or 106cells, preferably 107, 2 x 107, 5 x 107, or 108cells.

75. The population of cells of any one of claims 71-74, wherein at least 70% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence.

76. The population of cells of any one of claims 71-75, wherein at least 80% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence.

77. The population of cells of any one of claims 71-76, wherein at least 90% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence.

78. The population of cells of any one of claims 71-77, wherein at least 95% of cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous CISH sequence.

79. The population of cells of any one of claims 71-78, wherein expression of CISH is decreased by at least 70%, or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified.

80. The population of cells of any one of claims 71-79, wherein expression of CISH is decreased by at least 80%, or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified.

81. The population of cells of any one of claims 71-80, wherein expression of CISH is decreased by at least 90%, or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified.

82. The population of cells of any one of claims 71-81, wherein expression of CISH is decreased by at least 95%, or to below the limit of detection of the assay as compared to a suitable control, e.g., wherein the CISH gene has not been modified.

83. A pharmaceutical composition comprising the population of cells of any of claims 71- 82.

84. The population of cells of any of claims 71-82 or the pharmaceutical composition of claim 83, for use as an ACT therapy.

85. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50606489-50611774, optionally within chr3: 50607593-50608517, optionally within chr3: 50607665-50608153, optionally within chr3: 50607665-50607868.

86. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607593-50607613.

87. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607597-50607617.

88. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607599-50607619.

89. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr4: chr3:50607611-50607631.

90. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607631-50607651.

91. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607644-50607664.

92. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607665-50607685.

93. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607677-50607697.

94. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607680-50607700.

95. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607686-50607706.

96. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607740-50607760.

97. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607755-50607775.

98. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607757-50607777.

99. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607802-50607822.

100. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607818-50607838.

101. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607821-50607841.

102. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607836-50607856.

103. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607848-50607868.

104. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607849-50607869.

105. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607864-50607884.

106. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607867-50607887.

107. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607919-50607939.

108. The engineered cell composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607924-50607944.

109. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607932-50607952.

110. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607954-50607974.

111. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607960-50607980.

112. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607984-50608004.

113. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607985-50608005.

114. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607986-50608006.

115. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50607996-50608016.

116. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608019-50608039.

117. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608026-50608046.

118. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608063-50608083.

119. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608086-50608106.

120. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608095-50608115.

121. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608104-50608124.

122. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608121-50608141.

123. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608133-50608153.

124. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608363-50608383.

125. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608379-50608399.

126. The engineered cell, composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608423-50608443.

127. The engineered cell composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608469-50608489.

128. The engineered cell composition, pharmaceutical composition, or method of any one of the preceding claims, wherein the genetic modification is within the genomic coordinates of chr3:50608497-50608517.

129. A method of treating a cancer in a subject, the method comprising administering the subject the engineered cell of any one of claims 83-128.

130. The method of claim 129, further comprising administering an additional therapeutic agent to the subject.

131. The method of claim 130, wherein the additional therapeutic agent is a cancer therapy.

132. The method of claim 131, wherein the cancer therapy is a chemotherapy, a hormone therapy, an immunotherapy, a radiation therapy, or a targeted therapy.

133. The method of claim 130, wherein the additional therapeutic agent is a cell comprising a chimeric antigen receptor.

134. The method of claim 133, wherein the chimeric antigen receptor specifically binds to a cancer antigen.

135. The method of claim 129, wherein the cancer is selected from the group consisting of cancer of the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. In addition, the cancer may specifically be of the followinghistological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; bronchioloalveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometrioid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; mammary paget's disease; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w / squamous metaplasia; malignant thymoma; malignant ovarian stromal tumor; malignant thecoma; malignant granulosa cell tumor; and malignant roblastoma; sertoli cell carcinoma; malignant leydig cell tumor; malignant lipid cell tumor; malignant paraganglioma; malignant extra-mammary paraganglioma; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; malignant blue nevus; sarcoma; fibrosarcoma; malignant fibrous histiocytoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; malignant mixed tumor; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; malignant mesenchymoma; malignant brenner tumor; malignant phyllodes tumor; synovial sarcoma; malignant mesothelioma; dysgerminoma; embryonal carcinoma; malignant teratoma; malignant struma ovarii; choriocarcinoma; malignant mesonephroma; hemangiosarcoma; malignant hemangioendothelioma; kaposi's sarcoma; malignant hemangiopericytoma; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; malignant chondroblastoma; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; malignant odontogenic tumor; ameloblastic odontosarcoma; malignant ameloblastoma;ameloblastic fibrosarcoma; malignant pinealoma; chordoma; malignant glioma; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; malignant meningioma; neurofibrosarcoma; malignant neurilemmoma; malignant granular cell tumor; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; small lymphocytic malignant lymphoma; diffuse large cell malignant lymphoma; follicular malignant lymphoma; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.

136. The method of claim 129, wherein the cancer comprises a solid tumor.

137. The method of claim 136, wherein the tumor is an adenocarcinoma, an adrenal tumor, an anal tumor, a bile duct tumor, a bladder tumor, a bone tumor, a blood born tumor, a brain / CNS tumor, a breast tumor, a cervical tumor, a colorectal tumor, an endometrial tumor, an esophageal tumor, an Ewing tumor, an eye tumor, a gallbladder tumor, a gastrointestinal, a kidney tumor, a laryngeal or hypopharyngeal tumor, a liver tumor, a lung tumor, a mesothelioma tumor, a multiple myeloma tumor, a muscle tumor, a nasopharyngeal tumor, a neuroblastoma, an oral tumor, an osteosarcoma, an ovarian tumor, a pancreatic tumor, a penile tumor, a pituitary tumor, a primary tumor, a prostate tumor, a retinoblastoma, a Rhabdomyosarcoma, a salivary gland tumor, a soft tissue sarcoma, a melanoma, a metastatic tumor, a basal cell carcinoma, a Merkel cell tumor, a testicular tumor, a thymus tumor, a thyroid tumor, a uterine tumor, a vaginal tumor, a vulvar tumor, or a Wilms tumor.

Images