Gfral receptor inhibitor for use in the treatment of amyotrophic lateral sclerosis

EP4689109A1Pending Publication Date: 2026-02-11UNIVERSITA DEGLI STUDI DI ROMA LA SAPIENZA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024718277
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-03-31
Filing Date
2024-03-26
Publication Date
2026-02-11

AI Technical Summary

Technical Problem

Current treatments for amyotrophic lateral sclerosis (ALS) lack effective solutions for weight loss and cachexia, with the progression of the disease being linked to metabolic changes and hypothalamic dysfunction, and existing therapies have shown limited success due to unclear mechanisms and clinical heterogeneity.

Method used

A GFRAL receptor inhibitor, specifically a short hairpin RNA (shRNA), is used to block the interaction between GDF15 and its receptor GFRAL, thereby reducing weight loss and improving motor function in ALS patients.

Benefits of technology

The inhibition of the GFRAL receptor in ALS mouse models counteracts weight loss and improves motor function, suggesting potential for increased appetite and slowed disease progression in humans.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 000017
    Figure 000017
  • Figure 000018
    Figure 000018
  • Figure 000019
    Figure 000019
Patent Text Reader

Abstract

The invention relates to a GFRAL receptor inhibitor for use in the treatment of amyotrophic lateral sclerosis, in particular for the treatment of cachexia and / or for reducing weight loss in a subject suffering from amyotrophic lateral sclerosis. In particular, said inhibitor is a short hairpin RNA (shRNA). Pharmaceutical compositions and vectors comprising said inhibitor for the described uses also fall within the scope of the invention.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] GFRAL RECEPTOR INHIBITOR FOR USE IN THE TREATMENT OF

[0002] AMYOTROPHIC LATERAL SCLEROSIS

[0003] FIELD OF THE INVENTION

[0004] The invention relates to a GFRAL receptor inhibitor for use in the treatment of amyotrophic lateral sclerosis, in particular for the treatment of cachexia and / or for reducing weight loss in a subject suffering from amyotrophic lateral sclerosis. In particular, said inhibitor is a short hairpin RNA (shRNA).

[0005] BACKGROUND ART

[0006] Amyotrophic lateral sclerosis (ALS) is a progressive neurodegen erative disease characterized by the death of motor neurons in the cerebral cortex, brain stem and spinal cord, resulting in muscle atrophy. Most patients (about 80%) develop a sporadic form of ALS (sALS), while about 20% of cases develop familial genetic forms (LALS).

[0007] The most common genes recognized as being associated with and responsible for fALS include SOD1, C9orf72, TARDBP ( TDP-43 ), and FUS.

[0008] It has recently been demonstrated that weight loss is an important clinical feature prevalent among people with ALS at the time of diagnosis and appears to be independent of other dysfunctions, such as dysphagia and eating problems (1). With an estimated prevalence of 56%-62% in patients with ALS, weight loss is defined as an important and independent prognostic factor. Several studies have also reported that the course of the disease is directly proportional to weight loss or a low body mass index (BMI) at the time of diagnosis.

[0009] It has recently been hypothesized that the weight loss which occurs during the course of the disease may also depend on hypothalamic dysfunction, a brain region which also regulates, among other things, functions related to metabolism and hunger (2). In support of this hypothesis, pathological inclusions of the mutated TDP-43 protein are observed in the hypothalamus of approximately one-third of patients with ALS, and hypothalamic atrophy is found in 22% of cases (3). These metabolic alterations have also been observed in mouse models of ALS prior to the onset of signs of the disease, suggesting that they may participate in the onset of the disease (4).

[0010] By implementing specific dietary programmes, such as high-calorie diets based on fat or sugar, ALS patients showed slower disease progression and an improved quality of life (5). This observation focused attention on the influence of the metabolic condition of the ALS patient on the progression of the disease.

[0011] The lack of a clear understanding of the mechanisms involved in the pathogenesis of ALS, combined with its clinical and molecular heterogeneity, has hindered the development of effective therapy so far. At the same time, the abundance of potential mechanisms described in animal models has led to many attempts of treatments which, however, have not been confirmed as valid in clinical trials. There are many potential reasons for failure, including the choice of the wrong target, inappropriate pharmacodynamics, route of administration, and the likelihood that there may be different pathogenic mechanisms in different patients (6). For all these reasons, increasing attention to the nutritional aspect and the metabolic changes occurri ng in ALS patients can become an important area of therapeutic intervention with the aim of improving the quality of life of the patient and their family members and caregivers.

[0012] A drug for treating ALS, in particular a drug for improving the weight loss which occurs during the progression of ALS, is therefore still being sought.

[0013] Recently, it has been shown that high circulating levels of the cytokine growth differentiation factor 15 (GDF15) can cause anorexia and weight loss in the presence of tumours and other diseases (7). GDF 15 belongs to the TGF-B (transforming growth factor-B) family, which acts through a receptor expressed by neurons, GFRAL (GDNF family receptor a-like), reducing food intake and body weight. GFRAL is a receptor expressed in the central nervous system exclusively in neurons of the area postrema and in the nucleus of the solitary tract, both in mice and humans (8).

[0014] In the work of Tsai et al. (14), GDF 15 activity was inhibited in mice on a high-fat diet by means of administration of an anti-GDF15 monoclonal antibody or shRNA for silencing GFRAL, and an increase in body weight and adiposity v / as observed.

[0015] WO2022189936 discloses the use of an anti-GDF15 antibody which blocks the interaction between GDF 15 and GFRAL to ameliorate the cachexia associated with certain conditions.

[0016] However, an inhibition effect of the GDF15-GFRAL axis has never been shown in ALS subjects.

[0017] It has now been found that the inhibition of the GFRAL receptor in ALS subjects counteracts the weight loss associated with the disease. In particular, it has been found that the administration in ALS mouse models of artificial RNA molecules (short hairpin RNA - shRNA) capable of silencing or turn off the expression of the GFRAL gene, called shRNA-GFRAL, counteracts the weight loss characteristic of ALS and improves motor function, thus being able to improve the symptoms and quality of life of patients.

[0018] SUMMARY OF THE INVENTION

[0019] The object of the invention is a GFRAL receptor inhibitor for use in the treatment of amyotrophic lateral sclerosis in which said inhibitor is selected from an antisense oligonucleotide, a siRNA, a shRNA, an oligonucleotide comprising at least one locked nucleic acid (LNA), a recombinant virus, and an antisense expression vector.

[0020] It is also the object of the invention a GFRAL receptor inhibitor for use in the treatment of cachexia associated with amyotrophic lateral sclerosis in which said inhibitor is selected from an antisense oligonucleotide, a siRNA, a shRNA, an oligonucleotide comprising at least one locked nucleic acid (LNA), a recombinant virus, and an antisense expression vector.

[0021] In particular, it is an object of the invention said GFRAL receptor inhibitor for blocking and / or reducing weight loss in a subject suffering from amyotrophic lateral sclerosis.

[0022] It is also an object of the invention said GFRAL receptor inhibitor for increasing appetite in a subject suffering from amyotrophic lateral sclerosis and / or suffering from cachexia associated with amyotrophic lateral sclerosis.

[0023] Preferably, said GFRAL receptor inhibitor blocks, prevents and / or decreases the interaction between GFRAL and GDF15.

[0024] Said GFRAL receptor inhibitor can be selected from: an antisense oligonucleotide, a siRNA, a shRNA, a locked nucleic acid (LNA), a recombinant virus, an antisense expression vector. In a preferred embodiment, said GFRAL receptor inhibitor is a short hairpin RNA or shRNA.

[0025] In a preferred embodiment, said GFRAL receptor inhibitor blocks, silences or decreases the expression of the GFRAL receptor, in particular of the gene encoding GFRAL.

[0026] It is a further object of the invention a pharmaceutical composition comprising said GFRAL inhibitor and at least one pharmaceutically acceptable vector and / or excipient for use in the treatment of amyotrophic lateral sclerosis and / or for use in the treatment of cachexia associated with amyotrophic lateral sclerosis and / or forblocking and / or reducing weight loss in a subject suffering from amyotrophic lateral sclerosis and / or for increasing appetite in a subject suffering from amyotrophic lateral sclerosis.

[0027] It is also an object of the invention a vector comprising or expressing a GFRAL receptor inhibitor for use in the treatment of amyotrophic lateral sclerosis and / or for use in the treatment of cachexia associated with amyotrophic lateral sclerosis and / or for blocking and / or reducing weight loss in a subject suffering from amyotrophic lateral sclerosis and / or for increasing appetite in a subject suffering from amyotrophic lateral sclerosis.

[0028] Figures

[0029] Figure 1. a) Evaluation of serum GDF15 levels in hSODlG93A mice at three different stages: pre-symptomatic (13 weeks), symptomatic (16 weeks) and fully symptomatic (19 weeks); each point represents one mouse (n = 5). The data are mean ± SEM * P <0.05 ** P <0.01 one-way ANOVA). b) RT-PCR analysis of GDF-15 expression levels in CD1 lb+ cells from the motor cortex of hSODlG93A mice and age-matched controls); (n = 5. The data are mean ± SEM * P <0.05 ** P <0.01 one-way ANOVA). c) RT-PCR analysis of GFRAL expression levels in the area postrema of symptomatic (16 weeks) and fully symptomatic (19 weeks) hSODlG93A mice; (n = 3. The data are mean ± SEM * P <0.05 vs non-tg mice, oneway ANOVA).

[0030] Figure 2. Graph representative of food intake (b) and body weight (a) in hSODlG93Amice and non-transgenic (NTG) mice injected with AAV silencing GFRAL shRNA (sh group) or empty vector (sc group) at 10 weeks of age - TO in both graphs. A significant increase in both body weight and food intake was reported in subjects receiving GFRAL silencing (sh group), from week XIV to week XIX. SH treatment VS SC *p<0.05

[0031] Figure 3. a) Graph representative of motor performance with the Rotarod test in hSODlG93Amice and non-transgenic (NTG) mice injected with AAV silencing GFRAL shRNA (sh group) or empty vector (sc group) at 10 weeks of age - TO. SH treatment VS SC *p<0.05; b) Motor neuron count (SMI32+neurons) in lumbar spinal cord at 19 weeks of age in hSODlG93Amice and non-transgenic (NTG) mice injected with AAV silencing GFRAL shRNA (sh group) or empty vector (sc group) at 10 weeks of age - TO (scNTG n= 4; scSOD n= 2; shNTG n= 4; shSOD n= 2).

[0032] DETAILED DESCRIPTION OF THE INVENTION Cachexia is intended as a loss of body mass which cannot be completely reversed with nutrition, typically associated with a disease.

[0033] For GFRAL receptor is intended the GDNF family receptor a-like receptor.

[0034] For inhibitor is intended an agent capable of decreasing or blocking the activity of the GFRAL receptor. Preferably, said GFRAL inhibitor is an inhibitor capable of inhibiting, blocking or decreasing the expression of the GFRAL receptor, preferably capable of inhibiting, blocking or decreasing the expression of the gene encoding GFRAL.

[0035] The terms “polynucleotide” and “nucleic acid” used interchangeably herein refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxynucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or functionalised nucleotide bases.

[0036] The person skilled in the art can obtain a GFRAL receptor inhibitor as defined above based on common knowledge in the art.

[0037] Said inhibitor is a polynucleotide selected from a shRNA, an antisense oligonucleotide, a siRNA, an oligonucleotide comprising at least one locked nucleic acid (LNA), a recombinant virus, an antisense expression vector.

[0038] In an embodiment, said polynucleotide is capable of binding, at least partially, to the gene encoding GFRAL or to its mRNA and inhibiting its expression or said polynucleotide encodes or expresses a molecule capable of binding to the gene encoding GFRAL or to its mRNA and inhibiting its expression.

[0039] For “locked nucleic acid” or “LNA” is intended a modified nucleotide, as known in the art. In some embodiments, "LNA" also means an oligonucleotide comprising at least one LNA. An inhibitor for use according to the invention can comprise one or more modified LNAs, in particular can comprise a mixture of DNA and LNA, for example it can be an antisense oligonucleotide comprising one or more LNAs.

[0040] More preferably said inhibitor is a shRNA.

[0041] For short hairpin RNA or shRNA is intended an RNA sequence which, curving, forms a hairpin-like structure used for silencing gene expression. Small hairpin RNA is a synonym. Said shRNA preferably comprises a sequence complementary, at least in part, to the sequence of the gene encoding the GFRAL receptor.

[0042] The sequence of the gene encoding the GFRAL receptor is known. See for example the information in the GeneCards database regarding this gene (id: GC06P096440; update of 10 January 2023).

[0043] Therefore, the person skilled in the art is capable of designing and obtaining a shRNA capable of inhibiting the expression of the gene encoding the GFRAL receptor by means of the normal knowledge in the art. Such shRNA can also be commercially available.

[0044] In a preferred embodiment, said shRNA comprises or consists of a sequence obtained from the transcription of the following sequence (orientation 5’-3’):

[0045] CACCGACCAATAAGACAGATAACACTCGAGTGTTATCTTGTCTTATTGGTGCTT TTT [SEQ ID N.l]

[0046] The inhibitor for the use of the invention can be administered by means of a vector.

[0047] A vector comprising or expressing a GFRAL receptor inhibitor, in particular a shRNA, for use in the treatment of amyotrophic lateral sclerosis and / or of cachexia associated with amyotrophic lateral sclerosis and / or for blocking and / or reducing weight loss in a subject suffering from amyotrophic lateral sclerosis and / or for increasing appetite in a subject suffering from amyotrophic lateral sclerosis is also an object of the invention.

[0048] Said vector can be viral or non-viral, e.g., bacterial. Preferably it is a viral vector, more preferably selected from adenoviral vectors, adeno-associated viral vectors (AAV), herpes viral vectors, retroviral vectors, lentiviral vectors, RNA and DNA virus vectors. A preferred vector is an adeno-associated viral, or AAV, vector.

[0049] In a preferred embodiment, said vector comprises or expresses a shRNA capable of inhibiting the expression of the gene encoding the GFRAL receptor. In a preferred embodiment, said vector comprises the following sequence (orientation 5’-3 ’):

[0050] CACCGACCAATAAGACAGATAACACTCGAGTGTTATCTTGTCTTATTGGTGCTT TTT [SEQ ID N.l]

[0051] In a preferred embodiment, the inhibitor is a shRNA and is administered by means of an AAV vector. Any AAV vector is suitable for the purposes of the present invention. Said inhibitor, in particular said vector, can be administered by means of any suitable route of administration. For example, by means of injection. Preferably, by means of intracerebral or intravenous injection.

[0052] Said inhibitor can be included in a pharmaceutical composition further comprising pharmaceutically acceptable carriers and / or excipients known in the art, for example adjuvants, dispersing agents, emulsifiers.

[0053] Said pharmaceutical composition can optionally also comprise one or more further active ingredients, in particular one or more drugs commonly used in ALS.

[0054] The inhibitor for the use of the invention can be administered to a subject suffering from ALS, preferably fALS.

[0055] In an embodiment, the inhibitor described herein is for use in the treatment of amyotrophic lateral sclerosis.

[0056] For amyotrophic lateral sclerosis or ALS is intended a progressive motor neuron neurodegenerative disease which selectively affects motor neurons.

[0057] ALS can be a sporadic form (sALS) or a familial genetic form (fALS).

[0058] For treatment of amyotrophic lateral sclerosis is intended that the administration of the inhibitor improves or cures the disease and / or its symptoms or blocks or slows its progression.

[0059] In an embodiment, the inhibitor described herein is for use for the treatment of cachexia associated with amyotrophic lateral sclerosis. In particular, the administration of the inhibitor blocks or reduces lean mass loss and / or fat mass loss and / or involuntary weight loss associated with cachexia in a subject suffering from amyotrophic lateral sclerosis.

[0060] In this embodiment, after administration of the inhibitor the ALS subject does not lose more weight or loses less weight with respect to before the administration of the inhibitor.

[0061] In an embodiment, the inhibitor described herein is for use for increasing and / or stimulating appetite in a subject suffering from amyotrophic lateral sclerosis and / or in a subject suffering from cachexia associated with amyotrophic lateral sclerosis. In this embodiment, after the administration of the inhibitor, the subject suffering from ALS has a greater appetite with respect to before the administration of the inhibitor. The present invention will be now described by means of the following non-limiting examples.

[0062] EXAMPLES

[0063] Example 1

[0064] Materials and Methods

[0065] Animals

[0066] The experiments were approved by the Italian Ministry of Health in accordance with the guidelines on the ethical use of animals of the Directive of the Council of the European Community of 22 September 2010 (2010 / 63 / EU) and Italian Legislative Decree 26 / 2014. Every effort was made to minimize animal suffering and to reduce the number of animals used for each condition by calculating the sample size needed before running the experiments. hSODlG93Amales and females [B6.Cg-Tg (SOD1-G93A) IGur / J line, the transgene copy number is typically 17-23] (RRID: IMSR_JAX:004435), were obtained from Charles River (Calco, Italy) and EMMA CNR (Monterotondo, Italy). hSODlG93Awere maintained as hemizygotes from the breeding of transgenic males with wild type C57BL / 6 J females from Charles River Laboratories, both maintained on a C57BL / 6 J genetic background. The transgenic mice were identified by PCR on DNA obtained from tail biopsies, and housed in standard breeding cages at constant temperature (22°C) and relative humidity (50%), with a 12: 12 h light: dark cycle (light 7.00 am - 7.00 pm). Food and water were available ad libitum. Non-transgenic (non-tg) age-matched C57BL / 6J mice have always been used as controls. The serum was collected, frozen on dry ice and stored at -80°C until analysis. The ELISA kit for GDF-15 assay was purchased from MyBiosource (Cat. No. MBS2884063) and performed as described by the producer. All the samples were measured at least in duplicate.

[0067] Rotarod test

[0068] The behavioural testing began when the mice were 8 weeks old. All the animals were handled for at least 5 minutes per day for 2-3 days before starting the experiments. For the Rotarod test, to assess coordination, strength, and balance, they were assessed using a rotarod apparatus (Ugo Basile, Gemonio Italy, #47650). The animals were placed on the cylinder at a constant speed of 15 rpm. The arbitrary time limit was 300 seconds and the longest latency was recorded. CDllb (Microglia) MicroBeads.

[0069] Isolation of CD1 lb+ cells from the motor cortex: Non-tg and hSODlG93Amice were deeply anaesthetized with chloral hydrate (400 mg kg 1 , i.p.) and decapitated. The brains were removed, the tissues were cut into small pieces to obtain a single-cell suspension in the HBSS (Hank's Balanced Salt Solution) medium. The cells were filtered using 30 pm filters (Miltenyi Biotec) and processed immediately for separation with MACS MicroBeads. The CD1 lb+ cells, eluted as a positive fraction, were used for the analysis.

[0070] Quantitative RT-PCR

[0071] The cells were lysed in Trizol reagent for RNA isolation. The reverse transcription reaction was performed in a thermocycler (MJ Mini Personal Thermal Cycler; Biorad) using IScript TM Reverse Transcription Supermix (Biorad), under the following conditions: incubation at 25°C for 5 min, reverse transcription at 42°C for 30 min, inactivation at 85°C for 5 min. Real-time PCR (RT-PCR) was performed in an I-Cycler IQ Multicolor RT PCR Detection System (Biorad) using SsoFast EvaGreen Supermix (Biorad) according to the producer's instructions. The PCR protocol consisted of 40 denaturating cycles at 95 °C for 30 s and annealing / extension at 60 °C for 30 s.

[0072] Gene knockdown by means of stereotactic injection located in the rhombencephalon of the mouse.

[0073] Male mice of 10 weeks of age, with average weights between 20-25 g were anaesthetized with chloral hydrate (400 mg / kg i.p.) and the head was fixed on a stereotactic platform. A syringe (Neuros, Hamilton Reno., NV) attached to the stereotactic platform, loaded with 2 pl of AAV-shGFRAL or AAV-shControl was inserted through a hole in the rhombencephalon. The injection was performed bilaterally using the stereotactic coordinates: -7.32 mm posteriorly from the bregma; 0.025 mm laterally from the bregma and depth 4.5 mm from the skull. On each side, a total volume of 0.8 pl AAV was delivered in 10 minutes. The mice were left to rest for 9 days, monitored daily. AAV-shGFRAL and AAV-shControl were purchased from the company VectorBiolabs (PA, USA); AAV- shGFRAL has a sequence with SEQ ID N. 1.

[0074] Statistical analysis

[0075] The data are shown as mean S.E.M. Statistical significance was assessed by one-way ANOVA or two-way ANOVA for parametric data, as indicated; the Holm-Sidak test was used as a post-hoc test; the Mann-Whitney Rank and Kruskal-Wallis test for non-parametric data, followed by Dunn's or Tukey's post-hoc tests. For multiple comparisons, p-values corrected for multiplicity are indicated in the corresponding figures (*p < 0.05, *p < 0.01). For each experiment, the sample size (n) was chosen considering the following relationship: n 2sigma (Zalpha / D)2, where sigma is replaced by a variance estimate (s2); alpha is at 0.05 (and Zalpha = -2) and D is the difference between the treatments. Exclusion / inclusion criteria were set for the animals; the animals considered for the analysis were selected for age. The investigators performing the different analyses always received the samples from a third laboratory member, who was not involved in that specific experiment, to ensure blindness to the group assignment.

[0076] RESULTS

[0077] The inventors actually started the experimental studies in mouse models of ALS, in particular using the hSODlG93Amodel, which shows a mutation in the SOD1 protein reproducing some of the main clinical signs observed in humans.

[0078] First, we evaluated the serum levels of GDF15 at different stages of the disease, demonstrating a significant increase in the protein from the pre-symptomatic phase, in hSODlG93Amice (Fig. la).

[0079] To understand which cell produced the GDF15, we focused on microglial cells which carry out a key role in ALS progression (2). To this end, we isolated the microglial cells (CD1 lb+) from the brains of hSODlG93Amice, analysing the expression levels of GDF15 (Fig. lb). Our data showed a significant increase in GDF15 expression in the pre- and symptomatic phase, with a significant reduction in the late symptomatic phase (19 weeks of age). In addition, the expression level of the GFRAL receptor was increased in the rhombencephalon of hSODlG93Amice in the symptomatic stage of the disease (Fig. 1c).

[0080] To block the GFRAL-mediated signaling, non-transgenic (non-tg) or hSODlG93Amice were treated with shRNA-GFRAL starting from a pre-symptomatic stage of the disease. The data showed an increase in food consumption (Fig. 2b) and body weight (Fig. 2a), with a significant difference between treatments starting from the pre-symptomatic stage of the disease.

[0081] The same animals were evaluated for motor function through the Rotarod test (15) throughout the duration of the treatment. The data show an improvement starting from a pre- symptomatic stage of the disease in the hSODlG93Amice treated with shRNA-GFRAL (Fig.3a). The number of motor neurons was also increased in these mice (Fig.3b).

[0082] DISCUSSION

[0083] In recent years, malnutrition and weight loss have been shown to be common symptoms in people with ALS, affecting not only the quality of life but also the rate at which the disease progresses. Approximately 18-47% of ALS patients suffer from anorexia, and this percentage increases as the disease progresses (1,9,10). Hypothalamic dysfunctions and energy imbalances that contribute to altered appetite and body weight have also been described in ALS (11). We have recently demonstrated the existence of a causal link between hypothalamic inflammation and deregulation of feeding behaviour in mouse models of ALS (2). Furthermore, increasing the energy content of the diet increases the survival of hSODlG93Amice (4), and has also shown efficacy in a pilot clinical study, in patients given a diet with increased energy intake. For these reasons, the identification of the mechanisms causing weight loss in ALS is of diagnostic and therapeutic relevance.

[0084] The regulatory role of the GDF15 protein in modulating eating behaviour and weight loss has been identified herein. Recent studies demonstrate that the administration of a recombinant antibody for GDF15 in rodents (12) and non-human primates (13) reduces food intake and body mass. In the current study, we investigated the mechanisms by which GDF15 exerts its anorectic action in ALS. The results obtained show an increase in GDF15 in the plasma of mouse models, which could modulate eating behaviours and induce weight loss, through the signaling of its receptor, expressed in neurons of the brain stem. Furthermore, tissue inflammation, and in particular the release of GDF15 by the glial cells (hyperactive during the course of symptomatology), underscore an involvement of this protein in ALS. Finally, data obtained in vivo using specific AAV-shRNAs to switch off the GDF 15 receptor, showed a significant improvement in feeding behaviour and motor function in the mouse model of ALS. Greater attention to the nutritional aspect and metabolic changes in ALS patients can become an important area of therapeutic intervention, with the aim of improving the quality of life of the patient and his family.

[0085] References

[0086] 1. Moglia C, (2019). Early weight loss in amyotrophic lateral sclerosis: Outcome relevance and clinical correlates in a population-based color. Journal of Neurology Neurosurgery & Psychiatry' 90(6) :jnnp-2018-31961 1. 2. Cocozza, G.; Garofalo, S.; Morotti, M.; Chece, G.; Grimaldi, A.; Lecce, M.; Scavizzi; Menghini, R.; Casagrande, V.; Federici, M.; et al. The feeding behaviour of ALS mouse models is modulated by the Ca2+ -activated KCa3.1 channels. Br. J. Pharmacol. 2021 Dec; 178(24):4891-4906.

[0087] 3. Guillot SJ, Bolborea M, Dupuis L. Dysregulation of energy homeostasis in amyotrophic lateral sclerosis. Corr Opin Neurol. l;34(5):773-780.

[0088] 4. Dupuis, L., Oudart, H., Rene, F., Gonzalez de Aguilar, J. L., & Loeffler, J. P. (2004). Evidence for defective energy homeostasis in amyotrophic lateral sclerosis: Benefit of a high-energy diet in a transgenic mouse model. Proceedings. National Academy of Sciences United States of America, 101, 11159-11164.

[0089] 5. Ludolph, A. C., Dorst, J., Dreyhaupt, J., Weishaupt, J. H., Kassubek, J., Weiland, U., Meyer, T., Petri, S., Hermann, A., Emmer, A., Grosskreutz, J., Grehl, T., Zeller, D., Boentert, M., Schrank, B., Prudlo, J., Winkler, A. S., Gorbulev, S., Roselli, F., ... for the LIPCAL-ALS

[0090] Study Group. (2020). Effect of high-caloric nutrition on survival in amyotrophic lateral sclerosis. Annals of Neurology, 87, 206-216.

[0091] 6. Vasta R, Canosa A, Manera U, Di Pede F, Cabras S, De Marchi F, Mazzini L, Moglia C, Calvo A, Chio A. Do ecological factors influence the clinical presentation of amyotrophic lateral sclerosis? J Neurol Neurosurg Psychiatry. 2021 Sep;92(9): 1017- 1019.

[0092] 7. Suriben, R. et al. Antibody-mediated inhibition of GDF15-GFRAL activity reverses cancer cachexia in mice Nat. Med.

[0093] 8. Emmerson, P. J. et al. The metabolic effects of GDF15 are mediated by the orphan receptor GFRAL. Nat. Med. 23, 1215-1219 (2017).

[0094] 9. Dorst, J., Schuster, J., Dreyhaupt, J., Witzel, S., & JH, Kassubek Jet al. (2020). Effect of high-caloric nutrition on serum neurofilament light chain levels in amyotrophic lateral sclerosis. Journal of Neurology, Neurosurgery, and Psychiatry, 91(9), 1007- 1009.

[0095] 10. Ngo, S. T., van Eijk, R. P. A., Chachay, V., van den Berg, L. H., McCombe, P. A.,

[0096] Henderson, R. D., & Steyn, F. J. (2019). Loss of appetite is associated with a loss of weight and fat mass in patients with amyotrophic lateral sclerosis. Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration, 20, 497-505.

[0097] 11. Vercruysse P, (2016). Alterations in the hypothalamic melanocortin pathway in amyotrophic lateral sclerosis. Brain 139, 1106-1122.10.1093 / brain / aww004. 12. Tsai, V.W.-W. et al. TGF-b superfamily cytokine MIC-1 / GDF15 is a physiological appetite and body weight regulator. PLoS One 8,e55174 (2013).

[0098] 13. Xiong, Y. et al. Long-acting MIC-1 / GDF15 molecules to treat obesity: Evidence from mice to monkeys. Sei. Transl. Med. 9, eaan8732(2017).

[0099] 14. Vicky Wang-Wei Tsai, Hong Ping Zhang, Rakesh Manandhar, Peter Schofield, Daniel Christ, Ka Ki Michelle Lee-Ng, Helene Lebhar, Christopher Peter Marquis,

[0100] Yasmin Husaini, David A. Brown & Samuel N. Breit. GDF15 mediates adiposityresistance through actions on GFRAL neurons in the hindbrain AP / NTS. International Journal of Obesity, volume 43, pages 2370-2380 (2019).

[0101] 15. Shiotsuki H, Yoshimi K, Shimo Y, Funayama M, Takamatsu Y, Ikeda K, Takahashi R, Kitazawa S, Hattori N. A rotarod test for evaluation of motor skill learning. J

[0102] Neurosci Methods. 189(2): 180-5 (2010).

Claims

CLAIMS1. A GFRAL receptor inhibitor for use in the treatment of amyotrophic lateral sclerosis wherein said inhibitor is selected from an antisense oligonucleotide, a siRNA, a shRNA, an oligonucleotide comprising at least one locked nucleic acid (LNA), a recombinant virus, and an antisense expression vector.

2. A GFRAL receptor inhibitor for use in the treatment of cachexia associated with amyotrophic lateral sclerosis and / or for blocking and / or reducing weight loss in a subject suffering from amyotrophic lateral sclerosis and / or for increasing appetite in a subject suffering from amyotrophic lateral sclerosis and / or in a subject suffering from cachexia associated with amyotrophic lateral sclerosis, wherein said inhibitor is selected from an antisense oligonucleotide, a siRNA, a shRNA, an oligonucleotide comprising at least one locked nucleic acid (LNA), a recombinant virus, and an antisense expression vector.

3. The inhibitor for use according to claim 1 or 2, wherein said inhibitor blocks, prevents and / or decreases the interaction between GFRAL and GDF15.

4. The inhibitor for use according to any one of the preceding claims, wherein said inhibitor of the GFRAL receptor blocks, silences and / or decreases the expression of the gene encoding the GFRAL receptor.

5. The inhibitor for use according to any one of the preceding claims, wherein said GFRAL receptor inhibitor is a short hairpin RNA or shRNA.

6. The inhibitor for use according to claim 5, wherein said shRNA comprises or consists of a sequence obtained from the transcription of the following sequence (orientation 5’-3’): CACCGACCAATAAGACAGATAACACTCGAGTGTTATCTTGTCTTATTGG TGCTTTTT [SEQ ID N.I],7. A pharmaceutical composition comprising a GFRAL receptor inhibitor as described in claims 1-6, and at least one pharmaceutically acceptable carrier and / or an excipient for use in the treatment of amyotrophic lateral sclerosis and / or for use in the treatment of cachexia associated with amyotrophic lateral sclerosis and / or for blocking and / or reducing weight loss in a subject suffering from amyotrophic lateral sclerosis and / or for increasing appetite in a subject suffering from amyotrophic lateral sclerosis.

8. A vector comprising or expressing a GFRAL receptor inhibitor as described in claims 1-6, for use in the treatment of amyotrophic lateral sclerosis and / or for use in the treatment of cachexia associated with amyotrophic lateral sclerosis and / or for blocking and / or reducing weight loss in a subject suffering from amyotrophic lateral sclerosis and / or for increasing appetite in a subject suffering from amyotrophic lateral sclerosis.

9. The vector for the use of claim 8, wherein said vector comprises or expresses a shRNA capable of inhibiting the expression of the gene encoding the GFRAL receptor, preferably said vector comprises a sequence with SEQ ID NO: 1, more preferably it is an adeno-associated viral vector or AAV.

10. The inhibitor for the use according to any one of claims 1-6 or the pharmaceutical composition for use according to claim 7 or the vector for use according to claim 8 or 9, wherein the amyotrophic lateral sclerosis is a sporadic form (sALS) or a familial genetic form (fALS), preferably it is a familial genetic form (fALS).