Compositions and methods for treating cag repeat diseases

Abstract

The present disclosure provides a double-stranded RNA (dsRNA) comprising: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region; and ii) at least a second mismatch to the target CAG repeat region. The present disclosure provides a recombinant nucleic acid comprising: a) a dsRNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising a nucleotide sequence encoding such a recombinant nucleic acid. The present disclosure provides viral and non-viral delivery vehicles comprising a recombinant expression vector of the present disclosure; and pharmaceutical compositions comprising such delivery vehicles. The present disclosure provides methods for selectively reducing translation of a disease-associated CAG repeat-containing RNA.

Description

Atty. Dkt: IRIS-002WO COMPOSITIONS AND METHODS FOR TREATING CAG REPEAT DISEASES CROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Patent Application No.63 / 457,297, filed April 5, 2023, which application is incorporated herein by reference in its entirety. INCORPORATION-BY-REFERENCE OF XML SEQUENCE LISTING

[0002] A Sequence Listing is provided herewith as a Sequence Listing XML, “IRIS- 002WO_SEQ_LIST.XML” created on April 1, 2024 and having a size of 3,204,864 bytes. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety. INTRODUCTION

[0003] Repeat expansion disorders are genetic disorders caused by expansion of DNA repeats. DNA repeats may be composed of single nucleotides to dodecamers or longer. The threshold at which repeat expansions become symptomatic varies with the particular disease. There are over 50 distinct diseases caused by repeat expansions. Repeat expansions may occur in coding or non-coding regions of genes. Repeat expansions may cause defects in a protein encoded by a gene; change the regulation of gene expression; produce a toxic RNA, or lead to chromosome instability.

[0004] Inhibition of both mutant and wild-type expression of a repeat-containing gene may induce significant side effects. Thus, suppression of the mutant repeat expansion allele is a desired therapeutic strategy for repeat expansion disorders. Current strategies for mutant allele-specific inhibition include targeting disease-associated single nucleotide polymorphisms (SNPs) or deletions with antisense oligonucleotides or RNA interference agents. However, identifying SNPs associated with repeat expansion mutations requires detailed population-specific genetic studies in large clinical cohorts. Furthermore, depending upon the frequency of the target SNPs or location on the mutant repeat expansion allele, certain affected individuals or populations may be excluded. SUMMARY

[0005] The present disclosure provides a double-stranded RNA comprising: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region; and ii) at least a second mismatch to the target CAG repeat region. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of the double- stranded RNA, where the nucleotide sequence is operably linked to a promoter that is functional in aAtty. Dkt: IRIS-002WO eukaryotic cell. The present disclosure provides a recombinant nucleic acid comprising: a) a double- stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising a nucleotide sequence encoding such a recombinant nucleic acid. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising such a DNA molecule. The present disclosure provides viral and non-viral delivery vehicles comprising a recombinant expression vector of the present disclosure; and pharmaceutical compositions comprising such delivery vehicles. The present disclosure provides methods for selectively reducing translation of a disease-associated CAG repeat-containing RNA. BRIEFDESCRIPTIONOFTHEDRAWINGS

[0006] FIG.1A-1C depict miRNA miR33 scaffold designs for artificial miRNA expression. (FIG. A) miR33 miRNA structure and sequence elements. (FIG. B) Generalized miR33 scaffold for miRNA cloning and expression. “N” denotes the nucleotides that should be substituted to target mRNA of interest. “Z” denotes the nucleotides that should be substituted to maintain the double-stranded stem portion of the miRNA. The secondary structure of the stem region is dependent on the nucleotide complementarity between the guide sequence and 3’ stem sequence. (FIG. C) miR33 miRNA structure for a CAG-targeting sbRNA. “X” denotes the nucleotides in positions 17-21 that may be mismatched from the mRNA target sequence.

[0007] FIG.2A-2C depict miRNA miR451 scaffold designs for artificial miRNA expression. (FIG. 2A) miR451 miRNA structure and sequence elements (SEQ ID NO:65). (FIG.2B) Generalized miR451 scaffold for miRNA cloning and expression (SEQ ID NO:66). “N” denotes the nucleotides that should be substituted to target mRNA of interest. “Z” denotes the nucleotides that should be substituted to maintain the double-stranded stem portion of the miRNA. The secondary structure of the stem region is dependent on the nucleotide complementarity between the guide sequence and 3’ stem sequence. (FIG.2C) miR451 miRNA structure for a CAG-targeting sbRNA. “X” denotes the nucleotides in positions 17-21 that may be mismatched from the mRNA target sequence.

[0008] FIG.3 depicts small binding RNA (sbRNA) guide sequence design. Mismatch positions 8-11 and 17-21 within guide sequence are shown.

[0009] FIG.4 depicts sbRNA guide sequence mismatch positions 8-11 and 17-21 in different registers.

[0010] FIG.5 is a schematic depiction of a guide sequence screening system.

[0011] FIG.6 provides Table 1. Table 1 depicts mismatch (mm) positions, i.e., positions of mismatches between an sbRNA and a target CAG repeat region.Atty. Dkt: IRIS-002WO

[0012] FIG.7 provides examples of nucleotide sequences of first strand of a double-stranded RNA (dsRNA) with 2 mismatches to a target CAG repeat region of a CAG repeat containing RNA.

[0013] FIG.8A-8C provide examples of nucleotide sequences of first strand of a dsRNA with 3 mismatches to a target CAG repeat region of a CAG repeat containing RNA.

[0014] FIG.9A-9L provide examples of nucleotide sequences of first strand of a dsRNA with 4 mismatches to a target CAG repeat region of a CAG repeat containing RNA.

[0015] FIG. 10 provides Table 3.

[0016] FIG. 11 provides Table 4.

[0017] FIG. 12 provides Table 5.

[0018] FIG. 13 depicts guide sequence screening and allele selectivity.

[0019] FIG. 14 depicts mut HTT (CAG68) and wt HTT (CAG17) expression for sbRNA sequences that demonstrate the most mut HTT knock-down. DEFINITIONS

[0020] As used herein, the term “nucleic acid” or “polynucleotide” refer to any nucleic acid polymer composed of covalently linked nucleotide subunits, such as polydeoxyribonucleotides or polyribonucleotides. Examples of nucleic acids include RNA and DNA.

[0021] As used herein, “RNA” refers to a molecule comprising one or more ribonucleotides and includes double-stranded RNA, single-stranded RNA, isolated RNA, synthetic RNA, recombinant RNA, as well as modified RNA that differs from naturally-occurring RNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. Nucleotides of RNA molecules may comprise standard nucleotides or non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides.

[0022] As used herein, “DNA” refers to a molecule comprising one or more deoxyribonucleotides and includes double-stranded DNA, single-stranded DNA, isolated DNA, synthetic DNA, recombinant DNA, as well as modified DNA that differs from naturally-occurring DNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. Nucleotides of DNA molecules may comprise standard nucleotides or non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides.

[0023] As used herein, “nucleoside” means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.

[0024] As used herein, “nucleotide” means a nucleoside further comprising a phosphate linking group. As used herein, “linked nucleosides” may or may not be linked by phosphate linkages and thusAtty. Dkt: IRIS-002WO includes, but is not limited to “linked nucleotides.” As used herein, “linked nucleosides” are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).

[0025] As used herein, “nucleobase” or “base” means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.

[0026] As used herein, “oligonucleotide” means a compound comprising a plurality of linked nucleosides. In some cases, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides.

[0027] As used herein, “oligomeric compound” means a polymeric structure comprising two or more sub-structures. In certain embodiments, an oligomeric compound comprises an oligonucleotide. In certain embodiments, an oligomeric compound comprises one or more conjugate groups and / or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide. Oligomeric compounds also include naturally occurring nucleic acids.

[0028] As used herein, “single-stranded” means an oligomeric compound that is not hybridized to its complement and which lacks sufficient self-complementarity to form a stable self-duplex.

[0029] As used herein, “double-stranded” means an oligomeric compound that is partially or completely hybridized to its complement to form a stable duplex molecule. A double-stranded oligomeric compound may be composed of two separate strands of complementary oligomeric compounds hybridized to each other or a single oligomeric compound which has sufficient self- complementarity to form a stable self-duplex. Stable self-duplexes may contain stem-loop structure(s) and / or bulge(s).

[0030] “Isolated” refers to a substance that has been isolated from its natural environment or artificially produced. As used herein with respect to a cell, “isolated” refers to a cell that has been isolated from its natural environment (e.g., from a subject, organ, tissue, or bodily fluid). As used herein with respect to a nucleic acid, “isolated” refers to a nucleic acid that has been isolated or purified from its natural environment (e.g., from a cell, cell organelle, or cytoplasm), recombinantly produced, amplified, or synthesized. In embodiments, an isolated nucleic acid includes a nucleic acid contained within a vector.

[0031] As used herein, the term “wild-type” or “non-mutant” form of a gene refers to a nucleic acid that encodes a protein associated with normal or non-pathogenic activity (e.g., a protein lacking a mutation, such as a repeat region expansion that results in higher risk of developing, onset, or progression of a neurodegenerative disease).Atty. Dkt: IRIS-002WO

[0032] As used herein, the term “mutation” refers to any change in the structure of a gene, e.g., gene sequence, resulting in an altered form of the gene, which may be passed onto subsequent generations (hereditary mutation) or not (somatic mutation). Gene mutations include the substitution, insertion, or deletion of a single base in DNA or the substitution, insertion, deletion, or rearrangement of multiple bases or larger sections of genes or chromosomes, including repeat expansions.

[0033] As used herein, the term “inhibitory nucleic acid” refers to a nucleic acid that comprises a guide strand sequence that hybridizes to at least a portion of a target nucleic acid, e.g., target RNA, mRNA, or pre-mRNA, and inhibits its expression or activity. An inhibitory nucleic acid may target a protein coding region (e.g., exon) or non-coding region (e.g., 5’UTR, 3’UTR, intron, etc.) of a target nucleic acid. In some cases, an inhibitory nucleic acid is a single stranded or double stranded molecule. An inhibitory nucleic acid may further comprise a passenger strand sequence on a separate strand (e.g., double stranded duplex) or in the same strand (e.g., single stranded, self-annealing duplex structure). In some cases, an inhibitory nucleic acid is an RNA molecule, such as a siRNA, shRNA, pri-miRNA, pre- miRNA, or miRNA. In some cases, an inhibitory nucleic acid is double-stranded RNA (dsRNA), such as a pri-miRNA, pre-miRNA, miRNA, or shRNA.

[0034] As used herein, a “microRNA” or “miRNA” refers to a small non-coding RNA molecule capable of mediating silencing of a target gene by cleavage of the target mRNA, translational repression of the target mRNA, target mRNA degradation, or a combination thereof. Typically, miRNA is transcribed as a hairpin or stem-loop (e.g., having a self-complementary, single-stranded backbone) duplex structure, referred to as a primary miRNA (pri-miRNA), which is enzymatically processed (e.g., by Drosha, DGCR8, Pasha, etc.) into a pre-miRNA. Pre-miRNA is exported into the cytoplasm, where it is enzymatically processed by Dicer to produce a miRNA duplex with the passenger strand and then a single- stranded mature miRNA molecule, which is subsequently loaded into the RNA-induced silencing complex (RISC). Reference to a miRNA may include synthetic or artificial miRNAs.

[0035] As used herein, a “synthetic miRNA” or “artificial miRNA” or “amiRNA” or “small binding RNA” (sbRNA) refers to an endogenous, modified, or synthetic pri-miRNA or pre-miRNA (e.g., miRNA backbone or scaffold) in which the endogenous miRNA guide sequence and passenger sequence within the stem sequence have been replaced with a heterologous guide sequence and a heterologous passenger sequence that direct highly efficient RNA silencing of the targeted gene (see, e.g., Eamens et al. (2014), Methods Mol. Biol.1062:211-224). In some cases, the nature of the complementarity of the guide and passenger sequences (e.g., number of bases, position of mismatches, types of bulges, etc.) can be similar or different from the nature of complementarity of the guide and passenger sequences in the endogenous miRNA backbone upon which the synthetic miRNA is constructed.Atty. Dkt: IRIS-002WO

[0036] As used herein, the term “microRNA backbone,” “miR backbone,” “microRNA scaffold,” or “miR scaffold” refers to a pri-miRNA or pre-miRNA scaffold, with the stem sequence replaced by a heterologous RNA of interest, and is capable of producing a functional, mature miRNA that directs RNA silencing at the gene targeted by the miRNA of interest. In some cases, a miR backbone comprises a 5’ flanking region (also referred to herein as a “5’ flanking polynucleotide” or a “5’ leader”), a loop motif region (also referred to herein as a “loop polynucleotide”), and a 3’ flanking region (also referred to herein as a “3’ flanking polynucleotide” or a “3’ trailer”). In some cases, a miR backbone comprises a 5’ flanking region and a 3’ flanking region (and does not include a loop motif region). A miR backbone may be derived completely or partially from a wild type miRNA scaffold or be a completely artificial sequence.

[0037] As used herein, the term “short hairpin RNA” or “shRNA” includes a conventional stem-loop shRNA, which forms a precursor miRNA (pre-miRNA). “shRNA” also includes micro-RNA embedded shRNAs (miRNA-based shRNAs), wherein the guide strand and the passenger strand of the miRNA duplex are incorporated into an existing (or natural) miRNA or into a modified or synthetic (designed) miRNA. When transcribed, a conventional shRNA forms a primary miRNA (pri-miRNA) or a structure very similar to a natural pri-miRNA. The pri-miRNA is subsequently processed by Drosha and its cofactors into pre-miRNA. Therefore, the term “shRNA” includes pri-miRNA molecules and pre- miRNA molecules.

[0038] A “stem-loop structure” refers to a nucleic acid having a secondary structure that includes a region of nucleotides which are known or predicted to form a double strand or self-duplex (stem portion) that is linked on one side by a region of predominantly single-stranded nucleotides (terminal loop portion). The terms “hairpin”, “self-duplex” and “fold-back” structures are also used herein to refer to stem-loop structures. Such structures are well known in the art and the term is used consistently with its known meaning in the art. As is known in the art, the secondary structure does not require exact base-pairing. Thus, the stem can include one or more base mismatches or bulges. Alternatively, the base-pairing can be exact, i.e. not include any mismatches.

[0039] As used herein, the term “guide strand sequence” of an inhibitory nucleic acid refers to a sequence that is substantially complementary (e.g., at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary) to a region of about 10-50 nucleotides (e.g., about 15-30, 16- 25, 18-23, or 19-22 nucleotides) of the mRNA or pre-mRNA targeted for silencing. The guide sequence is sufficiently complementary to the target mRNA sequence to direct target-specific silencing, e.g., to trigger the destruction of the target mRNA by the RNAi machinery or process or to reduce translation of the target mRNA. In some cases, the guide strand sequence refers to the mature guide sequence remaining following cleavage by Dicer.Atty. Dkt: IRIS-002WO

[0040] As used herein, the term “passenger strand sequence” of an inhibitory nucleic acid refers to a sequence that is homologous to the target mRNA or pre-mRNA, and partially or completely complementary to the guide strand sequence of an inhibitory nucleic acid. The guide strand sequence and passenger strand sequence of an inhibitory nucleic acid are hybridized to form a duplex structure (e.g., forming a double-stranded duplex or single-stranded self-annealing duplex structure). In some cases, the guide strand sequence and passenger strand sequence refers to the mature sequences remaining following cleavage by Dicer.

[0041] As used herein, the term “5’ arm” or “5’ stem” refers to a portion of a double stranded RNA (e.g., shRNA, pre-miRNA, pri-mRNA) that comprises the guide strand or passenger strand.

[0042] As used herein, the term “3’ arm” or “3’ stem” refers to a portion of a double stranded RNA that comprises the passenger strand to the 5’ stem’s guide strand, or the guide strand to the 5’ stem’s passenger strand.

[0043] As used herein, a “duplex,” when used in reference to an inhibitory nucleic acid, refers to two nucleic acid strands (e.g., a guide strand and passenger strand) hybridizing together to form a duplex structure. A duplex may be formed by two separate nucleic acid strands or by a single nucleic acid strand having a region of self-complementarity (e.g., hairpin or stem-loop).

[0044] As used herein, “target nucleic acid” means a nucleic acid molecule to which an antisense compound hybridizes. A target nucleic acid may be a mRNA (target mRNA) or pre-mRNA (target pre-mRNA) encoded by a target gene.

[0045] As used herein, “targeting” or “targeted to” means the association of an antisense compound to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule. A double-stranded RNA targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.

[0046] As used herein, the term “complementary” refers to the ability of polynucleotides to form base pairs with each other. Base pairs are typically formed by hydrogen bonds between nucleotide subunits in antiparallel polynucleotide strands or a single, self-annealing polynucleotide strand. Complementary polynucleotide strands can form base pairs in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. In some cases, complementary nucleotides include G and U (wobble base pair). As apparent to skilled persons in the art, when using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine. Furthermore, when a “U” is denoted in the context of the present invention, the ability to substitute a “T” is understood, unless otherwise stated. Complementarity also encompasses Watson-Crick base pairing between non-modified and modified nucleobases (e.g., 5-methyl cytosine substituted for cytosine). Full complementarity, perfect complementarity or 100% complementarityAtty. Dkt: IRIS-002WO between two polynucleotide strands is where each nucleotide of one polynucleotide strand can form hydrogen bond with a nucleotide unit of a second polynucleotide strand. % complementarity refers to the number of nucleotides of a contiguous nucleotide sequence in a nucleic acid molecule that are complementary to an aligned reference sequence (e.g., a target mRNA, passenger strand), divided by the total number of nucleotides and multiplying by 100. In such an alignment, a nucleobase / nucleotide which does not form a base pair is called a mismatch. Insertions and deletions are not permitted in calculating % complementarity of a contiguous nucleotide sequence. It is understood by skilled persons in the art that in calculating complementarity, chemical modifications to nucleobases are not considered as long as the Watson-Crick base pairing capacity of the nucleobase is retained (e.g., 5-methyl cytosine is considered the same as cytosine for the purpose of calculating % complementarity).

[0047] As used herein, “non-complementary” in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.

[0048] As used herein, “mismatch” means a nucleobase of a first oligomeric compound that is not capable of pairing with a nucleobase at a corresponding position of a second oligomeric compound, when the first and second oligomeric compound are aligned. Either or both of the first and second oligomeric compounds may be oligonucleotides. Nucleotides that do not base pair include self-pairing nucleotides (A-A, T-T, U-U, C-C, and G-G), A and C, C and U, C and T, A and G. In some cases, a mismatch does not include G-U wobble base pairs.

[0049] The "percent identity" between two or more nucleic acid sequences refers to the proportion of nucleotides of a contiguous nucleotide sequence in a nucleic acid molecule that are shared by a reference sequence (i.e., % identity = number of identical nucleotides / total number of nucleotides in the aligned region (e.g., the contiguous nucleotide sequence) x 100). Insertions and deletions are not permitted in the calculation of % identity of a contiguous nucleotide sequence. It is understood by skilled persons in the art that in calculating identity, chemical modifications to nucleobases are not considered as long as the Watson-Crick base pairing capacity of the nucleobase is retained (e.g., 5- methyl cytosine is considered the same as cytosine for the purpose of calculating % identity).

[0050] As used herein, the term “hybridizing” or “hybridizes” refers to two nucleic acid strands forming hydrogen bonds between base pairs on antiparallel strands, thereby forming a duplex. While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. The strength of hybridization between two nucleic acid strands may be described by the melting temperature (Tm), defined as at a given ionic strength and pH, the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide.Atty. Dkt: IRIS-002WO

[0051] As used herein, “heterologous” refers to a nucleic acid that is not found in a native (naturally occurring) nucleic acid. For example, relative to a component of a microRNA (e.g., a 5’ flanking polynucleotide, a loop polynucleotide, a 3’ flanking polynucleotide) a heterologous guide sequence and a heterologous passenger sequence comprises a nucleotide sequence that is not associated with the microRNA in nature. As used herein, the “guide sequence” is interchangeable with “first strand” (or “targeting strand”, where the “targeting strand” hybridizes to a target RNA) of a double-stranded RNA, regardless of the orientation.

[0052] As used herein, “expression cassette” refers to any type of genetic construct containing a nucleic acid (e.g., transgene) in which part or all of the nucleic acid encoding sequence is capable of being transcribed. In some cases, expression includes transcription of the nucleic acid, for example, to generate a biologically-active polypeptide product or inhibitory RNA (e.g., siRNA, shRNA, miRNA) from a transcribed gene. In some cases, the transgene is operably linked to expression control sequences.

[0053] As used herein, the term “transgene” refers to an exogenous nucleic acid that has been transferred naturally or by genetic engineering means into another cell and is capable of being transcribed, and optionally translated.

[0054] As used herein, the term “gene expression” refers to the process by which a nucleic acid is transcribed from a nucleic acid molecule, and often, translated into a peptide or protein. The process can include transcription, post-transcriptional control, post-transcriptional modification, translation, post- translational control, post-translational modification, or any combination thereof. Reference to a measurement of “gene expression” may refer to measurement of the product of transcription (e.g., RNA or mRNA), or the product of translation (e.g., peptides or proteins).

[0055] As used herein, the term “inhibit expression of a gene” means to reduce, down-regulate, suppress, block, lower, or stop expression of the gene. The expression product of a gene can be an RNA molecule transcribed from the gene (e.g., an mRNA) or a polypeptide translated from an mRNA transcribed from the gene. A reduction in the level of an mRNA results in a reduction in the level of a polypeptide translated therefrom. In some cases, inhibition of expression reduces the level of a polypeptide without substantially affecting production of the encoding mRNA. The level of expression may be determined using standard techniques for measuring mRNA or protein.

[0056] As used herein, “vector” refers to a genetic construct that is capable of transporting a nucleic acid molecule (e.g., transgene encoding inhibitory nucleic acid) between cells and effecting expression of the nucleic acid molecule when operably-linked to suitable expression control sequences. Expression control sequences may include transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., KozakAtty. Dkt: IRIS-002WO consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. The vector may be a plasmid, phage particle, transposon, cosmid, phagemid, chromosome, artificial chromosome, virus, virion, lipid nanoparticle, etc. Once transformed into a suitable host cell, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself.

[0057] As used herein, “host cell” refers to any cell that contains, or is capable of containing a composition of interest, e.g., an inhibitory nucleic acid. In some cases, a host cell is a mammalian cell, such as a rodent cell (e.g., mouse or rat) or primate cell (e.g., monkey, chimpanzee, or human). In embodiments, a host cell may be in vitro or in vivo. In some cases, a host cell may be from an established cell line or primary cells. In some cases, a host cell may be obtained from a patient having or suspected of having a repeat expansion disease or disorder. In embodiments, a host cell is a non-CNS cell, such as a fibroblast. In some cases, a host cell is a cell of the CNS, such as a neuron, a glial cell, an astrocyte, or a microglial cell.

[0058] As used herein, “expanded repeat containing gene” or “expanded repeat containing RNA” refers to a mutant gene or RNA molecule (e.g., pre-mRNA or mRNA) encoded by the mutant gene having a base sequence that includes a repeat region (e.g., CAG repeat) where the repeat region is expanded beyond a predetermined number or range of base repeats that are typically present in a “normal” expanded repeat containing gene or RNA encoded by the gene. The presence or length of the repeat region may affect normal processing, function or activity of the RNA or encoded protein and cause a “repeat expansion” or “expanded repeat” disease or disorder. Expanded repeats may be unstable (dynamic) mutations that change size in successive generations. An expanded repeat may be a dinucleotide repeat, a trinucleotide repeat, a tetranucleotide repeat, a pentanucleotide repeat, a hexanucleotide repeat, etc. In some cases, a repeat is a CAG repeat or polyglutamine. An expanded repeat containing gene or RNA encoded by the expanded repeat containing gene may also be referred to as a “pathologic allele” or “pathogenic allele.” In some cases, a pathologic or pathogenic allele of a CAG repeat containing gene or RNA encoded by the gene has > 30 consecutive CAG repeats.

[0059] A “repeat expansion disease or disorder,” or “expanded repeat disease or disorder,” refers to a disease or disorder caused by the expansion of a base repeat sequence beyond a predetermined number or range of base repeats that are typically present in a “normal” expanded repeat containing gene or RNA encoded by the gene. A repeat expansion disease or disorder may manifest with markedly varied phenotypes depending on the size of the repeat expansion. Repeat expansion diseases or disorders are primarily neurodegenerative diseases. Some repeat expansion diseases are ophthalmologic diseases. In some cases, a repeat expansion disease or disorder is a polyglutamine disease.

[0060] As used herein, “neurodegenerative disease” or “neurodegenerative disorder” refers to diseases or disorders that exhibit neural cell death as a pathological state. A neurodegenerative diseaseAtty. Dkt: IRIS-002WO may exhibit chronic neurodegeneration, e.g., slow, progressive neural cell death over a period of several years, or acute neurodegeneration, e.g., sudden onset or neural cell death. Examples of chronic, neurodegenerative diseases include Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, spinocerebellar ataxia types 1-8 (SCA1-8), frontotemporal dementia (FTD), and amyotrophic lateral sclerosis (ALS). A neurodegenerative disease may exhibit death of mainly one type of neuron or of multiple types of neurons.

[0061] As used herein, “subject,” “patient,” and “individual” are used interchangeably herein and refer to living organisms (e.g., mammals) selected for treatment or therapy. Examples of subjects include human and non-human mammals, such as primates (monkey, chimpanzee), cows, horses, sheep, dogs, cats, rats, mice, guinea pigs, pigs, and transgenic species thereof.

[0062] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0063] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0064] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.

[0065] It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a small binding RNA (sbRNA)” includes a plurality of such sbRNAs and reference to “the target nucleic acid” includes reference to one or more target nucleic acids and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of suchAtty. Dkt: IRIS-002WO exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[0066] The use of the terms “a,” “an,” and “the,” and similar referents in the context of describing the disclosure (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if the range 10-15 is disclosed, then 11, 12, 13, and 14 are also disclosed. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the embodiments of the disclosure and does not pose a limitation on the scope of the disclosure unless otherwise claimed.

[0067] As used herein, the term “about” used in connection with an amount indicates that the amount can vary by 10% of the stated amount. For example, “about 100” means an amount of from 90-110. Where about is used in the context of a range, the “about” used in reference to the lower amount of the range means that the lower amount includes an amount that is 10% lower than the lower amount of the range, and “about” used in reference to the higher amount of the range means that the higher amount includes an amount 10% higher than the higher amount of the range. For example, from about 100 to about 1000 means that the range extends from 90 to 1100.

[0068] The term “and / or” as used herein a phrase such as “A and / or B” is intended to include both A and B; A or B; A (alone); and B (alone). Likewise, the term “and / or” as used herein a phrase such as “A, B, and / or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0069] It is understood that aspects and embodiments of the present disclosure described herein include “comprising,” “consisting,” and “consisting essentially of” aspects and embodiments.

[0070] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specificallyAtty. Dkt: IRIS-002WO embraced by the present invention and are disclosed herein just as if each and every such sub- combination was individually and explicitly disclosed herein.

[0071] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed. DETAILED DESCRIPTION

[0072] Repeat expansion disorders present significant obstacles for selective inhibition of disease allele versus normal allele. The present disclosure provides double-stranded RNAs that can exploit differences in the number of repeats and achieve allele-selective inhibition of repeat-containing proteins. The double-stranded target RNAs target the repeat region of a repeat-containing target RNA (e.g., an mRNA or a pre-mRNA), and contain from 2 to 5 (e.g., 2, 3, 4, or 5) mismatches relative to the repeat region in the target RNA. The mismatches enhance the ability of the double-stranded RNAs to selectively inhibit mutant protein expression versus wild-type.

[0073] The present disclosure provides a double-stranded RNA comprising: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region; and ii) at least a second mismatch to the target CAG repeat region. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of the double- stranded RNA, where the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell. The present disclosure provides a recombinant nucleic acid comprising: a) a double- stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising a nucleotide sequence encoding such a recombinant nucleic acid. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising such a DNA molecule. The present disclosure provides viral and non-viral delivery vehicles comprising a recombinant expression vector of the present disclosure; and pharmaceutical compositions comprising such delivery vehicles. The present disclosure provides methods for selectively reducing translation of a disease-associated CAG repeat-containing RNA. DOUBLE-STRANDED RNAS

[0074] The present disclosure provides a double-stranded RNA (dsRNA) comprising: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat containing RNA; and b) a second strandAtty. Dkt: IRIS-002WO that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region; and ii) at least a second mismatch to the target CAG repeat region. A dsRNA of the present disclosure functions as an artificial microRNAs to modulate expression of a target RNA (e.g., mRNA or pre-mRNA) transcript. Double stranded RNAs include precursor molecules, which are processed inside the cell prior to modulation. Double stranded RNAs may be encoded in a plasmid, vector, genome, or other nucleic acid expression vector for delivery to a cell.

[0075] In some cases, a dsRNA comprises, from 5’ to 3’: (a) a 5’ leader sequence; (b) a 5’ stem comprising or substantially comprising a passenger sequence or a guide sequence; (c) a terminal loop; (d) a 3’ stem comprising or substantially comprising: (i) a guide sequence if the 5’ stem comprises or substantially comprises the passenger sequence; or (ii) a passenger sequence if the 5’ stem comprises or substantially comprises the guide sequence; and (e) a 3’ trailer sequence; wherein the guide sequence targets a CAG repeat region of a CAG repeat containing mRNA or pre-mRNA and comprises from 2 to 5 base mismatches relative to the CAG repeat region, where at least one of the from 2 to 5 base mismatches is within nucleotides 8-11 of the guide sequence.

[0076] In some cases, the first strand of the dsRNA comprises only 2 mismatches to the target CAG repeat region of a CAG repeat-containing target RNA. In some cases, the first strand of the dsRNA comprises only 3 mismatches to the target CAG repeat region of a CAG repeat-containing target RNA. In some cases, the first strand of the dsRNA comprises only 4 mismatches to the target CAG repeat region of a CAG repeat-containing target RNA. In some cases, the second mismatch is within nucleotides 17-21 of the guide sequence. In some cases, the second mismatch is within nucleotides 9-16, and the third and fourth mismatches are within nucleotides 17-21 of the guide sequence. In some cases, the second and third mismatches are within nucleotides 9-16, and the fourth mismatch is within nucleotides 17-21 of the guide sequence.

[0077] For the numbering of positions of the mismatches, see, e.g., FIG.3 and FIG.4.

[0078] In some cases, the double stranded RNA refers to a single RNA oligonucleotide compound having at least partial self-complementarity to form a stable self-duplex. Unless otherwise specified, numbering of the nucleotide positions in the double-stranded RNA counts from the 5’ to 3’ direction on the single RNA strand. Similarly, unless otherwise specified, nucleotide sequence is read from the 5’ to 3’ direction on the single RNA strand.

[0079] An artificial double stranded RNA of the present disclosure comprises a 5’ leader, also referred to as a 5’ flanking, sequence. The 5’ leader sequence may be derived from or obtained in whole or in part from wild type microRNA sequence or be in whole or in part artificial. In some cases, 5’ leader sequence is derived from or obtained in whole or in part from the flanking sequence of a wild type pre- miRNA scaffold or pri-miRNA scaffold.Atty. Dkt: IRIS-002WO

[0080] The 5’ leader sequence is contiguously linked to the 5’ stem comprising or substantially comprising a passenger or a guide sequence. The 5’ leader sequence may be of any length. In some cases, the 5’ leader sequence is about 1 nucleotide to about 1,000 nucleotides in length, about 1 nucleotide to about 900 nucleotides, about 1 nucleotide to about 800 nucleotides, about 1 nucleotide to about 700 nucleotides, about 1 nucleotide to about 600 nucleotides, about 1 nucleotide to about 500 nucleotides, 1 nucleotide to about 400 nucleotides, about 1 nucleotide to about 300 nucleotides, about 1 nucleotide to about 200 nucleotides, about 1 nucleotide to about 100 nucleotides, about 1 nucleotide to about 75 nucleotides about 1 nucleotide to about 50 nucleotides, about 1 nucleotide to about 25 nucleotides, about 1 nucleotide to about 20 nucleotides, about 1 nucleotide to about 15 nucleotides, or about 1 nucleotide to about 10 nucleotides in length..

[0081] In some cases, the 5’ leader comprises a 5’ bulge sequence. As used herein, the term “bulge sequence” refers to a region of nucleic acid that is non-complementary to the nucleic acid opposite it in a duplex. For example, a duplex may contain a region of complementary nucleic acids, then a region of non-complementary nucleic acids, followed by a second region of complementary nucleic acids. The regions of complementary nucleic acids will bind to each other, whereas the central non-complementary region will not bind, thereby forming a “bulge.” In some cases, the two strands of nucleic acid positioned between the two complementary regions will be of different lengths, thereby forming a “bulge.”

[0082] An artificial dsRNA of the present disclosure comprises a 3’ trailer, also referred to as a 3’ flanking sequence. The 3’ trailer sequence may be derived from or obtained in whole or in part from wild type microRNA sequence or be in whole or in part artificial. In some cases, the 3’ trailer sequence is derived from or obtained in whole or in part from the flanking sequence of a wild type pre-miRNA scaffold or pri-miRNA scaffold.

[0083] The 3’ trailer sequence is contiguously linked to the 3’ stem comprising or substantially comprising a guide or a passenger sequence. The 3’ trailer sequence may be of any length. In some cases, the 3’ trailer sequence is about 1 nucleotide to about 1,000 nucleotides in length, about 1 nucleotide to about 900 nucleotides, about 1 nucleotide to about 800 nucleotides, about 1 nucleotide to about 700 nucleotides, about 1 nucleotide to about 600 nucleotides, about 1 nucleotide to about 500 nucleotides, 1 nucleotide to about 400 nucleotides, about 1 nucleotide to about 300 nucleotides, about 1 nucleotide to about 200 nucleotides, about 1 nucleotide to about 100 nucleotides, about 1 nucleotide to about 75 nucleotides about 1 nucleotide to about 50 nucleotides, about 1 nucleotide to about 25 nucleotides, about 1 nucleotide to about 20 nucleotides, about 1 nucleotide to about 15 nucleotides, or about 1 nucleotide to about 10 nucleotides in length. In some cases, the 3’ trailer comprises a 3’ bulge sequence.Atty. Dkt: IRIS-002WO

[0084] In some cases, the 3’ trailer comprises a polyU (polyuridine) tail. In some cases, the 3’ trailer comprises 3-6 uridines, e.g., 3 uridines, 4 uridines, 5 uridines or 6 uridines. In some cases, the polyU tail is immediately adjacent to the guide sequence or passenger sequence in the 3’ stem. In some cases, artificial double stranded RNA having a 3’ trailer comprising a polyU tail is expressed using a Pol III promoter.

[0085] In some cases, the 3’ trailer comprises a polyadenylation (pA) signal sequence. Suitable polyadenylation signals include, but are not limited to, an SV40 late pA signal, a BGH pA signal, and the like. In some cases, an artificial double stranded RNA having a 3’ trailer comprising a pA signal sequence is expressed using a Pol II promoter.

[0086] In some cases, the 5’ leader sequence and 3’ trailer sequence have the same number of nucleotides. In some cases, the 5’ leader sequence and 3’ trailer sequence have different lengths.

[0087] In some cases, the 5’ leader sequence and 3’ trailer sequence are obtained or derived from, in whole or in part, the same miRNA scaffold, for example the same wild type pre-miRNA scaffold or the same pri-miRNA scaffold. In some cases, the 5’ leader sequence and 3’ trailer sequence are both obtained from or derived from, in whole or in part, the miR-33 scaffold. In some cases, the 5’ leader sequence and 3’ trailer sequence are both obtained or derived from, in whole or in part, the pri-miR-33 scaffold. In some cases, the 5’ leader sequence and 3’ trailer sequence are both obtained or derived from, in whole or part, the pre-miR-33 scaffold. In some cases, the 5’ leader sequence and 3’ trailer sequence are selected from those presented in Table 2.

[0088] In some cases, the 5’ leader sequence is not complementary to the 3’ trailer sequence. In some cases, the 5’ leader sequence is partially complementary to the 3’ trailer sequence. In some cases, the 5’ leader sequence contains one, two, or more C mismatches to the uridine(s) in the polyU tail in the 3’ trailer sequence (or C-T mismatch for a DNA sequence encoding the double stranded RNA).

[0089] In some cases, the 5’ leader and 3’ trailer sequences contain sequences that allow for recognition and cleavage by Drosha. The canonical pathway of miRNA biogenesis in mammals is initiated by the Drosha–DGCR8 (DiGeorge syndrome critical region gene 8) complex (the Microprocessor), which processes long primary miRNAs (pri-miRNAs) into ∼60-nt pre-miRNAs for further processing by Dicer into a duplex ∼22 nt long. In some cases, primary miRNA sequences used as, or as part of the 5’ leader sequence and / or 3’ trailer sequence may direct Drosha cleavage of the double-stranded RNA. Methods of using precursor miRNAs as scaffolds for selected expression of guide:passenger duplexes are provided in U.S. Patent Publication No.2008 / 0226553 and Liu et al. (2008) Nucleic Acids Res.36:2811- 24, each of which is incorporated by reference in its entirety.Atty. Dkt: IRIS-002WO

[0090] In some cases, the artificial double-stranded RNA is processed by a Drosha independent / Dicer dependent pathway. In some cases, splicing, 3′-5′ exoribonuclease, or pol III termination may substitute for Drosha cleavage.

[0091] In some cases, the artificial double-stranded RNA is processed by a Drosha dependent / Dicer independent pathway. An example of Drosha dependent / Dicer independent pathway processing is provided by pri-miR-451, which is processed by Drosha, resulting in a pre-miR-451, which is then cleaved by Ago2 (argonaute 2), ac-pre-mir-451, which is further resected by an as yet unknown mechanism to generate mature miR-451. In some cases, the first 5’ nucleotide in a guide sequence is replaced with a U or an A in order to promote binding by Argonaute.

[0092] In some cases, the 5’ leader sequence and / or 3’ trailer sequence comprises or consists of a nucleotide sequence set forth in Table 2. In some cases, an artificial double-stranded RNA comprises a 5’ leader sequence comprising or consisting of CCGG and a 3’ trailer sequence comprising or consisting of UUUUUG. In some cases, an artificial double-stranded RNA comprises a 5’ leader sequence comprising or consisting of CC and a 3’ trailer sequence comprising or consisting of UUUUUG. In some cases, an artificial double-stranded RNA comprises a 5’ leader sequence comprising or consisting of GCUG and a 3’ trailer sequence comprising or consisting of GAUUUUUG. In some cases, an artificial double-stranded RNA comprises a 5’ leader sequence comprising or consisting of ugcacaccuccuggcgggcagcucug (SEQ ID NO:15) and a 3’ trailer sequence comprising or consisting of ggaggccugcccugacugcccacuuuuug (SEQ ID NO:17). Table 2: Examples of 5’ Leader and 3’ Trailer Sequences 5’ Leader Sequences Sequence SEQ ID NO:Atty. Dkt: IRIS-002WO miR-33 partial (DNA) ga tttttg NA miR-33 partial (RNA) ga uuuuug NA, p p g sequence, also sometimes referred to as sense sequence. The passenger sequence can be substantially identical to the target mRNA transcript. The passenger sequence can have 1, 2, 3, 4, or 5 mismatches with the target mRNA transcript. The passenger sequence may be about 15-30 nucleotides in length, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some cases, the passenger sequence may be about 19-24 nucleotides in length.

[0094] In some cases, the 3’ stem (or 3’ arm) of the double stranded RNA comprises a guide sequence, also sometimes referred to as antisense sequence. The guide sequence has complementarity to the target mRNA transcript. The guide strand may be about 15-30 nucleotides in length, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some cases, the guide sequence may be about 19-24 nucleotides in length.

[0095] In some cases, the 5’ stem comprises the guide sequence while the 3’ stem comprises the passenger sequence of the double stranded RNA.

[0096] The guide sequence and passenger sequence have sufficient complementarity to form a double stranded siRNA molecule upon processing in a host cell, which acts as a suitable substrate for the RNA interference machinery such that the guide sequence derived from the 3’ stem (or 5’ stem) is recognized by the RISC complex and targets its specific mRNA transcript. In some cases, the guide sequence and passenger sequence have 100% complementarity. In some cases, the guide sequence and passenger sequence are substantially complementary to each other, e.g.., about 70%, 75%, 80%, 85%, 90%, 95%, or 99% complementary. In some cases, the passenger sequence may comprise one to ten or one to five base mismatches or bulges.

[0097] The guide sequence may comprise a seed sequence, which has perfect or near-perfect Watson- Crick complementarity to the target mRNA sequence, located at positions 1-7, 2-7, 1-8, or 2-8, of the guide sequence relative to the first 5’ nucleotide of the guide strand. The seed region is important for efficient gene silencing by double stranded RNAs.

[0098] The guide sequence targets a CAG repeat region of a CAG repeat containing mRNA and comprises 2-5 mismatches relative to the CAG repeat region, wherein the first base mismatch is locatedAtty. Dkt: IRIS-002WO within positions 8-11 of the guide sequence. A mismatch includes self-pairing nucleotides (A-A, U-U, T-T, C-C, and G-G), A and C pairing, C and U pairing, C and T pairing, T and G pairing, T and C pairing, and A and G pairing. In some cases, the mismatch comprises a purine mismatch, such as introducing an adenosine base into the guide strand.

[0099] In some cases, the first strand of the dsRNA comprises only 2 mismatches to the target CAG repeat region of a CAG repeat-containing target RNA. Examples of the positions of the first and second mismatches, where the first strand of the dsRNA comprises only 2 mismatches to the target CAG repeat region of a CAG repeat-containing target RNA, are depicted in FIG.6.

[0100] In some cases, the first strand of the dsRNA comprises only 3 mismatches to the target CAG repeat region of a CAG repeat-containing target RNA. Examples of the positions of the first, second, and third mismatches, where the first strand of the dsRNA comprises only 3 mismatches to the target CAG repeat region of a CAG repeat-containing target RNA, are depicted in FIG.6.

[0101] In some cases, the first strand of the dsRNA comprises only 4 mismatches to the target CAG repeat region of a CAG repeat-containing target RNA. Examples of the positions of the first, second, third, and fourth mismatches, where the first strand of the dsRNA comprises only 4 mismatches to the target CAG repeat region of a CAG repeat-containing target RNA, are depicted in FIG.6.

[0102] For the numbering of positions of the mismatches, see, e.g., FIG.3 and FIG.4.

[0103] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region; and ii) at least a second mismatch to the target CAG repeat region, wherein: 1) when the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)), the second mismatch is from is from 9 to 13 bases 3’ of the first mismatch; 2) when the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5), the second mismatch is from 8 to 12 bases 3’ of the first mismatch; 3) when the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or (UGCUGCUGCUGCUGCUGCUGCUGAtty. Dkt: IRIS-002WO (SEQ ID NO:5)), the second mismatch is from 7 to 11 bases 3’ of the first mismatch; and 4) when the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5)), the second mismatch is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand comprises no more than 2 mismatches with the target CAG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CAG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CAG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first strand of the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the second strand of the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the first strand and the second strand of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first strand and the second strand of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first strand and the second strand of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first strand and the second strand of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first strand and the second strand of the double-stranded RNA each have a length of 25 nucleotides. In some cases, the double-stranded RNA has a length of from 36 nucleotides to 80 nucleotides (e.g., from 36 nucleotides to 40 nucleotides, from 40 nucleotides to 50 nucleotides, from 50 nucleotides to 60 nucleotides, from 60 nucleotides to 70 nucleotides, or from 70 nucleotides to 80 nucleotides). In some cases, the first strand of a dsRNA comprises any one of the nucleotide sequences depicted in FIG.7, FIG.8A-8C, and FIG.9A-9L (e.g., where each “T” may be replaced with “U”), and has a length of 21 nucleotides. In some cases, the first strand of a dsRNA comprises any one of the “RNA guide strand sequence” nucleotide sequences depicted in FIG.10 (Table 3). In some cases, the first strand of a dsRNA comprises any one of the “miRNA guide” nucleotide sequences depicted in FIG. 12 (Table 5). In some cases, each mismatch is generated by substituting a nucleotide (e.g., a nucleotide present in CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), a nucleotide present in GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), or a nucleotide present inAtty. Dkt: IRIS-002WO UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)) with a different nucleotide. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0104] As depicted in FIG.3 and FIG. 4, and as set out in FIG.6 (Table 1), where the first mismatch is at position 8, and the second mismatch is within positions 17-21, the second mismatch is from 9 to 13 bases 3’ of the first mismatch. Where the first strand of a dsRNA comprises 2, 3, or 4 mismatches, the first mismatch is the 5’-most mismatch. First mismatch at position 8; 2 mismatches

[0105] As depicted in FIG.6 (Table 1), in some cases, a dsRNA of the present disclosure comprises a first strand having no more than 2 mismatches to a target CAG repeat region of a CAG repeat-containing RNA, where the first mismatch is at position 8 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch is within positions 17-21 (as depicted in FIG.3 and FIG.4).

[0106] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first and a second substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) and the second substitution generates the second mismatch and is from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first and a second substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and the second substitution generates the second mismatch and is from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first and a second substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and the second substitution generates the second mismatch and is from 9 to 13 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In someAtty. Dkt: IRIS-002WO cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. First mismatch at position 8; 3 mismatches

[0107] As depicted in FIG.6 (Table 1), in some cases, a dsRNA of the present disclosure comprises a first strand having no more than 3 mismatches to a target CAG repeat region of a CAG repeat-containing RNA, where the first mismatch is at position 8 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch is within positions 17-21 and the third mismatch is within positions 17- 21 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch is within positions 9-16 and the third mismatch is within positions 17-21.

[0108] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); and b) a second strand that hybridizes to the first strand, wherein the first strand comprises a second mismatch and a third mismatch to the target CAG repeat region, and wherein the second and third mismatches are from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the firstAtty. Dkt: IRIS-002WO substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 9 to 13 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double- stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.Atty. Dkt: IRIS-002WO

[0109] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); and b) a second strand that hybridizes to the first strand, wherein the first strand comprises a second mismatch and a third mismatch to the target CAG repeat region, where the second mismatch is from 1 to 8 bases 3’ of the first mismatch, and where the third mismatch is from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, where the second substitution is from 1 to 8 bases 3’ of the first mismatch, and where the third substitution is from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, where the second substitution is from 1 to 8 bases 3’ of the first mismatch, and where the third substitution is from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, where the second substitution is from 1 to 8 bases 3’ of the first mismatch, and where the third substitution is from 9 to 13 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches toAtty. Dkt: IRIS-002WO the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double- stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. First mismatch at position 8; 4 mismatches

[0110] As depicted in FIG.6 (Table 1), in some cases, a dsRNA of the present disclosure comprises a first strand having no more than 4 mismatches to a target CAG repeat region of a CAG repeat-containing RNA, where the first mismatch is at position 8 (as depicted in FIG.3 and FIG.4). In some cases, the second, third, and fourth mismatches are within positions 17-21 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch is within positions 9-16 and the third and fourth mismatches are within positions 17-21 (as depicted in FIG.3 and FIG.4). In some cases, the second and third mismatches are within positions 9-16 and the fourth mismatch is within positions 17-21.

[0111] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); and b) a second strand that hybridizes to the first strand, wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, and wherein the second, third, and fourth mismatches are from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second substitution, the third substitution, and the fourth substitution are from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequenceAtty. Dkt: IRIS-002WO GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second substitution, the third substitution, and the fourth substitution are from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second substitution, the third substitution, and the fourth substitution are from 9 to 13 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double- stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0112] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3Atty. Dkt: IRIS-002WO (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); and b) a second strand that hybridizes to the first strand, wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, wherein the second and third mismatches are from 1 to 8 bases 3’ of the first mismatch, and wherein the fourth mismatch is from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, wherein the second substitution and the third substitution are from 1 to 8 bases 3’ of the first mismatch, and wherein the fourth substitution is from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, wherein the second substitution and the third substitution are from 1 to 8 bases 3’ of the first mismatch, and wherein the fourth substitution is from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, wherein the second substitution and the third substitution are from 1 to 8 bases 3’ of the first mismatch, and wherein the fourth substitution is from 9 to 13 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, theAtty. Dkt: IRIS-002WO first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0113] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); and b) a second strand that hybridizes to the first strand, wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, wherein the second mismatch is from 1 to 8 bases 3’ of the first mismatch, and wherein the third and fourth mismatches are from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, wherein the second substitution is from 1 to 8 bases 3’ of the first mismatch, and wherein the third and fourth substitutions are from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, wherein the second substitution is from 1 to 8 bases 3’ of the first mismatch, and wherein the third and fourth substitutions are from 9 to 13 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering ofAtty. Dkt: IRIS-002WO UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, wherein the second substitution is from 1 to 8 bases 3’ of the first mismatch, and wherein the third and fourth substitutions are from 9 to 13 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand In some cases, the first and second strands of the double- stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. First mismatch at position 9; 2 mismatches

[0114] As depicted in FIG.6 (Table 1), in some cases, a dsRNA of the present disclosure comprises a first strand having no more than 2 mismatches to a target CAG repeat region of a CAG repeat-containing RNA, where the first mismatch is at position 9 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch is within positions 17-21 (as depicted in FIG.3 and FIG.4).

[0115] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch to the target CAGAtty. Dkt: IRIS-002WO repeat region, wherein the second mismatch is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first and a second substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) and the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first and a second substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first and a second substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.Atty. Dkt: IRIS-002WO First mismatch at position 9; 3 mismatches

[0116] As depicted in FIG.6 (Table 1), in some cases, a dsRNA of the present disclosure comprises a first strand having no more than 3 mismatches to a target CAG repeat region of a CAG repeat-containing RNA, where the first mismatch is at position 9 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch and the third mismatch are within positions 17-21 (as depicted in FIG. 3 and FIG.4). In some cases, the second mismatch is within positions 10-16 and the third mismatch is within positions 17-21.

[0117] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch and a third mismatch to the target CAG repeat region, wherein the second mismatch is from 8 to 12 bases 3’ of the first mismatch, and wherein the third mismatch is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strandAtty. Dkt: IRIS-002WO comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0118] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch and a third mismatch to the target CAG repeat region, wherein the second mismatch is from 1 to 7 bases 3’ of the first mismatch, and wherein the third mismatch is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 1 to 7 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 1 to 7 bases 3’ of the first mismatch, and wherein the third substitutionAtty. Dkt: IRIS-002WO generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 1 to 7 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. First mismatch at position 9; 4 mismatches

[0119] As depicted in FIG.6 (Table 1), in some cases, a dsRNA of the present disclosure comprises a first strand having no more than 4 mismatches to a target CAG repeat region of a CAG repeat-containing RNA, where the first mismatch is at position 9 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch, the third mismatch, and the fourth mismatch are within positions 17- 21 (as depicted in FIG.3 and FIG.4). In some cases, the second and third mismatches are within positions 10-16 and the fourth mismatch is within positions 17-21. In some cases, the second mismatch is within positions 10-16 and the third and fourth mismatches are within positions 17-21.

[0120] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a secondAtty. Dkt: IRIS-002WO strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, wherein the second mismatch is from 8 to 12 bases 3’ of the first mismatch, wherein the third mismatch is from 8 to 12 bases 3’ of the first mismatch, and wherein the fourth mismatch is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third substitution, and a fourth substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand.Atty. Dkt: IRIS-002WO In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0121] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, wherein the second mismatch is from 1 to 7 bases 3’ of the first mismatch, wherein the third mismatch is from 1 to 7 bases 3’ of the first mismatch, and wherein the fourth mismatch is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 1 to 7 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 1 to 7 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 1 to 7 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 1 to 7 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 8 to 12Atty. Dkt: IRIS-002WO bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third substitution, and a fourth substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 1 to 7 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 1 to 7 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double- stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0122] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, wherein the second mismatch is from 1 to 7 bases 3’ of the first mismatch, wherein the third mismatch is from 8 to 12 bases 3’ of the first mismatch, and wherein the fourth mismatch is from 8 to 12 bases 3’ of the first mismatch. In some cases, the firstAtty. Dkt: IRIS-002WO strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 1 to 7 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 1 to 7 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third substitution, and a fourth substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 1 to 7 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 8 to 12 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNAAtty. Dkt: IRIS-002WO each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. First mismatch at position 10; 2 mismatches

[0123] As depicted in FIG.6 (Table 1), in some cases, a dsRNA of the present disclosure comprises a first strand having no more than 2 mismatches to a target CAG repeat region of a CAG repeat-containing RNA, where the first mismatch is at position 10 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch is within positions 17-21 (as depicted in FIG.3 and FIG.4).

[0124] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first and a second substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) and the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first and a second substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first and a second substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch toAtty. Dkt: IRIS-002WO the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. First mismatch at position 10; 3 mismatches

[0125] As depicted in FIG.6 (Table 1), in some cases, a dsRNA of the present disclosure comprises a first strand having no more than 3 mismatches to a target CAG repeat region of a CAG repeat-containing RNA, where the first mismatch is at position 10 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch and the third mismatch are within positions 17-21 (as depicted in FIG. 3 and FIG.4). In some cases, the second mismatch is within positions 11-16 and the third mismatch is within positions 17-21.

[0126] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch and a third mismatch to the target CAG repeat region, wherein the second mismatch is from 7 to 11 bases 3’ of the first mismatch, and wherein the third mismatch is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and isAtty. Dkt: IRIS-002WO from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0127] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4Atty. Dkt: IRIS-002WO (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch and a third mismatch to the target CAG repeat region, wherein the second mismatch is from 1 to 6 bases 3’ of the first mismatch, and wherein the third mismatch is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 1 to 6 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 1 to 6 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 1 to 6 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a lengthAtty. Dkt: IRIS-002WO of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. First mismatch at position 10; 4 mismatches

[0128] As depicted in FIG.6 (Table 1), in some cases, a dsRNA of the present disclosure comprises a first strand having no more than 4 mismatches to a target CAG repeat region of a CAG repeat-containing RNA, where the first mismatch is at position 10 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch, the third mismatch, and the fourth mismatch are within positions 17- 21 (as depicted in FIG.3 and FIG.4). In some cases, the second and third mismatches are within positions 11-16 and the fourth mismatch is within positions 17-21. In some cases, the second mismatch is within positions 11-16 and the third and fourth mismatches are within positions 17-21.

[0129] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, wherein the second mismatch is from 7 to 11 bases 3’ of the first mismatch, wherein the third mismatch is from 7 to 11 bases 3’ of the first mismatch, and wherein the fourth mismatch is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 7Atty. Dkt: IRIS-002WO to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third substitution, and a fourth substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0130] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, wherein the second mismatch is from 1 to 6 bases 3’ of the first mismatch, wherein the third mismatch is from 1 to 6 bases 3’ of the first mismatch,Atty. Dkt: IRIS-002WO and wherein the fourth mismatch is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 1 to 6 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 1 to 6 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 1 to 6 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 1 to 6 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third substitution, and a fourth substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 1 to 6 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 1 to 6 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have aAtty. Dkt: IRIS-002WO length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0131] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, wherein the second mismatch is from 1 to 6 bases 3’ of the first mismatch, wherein the third mismatch is from 7 to 11 bases 3’ of the first mismatch, and wherein the fourth mismatch is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 1 to 6 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 1 to 6 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third substitution, and a fourth substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 1 to 6 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 7 to 11 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 7 to 11Atty. Dkt: IRIS-002WO bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. First mismatch at position 11; 2 mismatches

[0132] As depicted in FIG.6 (Table 1), in some cases, a dsRNA of the present disclosure comprises a first strand having no more than 2 mismatches to a target CAG repeat region of a CAG repeat-containing RNA, where the first mismatch is at position 11 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch is within positions 17-21 (as depicted in FIG.3 and FIG.4).

[0133] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first and a second substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ IDAtty. Dkt: IRIS-002WO NO:1) and the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first and a second substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first and a second substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. First mismatch at position 11; 3 mismatches

[0134] As depicted in FIG.6 (Table 1), in some cases, a dsRNA of the present disclosure comprises a first strand having no more than 3 mismatches to a target CAG repeat region of a CAG repeat-containing RNA, where the first mismatch is at position 11 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch and the third mismatch are within positions 17-21 (as depicted in FIG.Atty. Dkt: IRIS-002WO 3 and FIG.4). In some cases, the second mismatch is within positions 12-16 and the third mismatch is within positions 17-21.

[0135] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch and a third mismatch to the target CAG repeat region, wherein the second mismatch is from 6 to 10 bases 3’ of the first mismatch, and wherein the third mismatch is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases,Atty. Dkt: IRIS-002WO the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0136] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch and a third mismatch to the target CAG repeat region, wherein the second mismatch is from 1 to 5 bases 3’ of the first mismatch, and wherein the third mismatch is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 1 to 5 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 1 to 5 bases 3’ of the first mismatch, and wherein the third substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, and a third substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 1 to 5 bases 3’ of theAtty. Dkt: IRIS-002WO first mismatch, and wherein the third substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. First mismatch at position 11; 4 mismatches

[0137] As depicted in FIG.6 (Table 1), in some cases, a dsRNA of the present disclosure comprises a first strand having no more than 4 mismatches to a target CAG repeat region of a CAG repeat-containing RNA, where the first mismatch is at position 11 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch, the third mismatch, and the fourth are within positions 17-21 (as depicted in FIG.3 and FIG.4). In some cases, the second mismatch and the third mismatch are within positions 12-16 and the fourth mismatch is within positions 17-21. In some cases, the second mismatch is within positions 12-16 and the third mismatch and the fourth mismatch are within positions 17-21.

[0138] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch, a third mismatch,Atty. Dkt: IRIS-002WO and a fourth mismatch to the target CAG repeat region, wherein the second mismatch is from 6 to 10 bases 3’ of the first mismatch, wherein the third mismatch is from 6 to 10 bases 3’ of the first mismatch, and wherein the fourth mismatch is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third substitution, and a fourth of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double-stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a lengthAtty. Dkt: IRIS-002WO of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0139] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, wherein the second mismatch is from 1 to 5 bases 3’ of the first mismatch, wherein the third mismatch is from 1 to 5 bases 3’ of the first mismatch, and wherein the fourth mismatch is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 1 to 5 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 1 to 5 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third substitution, and a fourth of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 1 to 5 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 1 to 5 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 1 to 5 bases 3’ of the first mismatch, wherein the thirdAtty. Dkt: IRIS-002WO substitution generates the third mismatch and is from 1 to 5 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double- stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0140] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:4 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), or SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:5); and ii) a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, wherein the second mismatch is from 1 to 5 bases 3’ of the first mismatch, wherein the third mismatch is from 6 to 10 bases 3’ of the first mismatch, and wherein the fourth mismatch is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and is from 1 to 5 basesAtty. Dkt: IRIS-002WO 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third substitution, and a fourth of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and is from 1 to 5 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the first strand is a variant comprising a first, a second, a third, and a fourth substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and is from 1 to 5 bases 3’ of the first mismatch, wherein the third substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch, and wherein the fourth substitution generates the third mismatch and is from 6 to 10 bases 3’ of the first mismatch. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the first and second strands of the double- stranded RNA each have a length of from 18 nucleotides to 25 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 20 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 21 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 22 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 23 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 24 nucleotides. In some cases, the first and second strands of the double-stranded RNA each have a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.Atty. Dkt: IRIS-002WO Target nucleic acids

[0141] A double stranded RNA of the present disclosure may be targeted to any gene or nucleic acid construct containing the targeted repeat region. In some cases, genes (DNA or mRNA) that encode human or primate proteins are targeted. In some cases, non-coding genes are targeted. In some cases, coding regions of a gene are targeted. In some cases, non-coding regions of a gene are targeted. In some cases, a target CAG repeat region is present in a target CAG repeat containing RNA. In some cases, a target CAG repeat region is present in a target CAG repeat containing mRNA. In some cases, a target CAG repeat region is present in a target CAG repeat containing pre-mRNA.

[0142] In some cases, double stranded RNAs of the present disclosure target CAG-repeat containing (polyglutamine) genes. In some cases, the CAG repeat containing gene is transcribed from one of the following genes: HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, and MAB21L1. Expansion of the CAG-repeat is associated with a number of dominant, genetic disorders referred to as polyglutamine (polyQ) diseases. While CAG-repeat containing proteins are ubiquitously expressed throughout the body, the pathology of polyglutamine diseases primarily appears in, but is not limited to, neuronal tissue. Thus, as used herein, the term polyglutamine disease refers to any disease or disorder associated with CAG-repeat expansion, including, but not limited to neurodegenerative diseases.

[0143] Huntingtin (HTT), also known as interesting transcript 15 (IT15), refers to a gene encoding huntingtin protein. The exact function of huntingtin is unknown but is involved in axonal transport. An example of a huntingtin transcript sequence is provided by NCBI Reference Sequence NM_002111.8 (SEQ ID NO:24). Typically, the polyglutamine tract of huntingtin has 10-35 CAG repeats. Expansion of the polyglutamine tract to 36 to more than 120 CAG repeats causes Huntington’s disease. Early signs and symptoms can include irritability, depression, small involuntary movements, poor coordination, and trouble learning new information or making decisions. Many people with Huntington disease develop involuntary jerking or twitching movements known as chorea. As the disease progresses, these movements become more pronounced. Affected individuals may have trouble walking, speaking, and swallowing. People with this disorder also experience changes in personality and a decline in thinking and reasoning abilities.

[0144] Ataxin 1 (ATXN1), which is associated with spinocerebellar ataxia type 1 (SCA1), refers to a gene encoding a polyglutamine containing protein expressed primarily in the nucleus where it binds chromatin and functions as a transcriptional repressor. An example of a ATXN1 transcript sequence is provided by NCBI Reference Sequence NM_001128164.2 (SEQ ID NO:25). Mutant forms of ataxin-1 containing expansion of the polyglutamine tract to typically about 40-83 repeats cause the movement disorder spinocerebellar ataxia type 1 (SCA1) through a toxic gain-of-function mechanism in theAtty. Dkt: IRIS-002WO cerebellum. The cerebellar dysfunction is progressive and permanent. People with this condition initially experience problems with coordination and balance (ataxia). Other signs and symptoms of SCA1 include speech and swallowing difficulties, muscle stiffness (spasticity), and weakness in the muscles that control eye movement (ophthalmoplegia). Eye muscle weakness leads to rapid, involuntary eye movements (nystagmus). Individuals with SCA1 may have difficulty processing, learning, and remembering information (cognitive impairment). Over time, individuals with SCA1 may develop numbness, tingling, or pain in the arms and legs (sensory neuropathy); uncontrolled muscle tensing (dystonia); muscle wasting (atrophy); and muscle twitches (fasciculations). Rarely, rigidity, tremors, and involuntary jerking movements (chorea) have been reported in people who have been affected for many years.

[0145] Ataxin 2 (ATXN2), which is associated with spinocerebellar ataxia type 2 (SCA2), refers to a gene encoding a polyglutamine containing, RNA-binding protein that targets cis-regulatory elements in 3' UTRs to stabilize a subset of mRNAs and increase protein expression. An example of an ATXN2 transcript sequence is provided by NCBI Reference Sequence: NM_001372574.1 (SEQ ID NO:26). Polyglutamine repeat expansion in ATXN2 (e.g., typically ~33 or more repeats) can cause signs and symptoms of spinocerebellar ataxia type 2 (SCA2). People with SCA2 initially experience problems with coordination and balance (ataxia). Other early signs and symptoms of SCA2 include additional movement problems, speech and swallowing difficulties, and weakness in the muscles that control eye movement (ophthalmoplegia). Eye muscle weakness leads to involuntary back-and-forth eye movements (nystagmus) and a decreased ability to make rapid eye movements (saccadic slowing). Over time, individuals with SCA2 may develop loss of sensation and weakness in the limbs (peripheral neuropathy), muscle wasting (atrophy), uncontrolled muscle tensing (dystonia), and involuntary jerking movements (chorea). Some people with SCA2 develop a group of movement abnormalities known as parkinsonism, which includes unusually slow movement (bradykinesia), involuntary trembling (tremor), and muscle stiffness (rigidity). Individuals with SCA2 may have problems with short term memory, planning, and problem solving, or experience an overall decline in intellectual function (dementia). Intermediate polyglutamine expansion (27-33 CAG repeats) in ATXN2 also increases the risk of amyotrophic lateral sclerosis (ALS). ALS is a neurodegenerative neuromuscular disease that results in the progressive loss of motor neurons that control voluntary muscles. Early symptoms of ALS include stiff muscles, muscle twitches, and gradual increasing weakness and muscle wasting. Limb-onset ALS begins with weakness in the arms or legs, while bulbar-onset ALS begins with difficulty speaking or swallowing. Half of the people with ALS develop at least mild difficulties with thinking and behavior, and about 15% develop frontotemporal dementia. Most people experience pain. Motor neuron loss continues until the ability to eat, speak, move, and finally the ability to breathe is lost. ALS eventually causes paralysis and early death, usually from respiratory failure.Atty. Dkt: IRIS-002WO

[0146] Ataxin 3 (ATXN3), which is associated with spinocerebellar ataxia type 3 (SCA3), refers to a gene encoding a polyglutamine containing, deubiquitinating enzyme. An example of an ATXN3 transcript sequence is provided by NCBI Reference Sequence NM_004993.6 (SEQ ID NO:27). Expansion of the polyglutamine repeat from the normal 13-36 CAG repeats to more than 50 CAG repeats causes Machado-Joseph disease (MJD), also known as Machado–Joseph Azorean disease, Machado's disease, Joseph's disease or spinocerebellar ataxia type 3 (SCA3). People with this condition initially experience problems with coordination and balance (ataxia). Other early signs and symptoms of SCA3 include speech difficulties, uncontrolled muscle tensing (dystonia), muscle stiffness (spasticity), rigidity, tremors, bulging eyes, and double vision. People with this condition may experience sleep disorders such as restless leg syndrome or REM sleep behavior disorder. Over time, individuals with SCA3 may develop loss of sensation and weakness in the limbs (peripheral neuropathy), muscle cramps, muscle twitches (fasciculations), and swallowing difficulties. Individuals with SCA3 may have problems with memory, planning, and problem solving.

[0147] Calcium voltage-gated channel subunit alpha1 A (CACNA1A), which is associated with spinocerebellar ataxia type 6 (SCA6), encodes the α1A pore-forming subunit of the neuronal calcium channel P / Q. An example of a CACNA1A transcript sequence is provided by NCBI reference sequence NM_000068.4 (SEQ ID NO:28). Expansion of the polyglutamine tract in the CACNA1A gene to typically 19-33 repeats causes spinocerebellar ataxia type 6 (SCA6). People with this condition initially experience problems with coordination and balance (ataxia). Other early signs and symptoms of SCA6 include speech difficulties, involuntary eye movements (nystagmus), and double vision. Over time, individuals with SCA6 may develop loss of coordination in their arms, tremors, and uncontrolled muscle tensing (dystonia).

[0148] Ataxin 7 (ATXN7), which is associated with spinocerebellar ataxia type 7 (SCA7), encodes a polyglutamine containing protein that is an integral subunit of GCN5 (general control of amino acid synthesis-5; KAT2A)-containing SAGA family of histone acetyltransferase (HAT) complexes. An example of an ATXN7 transcript sequence is provided by NCBI Reference Sequence NM_001377405.1 (SEQ ID NO:29). Polyglutamine expansion in ATXN7 causes spinocerebellar ataxia type 7 (SCA7), which is characterized by progressive cerebellar ataxia, retinal degeneration or blindness due to cone-rod dystrophy, and mild changes in sensation or reflexes. Later symptoms include loss of motor control, unclear speech (dysarthria), and difficulty swallowing (dysphagia).

[0149] Protein Phosphatase 2 Regulatory Subunit Bbeta (PPP2R2B), which is associated with spinocerebellar ataxia type 12 (SCA12), encodes the B regulatory subunit of Protein Phosphatase 2, a serine / threonine phosphatase. An example of a PPP2R2B transcript sequence is provided by NCBI Reference Sequence NM_181674.3 (SEQ ID NO:30). Expansion of the polyglutamine repeat from the typically normal range of about 7-28 to about 55-78 causes spinocerebellar ataxia type 12 (SCA12). TheAtty. Dkt: IRIS-002WO age of onset of symptoms of SCA12 ranges from 8 to 55 years, though most commonly occurs in the fourth decade. Symptoms typically begin with tremors and progress to cerebellar ataxia. Signs of dementia have also been reported as associated with SCA12.

[0150] TATA-Box Binding Protein (TBP), which is associated with spinocerebellar ataxia type 17 (SCA17), encodes the TATA-binding protein, a component of transcription factor IID (TFIID). An example of a TBP transcript sequence is provided by NCBI Reference Sequence NM_003194.5 (SEQ ID NO:31). TBP typically has 25-42 polyglutamine repeats, expansion to 45-66 repeats is associated with spinocerebellar ataxia type 17 (SCA17). People with this condition typically experience symptoms such as ataxia, dementia, and involuntary movements such as chorea and dystonia, rigidity, and pyramidal signs such as spasticity, weakness, slowing of rapid alternating movements, and hyperreflexia.

[0151] Androgen Receptor (AR) encodes a steroid-hormone activated transcription factor. An example of an AR transcript sequence is provided by NCBI Reference Sequence NM_000044.6 (SEQ ID NO:32). Expansion of the polyglutamine repeats from the typically 9-34 repeats to 38-62 repeats causes spinal bulbar muscular atrophy (SBMA), also known as Kennedy's disease. SBMA is characterized by muscle weakness and atrophy that worsens over time, resulting in cramping and difficulty with walking, swallowing, and speech. SBMA may also result in gynecomastia and infertility.

[0152] Atrophin 1 (ATN1) encodes a protein that is hypothesized to be a transcriptional co- repressor that recruits Nuclear Receptor Subfamily 2 Group E Member 1 (NR2E1) to repress transcription. An example of an ATN1 transcript sequence is provided by NCBI Reference Sequence NM_001007026.2 (SEQ ID NO:33). Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder related to the expansion of the polyglutamine repeat in ATN1 from the typical 7-35 copies to 49-93 copies. When DRPLA manifests before about age 20 it is typically associated with myoclonus, ataxia, seizures, behavioral changes, and intellectual disability. When it manifests after about age 20 it is associated with ataxia, choreoathetosis, delusions, and dementia.

[0153] Myeloid / Lymphoid Or Mixed-Lineage Leukemia Translocated To Chromosome 3 (MLLT3), also known as AF-9, encodes a component of the super elongation complex (SEC), which is necessary to increase the catalytic rate of RNA polymerase II transcription. An example of a MLLT3 transcript sequence is provided by NCBI Reference Sequence NM_004529.4 (SEQ ID NO:34). MLLT3 includes an unstable polyglutamine repeat and genetic aberrations involving MLLT3 have been associated with leukemias and neuromotor development delay, cerebellar ataxia, and epilepsy.

[0154] Bone Morphogenic Protein 2 Inducible Kinase (BMP2K) encodes a protein related to skeletal development and patterning. An example of a BMP2K transcript sequence is provided by NCBI Reference Sequence NM_198892.2 (SEQ ID NO:35). BMP2K includes a polyglutamine repeat and is associated with myopia and cancer, specifically gene mis-regulation associated with cancer.Atty. Dkt: IRIS-002WO

[0155] THAP Domain Containing 11 (THAP11) encodes a transcriptional repressor associated with embryogenesis. An example of a THAP11 transcript sequence is provided by NCBI Reference Sequence NM_020457.3 (SEQ ID NO:36). THAP11 includes a polyglutamine repeat of typically about 29 copies, but ranges from 20 to over 40 copies. An increased number of polyglutamine repeats, for example 38 copies, is associated with neurodegenerative disease. Expansion of the polyglutamine in THAP11 is also associated with intracellular aggregation of THAP11, cellular toxicity, growth inhibition, G0 / G1 arrest, and inhibition of transcription activity.

[0156] Zinc Finger Homeobox 3 (ZFHX3) encodes a transcription factor that regulates myogenic and neuronal differentiation. It also functions as a tumor suppressor in several cancers and is associated with atrial fibrillation. An example of a ZFHX3 transcript sequence is provided by NCBI Reference Sequence NM_006885.4 (SEQ ID NO:37). ZFHX3 includes a polyglutamine repeat. Individuals with an expanded polyglutamine repeat, e.g. having 19 copies, is associated with coronary heart disease, hypertension, diabetes mellitus, or dyslipidemia as compared to those with fewer repeats, e.g.17 copies.

[0157] POU Class 3 Homeobox 2 (POU3F2) encodes a transcription factor that is related to neuronal differentiation. An example of a POU3F2 transcript sequence is provided by NCBI Reference Sequence NM_005604.4 (SEQ ID NO:38). POU3F2 includes a polyglutamine tract and is associated with bipolar disorder, obesity, developmental delay, and intellectual disability.

[0158] Mastermind Like Transcriptional Coactivator 2 (MAML2) encodes a transcriptional coactivator for NOTCH proteins and promotes β-catenin turnover. An example of a MAML2 transcript sequence is provided by NCBI Reference Sequence NM_032427.4 (SEQ ID NO:39). MAML2 includes a polyglutamine tract with observed variability and is associated with cancers such as mucoepidermoid carcinomas, hidradenoma, B cell-derived lymphomas, and chronic lymphocytic leukemia.

[0159] Mastermind Like Transcriptional Coactivator 3 (MAML3) encodes a transcriptional coactivator for NOTCH proteins. An example of a MAML3 transcript sequence is provided by NCBI Reference Sequence NM_018717.5 (SEQ ID NO:40). MAML3 includes a polyglutamine tract and is associated with cancers such as schneiderian carcinoma and ossifying fibromyxoid tumor.

[0160] SWI / SNF Related, Matrix Associated, Actin Dependent Regulator Of Chromatin, Subfamily A, Member 2 (SMARCA2) encodes a component of the SWI / SNF complex that is involved in transcriptional regulation by chromatin remodeling. SMARCA2 is also involved in neural development. An example of a SMARCA2 transcript sequence is provided by NCBI Reference Sequence NM_003070.5 (SEQ ID NO:41). SMARCA2 includes a polymorphic polyglutamine tract and is associated with conditions such as Nicolaides-Baraitser syndrome and blepharophimosis-impairedAtty. Dkt: IRIS-002WO intellectual development syndrome. The SMARCA2 gene is also located on a chromosomal region that is linked to schizophrenia and bipolar disorder.

[0161] Origin Recognition Complex Subunit 4 (ORC4) encodes a component of the six subunit origin recognition complex (ORC) that is necessary for the initiation of DNA replication. An example of an ORC4 transcript sequence is provided by NCBI Reference Sequence NM_001190879.3 (SEQ ID NO:42). ORC4 includes a region of polymorphic trinucleotide CAG repeats located upstream of the coding sequence and is associated with Meier-Gorlin syndrome 1 and Meier-Gorlin syndrome 2.

[0162] RUNX Family Transcription Factor 2 (RUNX2) encodes a nuclear protein involved in osteoblastic differentiation and skeletal morphogenesis. An example of a RUNX2 transcript sequence is provided by NCBI Reference Sequence NM_001024630.4 (SEQ ID NO:43). RUNX2 includes a polyglutamine tract and a polyalanine tract. Expansion of the polyglutamine tract from, e.g., typical 23 residues to, e.g., 27-30 residues causes cleidocranial dysplasia, decreased bone mineral density, and decreases RUNX2 transactivation capacity. Cleidocranial dysplasia (CCD) is a disorder affecting the skull, bones and teeth. Signs and symptoms include absent or underdeveloped collar bones, delayed closing of fontanels in the skull, dental abnormalities, short stature, decreased bone density, hearing loss, and other bone abnormalities.

[0163] Transcription Factor 4 (TCF4) encodes a protein that binds to the E box to initiate transcription and promote neuronal differentiation. TCF4 includes a CTG repeat sequence, which in healthy individuals is typically around 20 repeats. Expansions of the CTG repeat sequence beyond ~100 units is associated with Fuchs’ Endothelial Corneal Dystrophy (FECD). FECD is an ocular disease characterized by degeneration of corneal endothelial cells and progressive vision loss. The TCF4 gene can be transcribed in either the sense direction to produce a CUG expansion transcript or in the antisense direction to produce a CAG expansion transcript.

[0164] DM1 Protein Kinase (DMPK) is a serine / threonine kinase required for proper maintenance of skeletal muscle function. Healthy individuals possess 5 – 38 CTG units in the 3’ Untranslated Region (UTR) of the DMPK gene, while individuals with Myotonic Dystrophy 1 (DM1) harbor upwards of 50 CTG units. DM1 is a multisystem disorder that affects tissues such as skeletal and smooth muscle, heart, and central nervous system. In DM1 patients, the DMPK gene can be transcribed in either the sense direction to produce an expanded CTG transcript or in the antisense direction to produce an expanded CAG transcript.

[0165] Mediator Complex Subunit 12 (MED12) encodes a component of the preinitiation complex that is involved in the control of initiation of transcription. An example of a MED12 transcript sequence is provided by NCBI Reference Sequence NM_005120.3 (SEQ ID NO:44). MED12 has aAtty. Dkt: IRIS-002WO polyglutamine tract and is associated with Opitz-Kaveggia syndrome, Lujan-Fryns syndrome, Ohdo syndrome, X-linked, and tumor formation, e.g., in uterine leiomyomas.

[0166] E1A Binding Protein P400 (EP400) encodes a component of the NuA4 histone acetyltransferase complex that is involved in transcriptional activation. An example of an EP400 transcript sequence is provided by NCBI Reference Sequence NM_015409.5 (SEQ ID NO:45). EP400 normally contains about 32 CAG repeats. EP400 is involved in ossifying fibromyxoid tumor and epilepsy, familial temporal lobe, 1.

[0167] Membrane Associated Guanylate Kinase, WW And PDZ Domain Containing 1 (MAGI1) encodes a protein involved in the assembly of multiprotein complexes at regions of cell to cell contact. An example of a MAGI1 transcript sequence is provided by NCBI Reference Sequence NM_015520.2 (SEQ ID NO:46). MAGI1 contains a polymorphic polyglutamine tract and is associated with conditions such as cervical large cell neuroendocrine carcinoma and microscopic colitis.

[0168] UBAP1-MVB12-Associated (UMA) Domain Containing 1 (UMAD1) is a protein coding gene. An example of a UMAD1 transcript sequence is provided by NCBI Reference Sequence NM_001302348.2 (SEQ ID NO:47). UMAD1 includes a region of polymorphic trinucleotide CAG repeats upstream of the start codon and is associated with retinitis pigmentosa.

[0169] DM1 Locus Antisense RNA (DM1-AS) is an RNA gene. An example of a DM1-AS RNA sequence is provided by NCBI Reference Sequence NR_147193.1 (SEQ ID NO:48). DM1-AS includes a region of polymorphic trinucleotide CAG repeats in an intron and is associated with myotonic dystrophy 1 and branchiootorenal syndrome 2.

[0170] AC007161.3 also known as ENSG00000283549 is an RNA gene and contains CAG repeats.

[0171] Interferon Regulatory Factor 2 Binding Protein Like (IRF2BPL) encodes a transcription factor associated with the development of the central nervous system and in neuronal maintenance and with regulating female reproductive function. An example of an IRF2BPL transcript sequence is provided by NCBI Reference Sequence NM_024496.4 (SEQ ID NO:49). IRF2BPL includes a polyglutamine tract and is associated with neurological problems such as neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures and Irf2bpl-related regressive neurodevelopmental disorder-dystonia-seizures syndrome.

[0172] Mab-21 Like 1 (MAB21L1) encodes a protein associated with eye and cerebellum development. An example of a MAB21L1 transcript sequence is provided by NCBI Reference Sequence NM_005584.5 (SEQ ID NO:50). MAB21L1 is associated with cerebellar, ocular, craniofacial, and genital Syndrome and hydrophthalmos. MAB21L1 includes polymorphic trinucleotide CAG repeats inAtty. Dkt: IRIS-002WO the 5’ untranslated portion of the gene that are associated with psychiatric conditions such as bipolar disorder.

[0173] In some cases, a pathogenic or pathologic allele of a CAG repeat containing gene or RNA encoded by the CAG repeat containing gene contains at least about 30 consecutive CAG repeats. DNA MOLECULES AND RECOMBINANT EXPRESSION VECTORS

[0174] The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of a dsRNA of the present disclosure, where the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell. The present disclosure provides a recombinant nucleic acid comprising: a) a dsRNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide. The present disclosure comprises a DNA molecule encoding such a recombinant nucleic acid. The present disclosure comprises a recombinant expression vector comprising the DNA molecule.

[0175] In some cases, a dsRNA of the disclosure is encoded by a nucleic acid molecule, for example a DNA molecule. Double stranded RNA sequences provided herein can be converted to DNA format by replacing each uracil base “U” with a thymine “T” base.

[0176] In some cases, nucleic acid molecule (e.g., DNA) encoding the double stranded RNA is contained within an expression cassette or a recombinant expression vector.

[0177] In some cases, the expression cassette further comprises one or more expression control sequences (regulatory sequences) operably linked with the transgene. “Operably linked” sequences include expression control sequences that are contiguous with the transgene or act in trans or at a distance from the transgene to control its expression. Examples of expression control sequences include transcription initiation sequences, termination sequences, promoter sequences, enhancer sequences, repressor sequences, splice site sequences, polyadenylation (polyA) signal sequences, or any combination thereof.

[0178] In some cases, a promoter is an endogenous promoter, synthetic promoter, hybrid promoter, constitutive promoter, inducible promoter, tissue-specific promoter (e.g., central nervous system (CNS)-specific), or cell-specific promoter (neurons, glial cells, or astrocytes). Examples of constitutive promoters include, Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter (optionally with the RSV enhancer), cytomegalovirus (CMV) promoter (optionally with the CMV enhancer), SV40 promoter, and dihydrofolate reductase promoter. Examples of inducible promoters include zinc-inducible sheep metallothionine (MT) promoter, dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, T7 polymerase promoter system, the ecdysone insect promoter, tetracycline-repressible system, tetracycline-inducible system, RU486-inducible system, and the rapamycin-inducible system. Further examples of promoters that may be used include, for example,Atty. Dkt: IRIS-002WO chicken beta-actin promoter (CBA promoter), a CAG promoter, an H1 promoter, a CD68 promoter, a JeT promoter, synapsin promoter, RNA pol II promoter, or an RNA pol III promoter (e.g., U6, H1, etc.).

[0179] In some cases, a promoter is an RNA pol II promoter. Examples of pol II promoters include PGK, CBA, U1, CMV, EIF1α, EF1α, CAG, or synaptophysin promoters. In some cases, the promoter is a tissue-specific RNA pol II promoter. In some cases, the tissue-specific RNA pol II promoter is derived from a gene that exhibits neuron-specific expression. In some cases, an expression cassette comprises a pol II promoter and a poly(A) tail, e.g., with the DNA sequence encoding the double stranded RNA flanked on the 5’ end by the pol II promoter and on the 3’ end by the poly(A) tail.

[0180] In some cases, a promoter is a neuron specific promoter. Examples of neuron-specific promoters include those from neuron specific enolase (NSE), human synapsin 1, human synapsin 2 promoter, caMK kinase, and tubuline.

[0181] In some cases, a promoter is an RNA pol III promoter. Examples of pol III promoters include U6, H1, 7SK, Y, RPR, MRP, and selenocysteine tRNA. In some cases, an expression cassette comprises a pol III promoter and a poly(T) tail, e.g., with the DNA sequence encoding the double stranded RNA flanked on the 5’ end by the pol III promoter and on the 3’ end by the poly(T) tail.

[0182] In some cases, a promoter is an RNA pol I promoter. In some cases, an expression cassette comprises a pol I promoter and a 3’-box, e.g. with the DNA sequence encoding the double stranded RNA flanked on the 5’ end by the pol I promoter and on the 3’ end by the 3’-box.

[0183] Expression cassettes for double stranded RNAs are known in the art, see, e.g., ter Brake et al. Mol. Ther. (2008) 16:557; Maczuga et al., BMC Biotechnol. (2012) 12:42; and Bofill-De Ros and Gu (2016) 103:157.

[0184] In some cases, the DNA sequence encoding the double stranded RNA of the disclosure is positioned in an untranslated region of an expression cassette. In some cases, the sequence encoding the inhibitory nucleic acid of the present disclosure is positioned in an intron, a 5' untranslated region (5 'UTR), or a 3' untranslated region (3'UTR) of the expression cassette. In some cases, the sequence encoding the inhibitory nucleic acid of the present disclosure is positioned in an intron downstream of the promoter and upstream of an expressed gene.

[0185] In some cases, the DNA nucleotide sequence encoding a dsRNA of the disclosure is flanked by two AAV inverted terminal repeats (ITRs) (e.g., 5’ ITR and 3’ ITR) within the expression cassette. In some cases, each AAV ITR is a full length ITR (e.g., approximately 145 bp in length, and containing functional Rep binding site (RBS) and terminal resolution site (trs)). In some cases, one of the ITRs is truncated (e.g., shortened or not full- length). In some cases, a truncated ITR lacks a functional terminal resolution site (trs) and is used for production of self-complementary AAV vectors (scAAV vectors).Atty. Dkt: IRIS-002WO

[0186] In some cases, the expression cassette comprises a nucleotide sequence selected from the nucleotide sequences depicted in FIG.11 (Table 4). In some cases, the cassette does not include the 3’ TTTTTG sequence.

[0187] In some cases, dsRNAs described herein can be encoded by vectors, such as plasmids, non-viral vectors, or viral vectors. The use of vectors for expressing double-stranded RNAs of the present disclosure may allow for continual or controlled expression of the double-stranded RNAs in the subject, rather than multiple doses of the double-stranded RNAs to the subject. The present disclosure provides a vector comprising an isolated nucleic acid comprising an expression cassette encoding a double-stranded RNA described herein.

[0188] Viral vectors include, but are not limited to, herpesvirus (HSV) vectors, retroviral vectors, adenoviral vectors, adeno-associated viral (AAV) vectors, lentiviral vectors, baculoviral vectors, and the like.

[0189] In some cases, the vector encoding a dsRNA of the disclosure is a retroviral vector. In some cases, a retroviral vector is a mouse stem cell virus, murine leukemia virus (e.g., Moloney murine leukemia virus vector), feline leukemia virus, feline sarcoma virus, or avian reticuloendotheliosis virus vector. In some cases, the vector encoding a double stranded RNA of the disclosure is a lentivirus or lentiviral based vector. In some cases, a lentiviral vector is a HIV (human immunodeficiency virus, including HIV type 1 and HIV type 2), equine infectious anemia virus, feline immunodeficiency virus (FIV), bovine immune deficiency virus (BIV), and simian immunodeficiency virus (SIV), equine infectious anemia virus, or Maedi-Visna viral vector. Methods for expressing shRNAs using lentivirus engineered cells are known in the art, for example, Stegmeier et al. Proc. Natl. Acad. Sci. USA (2005) 102:13212-13217; Klinghoffer et al. RNA (2010) 16:879-884. Production of replication-incompetent recombinant lentivirus may be achieved, for example, by co-transfection of expression vectors and packaging plasmids using commercially available packaging cell lines, such as TLA-HEK293TM, and packaging plasmids (Thermo Scientific / Open Biosystems, Huntsville, AL).

[0190] In some cases, the vector encoding a dsRNA of the disclosure is an adeno-associated virus (AAV) vector, such as a recombinant rAAV vector, which is produced by recombinant methods. AAV is a single-stranded, non-enveloped DNA virus having a genome that encodes proteins for replication (rep) and the capsid (Cap), flanked by two ITRs, which serve as the origin of replication of the viral genome. AAV also contains a packaging sequence, allowing packaging of the viral genome into an AAV capsid. In some cases, the AAV vector comprises an expression cassette encoding a double stranded RNA of the present disclosure flanked by two cis-acting AAV ITRs (5’ ITR and 3’ ITR). Functional ITR sequences are used for the rescue, replication and packaging of the AAV viral particle. Thus, an AAV vector is defined herein to include at least those sequences required in cis for replicationAtty. Dkt: IRIS-002WO and packaging (e.g., one or two functional ITRs and packaging sequence) of the virus. In some cases, each AAV ITR is a full length ITR (e.g., approximately 145 bp in length, and containing functional Rep binding site (RBS) and terminal resolution site (trs)). In some cases, one or both of the ITRs is modified, e.g., by insertion, deletion, or substitution, provided that the ITRs provide for functional rescue, replication, and packaging. In some cases, a modified ITR lacks a functional terminal resolution site (trs) and is used for production of self-complementary AAV vectors (scAAV vectors). In some cases, the ITRs are selected from any one of serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.Rh10, AAV11 and variants thereof. In some cases, the ITRs are from AAV2.

[0191] Other expression control sequences may be present in the rAAV vector operably linked to the DNA sequence encoding the double stranded RNA, including one or more of transcription initiation sequences, termination sequences, promoter sequences, enhancer sequences, repressor sequences, splice site sequences, polyadenylation (polyA) signal sequences, or any combination thereof.

[0192] rAAV vectors may have one or more AAV wild type genes deleted in whole or in part. In some embodiments the rAAV vector is replication defective. In some cases, the rAAV vector lacks a functional Rep protein and / or capsid protein.

[0193] Methods of packaging recombinant AAV vector into AAV capsids using host cell culture are known in the art. In some cases, one or more of the required components for packaging the rAAV vector, (e.g., Rep sequence, cap sequence, and / or accessory functions) may be provided by a stable host cell that has been engineered to contain the one or more required components (e.g., by a vector). Expression of the required components for AAV packaging may be under control of an inducible or constitutive promoter in the host packaging cell. AAV helper vectors are commonly used to provide transient expression of AAV rep and / or cap genes, which function in trans, to complement missing AAV functions that are necessary for AAV replication. In some cases, AAV helper vectors lack AAV ITRs and can neither replicate nor package themselves. AAV helper vectors can be in the form of a plasmid, phage, transposon, cosmid, virus, or virion.

[0194] Recombinant AAV vectors of the present disclosure may be encapsidated by an AAV capsid to form a rAAV particle. A “rAAV particle” or “rAAV virion” refers to an infectious, replication-defective virus including an AAV protein shell, encapsidating a transgene of interest which is flanked on both sides by AAV ITRs. A rAAV particle is produced in a suitable host cell which has sequences specifying a rAAV vector, AAV helper functions and accessory functions introduced therein to render the host cell capable of encoding AAV polypeptides that are required for packaging the rAAV vector (containing the transgene sequence of interest) into infectious rAAV particles for subsequent gene delivery to a target cell.Atty. Dkt: IRIS-002WO

[0195] In some cases, rAAV particles may be produced using the triple transfection method (see, e.g., U.S. Patent No.6,001,650, incorporated herein by reference in its entirety). In this approach, the rAAV particles are produced by transfecting a host cell with a rAAV vector (comprising a transgene) to be packaged into rAAV particles, an AAV helper vector, and an accessory function vector. In some cases, the AAV helper function vector supports efficient AAV vector production without generating any detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes). The accessory function vector encodes nucleotide sequences for non-AAV derived viral and / or cellular functions upon which AAV is dependent for replication (e.g., “accessory functions”). The accessory functions include those functions required for AAV replication, including, without limitation, those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (other than herpes simplex virus type-1), and vaccinia virus. In some cases, a double transfection method, wherein the AAV helper function and accessory function are cloned on a single vector, is used to generate rAAV particles.

[0196] The AAV capsid is an important element in determining the tissue-specificity of the rAAV particle. Thus, a rAAV particle having a particular capsid tissue specificity can be selected. In some cases, the rAAV particle comprises a capsid selected from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.Rh10, AAV11, and variants thereof. In some cases, the AAV capsid is selected from a serotype that is capable of crossing the blood- brain barrier, e.g., AAV9, AAVrh.10, or a variant thereof. In some cases, the AAV capsid is a chimeric AAV capsid.

[0197] In some cases, the rAAV vector is a mammalian serotype AAV vector (e.g., AAV genome and ITRs derived from mammalian serotype AAV), including a primate serotype AAV vector or human serotype AAV vector. In some cases, the AAV vector is derived from any one of serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.Rh10, AAV11, and variants thereof. In some cases, the AAV vector is a chimeric AAV vector. In some cases, rAAV vectors may be vectors comprising an AAV genome and AAV capsid derived from the same AAV serotype. In some cases, rAAV vectors are pseudotyped, meaning the rAAV vectors comprise an AAV genome derived from one AAV serotype and an AAV capsid derived at least in part from a different AAV serotype.

[0198] In some cases, the rAAV vector is AAV9 serotype. In some cases, the rAAV comprises an AAV9 capsid protein (e.g., SEQ ID NO:2 of US Patent No.7,198,951), an AAV9 rep protein (e.g., SEQ ID NO:3 of US Patent No.7,198,951), or both. In some cases, the rAAV comprises: (i) an AAV9 capsid protein (e.g., SEQ ID NO:2 of US Patent No.7,198,951), and (ii) AAV2 ITRs.Atty. Dkt: IRIS-002WO

[0199] In some cases, the rAAV particle is capable of transducing cells of the central nervous system (CNS). In some cases, the rAAV particle is capable of transducing non-neuronal cells or neuronal cells of the CNS. In some cases, the CNS cell is a neuron, glial cell, astrocyte, or microglial cell.

[0200] In some cases, the rAAV vector is a self-complementary AAV (scAAV) vector. scAAV vectors contain two complementary DNA strands in the form of a dimeric inverted repeat genome. The two complementary strands within the dimeric inverted repeat genome anneal together to form one double stranded DNA that is ready for immediate replication and transcription, thus bypassing the requirement for host cell DNA synthesis. Self-complementary AAV vectors are described in U.S. Patent Nos.7,465,583; 7,790,154; 8,361,457; and 8,784,799.

[0201] The present disclosure also provides host cells transfected with the rAAV comprising a DNA sequence encoding the double stranded RNAs described herein. In some cases, the host cell is a prokaryotic cell or a eukaryotic cell. In some cases, the host cell is a mammalian cell (e.g., HEK293T, COS cells, HeLa cells, KB cells), bacterial cell (E. coli), yeast cell, insect cell (Sf9, Sf21, Drosophila, mosquito), etc. In some cases, the host cell is obtained or derived from a human subject. In some cases, the host cell is a fibroblast. DNA molecule encoding one or both strands of a double-stranded RNA

[0202] The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of a double-stranded RNA of the present disclosure. In some cases, the nucleotide sequence encoding the first strand is operably linked to a promoter. In some cases, the nucleotide sequence encoding the first strand is operably linked to a promoter that is functional in a eukaryotic cell. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding: i) the first strand of a double-stranded RNA of the present disclosure; and ii) the second strand of a double-stranded RNA of the present disclosure. In some cases, the nucleotide sequence encoding the first strand and the second strand is operably linked to a promoter. In some cases, the promoter is a PolII promoter. In some cases, the promoter is a U6 promoter. In some cases, the promoter is a CAG promoter. In some cases, the promoter is a CBA promoter. In some cases, the promoter is a CMV promoter. In some cases, the promoter is an EF1α promoter. In some cases, the promoter is an H1 promoter. In some cases, a DNA molecule of the present disclosure comprises a nucleotide sequence that encodes any one of SEQ ID NOs:744-1603. Recombinant RNA molecules

[0203] The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA; which may be referred to as an “artificial microRNA” or a “small binding RNA” (sbRNA)) comprising: a) a dsRNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flankingAtty. Dkt: IRIS-002WO polynucleotide (also referred to herein as a “5’ leader”), a loop polynucleotide, and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the second strand of the double-stranded RNA; and iii) the 3’ trailer polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA) comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the first strand of the double-stranded RNA; and iii) the 3’ flanking polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33.

[0204] The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA; which may be referred to as an “artificial microRNA” or a “small binding RNA” (sbRNA)) comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”) and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the second strand of the double- stranded RNA; and iv) the 3’ trailer polynucleotide; and wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA) comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; and wherein one or both of 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide and the 3’ flanking polynucleotide are derived from miR451. Cassettes encoding a recombinant RNA molecule

[0205] The present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNAAtty. Dkt: IRIS-002WO molecule may be referred to as an “artificial microRNA” or an “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”), a loop polynucleotide, and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the second strand of the double-stranded RNA; and iii) the 3’ trailer polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the first strand of the double-stranded RNA; and iii) the 3’ flanking polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33. In some cases, the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequence TTTTTG 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, the cassette includes the nucleotide sequence Tn, where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, a cassette has a length of from about 110 nucleotides to about 150 nucleotides. In some cases, the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a polyadenylation sequence 3’ of the nucleotide sequence encoding the 3’ flanking polynucleotide.

[0206] The present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”) and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the second strand ofAtty. Dkt: IRIS-002WO the double-stranded RNA; and iv) the 3’ trailer polynucleotide; and wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; and wherein one or both of 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide and the 3’ flanking polynucleotide are derived from miR451. In some cases, the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequence TTTTTG 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, the cassette includes the nucleotide sequence Tn, where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, a cassette has a length of from about 110 nucleotides to about 650 nucleotides (e.g., from 110 nucleotides (nt) to 115 nt, from 115 nt to 120 nt, from 500 nt to 600 nt, or from 600 nt to 610 nt). In some cases, the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a polyadenylation sequence 3’ of the nucleotide sequence encoding the 3’ flanking polynucleotide.

[0207] In some cases, the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence tgcacacctcctggcgggcagctctg (SEQ ID NO:6). In some cases, the portion of the cassette encoding the loop polynucleotide comprises the nucleotide sequence tgttctggcaatacctg (SEQ ID NO:7). In some cases, the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence gggaggcctgccctgactgcccac (SEQ ID NO:8). In some cases, the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequence TTTTTG 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, a cassette has a length of from about 110 nucleotides to about 150 nucleotides. In some cases, the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a polyadenylation sequence 3’ of the nucleotide sequence encoding the 3’ flanking polynucleotide.

[0208] In some cases, the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence acctactgactgccagggcacttgggaatggcaagg (SEQ ID NO:9). In some cases, the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotideAtty. Dkt: IRIS-002WO sequence tcttgctatacccagaaaacgtgccaggaagagaac (SEQ ID NO:10). In some cases, the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence acctactgactgccagggcacttgggaatggcaagg (SEQ ID NO:9); and the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaac (SEQ ID NO:10).

[0209] In some cases, the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence gctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattaagggcgaattcgagctcggtacctcgcgaatgcatctagatatcggc gctatgcttcctgtgcccccagtggggccctggctgggatTtcatcatatactgtaagtttgcgatgagacactacagtatagatgatgtactagtccggg cacccccagctctggagcctgacaaggaggacaggagagatgctgcaagcccaagaagctctctgctcagcctgtcacaacctactgactgccaggg cacttgggaatggcaagg (SEQ ID NO:11). In some cases, the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaactcaggaccctgaagcagactactggaagggagactccagctcaaacaaggcaggggtggg ggcgtgggattgggggtaggggagggaatagatacattttctctttcctgttgtaaagaaataaagataagccaggcacagtggctcacgcctgtaatcc caccactttcagaggccaaggcgctggatccagatctcgagcggccgcccg (SEQ ID NO:12). In some cases, the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence gctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattaagggcgaattcgagctcggtacctcgcgaatgcatctagatatcggc gctatgcttcctgtgcccccagtggggccctggctgggatTtcatcatatactgtaagtttgcgatgagacactacagtatagatgatgtactagtccggg cacccccagctctggagcctgacaaggaggacaggagagatgctgcaagcccaagaagctctctgctcagcctgtcacaacctactgactgccaggg cacttgggaatggcaagg (SEQ ID NO:11); and the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaactcaggaccctgaagcagactactggaagggagactccagctcaaacaaggcaggggtggg ggcgtgggattgggggtaggggagggaatagatacattttctctttcctgttgtaaagaaataaagataagccaggcacagtggctcacgcctgtaatcc caccactttcagaggccaaggcgctggatccagatctcgagcggccgcccg (SEQ ID NO:12).

[0210] In some cases, the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence gctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattaagggcgaattcgagctcggtacctcgcgaatgcatctagatatcggc gctatgcttcctgtgcccccagtggggccctggctgggatAtcatcatatactgtaagtttgcgatgagacactacagtatagatgatgtactagtccggg cacccccagctctggagcctgacaaggaggacaggagagatgctgcaagcccaagaagctctctgctcagcctgtcacaacctactgactgccaggg cacttgggaatggcaagg (SEQ ID NO:13). In some cases, the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaactcaggaccctgaagcagactactggaagggagactccagctcaaacaaggcaggggtggg ggcgtgggattgggggtaggggagggaatagatacattttctctttcctgttgtaaagaaataaagataagccaggcacagtggctcacgcctgtaatcc caccactttcagaggccaaggcgctggatccagatctcgagcggccgccc (SEQ ID NO:14). In some cases, the portion ofAtty. Dkt: IRIS-002WO the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence gctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattaagggcgaattcgagctcggtacctcgcgaatgcatctagatatcggc gctatgcttcctgtgcccccagtggggccctggctgggatAtcatcatatactgtaagtttgcgatgagacactacagtatagatgatgtactagtccggg cacccccagctctggagcctgacaaggaggacaggagagatgctgcaagcccaagaagctctctgctcagcctgtcacaacctactgactgccaggg cacttgggaatggcaagg (SEQ ID NO:13); and the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaactcaggaccctgaagcagactactggaagggagactccagctcaaacaaggcaggggtggg ggcgtgggattgggggtaggggagggaatagatacattttctctttcctgttgtaaagaaataaagataagccaggcacagtggctcacgcctgtaatcc caccactttcagaggccaaggcgctggatccagatctcgagcggccgccc (SEQ ID NO:14).

[0211] The following are non-limiting examples of cassettes. In the following cassettes: (i) tgcacacctcctggcgggcagctctg (SEQ ID NO:6) encodes the 5’ leader polynucleotide; (ii) the first upper case sequence encodes the first strand of the double-stranded RNA; (iii) tgttctggcaatacctg (SEQ ID NO:7) encodes the loop polynucleotide; (iv) the second upper case sequence encodes the second strand of the double-stranded RNA; (v) gggaggcctgccctgactgcccac (SEQ ID NO:8) encodes the 3’ trailer polynucleotide; and (vi) TTTTTG is the Pol3 transcription termination sequence. In some cases, the cassette does not include the 3’ TTTTTG sequence. In some cases, the cassette includes the nucleotide sequence Tn, where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence. In some cases, the cassette includes the nucleotide sequence TTTTT in place of the 3’ TTTTTG sequence. Recombinant expression vector encoding sbRNA

[0212] The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or an “sbRNA”). In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a promoter that is functional in a eukaryotic cell. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase II promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase III promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CMV promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CAG promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CBA promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a U6 promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an EF1α promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operablyAtty. Dkt: IRIS-002WO linked to an H1 promoter. In some cases, the recombinant expression vector comprises a 5’ adeno- associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.

[0213] The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”), a loop polynucleotide, and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the second strand of the double-stranded RNA; and iii) the 3’ trailer polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the first strand of the double-stranded RNA; and iii) the 3’ flanking polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33.

[0214] The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”) and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the second strand of the double-stranded RNA; and iv) the 3’ trailer polynucleotide; and wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) theAtty. Dkt: IRIS-002WO 3’ flanking polynucleotide; and wherein one or both of 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide and the 3’ flanking polynucleotide are derived from miR451. Recombinant expression vector comprising a cassette

[0215] The present disclosure provides a recombinant expression vector comprising cassette (a “DNA molecule”) of the present disclosure, where the cassette comprises a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or an “sbRNA”). In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a promoter that is functional in a eukaryotic cell. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase II promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase III promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CMV promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a U6 promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an EF1α promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an H1 promoter. In some cases, the recombinant expression vector comprises a 5’ adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence. COMPOSITIONS, DELIVERY VEHICLES, AND VIRAL PARTICLES

[0216] The present disclosure provides a delivery vehicle comprising a recombinant expression vector of the present disclosure. The present disclosure provides a viral particle comprising a recombinant expression vector of the present disclosure. The present disclosure provides a composition comprising a recombinant expression vector of the present disclosure. Delivery vehicles

[0217] A recombinant expression vector of the present disclosure can be present in a delivery vehicle. Thus, the present disclosure provides a delivery vehicle comprising a recombinant expression vector of the present disclosure. In some cases, the delivery vehicle is a non-viral delivery vehicle. In some cases, the delivery vehicle is a lipid nanoparticle. In some cases, the delivery vehicle is a viral delivery vehicle. In some cases, the viral delivery vehicle is a recombinant AAV virion. Suitable AAV virions include those with AAV2 capsid, an AAV9 capsid, and the like.

[0218] Suitable lipid nanoparticles can include, e.g., one or more cationic lipids, lipids modified with poly(ethylene glycol) (“PEGylated lipids”), and the like. Suitable cationic lipids include, but are not limited to, XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)- heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate), ALNY-100 ((3aR,5s,6aS)-N,N-Atty. Dkt: IRIS-002WO dimethyl-2,2-di((92,12Z)-octadeca-9,12-dienyl)tetrahydr- o-3aH-cyclopenta[d] [1,3]dioxol-5-amine)), NC98-5 (4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tet- raazahexadecane- 1,16-diamide), DODAP (1,2-dioleyl-3-dimethylammonium propane), HGT4003, ICE, HGT5000, cis or trans HGT5001, DOTAP (1,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl- 3-trimethylammonium propane), DLinDMA, DLin-KC2-DMA, and C12-200. Other suitable lipids that can be included in a lipid nanoparticle include, but are not limited to, DSPC (1,2-distearoyl-sn-glycero-3- phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero- 3-phosphoethanolamine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2- dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac- glycerol)), and cholesterol. Suitable PEGylated lipids include, e.g., PEG-DSG (1,2-Distearoyl-rac– glycero-3-methoxypolyethylene glycol conjugated to, e.g., PEG-1000, PEG-2000, PEG-5000, and the like), PEG-DMG (1,2-Dimyristoyl-rac-glycerol conjugated to PEG), and PEG-ceramides. Pharmaceutical Compositions

[0219] The disclosure provides pharmaceutical compositions comprising nucleic acids (e.g., DNA), expression cassettes, or vectors encoding double stranded RNAs described herein and a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with cells and / or tissues without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0220] As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it may perform its intended function. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the cell or tissue being contacted. Additional ingredients that may be included in the pharmaceutical compositions used in the practice of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference.

[0221] As is well known in the medical arts, the dosage for any one patient depends upon many factors, including the patient's size, weight, body surface area, age, the level of expression of inhibitory RNA expression required to achieve a therapeutic effect, stability of the inhibitory nucleic acid, specific disease being treated, stage of disease, sex, time and route of administration, general health, and other drugs being administered concurrently.Atty. Dkt: IRIS-002WO

[0222] In some cases, rAAVs as described herein are administered to a subject in an amount of about 1×106VG (viral genomes) to about 1×1016VG per subject, or about 1×106, 2×106, 3×106, 4×106, 5×106, 6×106, 7×106, 8×106, 9×106, 1×107, 2×107, 3×107, 4×107, 5×107, 6×107, 7×107, 8×107, 9×107, 1×108, 2×108, 3×108, 4×108, 5×108, 6×108, 7×108, 8×108, 9×108, 1×109, 2×109, 3×109, 4×109, 5×109, 6×109, 7×109, 8×109, 9×109, 1×1010, 2×1010, 3×1010, 4×1010, 5×1010, 6×1010, 7×1010, 8×1010, 9×1010, 1×1011, 2×1011, 2.1×1011, 2.2×1011, 2.3×1011, 2.4×1011, 2.5×1011, 2.6×1011, 2.7×1011, 2.8×1011, 2.9×1011, 3×1011, 4×1011, 5×1011, 6×1011, 7×1011, 7.1×1011, 7.2×1011, 7.3×1011, 7.4×1011, 7.5×1011, 7.6×1011, 7.7×1011, 7.8×1011, 7.9×1011, 8×1011, 9×1011, 1×1012, 1.1×1012, 1.2×1012, 1.3×1012, 1.4×1012, 1.5×1012, 1.6×1012, 1.7×1012, 1.8×1012, 1.9×1012, 2×1012, 3×1012, 4×1012, 4.1×1012, 4.2×1012, 4.3×1012, 4.4×1012, 4.5×1012, 4.6×1012, 4.7×1012, 4.8×1012, 4.9×1012, 5×1012, 6×1012, 7×1012, 8×1012, 8.1×1012, 8.2×1012, 8.3×1012, 8.4×1012, 8.5×1012, 8.6×1012, 8.7×1012, 8.8×1012, 8.9×1012, 9×1012, 1×1013, 2×1013, 3×1013, 4×1013, 5×1013, 6×1013, 6.7×1013, 7×1013, 8×1013, 9×1013, 1×1014, 2×1014, 3×1014, 4×1014, 5×1014, 6×1014, 7×1014, 8×1014, 9×1014, 1×1015, 2×1015, 3×1015, 4×1015, 5×1015, 6×1015, 7×1015, 8×1015, 9×1015, or 1×1016VG / subject.

[0223] In some cases, rAAV particles as described herein are administered to a subject in an amount of about 1×106VG / kg to about 1×1016VG / kg, or about 1×106, 2×106, 3×106, 4×106, 5×106, 6×106, 7×106, 8×106, 9×106, 1×107, 2×107, 3×107, 4×107, 5×107, 6×107, 7×107, 8×107, 9×107, 1×108, 2×108, 3×108, 4×108, 5×108, 6×108, 7×108, 8×108, 9×108, 1×109, 2×109, 3×109, 4×109, 5×109, 6×109, 7×109, 8×109, 9×109, 1×1010, 2×1010, 3×1010, 4×1010, 5×1010, 6×1010, 7×1010, 8×1010, 9×1010, 1×1011, 2×1011, 2.1×1011, 2.2×1011, 2.3×1011, 2.4×1011, 2.5×1011, 2.6×1011, 2.7×1011, 2.8×1011, 2.9×1011, 3×1011, 4×1011, 5×1011, 6×1011, 7×1011, 7.1×1011, 7.2×1011, 7.3×1011, 7.4×1011, 7.5×1011, 7.6×1011, 7.7×1011, 7.8×1011, 7.9×1011, 8×1011, 9×1011, 1×1012, 1.1×1012, 1.2×1012, 1.3×1012, 1.4×1012, 1.5×1012, 1.6×1012, 1.7×1012, 1.8×1012, 1.9×1012, 2×1012, 3×1012, 4×1012, 4.1×1012, 4.2×1012, 4.3×1012, 4.4×1012, 4.5×1012, 4.6×1012, 4.7×1012, 4.8×1012, 4.9×1012, 5×1012, 6×1012, 7×1012, 8×1012, 8.1×1012, 8.2×1012, 8.3×1012, 8.4×1012, 8.5×1012, 8.6×1012, 8.7×1012, 8.8×1012, 8.9×1012, 9×1012, 1×1013, 2×1013, 3×1013, 4×1013, 5×1013, 6×1013, 6.7×1013, 7×1013, 8×1013, 9×1013, 1×1014, 2×1014, 3×1014, 4×1014, 5×1014, 6×1014, 7×1014, 8×1014, 9×1014, 1×1015, 2×1015, 3×1015, 4×1015, 5×1015, 6×1015, 7×1015, 8×1015, 9×1015, or 1×1016VG / kg.

[0224] Pharmaceutical compositions may be administered in a manner appropriate to the disease or condition to be treated (or prevented) as determined by persons skilled in the medical art. An appropriate dose and a suitable duration and frequency of administration of the compositions will be determined by such factors as the health condition of the patient, size of the patient (i.e., weight, mass, or body area), the type and severity of the patient's disease, the particular form of the active ingredient, and the method of administration. In general, an appropriate dose and treatment regimen provide the composition(s) in an amount sufficient to provide therapeutic and / or prophylactic benefit (such as described herein, including an improved clinical outcome, such as more frequent complete or partialAtty. Dkt: IRIS-002WO remissions, or longer disease-free and / or overall survival, or a lessening of symptom severity). For prophylactic use, a dose should be sufficient to prevent, delay the onset of, or diminish the severity of a disease associated with disease or disorder. Prophylactic benefit of the compositions administered according to the methods described herein can be determined by performing pre-clinical (including in vitro and in vivo animal studies) and clinical studies and analyzing data obtained therefrom by appropriate statistical, biological, and clinical methods and techniques, all of which can readily be practiced by a person skilled in the art.

[0225] Compositions (e.g., pharmaceutical compositions) may be administered by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subpial, intraparenchymal, intrastriatal, intrathalamic, intracerebellar, intracranial, intracisternal, intra-cerebral, intracerebral ventricular, intraocular, intraventricular, intralumbar, subcutaneous, transdermal, intradermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and / or drops), mucosal, nasal, buccal, sublingual; by intratracheal instillation, bronchial instillation, and / or inhalation; and / or as an oral spray, nasal spray, and / or aerosol. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract), and / or the condition of the subject. In some cases, compositions are directly injected into the CNS of the subject. In some cases, direct injection into the CNS is intracerebral injection, intracerebral ventricular injection, intraparenchymal injection, intrathecal injection, intrastriatal injection, intrathalamic injection, subpial injection, or any combination thereof. In some cases, direct injection into the CNS is direct injection into the cerebrospinal fluid (CSF) of the subject, optionally wherein the direct injection is intracisternal injection, intraventricular injection, and / or intralumbar injection. In some cases, compositions are administered by a combination of direct injection into the CNS and by a route that is not directly injected into the CNS (e.g., intravenously).

[0226] In some cases, pharmaceutical compositions comprising rAAV particles are formulated to reduce aggregation of rAAV particles, particularly where high rAAV particle concentrations are present (e.g., ˜1013VG / ml or more). Methods for reducing aggregation of rAAV particles are well known in the art and include, for example, addition of surfactants, pH adjustment, salt concentration adjustment, etc. (See, e.g., Wright F R, et al., Molecular Therapy (2005) 12:171-178, incorporated herein by reference in its entirety). Kits

[0227] In some cases, the compositions provided herein may be assembled into pharmaceutical or research kits to facilitate their use in therapeutic or research use. A kit may include one or more containers comprising: (a) expression cassette or vector encoding a double stranded RNA as described herein; (b) instructions for use; and optionally (c) reagents for transducing the kit component (a) into aAtty. Dkt: IRIS-002WO host cell. In some cases, the kit component (a) may be in a pharmaceutical formulation and dosage suitable for a particular use and mode of administration. For example, the kit component (a) may be presented in unit-dose or multi-dose containers, such as sealed ampoules or vials. The components of the kit may require mixing one or more components prior to use or may be prepared in a premixed state. The components of the kit may be in liquid or solid form, and may require addition of a solvent or further dilution. The components of the kit may be sterile. The instructions may be in written or electronic form and may be associated with the kit (e.g., written insert, CD, DVD) or provided via internet or web-based communication. The kit may be shipped and stored at a refrigerated or frozen temperature. TREATMENT METHODS

[0228] The present disclosure provides nucleic acids (e.g., DNA), expression cassettes, recombinant expression vectors comprising a cassette, recombinant expression vectors encoding dsRNAs, or pharmaceutical compositions described herein for use in a method of therapy.

[0229] The present disclosure provides method for selectively reducing translation of a disease- associated CAG repeat-containing RNA in an individual having a CAG repeat expansion disorder, the method comprising administering to the individual an effective amount of a recombinant expression vector of the present disclosure, a delivery vehicle of the present disclosure, a viral particle of the present disclosure, or a pharmaceutical composition of the present disclosure. In some cases, the repeat expansion disorder is Huntington’s disease, spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3, spinocerebellar ataxia type 6, spinocerebellar ataxia type 7, spinocerebellar ataxia type 12, spinocerebellar ataxia type 17, spinal and bulbar muscular atrophy, dentatorubral pallidoluysian atrophy, myotonic dystrophy type 1, Fuchs’ endothelial corneal dystrophy, or cleidocranial dysplasia. In some cases, said administering comprises direct injection to the central nervous system of the individual. In some cases, the direct injection is intracerebral injection, intracerebral ventricular injection intraparenchymal injection, intrathecal injection, intrastriatal injection, intrathalamic injection, intracisternal magna injection, subpial injection, or any combination thereof. In some cases, said administering provides for a ratio of a polypeptide encoded by the non-disease- associated CAG repeat-containing RNA to a polypeptide encoded by disease-associated CAG repeat- containing RNA of greater than 1.0. In some cases, said administering provides for a ratio of a polypeptide encoded by the non-disease-associated CAG repeat-containing RNA to a polypeptide encoded by disease-associated CAG repeat-containing RNA of from 1.1 to 1.8 (e.g., from 1.1 to 1.4, from 1.4 to 1.6, or from 1.6 to 1.8). In some cases, said administering provides for a ratio of a polypeptide encoded by the non-disease-associated CAG repeat-containing RNA to a polypeptide encoded by disease-associated CAG repeat-containing RNA of greater than 1.8 (e.g., 2.0, from 2.0 to 2.2, from 2.2 to 2.4, from 2.4 to 2.6, from 2.6 to 2.8, from 2.8 to 3.0). In some cases, said administeringAtty. Dkt: IRIS-002WO provides for a ratio of a polypeptide encoded by the non-disease-associated CAG repeat-containing RNA to a polypeptide encoded by disease-associated CAG repeat-containing RNA of greater than 5.0 (e.g., from 3.1 to 3.3, from 3.3 to 3.5, from 3.5 to 3.7, from 3.9 to 4.1, from 4.1 to 4.3, from 4.3 to 4.5, from 4.5 to 4.7, from 4.7 to 5.0).

[0230] The present disclosure provides methods for reducing or inhibiting expression of a CAG repeat containing RNA (e.g., mRNA or pre-mRNA) in a mammalian cell, comprising introducing into the mammalian cell a dsRNA of the present disclosure, or a recombinant expression vector of the present disclosure.

[0231] In some cases, inhibiting expression of a CAG repeat containing mRNA comprises inhibiting expression of the polyglutamine containing protein encoded by the CAG repeat containing mRNA, such as for example by binding to the CAG repeat region of a CAG repeat containing mRNA and blocking translation of the CAG repeat containing protein rather than by degradation of the CAG repeat containing mRNA.

[0232] In some cases, the method reduces or inhibits expression of a pathologic or pathogenic allele of a CAG repeat containing RNA. In some cases, the method selectively reduces or inhibits expression of a pathologic or pathogenic allele of a CAG repeat containing RNA compared to expression of a normal allele of a CAG repeat containing RNA.

[0233] In some cases, the double stranded RNA is contained within a pre-miRNA scaffold, pri- miRNA scaffold, or shRNA. In some cases, the double stranded RNA is cleaved by DROSHA and / or DICER in the mammalian cell to yield the siRNA.

[0234] In some cases, the siRNAs produced from the dsRNA in the mammalian cell are at an abundance of at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the siRNAs produced from the double stranded RNA by the mammalian cell. % abundance of a siRNA correctly processed from a double stranded RNA may be measured by obtaining the number of RNA sequence reads that have the correctly processed 5’ end and align to the reference CAG repeat region containing reference transcript, and dividing by the total number of RNA sequence reads of siRNAs aligned to the reference CAG repeat region containing reference transcript.

[0235] In some cases, the CAG repeat containing mRNA or pre-mRNA is transcribed from HTT, ATXN1, ATXN2, ATXN3, CACNA1A, Ataxin7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, or MAB21L1. In some cases, the CAG repeat containing mRNA contains an expanded number of repeats.Atty. Dkt: IRIS-002WO

[0236] In some cases, the mammalian cell is a CNS cell. In some cases, the mammalian cell is a non-neuronal cell or neuronal cell of the CNS. In some cases, the non-neuronal cell of the CNS is a glial cell, astrocyte, or microglial cell. In some cases, the mammalian cell is in vitro. In some cases, the mammalian cell is a non-CNS cell. In some cases, the mammalian cell is a fibroblast. In some cases, the mammalian cell is from a subject having one or more symptoms of a polyglutamine disease or suspected of having a polyglutamine disease or having a predisposition for a polyglutamine disease.

[0237] The present disclosure provides methods for reducing or inhibiting expression of a CAG repeat containing mRNA in a subject in need thereof, comprising administering to the subject a nucleic acid molecule (e.g., DNA) encoding a double stranded RNA of the disclosure, an expression cassette comprising the nucleic acid molecule encoding the double stranded RNA of the disclosure; a vector comprising the nucleic acid molecule encoding the double stranded RNA of the disclosure, or a pharmaceutical composition thereof.

[0238] In some cases, the inhibiting expression of a CAG repeat containing mRNA comprises inhibiting expression of the polyglutamine containing protein encoded by the CAG repeat containing mRNA, such as for example by binding to the CAG repeat region of a CAG repeat containing mRNA and blocking or repressing translation of the CAG repeat containing protein rather than by degradation of the CAG repeat containing mRNA.

[0239] In some cases, the CAG repeat containing mRNA or pre-mRNA is transcribed from HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, or MAB21L1.

[0240] In some cases, the CAG repeat containing mRNA or pre-mRNA contains an expanded number of repeats. In some cases, the subject has a polyglutamine disease, meaning exhibiting symptoms of the polyglutamine disease. In some cases, the subject is at risk of developing a polyglutamine disease and does not yet show signs of the polyglutamine disease. In some cases, the polyglutamine disease is associated with HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, or MAB21L1. In some cases, the polyglutamine disease is a neurodegenerative disease. In some cases, the subject has Huntington’s disease, spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3, spinocerebellar ataxia type 6, spinocerebellar ataxia type 7, spinocerebellar ataxia type 12, spinocerebellar ataxia type 17, amyotrophic lateral sclerosis, spinal bulbar muscular atrophy, dentatorubral pallidoluysian atrophy, cleidocranial dysplasia, retinitis pigmentosa, myotonic dystrophy 1, Fuchs’ endothelial corneal dystrophy, or branchiootorenal syndrome 2, or is at risk of developingAtty. Dkt: IRIS-002WO Huntington’s disease, spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3, spinocerebellar ataxia type 6, spinocerebellar ataxia type 7, spinocerebellar ataxia type 12, spinocerebellar ataxia type 17, amyotrophic lateral sclerosis, spinal bulbar muscular atrophy, dentatorubral pallidoluysian atrophy, cleidocranial dysplasia, retinitis pigmentosa, myotonic dystrophy 1, Fuchs’ endothelial corneal dystrophy, or branchiootorenal syndrome 2 and does not yet show signs of the disease.

[0241] The present disclosure also provides methods for treating a subject having a polyglutamine disease or at risk of developing a polyglutamine disease, comprising administering to the subject a nucleic acid molecule (e.g., DNA) encoding a double stranded RNA of the disclosure, an expression cassette comprising the nucleic acid molecule encoding the double stranded RNA of the disclosure; a vector comprising the nucleic acid molecule encoding the double stranded RNA of the disclosure, or a pharmaceutical composition thereof.

[0242] As used herein, the term "treat" refers to preventing or delaying onset of a polyglutamine disease; reducing severity of polyglutamine disease; reducing or preventing development of symptoms characteristic of polyglutamine disease; preventing worsening of symptoms characteristic of polyglutamine disease, or any combination thereof. In some cases, a treatment of a subject involves subjects having a polyglutamine disease or at risk of developing a polyglutamine disease and does not yet show signs of the polyglutamine disease.

[0243] In some cases, the methods for treatment of the present disclosure comprise administration as a monotherapy or in combination with one or more additional therapies for the treatment of the polyglutamine disease. Combination therapy may mean administration of the compositions of the present disclosure (e.g., a nucleic acid molecule (e.g., DNA) encoding a double stranded RNA of the disclosure, an expression cassette comprising the nucleic acid molecule encoding the double stranded RNA of the disclosure; a vector comprising the nucleic acid molecule encoding the double stranded RNA of the disclosure, or a pharmaceutical composition thereof to the subject concurrently, prior to, or subsequent to one or more additional therapies. Concurrent administration of combination therapy may mean that the compositions of the present disclosure (e.g., a nucleic acid molecule (e.g., DNA) encoding a double stranded RNA of the disclosure, an expression cassette comprising the nucleic acid molecule encoding the double stranded RNA of the disclosure; a vector comprising the nucleic acid molecule encoding the double stranded RNA of the disclosure, or a pharmaceutical composition thereof) and additional therapy are formulated for administration in the same dosage form or administered in separate dosage forms.

[0244] In some cases, the CAG repeat containing RNA is an mRNA or pre-mRNA transcript. In some cases, the CAG repeat containing RNA is transcribed from HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPL, MLLT3, BMP2K, THAP11, ZFHX3,Atty. Dkt: IRIS-002WO POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1- AS, AC007161.3, IRF2BPL, or MAB21L1.

[0245] In some cases, the processed artificial miRNA targets a pathogenic or pathologic allele of a CAG repeat containing RNA. In some cases, the processed artificial miRNA selectively targets a pathogenic or pathologic allele of a CAG repeat containing RNA compared to a normal allele of a CAG repeat containing RNA. In some cases, the pathogenic or pathologic allele of the CAG repeat containing RNA contains at least 30 consecutive CAG repeats.

[0246] In some cases, the cell is in a subject. In some cases, the subject is human. In some cases, the subject has or is suspected of having a CAG repeat expansion disorder.

[0247] The present disclosure also provides methods of inhibiting expression of a CAG repeat containing RNA in a cell comprising administering to the cell: (a) a viral vector encoding a double stranded RNA according to any of the embodiments described herein; or (b) a viral vector encoding an artificial miRNA.

[0248] In some cases, the CAG repeat containing RNA is a mRNA or pre-mRNA transcript. In some cases, the CAG repeat containing RNA is transcribed from HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1- AS, AC007161.3, IRF2BPL, or MAB21L1.

[0249] In some cases, the guide sequence of the artificial miRNA has 0 predicted perfectly matching off-target transcripts. In some cases, the guide sequence of the artificial miRNA has 0-1 predicted off-target transcripts having perfect 17mer match within positions 1-21 of the guide sequence. In some cases, the guide sequence of the artificial miRNA has 0 predicted perfectly matching off-target transcripts. In some cases, the guide sequence of the artificial miRNA has 0-4 predicted off-target transcripts having perfect 17mer match within positions 1-21 of the guide sequence. In some cases, the guide sequence of the artificial miRNA with one substitution has 0-2 predicted off-target transcripts.

[0250] In some cases, the cell is in a subject. In some cases, the subject is human. In some cases, the subject has or is suspected of having a CAG repeat expansion disorder.

[0251] In some cases, a subject treated in any of the methods described herein is a mammal (e.g., mouse, rat), preferably a primate (e.g., monkey, chimpanzee), or human.

[0252] In any of the methods of treatment described herein, a composition of the present disclosure (e.g., nucleic acid or expression cassette encoding a double stranded RNA, vector, or pharmaceutical composition according to the disclosure) may be administered to the subject by intrathecal, subpial, intraparenchymal, intrastriatal, intracranial, intrathalamic, intracerebellar (?), intracisternal, intra-cerebral, intracerebral ventricular, intraocular, intraventricular, intralumbar,Atty. Dkt: IRIS-002WO intraocular, parenteral, intravenous, intramuscular, intra-arterial, subcutaneous, transdermal, interdermal, rectal, intravaginal, intraperitoneal, mucosal administration or any combination thereof.

[0253] In some cases, a composition of the present disclosure (e.g., inhibitory nucleic acid, isolated nucleic acid comprising an expression cassette encoding an inhibitory nucleic acid, vector, rAAV particle, pharmaceutical composition) is directly injected into the CNS of the subject. In some cases, direct injection into the CNS is intracerebral injection, intraparenchymal injection, intrathecal injection, intrathalamic injection, subpial injection, or any combination thereof. In some cases, direct injection into the CNS is intracerebral ventricular injection. In some cases, direct injection into the CNS is direct injection into the cerebrospinal fluid (CSF) of the subject, optionally wherein the direct injection is intracisternal injection, intraventricular injection, intralumbar injection, or any combination thereof. In some cases, administration to the subject is accomplished by a combination of direct injection to the CNS and by a route that is not directly injected into the CNS (e.g., intravenously).

[0254] In some cases, the methods of the present disclosure reduce the level of a glutamine (Gln) repeat containing protein in a cell by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% at least 95% or more in a cell compared to the level of the Gln repeat containing protein in a cell that has not been contacted with the double stranded RNA. In some cases, the methods of the present disclosure reduces the level of a Gln repeat containing protein in a cell by 10-20%, 10-30%, 10-40%, 10- 50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20- 80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30- 100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50- 90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70- 100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% compared to the level of the Gln repeat containing protein in a cell that has not been contacted with the double stranded RNA. In some cases, the methods of the present disclosure reduce the level of the pathogenic or pathologic form of the Gln repeat containing protein. In some cases, the pathogenic or pathologic form of the Gln repeat containing protein contains at least 30 consecutive Gln repeats.

[0255] In some cases, the methods of the present disclosure reduce the level of a Gln repeat containing protein in the CNS of a subject by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% or more in the CNS compared to the level of the Gln repeat containing protein in the CNS of an untreated subject. In some cases, the methods of the present disclosure reduces the level of a Gln repeat containing protein in the CNS of a subject by 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-Atty. Dkt: IRIS-002WO 60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40- 95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60- 95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% compared to the level of the Gln repeat containing protein in the CNS of an untreated subject. In some cases, the methods of the present disclosure reduce the level of a pathogenic or pathologic form of a Gln repeat containing protein in the CNS of a subject. In some cases, the pathogenic or pathologic form of the Gln repeat containing protein contains at least 30 consecutive Gln repeats.

[0256] In some cases, the methods of the present disclosure provide for selective reduction in the level of a pathogenic or pathologic form of a Gln repeat containing protein (having an expanded Gln repeat in a cell). In some cases, the pathogenic or pathologic form of the Gln repeat containing protein contains at least 30 consecutive Gln repeats. In some cases, a selective reduction of a pathogenic or pathologic form of the Gln repeat containing protein is reduced at least 1.1X, 1.2X, 1.3X, 1.4X, 1.5X, 1.6X, 1.7X, 1.8X, 1.9X, 2X, 3X, 4X, 5X, 6X, 7X, 8X, 9X, 10X, 20X, 30X, 40X, 50X, 60X, 70X, 80X, 90X, 100X, 200X or more compared to the reduction of the level of the normal (wildtype) form of the Gln repeat containing protein. In some cases, the Gln repeat containing protein is transcribed from one of the following genes: HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, and MAB21L1.

[0257] In some cases, the methods of the present disclosure are used for selective reduction of expression or activity of the pathogenic or pathologic allele of a CAG repeat containing RNA (having an expanded CAG repeat in a cell). In some cases, the pathogenic or pathologic allele of the CAG repeat containing RNA contains at least 30 consecutive CAG repeats. In some cases, a selective reduction of the pathogenic or pathologic allele of the CAG repeat containing RNA is at least 1.1X, 1.2X, 1.3X, 1.4X, 1.5X, 1.6X, 1.7X, 1.8X, 1.9X, 2X, 3X, 4X, 5X, 6X, 7X, 8X, 9X, 10X, 20X, 30X, 40X, 50X, 60X, 70X, 80X, 90X, 100X, 200X or more compared to the reduction of expression of the normal (wildtype) allele of the CAG repeat containing RNA. In some cases, the CAG repeat containing RNA is transcribed from one of the following genes: HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, and MAB21L1.

[0258] In some cases, the methods of the present disclosure are used for selective reduction of expression or activity of the pathogenic or pathologic allele of a CAG repeat containing RNA in the CNS of a subject. In some cases, the pathogenic or pathologic allele of the CAG repeat containing RNA contains at least 30 consecutive CAG repeats. In some cases, a selective reduction of the CAG repeat containing RNA having an expanded CAG repeat is at least 1.1X, 1.2X, 1.3X, 1.4X, 1.5X, 1.6X, 1.7X, 1.8X, 1.9X, 2X or more compared to the normal (wildtype) allele for the CAG repeat containing RNA.Atty. Dkt: IRIS-002WO In some cases, the subject has or is suspected of having a CAG repeat expansion disease or disorder. In some cases, the CAG repeat containing RNA is transcribed from one of the following genes: HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, and MAB21L1. Examples of Non-Limiting Aspects of the Disclosure

[0259] Aspects, including embodiments, of the present subject matter described above may be beneficial alone or in combination, with one or more other aspects or embodiments. Without limiting the foregoing description, certain non-limiting aspects of the disclosure are provided below. As will be apparent to those of skill in the art upon reading this disclosure, each of the individually numbered aspects may be used or combined with any of the preceding or following individually numbered aspects. This is intended to provide support for all such combinations of aspects and is not limited to combinations of aspects explicitly provided below:

[0260] Aspect 1. A double-stranded RNA comprising: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises:

[0261] i) a first mismatch to the target CAG repeat region; and

[0262] ii) at least a second mismatch to the target CAG repeat region,

[0263] wherein:

[0264] i) when the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)), the second mismatch is from 9 to 13 bases 3’ of the first mismatch;

[0265] ii) when the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), the second mismatch is from 8 to 12 bases 3’ of the first mismatch;

[0266] iii) when the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)), the second mismatch is from 7 to 11 bases 3’ of the first mismatch; andAtty. Dkt: IRIS-002WO

[0267] iv) when the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)), the second mismatch is from 6 to 10 bases 3’ of the first mismatch.

[0268] Aspect 2. The double-stranded RNA of aspect 1, wherein each mismatch is generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; c) a substitution of a C with an A, a U, or a G.

[0269] Aspect 3. The double-stranded RNA of aspect 1 or aspect 2, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is from 9 to 13 bases 3’ of the first mismatch.

[0270] Aspect 4. The double-stranded RNA of any one of aspects 1-3, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) and the second substitution generates the second mismatch and is from 9 to 13 bases 3’ of the first mismatch.

[0271] Aspect 5. The double-stranded RNA of any one of aspects 1-3, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and the second substitution generates the second mismatch and is from 9 to 13 bases 3’ of the first mismatch.

[0272] Aspect 6. The double-stranded RNA of any one of aspects 1-3, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and the second substitution generates the second mismatch and is from 9 to 13 bases 3’ of the first mismatch.

[0273] Aspect 7. The double-stranded RNA of any one of aspects 3-6, wherein the first strand comprises no more than 2 mismatches with the target CAG repeat region.Atty. Dkt: IRIS-002WO

[0274] Aspect8. The double-stranded RNA of any one of aspects 3-6, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.

[0275] Aspect 9. The double-stranded RNA of any one of aspects 3-6, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

[0276] Aspect 10. The double-stranded RNA of aspect 3 or aspect 4, wherein the first strand comprises a nucleotide sequence selected from the group consisting of: CUGCUGCAGCUGCUGCAGCUG (SEQ ID NO:51); CUGCUGCAGCUGCUGCUACUG (SEQ ID NO:52); CUGCUGCAGCUGCUGCUGAUG (SEQ ID NO:53); CUGCUGCAGCUGCUGCUGCAG (SEQ ID NO:54); and CUGCUGCAGCUGCUGCUGCUA (SEQ ID NO:55).

[0277] Aspect 11. The double-stranded RNA of aspect 1 or aspect 2, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); wherein the first strand comprises a second mismatch and a third mismatch to the target CAG repeat region, and wherein the second and third mismatches are from 9 to 13 bases 3’ of the first mismatch.

[0278] Aspect 12. The double-stranded RNA of any one of aspects 1, 2, and 11, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 9 to 13 bases 3’ of the first mismatch.

[0279] Aspect 13. The double-stranded RNA of any one of aspects 1, 2, and 11, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 9 to 13 bases 3’ of the first mismatch.

[0280] Aspect 14. The double-stranded RNA of any one of aspects 1, 2, and 11, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and wherein the firstAtty. Dkt: IRIS-002WO substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 9 to 13 bases 3’ of the first mismatch.

[0281] Aspect 15. The double-stranded RNA of any one of aspects 11-14, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.

[0282] Aspect 16. The double-stranded RNA of any one of aspects 11-14, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

[0283] Aspect 17. The double-stranded RNA of aspect 1 or aspect 2, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region.

[0284] Aspect 18. The double-stranded RNA of aspect 1 or aspect 2, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, and wherein the second, third, and fourth mismatches are from 9 to 13 bases 3’ of the first mismatch.

[0285] Aspect 19. The double-stranded RNA of any one of aspects 1, 2, and 18, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 9 to 13 bases 3’ of the first mismatch.

[0286] Aspect 20. The double-stranded RNA of any one of aspects 1, 2, and 18, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering ofAtty. Dkt: IRIS-002WO GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 9 to 13 bases 3’ of the first mismatch.

[0287] Aspect 21. The double-stranded RNA of any one of aspects 1, 2, and 18, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 9 to 13 bases 3’ of the first mismatch.

[0288] Aspect 22. The double-stranded RNA of any one of aspects 18-21, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

[0289] Aspect 23. The double-stranded RNA of aspect 1 or aspect 2, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is from 8 to 12 bases 3’ of the first mismatch.

[0290] Aspect 24. The double-stranded RNA of any one of aspects 1, 2, and 23, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), and the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch.

[0291] Aspect 25. The double-stranded RNA of any one of aspects 1, 2, and 23, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch.Atty. Dkt: IRIS-002WO

[0292] Aspect 26. The double-stranded RNA of any one of aspects 1, 2, and 23, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch.

[0293] Aspect 27. The double-stranded RNA of any one of aspects 23-26, wherein the first strand comprises no more than 2 mismatches with the target CAG repeat region.

[0294] Aspect 28. The double-stranded RNA of any one of aspects 23-26, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.

[0295] Aspect 29. The double-stranded RNA of any one of aspects 23-26, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

[0296] Aspect 30. The double-stranded RNA of aspect 1 or aspect 2, wherein the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first strand comprises a second mismatch and a third mismatch to the target CAG repeat region, and wherein the second and third mismatches are from 8 to 12 bases 3’ of the first mismatch.

[0297] Aspect 31. The double-stranded RNA of any one of aspects 1, 2, and 30, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 8 to 12 bases 3’ of the first mismatch.

[0298] Aspect 32. The double-stranded RNA of any one of aspects 1, 2, and 30, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 8 to 12 bases 3’ of the first mismatch.

[0299] Aspect 33. The double-stranded RNA of any one of aspects 1, 2, and 30, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of theAtty. Dkt: IRIS-002WO nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 8 to 12 bases 3’ of the first mismatch.

[0300] Aspect 34. The double-stranded RNA of any one of aspects 30-33, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.

[0301] Aspect 35. The double-stranded RNA of any one of aspects 30-33, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

[0302] Aspect 36. The double-stranded RNA of aspect 1 or aspect 2, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, and wherein the second, third, and fourth mismatches are from 8 to 12 bases 3’ of the first mismatch.

[0303] Aspect 37. The double-stranded RNA of any one of aspects 1, 2, and 36, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 743), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 8 to 12 bases 3’ of the first mismatch.

[0304] Aspect 38. The double-stranded RNA of any one of aspects 1, 2, and 36, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 8 to 12 bases 3’ of the first mismatch.

[0305] Aspect 39. The double-stranded RNA of any one of aspects 1, 2, and 36, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution ofAtty. Dkt: IRIS-002WO the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 8 to 12 bases 3’ of the first mismatch.

[0306] Aspect 40. The double-stranded RNA of any one of aspects 36-39, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

[0307] Aspect 41. The double-stranded RNA of aspect 1 or aspect 2, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is from 7 to 11 bases 3’ of the first mismatch.

[0308] Aspect 42. The double-stranded RNA of any one of aspects 1, 2, or 41, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), and wherein the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch.

[0309] Aspect 43. The double-stranded RNA of any one of aspects 1, 2, or 41, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and wherein the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch.

[0310] Aspect 44. The double-stranded RNA of any one of aspects 1, 2, or 41, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and wherein the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch.

[0311] Aspect 45. The double-stranded RNA of any one of aspects 41-44, wherein the first strand comprises no more than 2 mismatches with the target CAG repeat region.Atty. Dkt: IRIS-002WO

[0312] Aspect 46. The double-stranded RNA of any one of aspects 41-44, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.

[0313] Aspect 47. The double-stranded RNA of any one of aspects 41-44, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

[0314] Aspect 48. The double-stranded RNA of aspect 1 or aspect 2, wherein the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)), wherein the first strand comprises a second mismatch and a third mismatch to the target CAG repeat region, and wherein the second and third mismatches are from 7 to 11 bases 3’ of the first mismatch.

[0315] Aspect 49. The double-stranded RNA of any one of aspects 1, 2, or 48, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 7 to 11 bases 3’ of the first mismatch.

[0316] Aspect 50. The double-stranded RNA of any one of aspects 1, 2, or 48, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 7 to 11 bases 3’ of the first mismatch.

[0317] Aspect 51. The double-stranded RNA of any one of aspects 1, 2, or 48, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 7 to 11 bases 3’ of the first mismatch.

[0318] Aspect 52. The double-stranded RNA of any one of aspects 48-51, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.Atty. Dkt: IRIS-002WO

[0319] Aspect 53. The double-stranded RNA of any one of aspects 48-51, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

[0320] Aspect 54. The double-stranded RNA of aspect 1 or aspect 2, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)), wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, and wherein the second, third, and fourth mismatches are from 1 to 6 bases 3’ of the first mismatch.

[0321] Aspect 55. The double-stranded RNA of aspect 1, 2, or 54, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 7 to 11 bases 3’ of the first mismatch.

[0322] Aspect 56. The double-stranded RNA of aspect 1, 2, or 54, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:2), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 7 to 11 bases 3’ of the first mismatch.

[0323] Aspect 57. The double-stranded RNA of aspect 1, 2, or 54, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 7 to 11 bases 3’ of the first mismatch.Atty. Dkt: IRIS-002WO

[0324] Aspect 58. The double-stranded RNA of any one of aspects 54-57, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

[0325] Aspect 59. The double-stranded RNA of aspect 1 or aspect 2, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is from 6 to 10 bases 3’ of the first mismatch.

[0326] Aspect 60. The double-stranded RNA of any one of aspects 1, 2, and 59, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), and the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch.

[0327] Aspect 61. The double-stranded RNA of any one of aspects 1, 2, and 59, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and the second substitution generates the ...

Claims

Atty. Dkt: IRIS-002WO CLAIMS What is claimed is:

1. A double-stranded RNA comprising a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region; and ii) at least a second mismatch to the target CAG repeat region, wherein: i) when the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)), the second mismatch is from 9 to 13 bases 3’ of the first mismatch; ii) when the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), the second mismatch is from 8 to 12 bases 3’ of the first mismatch; iii) when the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)), the second mismatch is from 7 to 11 bases 3’ of the first mismatch; and iv) when the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)), the second mismatch is from 6 to 10 bases 3’ of the first mismatch.

2. The double-stranded RNA of claim 1, wherein each mismatch is generated by a substitution that is independently selected from:Atty. Dkt: IRIS-002WO a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; c) a substitution of a C with an A, a U, or a G.

3. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is from 9 to 13 bases 3’ of the first mismatch.

4. The double-stranded RNA of any one of claims 1-3, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1) and the second substitution generates the second mismatch and is from 9 to 13 bases 3’ of the first mismatch.

5. The double-stranded RNA of any one of claims 1-3, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and the second substitution generates the second mismatch and is from 9 to 13 bases 3’ of the first mismatch.

6. The double-stranded RNA of any one of claims 1-3, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and the second substitution generates the second mismatch and is from 9 to 13 bases 3’ of the first mismatch.

7. The double-stranded RNA of any one of claims 3-6, wherein the first strand comprises no more than 2 mismatches with the target CAG repeat region.Atty. Dkt: IRIS-002WO 8. The double-stranded RNA of any one of claims 3-6, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.

9. The double-stranded RNA of any one of claims 3-6, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

10. The double-stranded RNA of claim 3 or claim 4, wherein the first strand comprises a nucleotide sequence selected from the group consisting of: CUGCUGCAGCUGCUGCAGCUG (SEQ ID NO:51); CUGCUGCAGCUGCUGCUACUG (SEQ ID NO:52); CUGCUGCAGCUGCUGCUGAUG (SEQ ID NO:53); CUGCUGCAGCUGCUGCUGCAG (SEQ ID NO:54); and CUGCUGCAGCUGCUGCUGCUA (SEQ ID NO:55).

11. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); wherein the first strand comprises a second mismatch and a third mismatch to the target CAG repeat region, and wherein the second and third mismatches are from 9 to 13 bases 3’ of the first mismatch.

12. The double-stranded RNA of any one of claims 1, 2, and 11, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 9 to 13 bases 3’ of the first mismatch.

13. The double-stranded RNA of any one of claims 1, 2, and 11, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 9 to 13 bases 3’ of the first mismatch.Atty. Dkt: IRIS-002WO 14. The double-stranded RNA of any one of claims 1, 2, and 11, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 9 to 13 bases 3’ of the first mismatch.

15. The double-stranded RNA of any one of claims 11-14, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.

16. The double-stranded RNA of any one of claims 11-14, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

17. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region.

18. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, and wherein the second, third, and fourth mismatches are from 9 to 13 bases 3’ of the first mismatch.

19. The double-stranded RNA of any one of claims 1, 2, and 18, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourthAtty. Dkt: IRIS-002WO substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 9 to 13 bases 3’ of the first mismatch.

20. The double-stranded RNA of any one of claims 1, 2, and 18, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 9 to 13 bases 3’ of the first mismatch.

21. The double-stranded RNA of any one of claims 1, 2, and 18, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 9 to 13 bases 3’ of the first mismatch.

22. The double-stranded RNA of any one of claims 18-21, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

23. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is from 8 to 12 bases 3’ of the first mismatch.

24. The double-stranded RNA of any one of claims 1, 2, and 23, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUGAtty. Dkt: IRIS-002WO (SEQ ID NO:1), and the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch.

25. The double-stranded RNA of any one of claims 1, 2, and 23, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch.

26. The double-stranded RNA of any one of claims 1, 2, and 23, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and the second substitution generates the second mismatch and is from 8 to 12 bases 3’ of the first mismatch.

27. The double-stranded RNA of any one of claims 23-26, wherein the first strand comprises no more than 2 mismatches with the target CAG repeat region.

28. The double-stranded RNA of any one of claims 23-26, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.

29. The double-stranded RNA of any one of claims 23-26, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

30. The double-stranded RNA of claim 1 or claim 2, wherein the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first strand comprises a second mismatch and a third mismatch to the target CAG repeat region, and wherein the second and third mismatches are from 8 to 12 bases 3’ of the first mismatch.

31. The double-stranded RNA of any one of claims 1, 2, and 30, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUGAtty. Dkt: IRIS-002WO (SEQ ID NO:1), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 8 to 12 bases 3’ of the first mismatch.

32. The double-stranded RNA of any one of claims 1, 2, and 30, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 8 to 12 bases 3’ of the first mismatch.

33. The double-stranded RNA of any one of claims 1, 2, and 30, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 8 to 12 bases 3’ of the first mismatch.

34. The double-stranded RNA of any one of claims 30-33, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.

35. The double-stranded RNA of any one of claims 30-33, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

36. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, and wherein the second, third, and fourth mismatches are from 8 to 12 bases 3’ of the first mismatch.

37. The double-stranded RNA of any one of claims 1, 2, and 36, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates theAtty. Dkt: IRIS-002WO first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO: 743), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 8 to 12 bases 3’ of the first mismatch.

38. The double-stranded RNA of any one of claims 1, 2, and 36, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 8 to 12 bases 3’ of the first mismatch.

39. The double-stranded RNA of any one of claims 1, 2, and 36, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 8 to 12 bases 3’ of the first mismatch.

40. The double-stranded RNA of any one of claims 36-39, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

41. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is from 7 to 11 bases 3’ of the first mismatch.Atty. Dkt: IRIS-002WO 42. The double-stranded RNA of any one of claims 1, 2, or 41, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), and wherein the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch.

43. The double-stranded RNA of any one of claims 1, 2, or 41, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and wherein the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch.

44. The double-stranded RNA of any one of claims 1, 2, or 41, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and wherein the second substitution generates the second mismatch and is from 7 to 11 bases 3’ of the first mismatch.

45. The double-stranded RNA of any one of claims 41-44, wherein the first strand comprises no more than 2 mismatches with the target CAG repeat region.

46. The double-stranded RNA of any one of claims 41-44, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.

47. The double-stranded RNA of any one of claims 41-44, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

48. The double-stranded RNA of claim 1 or claim 2, wherein the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)), wherein the first strand comprises a secondAtty. Dkt: IRIS-002WO mismatch and a third mismatch to the target CAG repeat region, and wherein the second and third mismatches are from 7 to 11 bases 3’ of the first mismatch.

49. The double-stranded RNA of any one of claims 1, 2, or 48, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 7 to 11 bases 3’ of the first mismatch.

50. The double-stranded RNA of any one of claims 1, 2, or 48, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 7 to 11 bases 3’ of the first mismatch.

51. The double-stranded RNA of any one of claims 1, 2, or 48, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 7 to 11 bases 3’ of the first mismatch.

52. The double-stranded RNA of any one of claims 48-51, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.

53. The double-stranded RNA of any one of claims 48-51, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

54. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 10 based on the numberingAtty. Dkt: IRIS-002WO of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)), wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, and wherein the second, third, and fourth mismatches are from 1 to 6 bases 3’ of the first mismatch.

55. The double-stranded RNA of claim 1, 2, or 54, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 7 to 11 bases 3’ of the first mismatch.

56. The double-stranded RNA of claim 1, 2, or 54, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:2), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 7 to 11 bases 3’ of the first mismatch.

57. The double-stranded RNA of claim 1, 2, or 54, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 7 to 11 bases 3’ of the first mismatch.

58. The double-stranded RNA of any one of claims 54-57, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.Atty. Dkt: IRIS-002WO 59. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is from 6 to 10 bases 3’ of the first mismatch.

60. The double-stranded RNA of any one of claims 1, 2, and 59, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), and the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch.

61. The double-stranded RNA of any one of claims 1, 2, and 59, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), and the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch.

62. The double-stranded RNA of any one of claims 1, 2, and 59, wherein the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), and the second substitution generates the second mismatch and is from 6 to 10 bases 3’ of the first mismatch.

63. The double-stranded RNA of any one of claims 59-62, wherein the first strand comprises no more than 2 mismatches with the target CAG repeat region.

64. The double-stranded RNA of any one of claims 59-62, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.Atty. Dkt: IRIS-002WO 65. The double-stranded RNA of any one of claims 59-62, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

66. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); and wherein the first strand comprises a second mismatch and a third mismatch to the target CAG repeat region, and wherein the second and third mismatches are from 6 to 10 bases 3’ of the first mismatch.

67. The double-stranded RNA of any one of claims 1, 2, and 66, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 6 to 10 bases 3’ of the first mismatch.

68. The double-stranded RNA of any one of claims 1, 2, and 66, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 6 to 10 bases 3’ of the first mismatch.

69. The double-stranded RNA of any one of claims 1, 2, and 66, wherein the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 6 to 10 bases 3’ of the first mismatch.Atty. Dkt: IRIS-002WO 70. The double-stranded RNA of any one of claims 66-69, wherein the first strand comprises no more than 3 mismatches with the target CAG repeat region.

71. The double-stranded RNA of any one of claims 66-69, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

72. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 11 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)), wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, and wherein the second, third, and fourth mismatches are from 6 to 10 bases 3’ of the first mismatch.

73. The double-stranded RNA of any one of claims 1, 2, and 72, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 6 to 10 bases 3’ of the first mismatch.

74. The double-stranded RNA of any one of claims 1, 2, and 72, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 6 to 10 bases 3’ of the first mismatch.

75. The double-stranded RNA of any one of claims 1, 2, and 72, wherein the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequenceAtty. Dkt: IRIS-002WO UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 6 to 10 bases 3’ of the first mismatch.

76. The double-stranded RNA of any one of claims 72-75, wherein the first strand comprises no more than 4 mismatches with the target CAG repeat region.

77. A double-stranded RNA, comprising: A) a first strand that hybridizes to a target CAG repeat region of a CAG repeat containing RNA; and B) a second strand that hybridizes to the first strand, wherein: a) the first strand comprises a first mismatch, a second mismatch, and a third mismatch, wherein: i) the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); ii) the second mismatch is from 1 to 8 bases 3’ of the first mismatch; and iii) the third mismatch is from 9 to 13 bases 3’ of the first mismatch; b) the first strand comprises a first mismatch, a second mismatch, and a third mismatch, wherein: i) the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3); ii) the second mismatch is from 1 to 7 bases 3’ of the first mismatch; and iii) the third mismatch is from 8 to 12 bases 3’ of the first mismatch; c) the first strand comprises a first mismatch, a second mismatch, and a third mismatch, wherein: i) the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); ii) the second mismatch is from 1 to 6 bases 3’ of the first mismatch; andAtty. Dkt: IRIS-002WO iii) the third mismatch is from 7 to 11 bases 3’ of the first mismatch; d) the first strand comprises a first mismatch, a second mismatch, and a third mismatch, wherein: i) the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); ii) the second mismatch is from 1 to 5 bases 3’ of the first mismatch; and iii) the third mismatch is from 6 to 10 bases 3’ of the first mismatch; e) the first strand comprises a first mismatch, a second mismatch, a third mismatch, and a fourth mismatch, wherein: i) the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); ii) the second mismatch is from 1 to 8 bases 3’ of the first mismatch; iii) the third mismatch is from 1 to 8 bases 3’ of the first mismatch; and iv) the fourth mismatch is from 9 to 13 bases 3’ of the first mismatch; f) the first strand comprises a first mismatch, a second mismatch, a third mismatch, and a fourth mismatch, wherein: i) the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); ii) the second mismatch is from 1 to 8 bases 3’ of the first mismatch; iii) the third mismatch is from 9 to 13 bases 3’ of the first mismatch; and iv) the fourth mismatch is from 9 to 13 bases 3’ of the first mismatch; g) the first strand comprises a first mismatch, a second mismatch, a third mismatch, and a fourth mismatch, wherein: i) the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2Atty. Dkt: IRIS-002WO (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3); ii) the second mismatch is from 1 to 7 bases 3’ of the first mismatch; iii) the third mismatch is from 1 to 7 bases 3’ of the first mismatch; and iv) the fourth mismatch is from 8 to 12 bases 3’ of the first mismatch; h) the first strand comprises a first mismatch, a second mismatch, a third mismatch, and a fourth mismatch, wherein: i) the first mismatch is at position 9 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or SEQ ID NO:3 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3); ii) the second mismatch is from 1 to 7 bases 3’ of the first mismatch; iii) the third mismatch is from 8 to 12 bases 3’ of the first mismatch; and iv) the fourth mismatch is from 8 to 12 bases 3’ of the first mismatch; i) the first strand comprises a first mismatch, a second mismatch, a third mismatch, and a fourth mismatch, wherein: i) the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); ii) the second mismatch is from 1 to 6 bases 3’ of the first mismatch; iii) the third mismatch is from 1 to 6 bases 3’ of the first mismatch; and iv) the fourth mismatch is from 7 to 11 bases 3’ of the first mismatch; j) the first strand comprises a first mismatch, a second mismatch, a third mismatch, and a fourth mismatch, wherein: i) the first mismatch is at position 10 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); ii) the second mismatch is from 1 to 6 bases 3’ of the first mismatch; iii) the third mismatch is from 7 to 11 bases 3’ of the first mismatch; and iv) the fourth mismatch is from 7 to 11 bases 3’ of the first mismatch;Atty. Dkt: IRIS-002WO k) the first strand comprises a first mismatch, a second mismatch, a third mismatch, and a third mismatch, wherein: i) the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); ii) the second mismatch is from 1 to 5 bases 3’ of the first mismatch; iii) the third mismatch is from 1 to 5 bases 3’ of the first mismatch; and iv) the fourth mismatch is from 6 to 10 bases 3’ of the first mismatch; or l) the first strand comprises a first mismatch, a second mismatch, a third mismatch, and a third mismatch, wherein: i) the first mismatch is at position 11 based on the numbering of SEQ ID NO:1 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:1)), SEQ ID NO:2 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:2)), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:3)); ii) the second mismatch is from 1 to 5 bases 3’ of the first mismatch; iii) the third mismatch is from 6 to 10 bases 3’ of the first mismatch; and iv) the fourth mismatch is from 6 to 10 bases 3’ of the first mismatch. wherein each mismatch is generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; c) a substitution of a C with an A, a U, or a G.

78. A double-stranded RNA comprising a first strand and a second strand, wherein the first strand comprises a nucleotide sequence selected from any one of the nucleotide sequences depicted in FIG. 7, FIG.8A-8C, FIG.9A-9L, FIG.10 (Table 3), and FIG.12 (Table 5).

79. The double-stranded RNA of any one of claims 1-78, wherein the second strand is 100% complementary to the first strand.Atty. Dkt: IRIS-002WO 80. The double-stranded RNA of any one of claims 1-78, wherein the second strand comprises from 1 to 10 mismatches, from 3 to 5 mismatches, from 4 to 7 mismatches, or from 5 to 10 mismatches, to the first strand.

81. The double-stranded RNA of any one of claims 1-80, wherein: a) the first strand and the second strand of the double-stranded RNA each has a length of from 18 bases to 25 nucleotides, from 19 to 25 nucleotides, from 19 to 23 nucleotides, or from 19 to 21 nucleotides; and / or b) the double- stranded RNA has a total length of from 36 nucleotides 40 nucleotides, from 40 nucleotides to 45 nucleotides, from 45 nucleotides to 50 nucleotides, from 50 nucleotides to 60 nucleotides, or from 60 nucleotides to 75 nucleotides.

82. The double-stranded RNA of any one of claims 1-80, wherein the first strand and the second strand of the double-stranded RNA each has a length of from 21 nucleotides to 25 nucleotides.

83. The double-stranded RNA of any one of claims 1-82, wherein the nucleotide at position 1 of the dsRNA is an A or a U.

84. A DNA molecule comprising a nucleotide sequence encoding the first strand as set forth in any one of claims 1-83, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.

85. A recombinant nucleic acid comprising: a1) the double-stranded RNA of any one of claims 1-83; and b1) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; iv) the second strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA; or a2) the double-stranded RNA of any one of claims 1-83; andAtty. Dkt: IRIS-002WO b2) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; iv) the first strand of the double-stranded RNA; and v) the 3’ flanking polynucleotide; wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA; or a3) the double-stranded RNA of any one of claims 1-83; and b3) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the second strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA; or a4) the double-stranded RNA of any one of claims 1-83; and b4) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

86. The recombinant nucleic acid of claim 85, wherein the recombinant nucleic acid comprises: a) the 5’ flanking polynucleotide; b) the first strand of the double-stranded RNA; c) the loop polynucleotide;Atty. Dkt: IRIS-002WO d) the second strand of the double-stranded RNA; and e) the 3’ flanking polynucleotide.

87. The recombinant nucleic acid of claim 85 or claim 86, wherein the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33.

88. The recombinant nucleic acid of claim 85, wherein the recombinant nucleic acid comprises: a) the 5’ flanking polynucleotide; b) the first strand of the double-stranded RNA; c) the second strand of the double-stranded RNA; and d) the 3’ flanking polynucleotide.

89. The recombinant nucleic acid of claim 85 or claim 86, wherein the 5’ flanking polynucleotide and the 3’ flanking polynucleotide are derived from miR451.

90. A DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid according to any one of claims 85-89.

91. The DNA molecule of claim 90, wherein the 5’ flanking polynucleotide is encoded by the nucleotide sequence: tgcacacctcctggcgggcagctctg (SEQ ID NO:6).

92. The DNA molecule of claim 90 or claim 91, wherein the loop polynucleotide is encoded by the nucleotide sequence: tgttctggcaatacctg (SEQ ID NO:7).

93. The DNA molecule of any one of claims 90-92, wherein the 3’ flanking polynucleotide is encoded by the nucleotide sequence: gggaggcctgccctgactgcccac (SEQ ID NO:8).

94. The DNA molecule of claim 90, wherein the 5’ flanking polynucleotide is encoded by the nucleotide sequence acctactgactgccagggcacttgggaatggcaagg (SEQ ID NO:9).

95. The DNA molecule of claim 90 or claim 94, wherein the 3’ flanking polynucleotide is encoded by the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaac (SEQ ID NO:10).

96. The DNA molecule of claim 90, wherein:Atty. Dkt: IRIS-002WO i) the 5’ flanking polynucleotide is encoded by the nucleotide sequence acctactgactgccagggcacttgggaatggcaagg (SEQ ID NO:9); and ii) the 3’ flanking polynucleotide is encoded by the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaac (SEQ ID NO:10) 97. A recombinant expression vector comprising the DNA molecule of any one of claims 90-96.

98. The recombinant expression vector of claim 97, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.

99. The recombinant expression vector of claim 98, wherein the promoter is an RNA polymerase II promoter or an RNA polymerase III promoter.

100. The recombinant expression vector of claim 98 or claim 99, wherein the promoter is a CAG promoter, a CBA promoter, a CMV promoter, a U6 promoter, an EF1α promoter, or an H1 promoter.

101. The recombinant expression vector of any one of claims 97-101, wherein the recombinant expression vector comprises a 5’ adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.

102. A recombinant expression vector comprising a nucleotide sequence encoding the recombinant nucleic acid of any one of claims 85-89.

103. The recombinant expression vector of claim 102, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.

104. The recombinant expression vector of claim 103, wherein the promoter is an RNA polymerase II promoter or an RNA polymerase III promoter.

105. The recombinant expression vector of claim 103 or claim 104, wherein the promoter is a CAG promoter, a CBA promoter a CMV promoter, a U6 promoter, an EF1α promoter, or an H1 promoter.Atty. Dkt: IRIS-002WO 106. The recombinant expression vector of any one of claims 97-105, wherein the recombinant expression vector comprises a 5’ adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.

107. A delivery vehicle comprising the recombinant expression vector of any one of claims 97-106.

108. The delivery vehicle of claim 107, wherein the delivery vehicle a non-viral delivery vehicle.

109. The delivery vehicle of claim 108, wherein the delivery vehicle is a lipid nanoparticle.

110. The delivery vehicle of claim 107, wherein the delivery vehicle is a viral particle.

111. A viral particle comprising the recombinant expression vector of any one of claims 97- 106.

112. The viral particle of claim 111, wherein the viral particle is an adeno-associated virus (AAV) particle.

113. The viral particle of claim 112, wherein the AAV particle comprises an AAV9 capsid.

114. The viral particle of claim 112, wherein the AAV particle comprises an AAV2 capsid.

115. A composition comprising: a) the recombinant expression vector of any one of claims 97-106; and b) a pharmaceutically acceptable excipient.

116. A composition comprising: a) the delivery vehicle of any one of claims 107-110; and b) a pharmaceutically acceptable excipient.

117. A composition comprising: a) a viral particle comprising the recombinant expression vector of any one of claims 97-106; and b) a pharmaceutically acceptable excipient.Atty. Dkt: IRIS-002WO 118. A method for selectively reducing translation of a disease-associated CAG repeat- containing RNA in an individual having a CAG repeat expansion disorder, the method comprising administering to the individual an effective amount of the expression vector of any one of claims 97-106, delivery vehicle of any one of claims 107-110, the viral particle of any one of claims 111-114, or the pharmaceutical composition of any one of claims 115-117.

119. The method of claim 118, wherein the repeat expansion disorder is Huntington’s disease, spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3, spinocerebellar ataxia type 6, spinocerebellar ataxia type 7, spinocerebellar ataxia type 12, spinocerebellar ataxia type 17, spinal and bulbar muscular atrophy, dentatorubral pallidoluysian atrophy, amyotrophic lateral sclerosis, myotonic dystrophy type 1, Fuchs’ endothelial corneal dystrophy, branchiootorenal syndrome 2, or cleidocranial dysplasia.

120. The method of claim 118 or claim 119, wherein said administering comprises direct injection to the central nervous system of the individual.

121. The method of claim 120, wherein the direct injection is intracerebral ventricular injection, intraparenchymal injection, intrathecal injection, intrastriatal injection, intrathalamic injection, intracisternal magna injection, subpial injection, or any combination thereof.

122. The method of any one of claims 118-121, wherein said administering provides for a ratio of a polypeptide encoded by the non-disease-associated CAG repeat-containing RNA to a polypeptide encoded by disease-associated CAG repeat-containing RNA of greater than 1.

0.

123. The method of any one of claims 118-122, wherein said administering provides for a ratio of a polypeptide encoded by non-disease-associated CAG repeat-containing RNA to a polypeptide encoded by disease-associated CAG repeat-containing RNA of from 1.1 to 1.

8.

124. The method of any one of claims 118-122, wherein said administering provides for a ratio of a polypeptide encoded by non-disease-associated CAG repeat-containing RNA to a polypeptide encoded by disease-associated CAG repeat-containing RNA of greater than 1.8.

Images