C3d immunotherapies

EP4698557A2Pending Publication Date: 2026-02-25THE RGT UNIV OF MICHIGAN
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024793419
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-04-17
Filing Date
2024-04-17
Publication Date
2026-02-25

AI Technical Summary

Technical Problem

Current cancer treatments, such as surgery, chemotherapy, and radiation therapy, often result in significant side effects including immune system suppression, destruction of normal cells, and the onset of secondary cancers, and are ineffective in differentiating between malignant and non-malignant plasma cells in diseases like multiple myeloma.

Method used

Administration of recombinant modified complement 3d (C3d) compositions, specifically with a protein transduction domain, to facilitate cellular uptake and induce anti-tumor cellular immunity, reducing tumor burden while sparing normal cells and preserving immune function.

Benefits of technology

The recombinant C3d compositions effectively decrease tumor burden, induce remission, and eliminate malignant clones with high mutation burdens, while maintaining normal immune function and minimizing toxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024025032_24102024_PF_FP_ABST
    Figure US2024025032_24102024_PF_FP_ABST
Patent Text Reader

Abstract

The disclosure provides modified complement 3d (C3d), compositions containing modified C3d, and methods of using the C3d compositions to treat diseases and disorders, for examples, disease and disorders characterized by evasion of immune surveillance and / or tumor-induced immunosuppression (e.g., multiple myeloma and other plasma cell malignancies).
Need to check novelty before this filing date? Find Prior Art

Description

C3D IMMUNOTHERAPIESFIELD

[0001] The disclosure provides modified complement 3d (C3d), compositions containing modified C3d, and methods of using the C3d compositions to treat diseases and disorders, for examples, disease and disorders characterized by evasion of immune surveillance and / or tumor- induced immunosuppression (e.g., multiple myeloma and other plasma cell malignancies).STATEMENT REGARDING FEDERALLY-SPONSORED RESEARCH

[0002] This invention was made with government support under W81XWH-18-1-0721 awarded by the U.S Army. The government has certain rights in the invention.SEQUENCE LISTING STATEMENT

[0003] The contents of the electronic sequence listing titled UM-41751-601-ST26. xml (Size: 12,653 bytes; and Date of Creation: April 17, 2024) is herein incorporated by reference in its entirety.BACKGROUND

[0004] Cancer is one of the most devastating diseases both in terms of human life opportunity loss and health care cost. It also presents unmet clinical needs. Cancer is typically treated with surgery, chemotherapy, radiation therapy, or a combination thereof. These treatments, however, often have significant side effects including immune system suppression, destruction of normal cells in the body, aberrant cellular metabolism, and even metastasis and the onset of secondary cancer.SUMMARY

[0005] The disclosure provides modified complement 3d (C3d), compositions containing modified C3d, and methods of using the C3d compositions to treat diseases and disorders, for example, cancer and disease and disorders characterized by evasion of immune surveillance and / or tumor-induced immunosuppression (e.g., multiple myeloma and other plasma cell malignancies).

[0006] In some embodiments, the disclosure provides a method of treating cancer in a subject comprising administering recombinant C3d or compositions comprising recombinantC3d to the subject whereupon the cancer is treated. In some embodiments, recombinant C3d isconfigured to comprise a domain that causes C3d to associate with cells. In some embodiments, the cell association domain is a short peptide that facilitate cellular intake and / or uptake of C3d (e.g., a cell-penetrating peptide or protein transduction domain). In some embodiments, recombinant C3d comprises a protein transduction domain (PTD (e.g., at the N-terminus of C3d)). In some embodiments, administering recombinant C3d comprising a N-terminal PTD (PTD-C3d) or compositions comprising PTD-C3d to the subject reduces serum IgG and / or M protein in the subject. In some embodiments, administering PTD-C3d or compositions comprising PTD-C3d to the subject reduces paraproteinemia in the subject. In some embodiments, administering PTD-C3d or compositions comprising PTD-C3d to the subject leads to an increase in the production of polyclonal IgG in the subject. In some embodiments, administering PTD-C3d or compositions comprising PTD-C3d to the subject decreases tumor burden (e.g., decreases the burden of partially transformed pre-malignant cells and / or malignant cells (e.g., plasma cells)) in the subject. In some embodiments, administering PTD-C3d or compositions comprising PTD-C3d to the subject decreases the tumor burden while concurrently preserving non-malignant cells and / or normal plasma cell function in the subject. In some embodiments, administering PTD-C3d or compositions comprising PTD-C3d to the subject promotes clearance of malignant plasma cells in the subject (e.g., while concurrently not altering normal immune functionality in the subject). In some embodiments, administering PTD-C3d or compositions comprising PTD-C3d to the subject induces remission of cancer (e.g., malignant myeloma or other cancer) in the subject. In some embodiments, administering PTD-C3d or compositions comprising PTD-C3d to the subject eliminates malignant clones (e.g., that have highly mutated Ig and / or express Ig class switched isotypes) while concurrently preserving normal B cell development and / or non-malignant plasma cells.

[0007] In some embodiments, the compositions, methods, and agents disclosed herein comprise a modified, recombinant C3d polypeptide sequence comprising amino acids 1024 to 1320 of murine C3d, or a homologous amino acid sequence of human C3d, having a Cys (C) to Ser(S) substitution at position 1028 or equivalent mutation (e.g., that prevents formation of a free sulfhydryl group within the polypeptide). In some embodiments, the compositions, methods, and agents disclosed herein comprise C3d polypeptide sequence of SEQ ID NO.:2, or a nucleic acid encoding same. In other embodiments, the compositions, methods, and agents disclosed herein comprise C3d polypeptide sequence of SEQ ID NO.:7, or a nucleic acid encoding same. In someembodiments, the C3d polypeptide has an N-terminal protein transduction domain (PTD, also referred to as a cell penetrating peptide). The disclosure is not limited to any particular PTD. In some embodiments, the PTD comprises the amino acid sequence of SEQ ID NO.:3. In other embodiments, the PTD is a polypeptide that is similar in length (e.g., plus or minus 2 amino acids) and charge to SEQ ID NO.:3. Any PTD that facilitates uptake and / or delivery of C3d polypeptide across the plasma membrane and into cells may be used including any of the variety of PTDs known in the art. PTDs useful in the disclosure include, but are not limited to, tissuespecific and non-tissue specific peptides including cationic peptides (e.g., of 6-12 amino acids in length comprised predominantly of arginine, ornithine and / or lysine residues); hydrophobic peptides (e.g., leader sequences of secreted growth factors or cytokines) and amphipathic peptides or cell-type specific peptides (e.g., obtained by linking hydrophobic peptides to nuclear localizing signals and / or identified via screening of peptide phage display libraries).

[0008] In some embodiments, the disclosure relates to the treatment of cancer and to the prevention of cancer growth and / or metastasis. In particular, in some embodiments, the disclosure provides soluble C3d comprising an N-terminal PTD (PTD-C3d). In some embodiments, soluble PTD-C3d or a composition comprising soluble PTD-C3d is used in a method of generating anti-tumor cellular immunity in a subject via administering a therapeutically effective amount of soluble PTD-C3d to the subject. In other embodiments, the disclosure provides a method of blocking tumor-induced immunosuppression in a subject comprising administering to the subject an effective amount of soluble PTD-C3d, or a composition comprising soluble PTD-C3d, to the subject thereby blocking tumor induced immunosuppression in the subject. The disclosure is not limited to any particular mechanism of blocking tumor immunosuppression. In some embodiments, soluble PTD-C3d, or a composition comprising soluble PTD-C3d, inhibits tumor induced immunosuppression via apoptosis of T regulatory cells (e.g., during priming of anti-tumor immunity). In some embodiments, the antitumor properties of soluble PTD-C3d occurs via T-cell mediated immune responses. In some embodiments, soluble PTD-C3d clears tumors while concurrently sparing nonmalignant cells. In some embodiments, soluble PTD-C3d or a composition comprising soluble PTD-C3d is utilized in lieu of a checkpoint inhibitor and / or chimeric antigen receptor (CAR) T cell therapy for the treatment of cancer. In other embodiments, soluble PTD-C3d or a composition comprisingsoluble PTD-C3d is utilized together with one or more conventional cancer treatments (e.g., surgical intervention, radiation therapy, and / or chemotherapy).

[0009] The present disclosure is not limited by the type of cancer / tumor and / or lymphoma treated using recombinant modified C3d or a composition comprising recombinant modified C3d disclosed herein. Indeed, any type of cancer, cancer cell, tumor cell, malignancy, neoplasm, and / or lymphoma may be treated, including, but not limited to, cancers of the bladder, breast, colon, kidney, liver, lung, ovary, cervix, pancreas, rectum, prostate, stomach, epidermis; a hematopoietic tumor of lymphoid or myeloid lineage (e.g., leukemias, myelomas, and lymphomas); a tumor of mesenchymal origin such as a fibrosarcoma or rhabdomyosarcoma; other tumor types such as melanoma, teratocarcinoma, neuroblastoma, glioma, adenocarcinoma and / or non-small lung cell carcinoma. In some embodiments, the cancer is myeloma (e.g., multiple myeloma).

[0010] Recombinant, modified C3d compositions of the present disclosure can be coadministered with other agents in order to prevent diseases or to treat diseases. In some embodiments, recombinant modified C3d or a composition comprising recombinant modified C3d is co-administered with a cancer therapeutic or concurrently with a cancer therapy (e.g., radiation therapy, chemotherapy, surgical intervention).

[0011] The disclosure provides compositions and methods for the treatment of cancer in a subject by administering recombinant modified C3d (e.g., PTD-C3d) or a composition comprising recombinant modified C3d of the disclosure and optionally one or more cancer therapeutic agents to a subject with cancer. The disclosure is not limited by the type of cancer therapeutic agent co-administered. Indeed, any cancer therapeutic known to those of skill in the art may be used including, but not limited to, those disclosed herein. In one embodiment, administration of recombinant modified C3d or a composition comprising recombinant modified C3d and optionally one or more cancer therapeutic agents results in enhanced therapeutic efficacy and / or potency relative to administration of the recombinant modified C3d or a composition comprising recombinant modified C3d or the one or more cancer therapeutic agents alone. The disclosure is not limited by the route or frequency of administration of recombinant modified C3d or a composition comprising recombinant modified C3d of the disclosure. Any suitable route of administration can be used to introduce recombinant modified C3d of the disclosure into a subject including, but not limited to, intravenous, subcutaneous or intratumoradministration, or other route or means described herein and / or known in the art. For example, local or systemic delivery can be accomplished by administration comprising administration into body cavities, by parenteral introduction, comprising intramuscular, intravenous, intraportal, intrahepatic, peritoneal, subcutaneous, and / or intradermal administration. Recombinant modified C3d of the disclosure may be administered proceeding, following, or in lieu of other treatments and / or therapies for treating and / or preventing cancer (e.g., preventing new cancer and / or the spread of cancer). In one embodiment, following administration, cancer and / or tumor cell reduction (e.g., cancer and / or tumor cell killing) is detected wherein the cancer and / or tumor cell reduction is not detected in a subject prior to administering recombinant modified C3d. In another embodiment, subsequent to detecting cancer and / or tumor cell reduction in a subject, treatment of the patient with recombinant modified C3d is modified based on the cancer and / or tumor cell reduction detected in the patient.

[0012] In one embodiment, the disclosure provides compositions comprising recombinant modified C3d (e.g., soluble PTD-C3d) for use in generating anti-cancer and / or anti-tumor response (e.g., cancer or tumor cell reduction or killing, and / or a cancer or tumor cell immune response) in a subject. The composition may include additional active and / or inactive constituents. For example, in some embodiments the composition comprises inactive constituents such as buffers, excipients, and the like provided herein. In some embodiments, the composition comprises active constituents such as one or more therapeutics described herein. The disclosure is not limited by the source of recombinant modified C3d polypeptide. C3d polypeptide may be human C3d, non-human primate C3d, murine C3d, or other available C3d polypeptide sequence. In some embodiments, compositions and methods of the disclosure utilize the polypeptide of SEQ ID NO.:1. In some embodiments, compositions and methods of the disclosure utilize the polypeptide of SEQ ID NO.:2. In some embodiments, compositions and methods of the disclosure utilize the polypeptide of SEQ ID NO.:6. In some embodiments, compositions and methods of the disclosure utilize the polypeptide of SEQ ID NO.:7.

[0013] In some embodiments, all or a portion of the amino acid sequences of SEQ ID NO.:1, SEQ ID NO.:2, SEQ ID NO.:6, and / or SEQ ID NO.:7 may be used. In some embodiments, C3d used in the compositions and methods of the disclosure comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more sequence identity to the amino acid sequence of SEQ ID NO.:1, SEQ ID NO.:2, SEQ ID NO.:6, or SEQ ID NO.:7.

[0014] The disclosure also provides methods of manufacturing any one of the compositions comprising recombinant modified C3d described herein.

[0015] The disclosure further provides methods of using recombinant modified C3d (e.g., soluble PTD-C3d or compositions comprising soluble PTD-C3d) for treating (e.g., therapeutically and / or prophylactically) cancer in a patient. In a further embodiment, following administration of a composition comprising recombinant modified C3d of the disclosure to a patient, one or more immune responses to the cancer / tumor is detected (e.g., wherein the one or more immune responses are not detected the patient prior to administering the recombinant modified C3d composition). In yet a further embodiment, subsequent to detecting the one or more immune responses in the patient, treatment of the patient is modified (e.g., increased (e.g., the amount of cancer specific treatment (e.g., radiation, chemotherapy, surgical intervention) is augmented); decreased (e.g., the amount of cancer specific treatment (e.g., radiation, chemotherapy, surgical intervention) is reduced) and / or one or more additional treatments (e.g., the amount of cancer specific treatment (e.g., radiation, chemotherapy, surgical intervention) are started or discontinued.

[0016] The disclosure further provides compositions and kits comprising recombinant modified C3d according to the description provided herein.

[0017] A variety of therapeutic agents may be administered with recombinant modified C3d including, but not limited to, a chemotherapeutic, a corticosteroid, an immunosuppressant, an anti-inflammatory agent, an antibiotic, or any combination thereof.

[0018] Other aspects and embodiments of the disclosure will be apparent in light of the following detailed description and accompanying figures.BRIEF DESCRIPTION OF THE DRAWINGS

[0019] FIGS. 1A-1B show that C3d injection of Vk*myc mice decreases paraproteinemia. Vk*myc mice older and younger than one year (N>12), with detected M-protein, were injected with 20 microg C3d peptide intra-tibia two months before analysis. (FIG. 1A and IB) Shown is the change in the blood IgG concentration in Vk*myc following C3d or control injection. (FIG. 1C). M protein was detected by SPEP before and at the end of treatment. M protein seen as a single narrow band in the gamma region of the gel decreases in mice treated with C3d. Instead, a broad band of polyclonal Ig appears. In control mice the narrow band increases relative to thealbumin hand. A and B. Comparisons were by double tailed paired t test. **, P<0.01 ;***, PcO.OOl. C. Comparison was by two tailed Mann- Whitney test. ****, P<0.0001.

[0020] FIG. 2 shows that C3d induces CMI that in turn depletes malignant cells. Vk*myc mice older and younger than one year, (N>10), with detected M-protein, were injected with 20- 40 microg C3d peptide intra-tibia two months before analysis. M protein was detected by SPEP. Vk*myc were immunized twice, 2 months apart before treatment with C3d. (FIG. 2A). Tsne plots of mass cytometry (CYTOF) indicating the various cell clusters. (FIG. 2B). Typical CYTOF tsne plots of plasma cell clusters in purple and B cells (not plasma cells) in red. CYTOF analysis of a representative C57BL / 6 mouse of comparable age to the plots of the Vk*myc mice is shown in the far right (No MM mouse). (FIG. 2C). Frequency of plasma cells detected by CYTOF of bone marrow. (FIG. 2D-F). ELISPOT analysis of IgG antibody secreting cells ((FIG. 2D) or of NP-specific IgG ASC in BM ((FIG. 2E), or of NP-specific B cells in the Spleen, SP ((FIG. 2F), 2 months after treatment begun were injected with 20 microg C3d peptide or with PBS intra-tibia two months before analysis. (FIG. 2G-J). .Vk*myc mice treated as explained above mice were divided in two groups seven days after C3d injection. One group was treated with Cyclosporin (CsA) administered at a concentration of 3 mg / kg twice weekly for 7 weeks until end point, 2 months after C3d injection. (FIG. 2G and H). Serum IgG concentration before and after treatment. (FIG. 2H-J). Number of plasma cells determined by FACS counting CD19-, B2201o, CD138+ cells in 100,000 live cells. Analyses in (FIG. 2C-E) were by double tailed paired t test. **, P<0.01;***, PcO.OOl. (FIG. 2F and J). Comparison was by two tailed Mann- Whitney test. Ns=P>0.05.

[0021] FIG. 3 shows that C3d decreases malignant plasma cells sparing normal plasma cells. Vk*myc mice (N=l 1) were injected with 20 microg C3d peptide or with PBS intra-tibia two months before analysis. Malignancy and non-malignancy associated gene expression was analyzed in 3995 individual plasma cells obtained from the bone marrow of C3d or PBS injected mice. (FIG. 3A). UMAP plots of sc RNA gene expression depicting the different cell populations analyzed. (FIG. 3B). Graph depicts the differential expression of malignancy associated or non- malignancy associated genes in the upper and lower percentil 20 for each category and in each group of mice. Each horizontal line represents a gene, each vertical line represents a cell. (FIG. 3C). Graphs show PCA analysis of the expression of selected genes in the upper and lower percentil 20 associated with malignancy or non-malignancy in all the plasma cells analyzed fromboth C3d treated and untreated mice. The genes chosen contribute most of the difference between malignant and non-malignant cells. (FIGS. 3D and 3E). Clone relative expression of malignant or non-malignant genes in the upper and lower percentil 20, aggregated into scores. Two dimensions plots depicting gene expression scores from treated and untreated mice. Dots are plotted independently of clone size (FIG. 3D). The size and color of the circles represent the number of copies of each clonotype defined according to the CDR3 sequence ((FIG. 3E).

[0022] FIG. 4 shows that C3d treatment decreases the frequency of highly mutated malignant B cell clones and Ig class switched B cells in the BM but increases the frequency of normal maturing B cells. Vk*myc mice were injected with 20 microg C3d peptide or with PBS intratibia two months before analysis (N=8). Single cell V(D) J sequences were obtained using the 10X genomics kits followed by NGS. IgH+L sequences were further analyzed using the ARGalaxy software as well as the NCBI Ig Blast and IMGT suites. (FIG. 4A). Frequency distribution of Ig isotypes in 5 Vk-MYC* mice treated or not (Unt) with C3d. Comparison of the frequencies of IgM producing clones in the BM by Mann Whitney test of mice treated or not with C3d indicated P= 0.0157. IgGl frequencies also differed according to the treatment (P=0.0476 Mann Whitney test). (FIG. 4B). IgVH family frequencies in B cells in the bone marrow of Vk-MYC* mice treated or not (Unt) with C3d. (FIG. 4C). IgVH gene frequencies in B cells in the bone marrow of Vk-MYC* mice treated or not (Unt) with C3d. (FIGS. 4D and 4E). Typical Circos analysis of the V-J recombination in H chains obtained from bone marrow of mice C3d treated (FIG. 4D) or not (FIG. 4E) with C3d. The ribbons link each VH to their respective JH and the ribbon thickness is proportional to the number of sequences that express that combination. Around the circle the colored bars reflect each JH or VH. There are less colored ribbons in C3d treated mice (FIG. 4D) as compared to untreated (FIG. 4E) mice that have wider and / or more frequent VH-JH ribbons, indicative of clonal skewing. (FIG. 4F). CDR3 AA length distribution curves obtained from bone marrow B cells of mice C3d treated or not with C3d. Untreated CDR3 lengths are skewed and show a peak of 8 AA length. Comparison of the curves by the Wilcoxon matched ranks test indicates an exact P value of 0.0092. The area under the curves (AUC) is also indicated. (FIG. 4G). Graph shows the frequency of Ig clones with VH mutation frequencies above 2% and that were detected in more than 10 different cells. Each dot represents the average clone frequency in all the V(D)J sequences obtained from one mouse marrow. Data analysis by Mann Whitney test indicated a P= 0.0317. H. Number ofmutations per VH region in heavy chain sequences obtained from B cells isolated from the bone marrow of Vk-MYC* mice treated or not (Unt) with C3d. Each dot represents mutation frequencies in VH sequences in one cell. Each clonotype is counted only once. Frequencies were analyzed by ANOVA followed by Kruskal-Wallis multiple comparisons test. Comparisons that yielded P<0.0001 are noted by ****. Statistics analysis was by Prism software (v9 for mac).

[0023] FIG. 5 shows that C3d induces clonal-specific deletion of antigen-specific MM cells / destroys MM cells by promoting anti-MM cellular immunity. Vk*myc mice (N=8) were immunized 3 times with 4-hydrox-3-nitrophenyl(acetyl) (NP) coupled to Ovalbumin with 2 months intervals, starting at 8-10 weeks. Mice were injected with 20 microg C3d peptide or with PBS intra-tibia two months before analysis. Analysis of BM cells was by 10X genomics. (FIG. 5A). Graph depicts the frequency of VH1-72 usage in each mouse. VH1-72 is the main VH region recruited by NP antigens. Comparison was by the Mann Whitney test, P=0.0286. (FIG. 5B). The number of IgG or IgA VH1072 sequences in clones obtained from mice treated or not with C3d was compared by Fisher’s Exact test. P<0.0001. (FIGS. 5C and 5D). Seq2Logo depicting the CDR1 aminoacid motifs in B cell clones with VH 1-72 from mice treated (FIG. 5C) or not (FIG. 5D) with C3d. Stacks represent AA with the size of the letters proportional to their prevalence. Shown is the Kullback-Leibler Logo. AA below “0” depict depleted AA.Apparent is the depletion of L at position 8 (corresponding to AA33 in the VH sequence) in mice treated with C3d. The W33L mutation causes a 10X increase in affinity to the NP hapten. Seq2Logo is available online. (FIG. 5E). Graph depicts the number of sequences in each clone (dot), C3d N=115; PBS N=110). Results were compared by the Mann Whitney test, P=0.0006. (FIG. 5F). Number of mutations per VH1-72 regions in heavy chain sequences obtained from B cells isolated from the bone marrow of Vk-MYC* mice treated or not with C3d. Each dot represents mutation frequencies in VH sequences in one cell. Each clonotype is counted only once. Only VH regions with mutation frequencies above 10% are shown. Frequencies were analyzed by ANOVA followed by Kruskal-Wallis multiple comparisons test. Comparisons that yielded P<0.0001 are noted by ****. Statistics analysis was by Prism software (v9 for mac).

[0024] FIG. 6 shows murine C3d peptide sequence and purification. The C3d peptide sequence encompasses amino acids 1024 to 1320 of the C3d region of murine C3. The sequence includes a N-terminal protein transduction domain (RKKRRQRRR) and Cys (C) to Ser (S) substitution at position 1028 of C3 to avoid the presence of a free sulfhydryl in the recombinantpeptide. The C3d sequence was cloned into a baculovirus expression vector, and used to transduce Sf9 insect cells. Large-scale production for purification was done in High-five infected at an MOI of 2. Purification was done using NTA Agarose from Qiagen and eluted with imidazole in PBS. The samples were analyzed on a 4-20% gradient SDS-PAGE. The monomer was detected in the soluble (shown) and in the insoluble fractions (not shown). Aliquots of Img / ml were prepared and mice were injected with 20 microliters, containing 20 micrograms of peptide in PBS intra tibia.

[0025] FIG. 7 shows detection of M protein. M protein was detected by SPEP before and at 2 months after treatment in mice treated with C3d and in controls. M protein seen as a single narrow band in the gamma region of the gel decreases in mice treated with C3d. Instead, a broad band of polyclonal Ig appears. In control mice the narrow band increases in intensity relative to the albumin band and remains narrow.

[0026] FIGS . 8 A-D show C3d decreases tumor load without changing other cell populations in the BM. Vk*myc mice older and younger than one year, with detected M-protein, were injected with 20-40 microg C3d peptide intra-tibia two months before analysis. Vk*myc were immunized twice, 2 months apart before treatment with C3d. M protein was detected by SPEP. (FIG. 8A) Tsne plots of mass cytometry (CYTOF) indicating plasma cell clusters in purple. (FIG. 8B) Frequency of plasma cells detected by CYTOF of bone marrow or by FACS. (FIG. 8C) Graph depicts frequencies of plasma cells in the treated or control mice divides according to age at beginning of treatment assessed by mass cytometry. (FIG. 8D). Analysis of the frequency of non-plasma cell bone marrow cell populations by mass cytometry. Frequencies of the total number of cells are indicated. Data analysis was by Mann-Whitney test. Comparisons that yielded P<0.05 are noted by **, P=0.0022; *, P=0.0286. Statistics analysis was by Prism software (v9 for mac).

[0027] FIGS. 9A-C show UMAP plots of sc RNA gene expression depicting the different cell populations. (FIG. 9A) The graphs depict two paired samples treated (C3d) or not treated (Ctrl) with C3d. (FIG. 9B) UMAP plots of every sample considered in the analysis. (FIG. 9C) Gene expression of markers used to differentiate between cell populations. Y-axis depicts the names of the cell types; the X-axis depicts the gene identity. Expression is noted according to the number of cells that express the marker above background (diameter of the circle increases with the fraction of cells expressing the marker); The average intensity is represented by a colorgradient varying from white (no expression) to purple (mid intensity expression) and to blue (maximum expression).

[0028] FIG. 10 shows circos analysis of the V-J recombination in H chains obtained from bone marrow of mice treated or not treated with C3d. The ribbons link each VH to their respective JH and the ribbon thickness is proportional to the number of sequences that express that combination. Around the circle the colored bars reflect each JH or VH. Figure shows that C3d treated mice there are les colored ribbons that are thinner as compared to control mice that have wider and / or more frequent VH-JH ribbons.

[0029] FIG. 11 shows analysis of differential gene expression in granulocytes. Graph shows a volcano plot analysis indicating that granulocytes obtained from the bone marrow of mice treated with C3d had increased expression of C-X-C motif chemokine ligand 2, Cxcl2, and Interferon Alpha- Inducible Protein 27-Like Protein, 1112712a, compared to granulocytes obtained from control animals. X-axis depicts the fold change (Log2) and the Y-axis depicts the adjusted p-values (Log 10) according to the false discovery rate method.

[0030] FIGS. 12A-D show Multiple Myeloma nephropathy. FIG. 12A Controls. Shown are H&E staining of frozen sections obtained from mice treated or not with C3d two months after treatment. Typical lesions observed in controls are collagen and amyloid deposits (FIG. 12A). In control and treated mice there are frequent proteinaceous casts (arrow), (FIGS. 12B and D).Figure also shows in (FIG. 12C) calcium phosphate crystals. The features observed are found in human subjects with Multiple Myeloma.

[0031] FIG. 13 shows Ig light chain deposition in kidney sections. Shown are typical frozen sections obtained from mice treated or not with C3d two months after treatment. The pictures indicate increased deposition of kappa light chains in the glomeruli of control mice in comparison to mice treated with C3d. Figure is representative of observation of 5 sections per mouse (N=5 per group). Pictures were obtained with a Leica DMI6000B microscope equipped with a Leica DFC360 FX monochrome digital camera and a Leica HCX PL FLUOTAR L 40X / 0.60 CORR PH2 microscope objective (Leica Microsystems, Wetzlar, Germany). At least 5 fields were imaged at 400x magnification via QCapture Pro 7 software (Qlmaging, Surrey, Canada, RRID:SCR_014432).

[0032] FIG. 14 provides the amino acid sequence of residues 1024- 1320 of human C3d (SEQ ID NO.: SEQ ID NO.:6); amino acid sequence of residuesl024-1320 of human C3d having aCys (C) to Ser(S) substitution at position 1028 (SEQ ID NO.:7); amino acid sequence of residues 1024- 1320 of human C3d having a Cys (C) to Scr(S) substitution at position 1028 and also having an N-terminal PTD (SEQ ID NO.:8).

[0033] FIG. 15 shows that C3d treatment increases MHC class-I expression by 18.81 B cells and profound changes in gene expression. (FIG. 15A). Volcano plot analysis of differential gene expression by 18.81 B cells incubated with 200 microg C3d for 24 hours. C3d changed the expression of 1093 genes with P<0.0001 (ST11). (FIG. 15B). Immunofluorescence analysis of 18.81 B cells in cytospin slides stained with goat anti-mouse C3d followed by Texas-red labelled rabbit anti-goat antibodies. Bar indicate 50 microns. (FIG. 15C). MHC class-I expression by 18.81 B cells incubated with 200 micrg. C3d for 24, 40 and 72 hours. Samples were paired according to the incubation time and according to the read out, H2Ddor H2Kd. Y-axis depicts mean fluorescence intensity, X axis indicates treated or not treated samples. Histograms are representative of flow cytometry analysis of MHC-I expression. Blue refers to expression on cells incubated without C3d and red refers to cells incubated with C3d. Statistical analysis was done with Prism software (V10.1.1) using a paired T test analysis. P<0.001, ***.

[0034] FIG. 16 shows that C3d treatment induces expression of genes encoding ribosomal proteins and LncRNAs in vivo and in B cells in culture. (FIG. 16A). Full string network of 52 genes differentially expressed by plasma cells obtained from the bone marrow of mice treated with C3d relative to plasma cells obtained from the bone marrow of control mice. Network nodes represent proteins. Colored nodes refer to first shell of interactors. Edges represent protein interactions, known from curated data bases or experimental data; predicted by gene neighborhood, co-occurrence, homologies and / or co-expression. Software available online (string-db) run at the highest confidence (0.900) to show a maximum of 5 interactions and analysis with DBSCAN clustering to show a maximum of three clusters (String, version 12.0, String consortium 2023, used under a Creative Commons BY 4.0 license ). (FIG. 16B). C3d induced DE genes in plasma cells of bone marrow of treated mice and in 18.8 IB cells after 24 hours incubation with C3d. Values are expressed as Log 2 Fold Change. Negative values mean decreased expression. Positive values mean increased expression. Changes in expression were had an adjusted P <0.0001 (ST10). C and D. The Prmt5 -E2F1 pathway is activated by C3d after 24 hours incubation with 18.81 B cells in culture.

[0035] FIG. 17 shows C3d increases expression of genes encoding ribosomal proteins and Long Non-Coding RNAs. Vk*myc mice (N=l 1) were injected with 20 microg C3d peptide (N=6) or with PBS (N=5) intra-tibia two months before single cell RNA analysis of bone marrow cells. (FIG. 17A and 17B) UMAP plots of sc RNA gene expression depicting the different cell populations analyzed indicating hMYC expression to identify cells of the B cell lineage that activated hMYC. (FIG. 17C) Genes differentially expressed in C3d treated relative to control mice in all the bone marrow cell populations indicated. (FIG. 17D) GSEA pathway analysis of differentially expressed genes in various bone marrow cell populations. Major pathways are identified below and the cell types on the left. The normalized enrichment score (NES) is shown in a colored scale and the number of genes differentially expressed in each pathway are represented in proportion to the size of the circle.DETAILED DESCRIPTION OF THE DISCLOSURE

[0036] The present disclosure is directed to recombinant, modified complement 3d (C3d), compositions containing recombinant, modified C3d, and methods of using the C3d compositions to treat diseases and disorders, for example, cancer and disease and disorders characterized by evasion of immune surveillance and / or tumor-induced immunosuppression (e.g., multiple myeloma and other plasma cell malignancies).

[0037] Definitions. To facilitate an understanding of the present disclosure, a number of terms and phrases are defined below. Additional definitions are set forth throughout the detailed description.

[0038] The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of’ and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.

[0039] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9,the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 arc explicitly contemplated.

[0040] Unless otherwise defined herein, scientific, and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear; in the event, however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0041] As used herein, “treat,” “treating” and the like means a slowing, stopping, or reversing of progression of a disease or disorder or reducing the severity or activity thereof when provided a compound or composition described herein to an appropriate control subject. The term also means a reversing of the progression of such a disease or disorder to a point of eliminating or greatly reducing the symptoms. As such, “treating” means an application or administration of the compositions described herein to a subject, where the subject has a disease or a symptom of a disease, where the purpose is to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease or symptoms of the disease.

[0042] As used herein, the term “preventing” refers to partially or indefinitely delaying onset of a disease, disorder and / or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular disease, disorder, and / or condition; partially or completely delaying progression from a particular disease, disorder and / or condition; and / or decreasing the risk of developing pathology associated with the disease, disorder, and / or condition.

[0043] As used herein, the terms “providing,” “administering,” “introducing,” are used interchangeably herein and refer to the placement of the compositions of the disclosure into a subject by a method or route which results in at least partial localization of the composition to a desired site. The compositions can be administered by any appropriate route which results in delivery to a desired location in the subject.

[0044] The terms "host," "subject," or "patient" as used herein, refer to an individual to be treated by (e.g., administered) the compositions and methods of the present disclosure. A “subject” or “patient” may be human or non-human and may include, for example, animal strains or species used as “model systems” for research purposes, such a mouse model. Likewise,patient may include either adults, juveniles (e.g., children), or infants. Moreover, patient may mean any living organism, preferably a mammal (c.g., humans and non-humans) that may benefit from the administration of compositions contemplated herein. Examples of mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. Examples of non-mammals include, but are not limited to, birds, fish, and the like. In one embodiment, the mammal is a human. In the context of the disclosure, the term "subject" generally refers to an individual who will be administered or who has been administered one or more compositions of the present disclosure (e.g., recombinant, modified C3d).

[0045] The terms "buffer" or "buffering agents" refer to materials, that when added to a solution, cause the solution to resist changes in pH.

[0046] The terms "reducing agent" and "electron donor" refer to a material that donates electrons to a second material to reduce the oxidation state of one or more of the second material's atoms.

[0047] The term "monovalent salt" refers to any salt in which the metal (e.g., Na, K, or Li) has a net 1+ charge in solution (i.e., one more proton than electron).

[0048] The term "divalent salt" refers to any salt in which a metal (e.g., Mg, Ca, or Sr) has a net 2+ charge in solution.

[0049] The terms "chelator" or "chelating agent" refer to any materials having more than one atom with a lone pair of electrons that are available to bond to a metal ion.

[0050] The term "solution" refers to an aqueous or non-aqueous mixture.

[0051] As used herein, the terms "cancer" and "tumor" refer to a cell that exhibits a loss of growth control (e.g., often forming large numbers of clones of the cell) or tissue of uncontrolled growth or proliferation of cells. Cancer and tumor cells generally are characterized by a loss of contact inhibition, may be invasive, and may display the ability to metastasize. The present disclosure is not limited by the type of cancer (e.g., prophylactically and / or therapeutically treated). Indeed, a variety of cancers may be treated with compositions and methods described herein including, but not limited to, melanomas, lymphomas, epithelial cancer, breast cancer, ovarian cancer, endometrial cancer, colorectal cancer, lung cancer, renal cancer, melanoma,kidney cancer, prostate cancer, brain cancer, sarcomas, carcinomas, and / or a combination thereof.

[0052] Metastasis" as used herein refers to the process by which a cancer spreads or transfers from the site of origin to other regions of the body with the development of a similar cancerous lesion at the new location. A "metastatic" or "metastasizing" cell is one that loses adhesive contacts with neighboring cells and migrates via the bloodstream or lymph from the primary site of disease to invade neighboring body structures.

[0053] As used herein, the term "adjuvant" refers to any substance that helps or that itself establishes a condition in which an immune response (e.g., anti-cancer immune response) to an antigen occurs. Some adjuvants can cause activation of a cell of the immune system (e.g., an adjuvant can cause a cell to produce and secrete a cytokine that helps the response of an immune cell to be initiated). Examples of adjuvants that can cause activation of a cell of the immune system include, but are not limited to, saponins purified from the bark of the Q. saponaria tree, such as QS21 (a glycolipid that elutes in the 21st peak with HPLC fractionation; Aquila Biopharmaceuticals, Inc., Worcester, Mass.); poly(di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus Research Institute, USA); derivatives of lipopolysaccharides such as monophosphoryl lipid A (MPL; Ribi ImmunoChem Research. Inc., Hamilton, Mont.), muramyl dipeptide (MDP; Ribi) and threonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (a glucosamine disaccharide related to lipid A; OM Pharma SA, Meyrin, Switzerland); and Leishmania elongation factor (a purified Leishmania protein; Corixa Corporation, Seattle, Wash.).Traditional adjuvants are well known in the art and include, for example, aluminum phosphate or hydroxide salts ("alum").

[0054] As used herein, the term "an amount effective to induce a response" (e.g., of a composition comprising recombinant, modified C3d), refers to the dosage level required (e.g., when administered to a subject) to stimulate, generate and / or elicit a desired response in the subject. Thus, the term "therapeutically effective amount" or grammatical equivalents herein refers to an amount of the preparation that is sufficient to modulate the response (e.g., immune response) of an individual or an amount sufficient to inhibit, suppress, hinder, retard or reverse progression of cancer and / or tumor growth. This amount may be different for different individuals, different tumor types, and different preparations. A “therapeutically effective amount” of a substance / molecule of the disclosure may vary according to factors such as thedisease state, age, sex, and weight of the individual, and the ability of the substance / molecule, to elicit a desired response in the individual. A therapeutically effective amount encompasses an amount in which any toxic or detrimental effects of the substance / molecule are outweighed by the therapeutically beneficial effects. A "therapeutically effective amount" can be determined using procedures routinely employed by those of skill in the art such that an "improved therapeutic outcome" results. An effective amount can be administered in one or more administrations (e.g., via the same or different route), applications or dosages and is not intended to be limited to a particular' formulation or administration route.

[0055] As used herein, the term "under conditions such that said subject generates an immune response" refers to any qualitative or quantitative induction, generation, and / or stimulation of an immune response (e.g., innate or acquired).

[0056] As used herein, the term "immune response" refers to a response by the immune system of a subject. For example, immune responses include, but are not limited to, a detectable alteration (e.g., increase or decrease) in T regulator cell (Treg) expression or total cell population / number, Toll-like receptor (TLR) activation, lymphokine (e.g., cytokine (e.g., Thl or Th2 type cytokines) or chemokine) expression and / or secretion, macrophage activation, dendritic cell activation, T cell activation (e.g., CD4+ or CD8+ T cells), NK cell activation, and / or B cell activation (e.g., antibody generation and / or secretion). Additional examples of immune responses include binding of an immunogen (e.g., antigen (e.g., immunogenic polypeptide)) to an MHC molecule and inducing a cytotoxic T lymphocyte ("CTL") response, inducing a B cell response (e.g., antibody production), and / or T-helper lymphocyte response, and / or a delayed type hypersensitivity (DTH) response (e.g., against an antigen from which an immunogen is derived), expansion (e.g., growth of a population of cells) or depletion (e.g., via programmed cell death) of cells of the immune system (e.g., T cells, B cells (e.g., of any stage of development (e.g., plasma cells), and increased processing and presentation of antigen by antigen presenting cells. An immune response may be directed against immunogens that the subject's immune system recognizes as foreign (e.g., non-self antigens (e.g., tumor antigens), or self-antigens (e.g., that a host fails to recognize (e.g., a tumor antigen)). Thus, it is to be understood that, as used herein, "immune response" refers to any type of immune response, including, but not limited to, innate immune responses (e.g., activation of Toll receptor signaling cascade), cell-mediated immune responses (e.g., responses mediated by T cells (e.g., antigen-specific T cells) and non-specificcells of the immune system), and humoral immune responses (e.g., responses mediated by B cells (e.g., via generation and secretion of antibodies into the plasma, lymph, and / or tissue fluids). The term "immune response" is meant to encompass all aspects of the capability of a subject's immune system to respond to immunogens (e.g., both the initial response to an immunogen (e.g., a tumor antigen) as well as acquired (e.g., memory) responses that are a result of an adaptive immune response).

[0057] As used herein, the terms "purified" or "to purify" refer to the removal of contaminants or undesired compounds from a sample or composition. As used herein, the term "substantially purified" refers to the removal of from about 70 to 90 %, up to 100%, of the contaminants or undesired compounds from a sample or composition.

[0058] As used herein, the terms "administration" and "administering" refer to the act of giving a composition of the present disclosure (e.g., recombinant, modified C3d) to a subject. Exemplary routes of administration to the human body include, but are not limited to, through the eyes (ophthalmic), mouth (oral), skin (transdermal), nose (nasal), lungs (inhalant), oral mucosa (buccal), ear, rectal, by injection (e.g., intravenously, subcutaneously, intraperitoneally, intratumorally, etc.), topically, and the like.

[0059] As used herein, the terms "co-administration" and "co- administering" refer to the administration of at least two agent(s) (e.g., recombinant, modified C3d of the disclosure and one or more other agents - e.g., a chemotherapeutic) or therapies to a subject. In some embodiments, the co-administration of two or more agents or therapies is concurrent. In other embodiments, a first agent / therapy is administered prior to a second agent / therapy. In some embodiments, co- administration can be via the same or different route of administration. Those of skill in the art understand that the formulations and / or routes of administration of the various agents or therapies used may vary. The appropriate dosage for co-administration can be readily determined by one skilled in the art. In some embodiments, when agents or therapies are coadministered, the respective agents or therapies are administered at lower dosages than appropriate for their administration alone. Thus, co-administration is especially desirable in embodiments where the co-administration of the agents or therapies lowers the requisite dosage of a potentially harmful (e.g., toxic) agent(s), and / or when co-administration of two or more agents results in sensitization of a subject to beneficial effects of one of the agents via co- administration of the other agent.

[0060] The terms "pharmaceutically acceptable" or "pharmacologically acceptable," as used herein, refer to compositions that do not substantially produce adverse reactions (c.g., toxic, allergic or immunological reactions) when administered to a subject.

[0061] As used herein, the term "pharmaceutically acceptable carrier" refers to any of the standard pharmaceutical carriers including, but not limited to, phosphate buffered saline solution, water, and various types of wetting agents (e.g., sodium lauryl sulfate), any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintrigrants (e.g., potato starch or sodium starch glycolate), polyethylene glycol, and the like. The compositions also can include stabilizers and preservatives. Examples of carriers, stabilizers and adjuvants have been described and are known in the art (See e.g., Martin, Remington's Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, Pa. (1975), incorporated herein by reference).

[0062] As used herein, the term "pharmaceutically acceptable salt" refers to any salt (e.g., obtained by reaction with an acid or a base) of a composition of the present disclosure that is physiologically tolerated in the target subject. "Salts" of the compositions of the present disclosure may be derived from inorganic or organic acids and bases. Examples of acids include, but are not limited to, hydrochloric, hydrobromic, sulfuric, nitric, perchloric, fumaric, maleic, phosphoric, glycolic, lactic, salicylic, succinic, toluene-p-sulfonic, tartaric, acetic, citric, methanesulfonic, ethanesulfonic, formic, benzoic, malonic, sulfonic, naphthalene-2-sulfonic, benzenesulfonic acid, and the like. Other acids, such as oxalic, while not in themselves pharmaceutically acceptable, may be employed in the preparation of salts useful as intermediates in obtaining the compositions of the disclosure and their pharmaceutically acceptable acid addition salts.

[0063] Examples of bases include, but are not limited to, alkali metal (e.g., sodium) hydroxides, alkaline earth metal (e.g., magnesium) hydroxides, ammonia, and compounds of formula NW4+, wherein W is Cl-4 alkyl, and the like.

[0064] Examples of salts include, but are not limited to: acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, flucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, chloride, bromide, iodide, 2-hydroxyethanesulfonate, lactate, maleate, methanesulfonate, 2-naphthalenesulfonate,nicotinate, oxalate, palmoate, pectinate, persulfate, phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, tosylatc, undccanoatc, and the like. Other examples of salts include anions of the compounds of the present disclosure compounded with a suitable cation such as Na+, NH4+, and NW4+ (wherein W is a Cl-4 alkyl group), and the like. For therapeutic use, salts of the compounds of the present disclosure are contemplated as being pharmaceutically acceptable. However, salts of acids and bases that are non-pharmaceutically acceptable may also find use, for example, in the preparation or purification of a pharmaceutically acceptable compound.

[0065] For therapeutic use, salts of the compositions of the present disclosure are contemplated as being pharmaceutically acceptable. However, salts of acids and bases that are non-pharmaceutically acceptable may also find use, for example, in the preparation or purification of a pharmaceutically acceptable composition.

[0066] As used herein, the term "at risk for disease" refers to a subject that is predisposed to experiencing a particular disease. This predisposition may be genetic (e.g., a particular genetic tendency to experience the disease, such as heritable disorders), or due to other factors (e.g., environmental conditions, exposures to detrimental compounds present in the environment, etc.). Thus, it is not intended that the present disclosure be limited to any particular risk (e.g., a subject may be "at risk for disease" simply by being exposed to and interacting with other people), nor is it intended that the present disclosure be limited to any particular disease (e.g., cancer).

[0067] As used herein, the term "kit" refers to any delivery system for delivering materials. In the context of recombinant, modified C3d (e.g., a composition comprising recombinant, modified C3d (e.g., soluble PTD-C3d) of the disclosure), such delivery systems include systems that allow for the storage, transport, or delivery of recombinant, modified C3d and / or supporting materials (e.g., written instructions for using the materials, etc.) from one location to another. For example, kits include one or more enclosures (e.g., boxes) containing the relevant agents (e.g., recombinant, modified C3d) and / or supporting materials. As used herein, the term "fragmented kit" refers to delivery systems comprising two or more separate containers that each contain a subportion of the total kit components. The containers may be delivered to the intended recipient together or separately. For example, a first container may contain a composition comprising soluble recombinant, modified C3d of the disclosure for a particular use, while a second container contains a second agent (e.g., a buffer, excipient, active agent, orinactive agent). Indeed, any delivery system comprising two or more separate containers that each contains a sub-portion of the total kit components arc included in the term "fragmented kit." In contrast, a "combined kit" refers to a delivery system containing all of the components of a composition comprising recombinant, modified C3d needed for a particular use in a single container (e.g., in a single box housing each of the desired components). The term "kit" includes both fragmented and combined kits.

[0068] As used herein, the term "immunoglobulin" or "antibody" refer to proteins that bind a specific antigen. Immunoglobulins include, but are not limited to, polyclonal, monoclonal, chimeric, and humanized antibodies, Fab fragments, F(ab')2 fragments, and includes immunoglobulins of the following classes: IgG, IgA, IgM, IgD, IgE, and secreted immunoglobulins (sig). Immunoglobulins generally comprise two identical heavy chains and two light chains. However, the terms "antibody" and "immunoglobulin" also encompass single chain antibodies and two chain antibodies.

[0069] As used herein, the term "subject suspected of having cancer" refers to a subject that presents one or more symptoms indicative of a cancer (e.g., a noticeable lump or mass) or is being screened for a cancer (e.g., during a routine physical). A subject suspected of having cancer may also have one or more risk factors. A subject suspected of having cancer has generally not been tested for cancer. However, a "subject suspected of having cancer" encompasses an individual who has received a preliminary diagnosis (e.g., a CT scan showing a mass or increased PSA level) but for whom a confirmatory test (e.g., biopsy and / or histology) has not been done or for whom the stage of cancer is not known. The term further includes people who once had cancer (e.g., an individual in remission). A "subject suspected of having cancer" is sometimes diagnosed with cancer and is sometimes found to not have cancer.

[0070] As used herein, the term "subject diagnosed with a cancer" refers to a subject who has been tested and found to possess cancerous cells. The cancer may be diagnosed using any suitable method, including but not limited to, biopsy, x-ray, blood test, etc.

[0071] As used herein, the term "post-surgical tumor tissue" refers to cancerous tissue (e.g., organ tissue) that has been removed from a subject (e.g., during surgery).

[0072] As used herein, the term "identifying the risk of said tumor metastasizing" refers to the relative risk (e.g., the percent chance or a relative score) of a tumor (e.g., prostate, colon, breast, etc. tumor) metastasizing.

[0073] As used herein, the term "subject at risk for cancer" refers to a subject with one or more risk factors for developing a specific cancer. Risk factors include, but arc not limited to, gender, age, genetic predisposition, environmental exposure, and previous incidents of cancer, preexisting non-cancer diseases, and lifestyle.

[0074] As used herein, the term "characterizing cancer in subject" refers to the identification of one or more properties of a cancer sample in a subject, including but not limited to, the presence of benign, pre-cancerous or cancerous tissue and the stage of the cancer.

[0075] As used herein, the term "characterizing tissue in a subject" refers to the identification of one or more properties of a tissue sample (e.g., including but not limited to, the presence of cancerous tissue, the presence of pre-cancerous tissue that is likely to become cancerous, and the presence of cancerous tissue that is likely to metastasize).

[0076] As used herein, the term "stage of cancer" refers to a qualitative or quantitative assessment of the level of advancement of a cancer. Criteria used to determine the stage of a cancer include, but are not limited to, the size of the tumor, whether the tumor has spread to other parts of the body and where the cancer has spread (e.g., within the same organ or region of the body or to another organ).

[0077] As used herein, the term "primary tumor cell" refers to a cancer cell that is isolated from a tumor in a mammal and has not been extensively cultured in vitro.

[0078] As used herein, the term "target diseased cell" refers to (a) a cell causing, propagating, aggravating or contributing to a disease in a subject, (b) a cell capable of causing, propagating, aggravating or contributing to a disease in a subject, (c) a cell derived from (a) or (b), or (d) a cell sharing antigenic characteristics of (a) or (b). Target diseased cells may or may not be taken from the subject to be treated by a method of the disclosure. Target diseased cells include, but are not limited to, tumor cells (including unmodified tumor cells, tumor cells modified (e.g., genetically modified) with different approaches, primary cultures of tumor cells, and established cancer cell lines). The sources of tumor cells include, but are not limited to, lymphoma, melanoma, liver cancer, hepatocellular’ carcinoma, lung cancer, gastric cancer, colorectal carcinoma, renal carcinoma, head and neck cancers, sarcoma, leukemia, brain tumor and / or lymphoma, osteosarcoma, bladder carcinoma, myloma, breast cancer, prostate cancer, ovarian cancer, and pancreas carcinoma. In addition, target diseased cells include cellstransformed or immortalized by irradiation, viral infection, exposure to carcinogens, and other means known to or to be developed by those skilled in the art.

[0079] As used herein, the terms "treatment", "therapeutic use", or "medicinal use" refer to any and all uses of the claimed compositions that remedy a disease state or symptoms, or otherwise prevent, hinder, retard, or reverse the progression of disease or other undesirable symptoms in any way whatsoever. For example, the terms "treatment of cancer" or "treatment of tumor" or grammatical equivalents herein are meant the suppression, regression, or partial or complete disappearance of a pre-existing cancer or tumor. The definition is meant to include any diminution in the size, potency or growth rate of a pre-existing cancer or tumor.

[0080] As used herein, the terms "improved therapeutic outcome" and "enhanced therapeutic efficacy", relative to cancer refers to a slowing or diminution of the growth of cancer cells or a solid tumor, or a reduction in the total number of cancer cells or total tumor burden. An "improved therapeutic outcome" or "enhanced therapeutic efficacy" means there is an improvement in the condition of the individual according to any clinically acceptable criteria, including reversal of an established tumor, an increase in life expectancy or an improvement in quality of life.

[0081] As used herein, the term "nucleic acid molecule" refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA. The term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to, 4 acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5 (carboxy hydroxy l->methyl) uracil, 5-fluorouracil, 5 bromouracil, 5-carboxy methylaminomethyl 2 thiouracil, 5 carboxymethyHaminomethyluracil, dihydrouracil, inosine, N6 isopentenyladenine, 1 methyladenine, 1-methylpseudo-iuracil, 1 methylguanine, 1 methylinosine, 2,2- dimethyl-iguanine, 2 methyladenine, 2 methylguanine, 3-methyl->cytosine, 5 methylcytosine, N6 methyladenine, 7 methylguanine, 5 methylaminomethyluracil, S-methoxy-amino-methyl 2 thiouracil, beta D mannosylqueosine, 5' methoxycarbonylmethyluracil, 5 methoxyuracil, 2 methylthio N6 isopentenyladenine, uracil 5 oxyacetic acid methylester, uracil 5 oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2 thiocytosine, 5-methyl-2 thiouracil, 2-thiouracil, 4 thiouracil, 5-methyluracil, N-uracil 5 oxyacetic acid methylester, uracil 5 oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6 diaminopurine.

[0082] The term "wild-type" refers to a gene or gene product isolated from a naturally occurring source. A wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designed the "normal" or "wild-type" form of the gene. In contrast, the term "modified" or "mutant" refers to a gene or gene product that displays modifications in sequence and or functional properties (i.e., altered characteristics) when compared to the wildtype gene or gene product. It is noted that naturally occurring mutants can be isolated; these are identified by the fact that they have altered characteristics (including altered nucleic acid sequences) when compared to the wild-type gene or gene product.

[0083] As used herein, the terms "nucleic acid molecule encoding," "DNA sequence encoding," and "DNA encoding" refer to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide (protein) chain. The DNA sequence thus codes for the amino acid sequence.

[0084] As used herein, the terms "an oligonucleotide having a nucleotide sequence encoding a gene" and "polynucleotide having a nucleotide sequence encoding a gene," means a nucleic acid sequence comprising the coding region of a gene or in other words the nucleic acid sequence that encodes a gene product. The coding region may be present in a cDNA, genomic DNA or RNA form. When present in a DNA form, the oligonucleotide or polynucleotide may be single-stranded (i.e., the sense strand) or double-stranded. Suitable control elements such as enhancers / promoters, splice junctions, polyadenylation signals, etc. may be placed in close proximity to the coding region of the gene if needed to permit proper initiation of transcription and / or correct processing of the primary RNA transcript. Alternatively, the coding region utilized in the expression vectors of the present disclosure may contain endogenous enhancers / promoters, splice junctions, intervening sequences, poly adenylation signals, etc. or a combination of both endogenous and exogenous control elements.

[0085] The terms "in operable combination," "in operable order," and "operably linked" as used herein refer to the linkage of nucleic acid sequences in such a manner that a nucleic acid molecule capable of directing the transcription of a given gene and / or the synthesis of a desired protein molecule is produced. The term also refers to the linkage of amino acid sequences in such a manner so that a functional protein is produced.

[0086] The term "isolated" when used in relation to a nucleic acid, as in "an isolated oligonucleotide" or "isolated polynucleotide" refers to a nucleic acid sequence that is identified and separated from at least one component or contaminant with which it is ordinarily associated in its natural source. Isolated nucleic acid is such present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids as nucleic acids such as DNA and RNA found in the state they exist in nature. For example, a given DNA sequence (e.g., a gene) is found on the host cell chromosome in proximity to neighboring genes; RNA sequences, such as a specific mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other mRNAs that encode a multitude of proteins. However, isolated nucleic acid encoding a given protein includes, by way of example, such nucleic acid in cells ordinarily expressing the given protein where the nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature. The isolated nucleic acid, oligonucleotide, or polynucleotide may be present in single- stranded or double- stranded form. When an isolated nucleic acid, oligonucleotide or polynucleotide is to be utilized to express a protein, the oligonucleotide or polynucleotide will contain at a minimum the sense or coding strand (i.e., the oligonucleotide or polynucleotide may be single- stranded), but may contain both the sense and anti-sense strands (i.e., the oligonucleotide or polynucleotide may be double-stranded).

[0087] As used herein, the term "purified" or "to purify" refers to the removal of components (e.g., contaminants) from a sample. For example, antibodies are purified by removal of contaminating non-immunoglobulin proteins; they are also purified by the removal of immunoglobulin that does not bind to the target molecule. The removal of non-immunoglobulin proteins and / or the removal of immunoglobulins that do not bind to the target molecule results in an increase in the percent of target-reactive immunoglobulins in the sample. In another example, recombinant polypeptides are expressed in bacterial host cells and the polypeptides are purified by the removal of host cell proteins; the percent of recombinant polypeptides is thereby increased in the sample.

[0088] Amino acid sequence" and terms such as "polypeptide" or "protein" are not meant to limit the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule.

[0089] The term "native protein" as used herein to indicate that a protein does not contain amino acid residues encoded by vector sequences; that is, the native protein contains only those amino acids found in the protein as it occurs in nature. A native protein may be produced by recombinant means or may be isolated from a naturally occurring source.

[0090] As used herein the term "portion" when in reference to a protein (as in "a portion of a given protein") refers to fragments of that protein. The fragments may range in size from four amino acid residues to the entire amino acid sequence minus one amino acid.

[0091] "Sequence identity," "% sequence identity" and the like with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0092] Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.1. Compositions, methods, and agents comprising recombinant, modified C3d and methods of utilizing same.

[0093] The disclosure provides recombinant, modified complement 3d (C3d), compositions containing modified C3d, and methods of using the C3d compositions to treat diseases and disorders, for examples, cancer and disease and disorders characterized by evasion of immunesurveillance and / or tumor-induced immunosuppression (e.g., multiple myeloma and other plasma cell malignancies).

[0094] In one aspect, the disclosure provides a composition comprising recombinant, modified C3d (e.g., recombinant, modified C3d configured to comprise a domain that causes C3d to associate with cells). In some embodiments, the cell association domain is a short peptide that facilitate cellular intake and / or uptake of C3d (e.g., a cell-penetrating peptide or protein transduction domain). In some embodiments, the disclosure provides recombinant, modified C3d comprising an N-terminal protein transduction domain (PTD, PTD-C3d). In some embodiments, the disclosure provides a method of treating a disease and / or disorder (e.g., cancer) comprising administering a recombinant, modified C3d of the disclosure (e.g., administering an effective amount of recombinant, modified C3d to a subject to prophylactically and / or therapeutically treat the disease or disorder.

[0095] For example, previous forms of immunotherapy have brought only modest success in multiple myeloma (MM). Whether failures reflect lack of immunogenicity (i.e., escape), tumor- induced immunosuppression or age-associated immunodeficiency is uncertain13. Expression of immune-checkpoint, mediators such as PD-1 on T cells and PD-L1 on MM cells were found in MM but unfortunately anti-PD-l / anti-PD-Ll antibodies early clinical trials were not successful13. BCMA targeted CAR-T cells infrequently induce complete remission (as low as 28%) and is associated with frequent relapses in spite of frequent early responses (>60% of the subjects have a reduction in tumor burden)25,26. These results suggest MM escapes from immunotherapies even when the targeted antigen (e.g. BCMA) is necessary for plasma cell function27. Furthermore, toxicity limits implementation of the most aggressive treatments in frail subjects. Experiments were conducted during development of embodiments of the disclosure in order to test whether cell-mediated immunity (CMI) responses could be induced and separated into protective immunity versus auto-immune responses and whether such segregation could be exploited for immunotherapy without causing the depletion of healthy cells.

[0096] For example, in some embodiments, it was hypothesized and tested whether complement products could be utilized to facilitate segregation of immunity against malignant cells from immunity against healthy cells. In one embodiment, a multiple myeloma model was utilized (e.g., to determine if complement products could be used to facilitate segregation of immunity against malignant cells from immunity against healthy cells). Multiple myeloma is atumor of plasma cells. There are currently no therapies that differentiate between malignant and non-malignant plasma cells. In order to test whether cell mediated immunity (CMI) could selectively recognize and control transformed cells at different stages of malignant transformation, a mouse model was used that develops spontaneous multiple myeloma recapitulating the human disease development as well as normal B cell development (Rodriguez- Otero et al. (2023). N Engl J Med 388, 1002-1014). These mice harbor human c-Afyc that is expressed upon reversion of a STOP codon in B cells undergoing somatic hypermutation, the Vk*MYC mouse (Chesi, et al., 2008. Cancer cell 13, 167-180; Chesi, et al., 2012. Blood 120, 376-385). The Vk*MYC mouse spontaneously develops monoclonal gammopathy and multiple myeloma.

[0097] As disclosed herein, the disclosure provides therapeutic C3d polypeptide capable of selectively attacking and clearing cancer cells (e.g., MM cells). Also detailed herein, the recombinant, modified C3d compositions of the disclosure have reduced or minimal toxicity. In some embodiments, recombinant, modified C3d does not target a single specific tumor antigen and provides protection against relapses by tumor cells escaping antigen specific immune destruction. In further embodiments, a composition of the disclosure (e.g., comprising recombinant, modified C3d) can be used to treat (e.g., clear) highly mutated B cells while sparing non-transformed B cells and plasma cells. While an understanding of a mechanism is not needed to practice the present disclosure and while the disclosure is not limited to any particular mechanism of action, in one embodiment, a composition of the disclosure (e.g., comprising recombinant, modified C3d) treats (e.g., clears) transformed / mutated B and / or plasma cells while concurrently sparing non-transformed cells by activation of long-non coding RNAs and / or increased expression of ribosomal RNAs (e.g., linked to expression of defective ribosomal products by malignant / transformed cells).

[0098] In some embodiments, administering recombinant, modified C3d or compositions comprising recombinant, modified C3d to the subject reduces serum IgG and / or M protein in the subject. In some embodiments, administering recombinant, modified C3d or compositions comprising recombinant, modified C3d to the subject reduces paraproteinemia in the subject. In some embodiments, administering recombinant, modified C3d to the subject leads to an increase in the production of polyclonal IgG in the subject. In some embodiments, administering recombinant, modified C3d to the subject decreases the tumor burden (e.g., decreases the burdenof partially transformed pre-malignant cells and / or malignant cells (e.g., plasma cells)) in the subject. In some embodiments, administering recombinant, modified C3d to the subject decreases the tumor burden (e.g., decreases the burden of partially transformed pre-malignant cells and / or malignant cells (e.g., plasma cells)) while concurrently preserving non-malignant cells and / or normal plasma cell function in the subject. In some embodiments, administering recombinant, modified C3d to the subject promotes clearance of malignant plasma cells in the subject (e.g., while concurrently not altering normal immune functionality in the subject). In some embodiments, administering soluble PTD-C3d or compositions comprising recombinant, modified C3d to the subject induces remission of cancer (e.g., malignant myeloma or other cancer) in the subject. In some embodiments, administering recombinant, modified C3d or compositions comprising recombinant, modified C3d to the subject eliminates malignant clones (e.g., that have highly mutated Ig and / or express Ig class switched isotypes) while concurrently preserving normal B cells and / or non-malignant plasma cells.

[0099] In some embodiments, compositions, methods, and agents disclosed herein comprise a modified, recombinant C3d polypeptide sequence comprising amino acids 1024 to 1320 of murine C3d, or a homologous amino acid sequence of human C3d, having a Cys (C) to Ser(S) substitution at position 1028 or equivalent mutation (e.g., that prevents formation of a free sulfhydryl group within the polypeptide). In some embodiments, a C3d polypeptide sequence of SEQ ID NO.:2, or a nucleic acid encoding same, is utilized. In other embodiments, a C3d polypeptide sequence of SEQ ID NO.:7, or a nucleic acid encoding same, is used. In some embodiments, the C3d polypeptide comprises a cell penetrating peptide sequence and / or a protein transduction domain. The disclosure is not limited to any particular cell penetrating peptide sequence and / or protein transduction domain. In some embodiments, the cell penetrating peptide sequence and / or protein transduction domain comprises the amino acid sequence of SEQ ID NO.:3. In other embodiments, the cell penetrating peptide sequence and / or protein transduction domain is a polypeptide that is similar in length (e.g., plus or minus 2 amino acids) and charge to SEQ ID NO.:3. Any cell penetrating peptide sequence and / or protein transduction domain (PTD) useful for delivery of C3d polypeptide across the plasma membrane and into cells may be used including any of the variety of cell penetrating peptide sequences and / or protein transduction domains known in the ail. Cell penetrating peptide sequences and / or protein transduction domains useful in the disclosure include, but are not limited to, tissue- specific andnon-tissue specific peptides including cationic peptides (e.g., of 6-12 amino acids in length comprised predominantly of arginine, ornithine and / or lysine residues); hydrophobic peptides (e.g., leader sequences of secreted growth factors or cytokines) and amphipathic peptides or celltype specific peptides (e.g., obtained by linking hydrophobic peptides to nuclear localizing signals and / or identified via screening of peptide phage display libraries).

[0100] As disclosed herein, in some embodiments, C3d polypeptide acts by facilitating and / or hastening immune surveillance conferred by cell-mediated immunity (CMI) against transformed B and / or plasma cells including pre-malignant plasma cells that give rise to MM, overcoming tumor-induced immunosuppression and / or tolerance (e.g., since administration of cyclosporine following injection of C3d abolished tumor clearance). Although a fraction of monoclonal gammopathies progress to MM over years (1-10% per year), treatment of these conditions to prevent MM is currently discouraged by toxicity. The lack of toxicity observed for Cd3 compositions of the disclosure make a recombinant, soluble C3d polypeptide of the disclosure useful for the prevention and / or treatment of MM and / or other cancer or disease or condition (e.g., using a composition of the disclosure for prophylactic and / or therapeutic treatment of pre-malignant conditions (e.g., for monoclonal gammopathy of uncertain significance (MGUS) or other disease or condition for which there are few to no current therapies)). Thus, in some embodiments, the disclosure provides that recombinant, soluble C3d polypeptide can be used to induce immune-mediated clearance of premalignant cells (e.g., of a pre-malignant disease or condition) without little to no toxicity. For example, in some embodiments, the disclosure provides (See Examples) that recombinant, modified / soluble C3d can be used to induce CMI that selectively targets transformed cells and selectively spares nontransformed cells.

[0101] While an understanding of a mechanism is not needed to practice the present disclosure and while the disclosure is not limited to any particular mechanism, in some embodiments, the disclosure provides that treatment with recombinant, modified C3d provides protective cell-mediated immunity (CMI) that selectively targets transformed cells and selectively spares non-transformed cells. In some embodiments, CMI induced by a composition comprising recombinant, modified C3d of the disclosure comprises immune responses that target the products of multiple mutations of somatic non-Ig genes (e.g., those encoded by long noncoding RNAs and / or an Ig mutation burden increased in malignant plasma cells relative to non-malignant cells). The disclosure is not limited to any particular mechanism of action. In another embodiment, CMI induced by a composition comprising recombinant C3d of the disclosure results in the size of clones isolated from bone marrow being decreased (e.g., by 5, 10, 15 or more fold) post treatment relative to non-treated subjects. C3d mediated decrease of highly mutated clones (e.g., with greater than 10 mutations / VH region) and of larger clones indicates, in some embodiments, that mutations are the target of immunity owing to the cumulative changes in the Ig sequence and / or that highly mutated and / or frequent cells are eliminated due to other properties associated with malignancy (e.g., expression of DRiPs or peptides derived from long non-coding RNAs).

[0102] In some embodiments, the disclosure provides compositions comprising C3d and methods of using the compositions to change alter gene expression in target cells (e.g., in transformed / malignant plasma and / or B cells). In some embodiments, a recombinant C3d of the disclosure is utilized to alter (e.g., increase or decrease) the expression of genes encoding ribosomal genes and long non-coding RNAs on plasma cells (e.g., in order to prophylactically and / or therapeutically treat a cancer, disease, or other condition).

[0103] In some embodiments, the disclosure provides recombinant C3d protein modified to include a peptide internalization domain induces anti-multiple myeloma T cell immunity that reduces tumor burden and spares non-malignant plasma cells. Experiments conducted during development of the disclosure indicated that the recombinant, modified C3d induced immunity preferentially targets clones with an elevated Ig mutation burden. While an understanding of a mechanism is not needed to practice the present disclosure and while the disclosure is not limited to any particular mechanism, in some embodiments, the disclosure provides that recombinant, modified C3d selectively promotes clearance of malignant plasma cells while concurrently maintaining the integrity of normal immune responses (e.g., treatment with recombinant, modified C3d induced remission of MM while at the same time preserving non-malignant cells and plasma cell function). For example, recombinant, modified C3d treatment resulted in C3d- dependent, selective elimination of malignant clones that have highly mutated Ig and / or express Ig class switched isotypes while preserving normal B cell development.2. Methods of Treating a Disease or Disorder

[0104] The disclosure provides recombinant, modified complement 3d (C3d), compositions containing modified C3d, and methods of using the C3d compositions to treat diseases and disorders, for example, cancer and diseases and disorders characterized by evasion of immune surveillance and / or tumor-induced immunosuppression (e.g., multiple myeloma and other plasma cell malignancies).

[0105] The disclosure provides compositions comprising recombinant, modified C3d (e.g., disclose herein) and methods of treating cancer in a subject comprising administering the recombinant, modified C3d to the subject whereupon the cancer is treated. In some embodiments, a composition comprising recombinant, modified C3d comprises an excipient and / or carrier.

[0106] Excipients and carriers may include any and all solvents, dispersion media, antibacterial and antifungal agents, isotonic and absorption delaying agents. Some examples of materials which can serve as excipients and / or carriers are sugars including, but not limited to, lactose, glucose and sucrose; starches including, but not limited to, com starch and potato starch; cellulose and its derivatives including, but not limited to, sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients including, but not limited to, cocoa butter and suppository waxes; oils including, but not limited to, peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols; including propylene glycol; esters including, but not limited to, ethyl oleate and ethyl laurate; agar; buffering agents including, but not limited to, magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol, and phosphate buffer solutions, as well as other non-toxic compatible lubricants including, but not limited to, sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, preservatives, and antioxidants. Techniques and formulations may be found, for example, in Remington's Pharmaceutical Sciences, 19th Edition (Mack Publishing Company, 1995). The route or administration and the form of the composition usually dictates the type of carrier to be used.

[0107] The compositions may be formulated for any appropriate manner of administration, and thus administered, including for example, oral, nasal, intraocular, intravenous, intravaginal, epicutaneous, sublingual, intracranial, intradermal, intraperitoneal, subcutaneous, intramuscularadministration, or via inhalation. Techniques and formulations may generally be found in “Remington's Pharmaceutical Sciences,” (Meade Publishing Co., Easton, Pa.). Therapeutic or pharmaceutical compositions must typically be sterile and stable under the conditions of manufacture and storage.

[0108] The terms “effective amount” or “therapeutically effective amount,” as used herein, refer to a sufficient amount of a composition described herein being administered which will relieve to some extent one or more of the symptoms of the disease or condition being treated (e.g., cancer and / or tumor proliferation and / or growth). The result can be reduction and / or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. For example, an “effective amount” for therapeutic uses is the amount of a compositions required to attenuate and / or modulate cancer and / or tumor proliferation and / or growth.

[0109] The amount of the composition required for use in treatment or prevention will vary not only with the particular composition selected but also with the route of administration, the nature and / or symptoms of the disease and the age and condition of the patient and will be ultimately at the discretion of the attendant physician or clinician. The determination of effective dosage levels, that is the dosage levels necessary to achieve the desired result, can be accomplished by one skilled in the art using routine methods, for example, human clinical trials, in vivo studies, and in vitro studies. For example, in some embodiments, useful dosages of compositions required to attenuate and / or modulate cancer and / or tumor proliferation and / or growth can be determined by comparing their in vitro activity, and in vivo activity in animal models.

[0110] Dosage amount and interval may be adjusted individually to provide plasma levels of the active, recombinant, modified C3d agent which are sufficient to maintain the modulating effects, or minimal effective concentration (MEC). The MEC will vary for each composition disclosed herein but can be estimated from in vivo and / or in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. However, bioassays can be used to determine plasma concentrations. Dosage intervals can also be determined using MEC value. Compositions should be administered using a regimen, which maintains plasma levels above the MEC for 10-90% of the time, preferably between 30-90% andmost preferably between 50-90%. In cases of local administration or selective uptake, the effective local concentration of the composition may not be related to plasma concentration.

[0111] It should be noted that the attending physician would know how to and when to terminate, interrupt, or adjust administration due to toxicity or organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate, precluding toxicity. The magnitude of an administrated dose in the management of the disorder of interest will vary with the severity of the symptoms to be treated and the route of administration. Further, the dose, and perhaps dose frequency, will also vary according to the age, body weight, and response of the individual patient. A program comparable to that discussed above may also be used in veterinary medicine for non-human subjects.

[0112] As used herein, the terms "purified" or "to purify" refer to the removal of contaminants or undesired compounds from a sample or composition. As used herein, the term "substantially purified" refers to the removal of from about 70 to 90 %, up to 100%, of the contaminants or undesired compounds from a sample or composition. For example, a C3d polypeptide of the disclosure may be generated using any expression system known with the resulting C3d being substantially purified therefrom.

[0113] In some embodiments, a composition comprising recombinant, modified C3d comprises between 0.1 and 500 pg of recombinant, modified C3d polypeptide. However, the present disclosure is not limited to this amount of C3d polypeptide. For example, in some embodiments, more than 500 pg of C3d polypeptide is present in a composition for administration to a subject. In some embodiments, less than 0.1 pg of C3d polypeptide is present in a composition for administration to a subject.

[0114] In some embodiments, it is expected that each dose (e.g., of a composition comprising a C3d polypeptide) comprises 0.05-5000 pg of C3d polypeptide (e.g., recombinant and / or purified C3d polypeptide), in some embodiments, each dose will comprise 1-500 pg, in some embodiments, each dose will comprise 350-750 pg, in some embodiments, each dose will comprise 50-200 pg, in some embodiments, each dose will comprise 25-75 pg of C3d polypeptide (e.g., recombinant and / or purified C3d polypeptide). In some embodiments, each dose comprises an amount of C3d polypeptide sufficient to generate the desired cell mediated immune response. An effective amount of C3d polypeptide in a dose need not be quantified, aslong as the amount of C3d polypeptide generates the desired cell mediated immune response in a subject when administered to the subject. An optimal amount for a particular administration (e.g., to induce a desired cell mediated immune response) can be ascertained by one of skill in the art using standard assays and procedures (e.g., those described and / or referenced herein).The specific dose level and frequency of dosage for any particular patient may be varied and will depend upon a variety of factors including the activity of the specific composition employed, the metabolic stability and length of action of the compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the host undergoing therapy.

[0115] Composition described herein can be evaluated for efficacy and toxicity using known methods. For example, the toxicology of a particular composition can be established by determining in vitro toxicity towards a cell line, such as a mammalian, and preferably human, cell line. The results of such studies are often predictive of toxicity in animals, such as mammals, or more specifically, humans. Alternatively, the toxicity of particular composition in an animal model, such as mice, rats, rabbits, dogs, or monkeys, may be determined using known methods. As detailed herein, C3d compositions displayed little to no toxicity indicating relatively high dosing may be possible. The efficacy of a particular composition may be established using several recognized methods, such as in vitro methods, animal models, or human clinical trials. When selecting a model to determine efficacy, the skilled artisan can be guided by the state of the art to choose an appropriate model, dose, route of administration and / or regime. The efficacy of C3d compositions is shown in the examples.

[0116] An effective amount of a composition of the disclosure may be administered alone or in combination with at least one additional therapeutic agent. In some embodiments, the at least one additional therapeutic agent is administered prior to, concomitantly with, or following administration of the composition (e.g., recombinant, modified C3d disclosed herein). The additional therapeutic agent may include, for example, a corticosteroid, an immunosuppressant, rituximab, anti-inflammatory agent, an antibiotic, an opioid antagonist, a vitamin or nutritional supplement, or any combination thereof. The choice of additional therapeutic agents will not only depend on the particular disease or disorder but also the nature and / or symptoms of the disease and the age and condition of the patient.

[0117] The disease or disorder may be characterized by abnormal cell growth and / or tumor proliferation and / or growth. As such, the disease or disorder may comprise cancer or other type malignancy described herein.

[0118] A composition comprising recombinant, modified C3d disclosed herein may be used in combination with, preceding, following, or in lieu of other treatments and / or therapies for treating and / or preventing cancer (e.g., preventing new cancer and / or the spread of cancer). For example, a subject to whom a composition comprising recombinant, modified C3d of the disclosure is administered may be treated (e.g., previously, concurrently, or subsequently) with surgical intervention, chemotherapy, radiation therapies and / or other forms of immunotherapy that are commonly used and well known in the art to treat cancer (e.g., the type of cancer a subject administered the composition of the disclosure has). In a further embodiment, when used, these other treatments and / or therapies are utilized in such a way (e.g., at a time or for a duration of time) that does not interfere with the efficacy of the compositions of the present disclosure (e.g., to inhibit cancer growth and / or to reduce or eliminate cancer cells in the subject).

[0119] A composition comprising recombinant, modified C3d disclosed herein may be coadministered with one or more cancer therapeutic agents. For example, a composition comprising C3d disclosed herein may be administered with one or more cancer therapeutic agents including, but not limited to, alkylating agents, alkaloids; antimetabolites, anti-tumor antibiotics, nitrosoureas, hormonal agonists / antagonists and analogs, immunomodulators, photosensitizers, and enzymes. For example, the cancer therapeutic agent may be one or more of Docetaxel, Alkyl Sulfonates, Aclacinomycins, Folic Acid, L-Asparaginase, Interferon-cc (TAXOTERE) Analogs, Etoposide, Busulfan, Actinomycin Fi, Denopterin, Pegasargase, Interferon- f>, Irinotecan, Improsulfan, Anthramycin, Edatrexate, Interferon-y, Paclitoxel, Piposulfan, Azaserine, Methotrexate, Interferon-ct (TAXOL) 2a, Teniposide, Bleomycins, Piritrexim, Interleukin-2, Topotecan, Aziridines, Cactinomycin, Pteropterin, Lentinan, Vinblastine, Benzodepa, Carubicin, TOMUDEX, Propogermanium, Vincristine, Carboquone, Carzinophilin, Trimctrcxatc, PSK, Vcndcsinc, Mcturcdcpa, Chromomycins, Roquinimcx, Vinorelbine, Uredepa, Dactinomycin, Purine Analogs, Rituximab, Daunorubicin, Cladribine, Sizofiran, Ethylenimines 6-Diazo-5-oxo-L- Fludarabine, Trastuzumab, norleucine, Methylmelamines, Altretamine, Doxorubicin 6- Ubenimex, Mercaptopurine,Triethylenemelamine, Epirubicin, Thiamiprine, Cyclophosphamide / Cytoxan, Tricthylcncphosphoramidc, Idarubicin, Thioguaninc, Tricthylcncthiophosphoramidc, Mcnogaril, Mitomycins, Mitoxantrone, Pyrimidine Analogs, Nitrogen Mycophenolic Acid, Ancitabine Mustards, Chlorambucil, Nogalamycin, 5-Azacytidine, Chlomaphazine, Olivomycins, 6- Azauridine, Cyclophosphamide, Peplomycin, Carmofur, Estramustine, Pirarubicin, Cytarabine, Ifosfamide, Plicomycin, Doxifluridine, Mechlorethamine, Porfiromycin, Emitefur, Mechlorethamine, Puromycin, Enocitabine, Oxide Hydrochloride, Melphalan, Streptonigrin, Floxuridine, Novembichin, Streptozocin, Fluorouracil, Valrubilcin, Perfosfamide, Tubercidin, Gemcitabine, Phenesterine, Zinostatin, Tegafur, Prednimustine, Zorubicin, Trofosfamide, Uracil, Mustard, Carboplatin, Cisplatin, Miboplatin, Oxaliplatin, Dacarbazine, Mannomustine, Mitobronitol, Mitolactol, Thiotepa, Pipobroman, Temozolomide, Carmustine Aceglatone, Dexamethasone, Porfimer, Sodium Chlorozotocin, Amsacrine, Prednisone, Fotemustine, Bisantrene, Lomustine, Defosfamide, Androgens, Nimustine, Demecolcine, Calusterone, Ranimustine, Diaziquone, Dromostanolone, Eflornithine, Epitiostanol, Elliptinium, Mepitiostane, Acetate, Etoglucid, Testolactone, Fenretinide, Finasteride, Antiadrenals, Gallium, Nitrate, Aminoglutethimide, Hydroxyurea, Mitotane, Lonidomine, Trilostane, Miltefosine, Mitoguazone, Antiandrogens, Mopidamol, Bicalutamide, Nitracrine, Flutamide, Pentostatin, Nilutamide, Phenamet, Podophyllinic, Antiestrogens, Acid 2- Ethylhydrazide , Procarbazine, Droloxifene, Razoxane, Tamoxifen, Sobuzoxane, Toremifene, Spirogermanium, Exemestane, Amsacrine, Aromatase Inhibitors, Tretinoin, Aminoglutethimide, Tenuazonic Acid, Anastrozole, Triaziquone, Fadrozole 2, 2', 2"- Formestane, Triclorotriethylamine, Urethan, Letrozole, Topotecan, Estrogens, Fosfestrol, Hexestrol, Polyestradiol, Phosphate LHRA Analogs, Buserelin, Goserelin, Leuprolide, Triptorelin, Progestogens, Chlormadinone Acetate, Medroxyprogesterone, Megestrol Acetate, and / or Melengestrol.

[0120] Compositions described herein may be administered to the subject by a variety of methods know to those skilled in the art, including without limitation, systemic administration (e.g., oral, rectal, nasal, sublingual, buccal, implants, intravenous, or parenteral) or topical administration (e.g., dermal, pulmonary, nasal, aural, ocular, liposome delivery systems, or iontophoresis).

[0121] The disclosure is further described by reference to the following examples, which are provided for illustration only. The disclosure is not limited to the examples, but rather includesall variations that are evident from the teachings provided herein. All publicly available documents referenced herein, including but not limited to U.S. patents arc specifically incorporated by reference.EXAMPLES

[0122] The following examples further illustrate the disclosure but should not be construed as in any way limiting its scope.

[0123] Generation and characterization of soluble, modified complement 3d (C3d).

[0124] Design. Experiments were designed and conducted in order to characterize the ability of a recombinant C3d peptide to change the natural evolution of spontaneous Multiple Myeloma in murine model. VK*-MYC mice develop spontaneous MM owing to reversion of a stop codon in the hMYC transgene by somatic hypermutation. In this model, disease progression from premalignancy (monoclonal gammopathy of undetermined significance, MGUS) to full MM can be followed by measuring the concentration of the monoclonal IgG in the blood. MM development was induced by repeated immunization with NP-OVA. Mice paired according to state of disease at the start of the study, were injected with C3d peptide or with the solvent intratibia. The end point was set at 8 weeks after injection or earlier in case mice showed signs of morbidity. At the study end point M protein and IgG were measured and compared with values prior to treatment in paired mice. We also enumerated Plasma cells in the bone marrow and spleen were enumerated by FACS, CYTOF and EEISPOT. scRNA analysis in bone marrow cells was performed in order to determine the extent to which C3d treatment spared normal plasma cells. The systemic impact of the disease in the kidneys was determined by pathologic examination. Blocking T cell function with Cyclosporin A was utilized to test possible mechanisms of action.

[0125] Materials and methods.

[0126] Mice. C57BE / 6 wild type (WT) mice were purchased from The Jackson Eaboratories. Vk-MYC* mice were obtained from Dr. Eeif Bergsagel at the Mayo Clinic, Scottsdale Arizona16. Heterozygous WT / Vk-MYC* mice were maintained by breeding C57BE / 6 and WT / Vk-MYC* mice. Mice were genotyped by PCR to select Vk-MYC* positive mice according to Chesi et al.16.

[0127] Immunization. To model development of MM, WT / Vk-MYC* mice were immunized with 100 microg of 4-hydroxy-3-nitrophenyl (NP) conjugated ovalbumin (NP-OVAE) (NP(25)- OVAL(#N-5051-100, Biosearch Technology) in complete Freund’s adjuvant. Mice were reimmunized twice, 30 days apart, by administration of NP-OVAL in incomplete Freunds adjuvant, i,p.

[0128] Recombinant C3d design and administration. Murine C3d sequence encompassing amino acids 1024-1320 (See FIG. 6) was paired with an N-tcrminal sequence (RKKRRQRRR (SEQ ID NO.: 3), cgcaaaaaacgccgccagcgccgccgc (SEQ ID NO.: 4)) with Cys (C) to Ser (S) substitution at position 1028 to avoid generating a free sulfhydryl group. The fusion sequence was cloned into a baculovirus expression vector by GIBSON assembly and used to transduce Sf9 insect cells. Polypeptide was isolated using NTA Agarose (Qiagen) and eluted with imidazole in PBS. Purity of samples were determined by electrophoresis in 4-20% gradient SDS-PAGE gels (See FIG. 6). The monomer was detected in the soluble fractions. Aliquots of Img / ml were frozen. Twenty micrograms of recombinant murine C3d with a terminal protein transduction domain in 20 microliters of PBS was injected into the tibia. Some mice treated with C3d were also treated with cyclosporine (SIGMA CAS No:59865-13-3, product number PHR1092) 3 mg / kg twice weekly for 7 weeks.

[0129] Flow cytometry. Single cells were acquired from mouse spleen and bone marrow 60 days after C3d treatment and suspended in cell suspension buffer. Cells were counted on a Neubauer chamber and 1 x 106cells were incubated in Falcon™ Round-Bottom Polystyrene Test Tubes with FVS780 (BD Life Sciences, San Jose, CA) for 10 min to test cell viability. Cells were incubated for 30 minutes at 37°C with the following antibodies: anti-CD19 (clone #1D3), anti-CD8 (clone#88.25) or anti-CDl lb (clone #M1 / 7O) were FITC conjugated; anti-CD19 (clone #1D3), anti-B220, CD45R (clone # RA3-6B2), anti-CD4 (clone #GK1.5) or anti-Ly6G (clone #RB6-8C5) -APC conjugated; anti-IgD ( clone #1 L26c), anti-CD267,TACI (clone #8F10-3), anti-CD279, PD-1 (clone #J43), anti-CD8 alpha (clone #5H10), anti-Ly6C (clone #RB6-8C5), anti-CD5 (clone #53-7.3) -PE conjugated; anti-CD138 (clone #300506), anti-CD21 / 35 (clone#7G6), anti-CD117, cKit (clone #2B8) conjugated to Prcp-Cy5.5; anti- LY6A / E, Sca-1 (clone #D7) conjugated to PE-Cy7; and anti-IgM (clone #11 / 41) conjugated to AF488. Following surface staining, cells were fixed and permeabilized with eBioscience™ Fixation- Permeabilization kit (cat# 00-5521-00) and incubated with FITC conjugated anti-Foxp3 (clone # FJK-16s). All antibodies were purchased from Invitrogen and were diluted 1 to 50. The results were read by FACS Canto II (BD Life Sciences, San Jose, CA) and analyzed by FlowJo™ vl0.8 Software II (BD Biosciences, San Jose, CA).

[0130] ELISA. Mice sera were acquired from tail veins before and every 2 weeks since C3d treatment until the endpoint for each mouse. Sera were diluted from 1:50,000 to 1:100,000 andconcentrations tested by ELISA done according to published methods (de Mattos Barbosa, 2021). The plates were read at 405nm in a BioTck synergy 2 plate reader.

[0131] Histopathology of the kidney. Upon sacrifice, the kidneys were sectioned, and part was fixed, embedded in paraffin and stained with Hematoxylin and Eosin (H&E) to perform the histological studies. Alternatively, sections of mice kidneys were snap frozen in Tissue-Tek Optimal Cutting Temperature (O.C.T.) Compound (Sakura Finetek Cat# 4583) and snap frozen. Five microns cryosections were processed and sections were incubated with the primary antibodies goat anti-mouse kappa-unlabeled (Img / mL, Southern Biotech Cat#1050-01, RRID:AB_ AB._ 2737431), goat anti-mouse Lambda, unlabeled (1 mg / mL; Southern Biotech Cat#1060-02, RRID:AB_2794390) for 1 hour at 4° C, followed by CF555-conjugated donkey anti-goat IgG (20 pg / mL; Sigma- Aldrich Cat#SAB4600059-250UL) or Alexa Fluor Plus 488- conjugated donkey anti-goat IgG (4 pg / mL; Thermo Fisher Scientific Cat# A32814, RRID:AB_2762838); for 1 hour at 4° C. For contrast, nuclei were stained with DAPI and slides were mounted with anti-fade mounting media. The slides were examined with a Leica DMI6000B microscope equipped with a Leica DFC360 FX monochrome digital camera and a Leica HCX PL FLUOTAR L 40X / 0.60 CORR PH2 microscope objective (Leica Microsystems, Wetzlar, Germany). At least 5 fields were imaged at 400x magnification via QCapture Pro 7 software (Qlmaging, Surrey, Canada, RRID:SCR_014432). In some slides glomeruli areas were selected with aid of the tissue green auto-fluorescence and the differential interference contrast (DIC) in stacked images and the mean fluorescence intensity (MFI) of Ig-kappa, Ig-Lambda in the selected area was measured with Adobe Photoshop CC software (Adobe Systems Incorporated, San Jose, CA, RRID:SCR_014199).

[0132] Serum Protein Electrophoresis (SPE). Mice sera was obtained from blood retrieved every 2 weeks following immunizations with NP-OVAL. The SPE was performed on a Helena™ QuickGel Chamber according to manufacturers’ instructions using a QuickGgel split beta.

[0133] CyTOF staining and analysis. CyTOF staining and analysis was done at the CYTOF Core of the University of Michigan. Bone marrow cells were acquired 60 days after initiation of C3d treatment. Cells were suspended in PBS (0.04% BSA), on ice and cell quality was confirmed by measuring cell viability by Trypan Blue staining. Cells were incubated and were stained with 50pL of antibody cocktails in Maxpar Cell Staining Buffer, according to the Fluidigm protocol followed by the CYTOF Core. Antibodies were purchased from andconjugated by either the Lederer’s Lab of Brigham and Women's Hospital or by the Fluidigm Corp., San Francisco, CA. After staining cells were fixed with 1.6% formaldehyde solution. Fixed cells were incubated with Cell-ID Intercalator-Ir solution at 4 °C overnight, washed with Maxpar Cell Staining Buffer and resuspended in Maxpar Water the following day. The EQ Four Element Calibration Beads were used to normalize data using a bead-based passport specific to the manufactured bead lot. 50,000 cells were acquired per sample on CyTOF Helios system (Fluidigm Corp., San Francisco, CA) at approximately 200-300 events / s. After acquisition, the instrument software applied a signal correction algorithm based on the calibration beads signal to correct for any temporal variation in detector sensitivity.

[0134] CyTOF data analysis. Normalized data was generated at the University of Michigan CYTOF CORE laboratory using standard methodologies. Events were pre-processed by FlowJo™ software for Windows (v 10.8) for live single cells. Gating for intact cells was done by selecting events that express both191Ir and193Ir markers on a biaxial plot using the two DNA channels (191Ir and193Ir). Exclusion of beads and cell / bead doublets was done according to expression of! 9{Ir in a DNA channel and excluding!40Ce signal, a bead-only isotope. Cells were191Ir-positive and1°Ce-negative. Gating for live cells was done by excluding195Pt positive events.

[0135] Cytofkit28was used for the data merging and analysis. 10000 Cells in each sample were abstracted to merge and data of 30 to 35 markers was transformed by Customized Asinh Transformation. The t-Distributed Stochastic Neighbor Embedding (t-SNE) algorithm was used for dimensionality reduction and cell subset clustering was generated by Rphenograph29. Cell subsets were identified by visualizing the expression of cell-specific surface markers.

[0136] ELISPOT. To enumerate antibody-secreting cells, 96-well Filtration Plate MultiScreen HTS HA Sterile Plates (MilliPore Cat#MSHAS4510) were activated with 30 pl / well of 35% ethanol for 30 seconds. For determining Ig secreting cells, plates were coated with 100 pl of 5 g / ml of unconjugated goat anti-mouse Ig (H+L) (4ug / ml, Southern Biotech, Birmingham, AL, Cat#1010-01, RRID:AB_2794121) in PBS over night at 4°C; for determining NP-specific antibody secreting cells, plates were coated with lOOpl of 5 pg / ml NP-24-BSA in sodium carbonate (pH 9.6) overnight at 4°C. Coated plates were blocked with 5% BSA in PBS at room temperature for 2 hours, and cells obtained from spleen and bone marrow were 1:2 serially diluted from a maximum of 2xl05cells per well and incubated at 37° C in 5% CO2atmosphereovernight. Antibody secreting cells were detected with alkaline phosphatase (AP)-conjugated antibodies goat anti-mouse IgM (0.5 g / mL; SouthcrnBiotcch Cat#1020-04,RRID:AB_2794200) or goat anti-mouse IgG (0.5 pg / mL; SouthernBiotech Cat#1030-04, RRID:AB_2794293) for 1 hour at room temperature. The reaction was visualized by subsequent addition of BCIP / 5-bromo-4-chloro-3-indolylphosphate / nitro blue tetrazolium substrate (Sigma- Aldrich Cat#B5655-5TAB). The number of spots was determined using a CTL ImmunoSpot S5 UV Analyzer equipped with ImmunoSpot ImmunoCapture and ImmunoSpot Counting software (Cellular' Technology Ltd., Cleveland, OH, RRID:SCR_011082).

[0137] Single cell RNA (Sc-RNA) analysis. Pre-processing: scRNA was obtained from bone marrow cells isolated from 5 C3d treated and 5 non-treated mice, two months after treatment using 10X genomics procedures. Data were processed and analyzed on UMICH’s Advanced Research Computing (ARC)’s high-computing cluster, Great Lakes. Reads were aligned and quantified using Cell Ranger using a custom reference to account for the human MYC transgene, which the human MYC gene from GRCh38 was added to the GRCm38 genome reference30. The downstream analysis was done with Seurat in R using the filtered count matrices from Cell Ranger. Cells from each sample were filtered based “nCount”, “nFeature”, and percent mitochondrial genes (refer to code for filtering thresholds). Seurat’s integration pipeline was then used to process the scRNA-seq31. The cells were integrated by run ID since some samples were sequenced on different days. Reciprocal PCA (RPCA) was used in the “IntegrateData” function. 22 principal components (PCs) were used for clustering and generating the UMAP. Clusters were annotated using canonical cell type markers and cluster-specific differential expression (DE) genes from the “FindAllMarkers” function. Hematopoietic stem cells (HSCs) expressed Cdk6, Kit, and Adgrgl. Fibroblasts expressed Collal, Colla2, Loxll, and Lum. Erythroid cells expressed Hba-al and Hba-a2. Platelets expressed Pf4, Itga2b, Gplba, Tubbl, and Ppbp. T and NK cells were found to be in the same cluster, which these cells expressed a combination of Ptrprc, Cd3d, Cd3e, Cd4, Foxp3, Cd8a, Nkg7, Klrgl, and Gzma. B cells expressed Cd79a, Cdl9, and Ms4al. Plasma cells expressed Sdcl, Xbpl, CcrlO, Prdml, and Ly6c2. Plasma cells did not express any of the B cell markers. Granulocytes mainly expressed Ptprc, Itgam, S100a8, S100a9, Cd33, Ly6g, Prss34, and Mcpt8. Monocytes / macrophages mainly expressed Ptprc, Itgam, Cd68, Adgrel, Cdl4, Mrcl, and Ccr2. Plasmacytoid dendritic cells (pDCs) mainly expressed Ptprc, Cd4, Cd68, Siglech, and Irf8.

[0138] To distinguish malignant versus non-malignant plasma cells, gene expression was analyzed in plasma cells defined as cells expressing one or more of each of the following genes: Sdcl, Xbpl, or Prdml. Malignant and non-malignant scores were calculated based on the expression of genes found to be associated with malignancy in the VK-MYC* mouse model according to Croucher et al.21. Malignant and non-malignant scores were determined in each sample using the “AddModuleScore” function in Seurat31. Cells with a malignant score in the top 20% and non-malignant score in the bottom 20% were considered the most malignant; while cells with a malignant score in the bottom 20% and non-malignant score in the top 20% were considered non-malignant. The frequency of malignant and benign cells in each sample was calculated considering cell unique identifiers. Heatmaps were created using “pheatmap”. A total of 808 clones were examined.

[0139] Immunoglobulin sequence analysis. Sequences were obtained from 10X genomics from bone marrow cell suspensions. Data were processed and analyzed on UMICH’s Advanced Research Computing (ARC)’s high-computing cluster, Great Lakes. FASTA reads were produced by Cell Ranger software (10X genomics) and sequences were submitted to IgBlast to generate AIRR files or to IMGT32-35to obtain IMGT archive files. The IMGT files were further analyzed with the ARGalaxy suite software36and / or the statistics program at the IMGT site. From the organized data isotype and somatic hypermutation data were complies and graphs were produced using prism (v9 for Mac).

[0140] C3d incubation of 18.81 pre-lymphoma cells: 18.81 cells containing a hygromycin B resistance plasmid {Balin, 2010 #8118} were cultured at 37C in RPMI (Thermo Fisher Scientific, Cat: 11875093) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Cat: A5670701), 1% penicillin / streptomycin (Thermo Fisher Scientific, Cat: 15140122) and L-glutamine (Thermo Fisher Scientific, A2916801), 0.1% 2-metacaptoethnol (Thermo Fisher Scientific, Cat: 21985023), and 200 pg / ml of Hygromycin B (Thermo Fisher Scientific, Cat: 10687010). Cells were plated at 1x105 cells / lOOpl in all wells of a flat-bottom 96 well plated and incubated for one hour at 37C. Following, the incubation, 20 pl of Img / ml C3d or PBS with 10% glycerol was added to six wells of the plate. This was repeated every 24hrs for two additional days. Total C3d incubation times were 24, 48, and 72 hours. Cells were harvested and stained with anti-mouse H-2Kd-PE / Cy7 (Biolegend, Clone: SF1-1.1, RRID: AB_2562733, Cat: 116622) and anti-mouse H-2Dd-Alex fluorophore 647 (Biolegend, Clone: 34-2-12, RRID:AB_492913, Cat: 110612), anti-mouse CD21-PE (Biolegend, Clone 7E9, RRID:AB_940411 Cat: 123409), and anti-mouse C3d-FITC. Anti-C3d antibody was conjugated using Abeam FITC lightning link kit (Abeam, Cat: ab 102884).

[0141] Statistics. Statistical analysis was performed using GraphPad Prism software (v9 for Mac, GraphPad Software). Distributions of 2 unpaired groups were compared using two nonparametric two tailed Mann-Whitney tests. Paired analysis was by either multiple paired T tests or by the Wilcoxon matched-pairs signed rank test. Correction for multiplicity of measurements was done using False Discovery Rate. Comparisons of more than 2 groups were by ANOVA. Categorical variables were compared using %2 or Fisher’s exact test analysis. A P value of less than 0.05 was considered statistically significant. Data are presented as the mean ± SEM in all figures in which error bars are shown.

[0142] Recombinant, soluble, modified complement 3d (C3d) of the disclosure has antitumor properties and decreases paraproteinemia in mice with spontaneous monoclonal gammopathy. In order to explore whether recombinant C3d protein / polypeptide could induce cell mediated immunity against malignant plasma cells and / or pre-malignant precursor cells and hence evoke immune surveillance on normal and malignant B lineage cells, it was tested whether administration of a recombinant C3d protein could modify the development and early course of monoclonal gammopathies. For example, it was reasoned that if malignant plasma cells are immunogenic, C3d may enhance anti-tumor cell mediated immunity. On the other hand, if multiple myeloma and premalignant conditions are not immunogenic C3d may not be useful.

[0143] In order to test the impact of soluble, recombinant C3d on clonal- specific immune surveillance a C3d peptide linked to a peptide-intemalization domain (FIG. 6A) was produced and the recombinant C3d protein was administered to mice that develop spontaneous monoclonal malignancy, the VK*MYC mice. VK*MYC mice express human c-Myc under the control of Ig promoter and enhancer in B cells, following B cell antigen activation and reversion of a stop codon by somatic hypermutation (Chesi, M. et al.. Cancer cell 13, 167-180). Tracing the development of pre-malignancy and evolution of multiple myeloma is facilitated by detection of clonotypic M protein, a monoclonal Ig detected in blood and marker of the premalignant monoclonal gammopathy of undetermined significance (MGUS), smoldering multiple myeloma (SMM) (Cowan, A. J. et al., (2022) JAMA 327, 464-477) and ultimately multiple myeloma. Drug efficacy studies in the VK*-MYC model predict single-agent drug activity in multiple myeloma,with a positive predictive value of 67% (4 of 6) for clinical activity, and a negative predictive value of 86% (6 of 7) for clinical inactivity (Chcsi ct ah, Blood 120, 376-385; Chcsi ct al., Nat Med 22, 1411-1420).

[0144] To accelerate the development of the monoclonal gammopathy Vk*-MYC transgenic mice (between 5 and 8 months of age) were immunized repeatedly (3 times separated by 35 days) with 4-hydroxy-3-nitrophenyl-OVA, NP-OVA a hapten-carrier conjugate known to induce germinal center reactions, until development gammopathy and ultimately multiple myeloma were evident from quantification of IgG and clonotypic M protein, recapitulating disease progression in humans (Chesi, et al., Cancer cell 13, 167-180; Chesi, et al., Blood 120, 376-385). 20-40 microg C3d protein was administered by intra-tibial injection to VK*-MYC mice that had a clear monoclonal Ig band. Untreated mice were injected with buffer (PBS) without C3d. Because monoclonal gammopathy and multiple myeloma develop at different ages in VK*-MYC (as in humans), mice were paired according to age, baseline total and monoclonal IgG concentrations, and one of each pair was either treated with recombinant C3d or injected with PBS, that is left untreated.

[0145] It was observed that a single C3d treatment averted the increase in serum IgG and M protein in mice of the same age and equivalent tumor burden at the beginning of the experiment. In untreated mice, the serum IgG increased 49% during the ensuing two months (FIGS. 1A and IB) and the M protein increased in every mouse injected with PBS (FIG. IB and FIG. 7). In contrast, after treatment with C3d for 2 months, the concentration of IgG in serum decreased, on average, 32.5% (FIGS. 1A and IB) and the M protein bands detected by serum protein electrophoresis at the time of injection became indistinguishable from broader Ig bands (FIG. IB and FIG. 7). Thus, over two months, treatment with C3d selectively decreased paraproteinemia, while allowing or possibly favoring production of polyclonal IgG. Thus, in some embodiments, the disclosure provides that recombinant, soluble C3d promoted development of immunity that selectively impaired Ig production by transformed cells. While an understanding of a mechanism is not needed to practice the present disclosure and while the disclosure is not limited to any particular mechanism, in some embodiments, C3d promotes development of immunity that selectively impairs Ig production by transformed cells.

[0146] C3d treatment decreases paraproteinemia and reduces multiple myeloma tumor burden. In order to determine whether the decrease in paraproteinemia following treatment withC3d reflected a decrease in tumor burden, assays were performed to determine the frequency of plasma cells in bone marrow retrieved from VK*-MYC mice 60 days after treatment with C3d or from paired VK*-MYC mice that were received PBS only. VK*-MYC mice treated with C3d 60 days earlier, had in bone marrow, less than two-fold the number of plasma cells detected by Cytometry by Time of Flight (CYTOF) than PBS injected partners (FIGS. 2A-2C). Although bone marrow samples exhibit notable variability in cellularity, all treated mice save one had appreciably lower frequencies of plasma cells than untreated partners (FIG. 2C). This extent of decrease in plasma cell burden was confirmed by flow cytometry and by ELISPOT of bone marrow derived cells (FIGS. 2E-F). The decrease in the frequency of ASCs was not observed in the spleen (FIG. 2G) confirming a bone marrow specific decrease. The decrease in frequency of bone marrow plasma cells was observed both in elderly mice (>1 year of age) with frank manifestations of multiple myeloma and in younger mice (0.75 Y) that had not developed full multiple myeloma (IgG< 5mg / ml) (FIGS. 8A-C). These results indicate that the impact of C3d treatment on paraproteinemia reflects at least in part a decrease in tumor burden and that the decrease can impact partly transformed pre-malignant as well as malignant plasma cells.

[0147] CMI targets malignant clones and spares non-malignant clones. From theoretical and practical perspectives, it would be important to know whether the decrease in serum IgG and in frequency of plasma cells reflected a specific action on multiple myeloma cells and possibly pre- malignant plasma cells, or, a broader action that impacted normal plasma cells, normal hematopoietic or non-hematopoietic cells. As mice treated with C3d appeared healthier and better groomed than untreated partners, treatment with C3d generated no obvious systemic toxicity. Moreover, treatment with C3d had no discernable impact on frequencies of hematopoietic cells (FIG. 8D), suggesting the impact could be limited to cells of B cell lineage. The more difficult and discerning question however is whether treatment with C3d impacts non- malignant cells of B cell lineage, as normal B cells and especially memory B cells and plasma cells accumulate mutations to the same extent as multiple myeloma cells (Machado et al., Nature 608, 724-732) and display cell surface phenotypes similar’ to phenotypes of malignant plasma cells.

[0148] It was next tested whether C3d selectively targets transformed plasma cells or both, transformed and non-transformed plasma cells. Since multiple myeloma and pre-malignant gammopathies were induced in VK*-MYC mice by immunization of mice with NP-OVA (whichwould selectively induce hMYC in NP-specific B cells), this question could be approached in part by comparing frequencies of NP-spccific ASC in bone marrow where MM cells tend to accumulate, and spleen, where naive and activated B cells accumulate. VK*-MYC mice treated with C3d had, on average, 16-fold fewer NP-specific antibody- secreting cells (ASC) in bone marrow than untreated VK*-MYC mice (FIG. 2E). However, treatment with C3d did not suppress T cell and B cell responses to NP-OVA, as NP-specific ASC in the spleens of treated mice were as frequent as in in spleens of untreated mice (FIG. 2F). Thus, the disclosure provides, in some embodiments, that C3d selectively promotes selective clearance of malignant plasma cells and that C3d treatment helps maintain the integrity of immune responses.

[0149] C3d treatment eliminates malignant plasma cells and spares non-malignant plasma cells. The notably specific clearance of malignant plasma cells and the sparing of non-malignant plasma cells by treatment with C3d protein indicates that recombinant, soluble C3d protein may have recruited protective cell mediated immunity. However, C3d may also, or instead, have exerted some yet undefined direct action on malignant plasma cells or it may have promoted antibody-mediated clearance of plasma cells, consistent with functions of C3d conjugated antigen (Dempsey, et al., Science 271, 348-350. 10.1126 / science.271.5247.348; Fearon, Science 272, 50-53). The observation that treatment of VK*-MYC mice with cyclosporine, twice weekly beginning 7 days after C3d injection, inhibited C3d-induced decrease in tumor load (FIG. 2G-I) while having no effect in splenic plasma cells (FIG. 2J), are consistent with the concept that C3d protein recruited cell-mediated immunity to surveil and clear malignant clones.

[0150] To probe C3d-induced CMI on normal and malignant plasma cells, single cell RNA sequencing (scRNA seq) analysis was used to compare bone marrow cells from VK*-MYC mice treated with C3d with bone marrow cells from VK*-MYC mice that had not received C3d, using 10X genomics technologies. For this analysis, plasma cells were defined as cells with rearranged IgH that expressed hmyc, SD1C, PDRM1, or XBP1 but not CD19 (FIGS. 9A-B). After filtering, a total of 3995 cells were obtained from 5 VK*-MYC mice treated with C3d and from 5 VK*- MYC mice that were not treated with C3d. Based on criteria introduced by Croucher et al. (Croucher, (2021). Nat Commun 72, 6322), malignant and non-malignant cells were distinguishable according to the expression of a set of genes associated with malignancy or with non-malignancy. Scores were compiled reflecting malignant genes or non-malignant genes expression (see methods, above). Malignant cells were defined as those with malignant geneexpression score in the top 20% and non-malignant gene expression score in the lower 20%. In contrast, non-malignant cells were defined as those with malignant gene expression score in the bottom 20% and non-malignant gene expression score in the top 20%20 (FIGS. 3A-C). Only 3% of the plasma cells retrieved from bone marrow from C3d treated VK*-MYC animals were malignant, while 28.3% of the of the plasma cells retrieved from bone marrow of mice not treated with C3d were malignant (FIG. 3D). Conversely, benign plasma cells were 19-fold more frequent than malignant clones in C3d-treated animals while malignant and non-malignant plasma cells were detected in approximately equal frequencies in VK*-MYC mice that were not treated with C3d (FIG. 3D). Mice that received PBS had more larger clones than mice given C3d (FIG. 3E). Moreover, one in 5 VK*-MYC mice treated with C3d had no detectable malignant cells among 651 single cells analyzed, and only 0.7% plasma cells in the bone marrow. While an understanding of a mechanism is not needed to practice the present disclosure and while the disclosure is not limited to any particular mechanism, in some embodiments, the disclosure provides that treatment with C3d induced remission of MM while at the same time preserving non-malignant cells and plasma cell function.

[0151] To determine if highly mutated cells were preferentially targeted following C3d administration, the bone marrow Ig B cell repertoires of treated and non-treated mice were studied using 10X genomics. Malignant cells are the progeny of activated B cells that accumulate mutations and express Ig class switched isotypes while the majority of B cells in the bone marrow are immature expressing predominantly non-mutated IgM / D. The V(D)J H+L sequences obtained by paired NGS of single cells obtained from bone marrow isolates were analyzed from five VK*-MYC mice treated or from five VK*-MYC mice not treated with C3d, 8- 10 weeks after treatment. Analysis showed that C3d treatment decreased the frequency of Ig class-switched B cells in the bone marrow and increased the frequency of IgM expressing cells by 2 fold consistent with specific targeting of malignant plasma cells that predominantly express IgG (FIG. 4A). No significant differences in the VH repertoires of BM B cells in mice treated or not with C3d were observed indicating that C3d spares normal B cell development that is the major source of repertoire diversity in the BM (FIGS. 4B-C). It was also observed that IgH CDR3 sequences obtained from mice that received PBS were skewed likely owing to over representation of certain malignant clones (FIG. 4F). Furthermore, analysis of V-J recombination of all IgH chains by Circos plots showed that there were fewer enlarged clonesthat utilize the same VH and JH gene segments in mice treated with C3d relative to untreated mice (FIGS. 4D-E). C3d treatment decreased the frequency of Ig clonotypcs expressing VH mutated above 2% by almost 6 fold (FIG. 4G) and decreased the frequency of VH mutations for cells expressing IgA and IgGl isotypes (FIG. 4H). Thus, in some embodiments, the disclosure provides compositions and methods of using recombinant, soluble C3d to induce C3d-dependent cell mediated immunity and selective elimination of malignant clones that have highly mutated Ig and / or express Ig class switched isotypes found in multiple cells while concurrently preserving normal B cell development of cells expressing mostly unmutated IgM and a diverse V(D)J repertoire.

[0152] To test if C3d directed cell mediated immunity to specific plasma cell clones, specific NP-responses were tested / analyzed in the bone marrow (for example, reasoning that since multiple myeloma arises in response to NP-OVA, clonal-specific deletion should result in the decrease of cells expressing the canonical VH1.72 and / or the W33L CDR1 mutation that increases affinity for NP by 10 fold (Cumano, A., and Rajewsky, K. (1986). EMBO J 5, 2459- 2468; Furukawa, et al., (2007). Mol Immunol 44, 2436-2445). It was observed that C3d treated mice had 10.4 fold less VH1-72 expressing cells than mice injected with PBS (FIG. 5A). Furthermore, in mice injected with C3d only 10% of the VH1-72 sequences had the canonical W33L mutation while 56% of the VH1-72 sequences in mice injected with PBS had the W33L mutation (PcO.0001, Fisher’s exact test) indicating that C3d promoted clone specific cell mediated immunity (FIGS. 5B-D). Results also show that clone-directed immunity targeted the largest and most mutated clones (FIGS. 5E and F). The data are consistent with clonal- specific cell mediated immunity.

[0153] Analysis of differential gene expression in granulocytes indicated that these cells obtained from the bone marrow of mice treated with C3d showed increased expression of C-X-C motif chemokine ligand 2, Cxcl2, and Interferon Alpha-Inducible Protein 27-Like Protein, Ifi2712a, compared to granulocytes obtained from controls (FIG. 10). CXCL2 is produced by neutrophils and is a potent chemoattractant for these cells. Ifi2712a is involved in apoptosis and its function in granulocytes is not well understood. The data indicates that C3d treatment interferes with tumor environment in the bone marrow.

[0154] It was next tested whether treatment with C3d polypeptide that effectively decreased paraproteinemia and cleared malignant MM cells could also impact somatic manifestations ofMM. Multiple Myeloma is associated with kidney disease. Myeloma nephropathy occurs when Ig deposits in the kidney and include light chain amyloidosis; monoclonal Ig deposition disease; and, less frequently, cryoglobulinemic glomerulonephritis and proliferative glomerulonephritis. To assess myeloma nephropathy in mice treated or not with C3d, kidney sections were obtained at the end of treatment and were characterized by staining with H&E and with an antibody directed at kappa or lambda light chains. Results shown in FIGS. 12A-12D and 13 show that both control and C3d treated mice had proteinaceous casts in the tubules. Three out of 6 control mice had no specific pathology, one had collagen deposits and histology consistent with hamartoma; one had mild tubular injury (FIG. 12A) and another had changes consistent with “waxy cast” (FIG. 12B). Of the 4 C3d treated mice examined three had proteinaceous casts (FIG. 12D), focal segmental glomerulonephritis, diffuse mild tubular injury and one had calcium phosphate crystals (FIG. 12C), focal segmental glomerulonephritis and diffuse mild tubular injury (FIG. 12). Every section had generalized mild deposits of kappa light chains in both the medulla and cortex as well as rare focal accumulations in the glomeruli (FIG. 13). There were no significant deposits of Ig lambda light chains. While an understanding of a mechanism is not needed to practice the present disclosure and while the disclosure is not limited to any particular mechanism, in some embodiments, the disclosure indicates that mice develop myeloma nephropathy and that the short course of treatment does not reverse kidney disease when it is sufficiently advanced or because reversal of kidney disease may require treatment for longer than 2 months.

[0155] C3d increases expression of genes encoding ribosomal proteins and genes encoding long non-coding RNAs that increase MHC-I expression of neo-peptides. C3d treatment caused a profound change in gene expression. scRNA analysis of bone marrow cells revealed that C3d changed the expression of 252 genes and decreased the expression of 94 genes in bone marrow cells studied 2 months after treatment, with an adjusted PcO.OOOl. To determine how C3d impacted malignant plasma cells it was tested if internalization of C3d by tumor cells altered plasma cell gene expression promoting immunity. scRNA analysis of bone marrow hMyc- positive plasma cells revealed that C3d changed the expression (with adjusted P<0.0001) of 58 genes (FIG. 17 A-C). Changes in the ribosomal composition determine the extent to which translation of defective ribosomal products “DRiPs” occur (Schwanhausser el al., 2021). Because presentation by MHC I of peptides originated from DRiPs are important in immunesurveillance (Yewdell and Nicchitta, 2006), it was tested whether C3d changed ribosomal gene expression to facilitate translation of DRiPs. The results show that C3d increased the expression of 23 of the 80 ribosomal proteins by plasma cells. C3d increased the expression of Rpl genes that encode proteins that form the S60 ribosomal subunit (RpllO, Rpl22, Rpl23a, Rpl24, Rpl 30, Rpl35, Rpl35a, Rpl36a, Rpl37, Rpl37a, Rpl38, Rpl39 and Rpl41) with adjusted P< 0.0001. C3d also increased the expression of Rps genes that encode proteins that form the 40S ribosomal subunit (Rps2, Rps3, Rps3al, Rps4x, Rpsl5a, Rps 6, Rps21, Rps26, Rps28 and Rps29) with adjusted P< 0.0001. Consistent with the increased expression of ribosomal genes gene ontology (GO) term analysis identified “translation and secretion” as the main pathways enhanced by C3d treatment on Plasma cells (FIG. 17D). Of the 23 genes encoding ribosomal proteins increased in expression, in plasma cells, by C3d in vivo, 13 were also found to be increased following treatment of 18.82 B cells in culture, with adjusted P<0.0001, (FIG. 16), compared to cultures that received media alone. These results are consistent with C3d dependent changes in ribosomal function. Of particular interest, Rps28 expression has been linked to immune- surveillance (Wei et al., (2019). Mol Cell 73, 1162-1173 el 165) indicating that intracellular C3d may increase antigen presentation and non-canonical gene translation originating DRiPs for MHC-I presentation. This was tested by incubating 18.81 B cells with C3d and revealed that icells incubated with C3d increased MHC-I expression by at least 30% starting at 24 hours postincubation (FIG. 15A-C).

[0156] Treatment by C3d increased the expression of long non-coding RNAs that have been shown to provide MHC class I binding peptides (Barczak,. (2023). Nat Commun 14, 1078). Thus, C3d increased the expression of Gm42047 (adjP=3.19x10-40) by plasma cells and to a lesser extent by B cells and plasmacytoid dendritic cells in the bone marrow. Gm42047 expression was also increased after incubation of 18.81 with C3d (FIG. 16). Incubation of 18.81 cells with C3d increased the expression of several LncRNAs found by Barczak et al. to contribute peptides that bind MHC-I with high affinity. These included 4930426D05Rik (adjP=4.32*10-4), 4933427D14Rik (adjP=7.75*10-5), AC160336.1(adjP=1.29*10-13), Tomm6os (adjP=0.03), Gm42047 (adjP=1.43*10-5), Gm43549 (adjP=3.25*10-6) and Gm37499 (adjP=0.006). Because many LncRNAs are targets of E2F1 which is repressed by methylation by the protein arginine methyl transferase (PRMT) (Markiewski, M.M., and Lambris, J.D. (2009).. Trends Immunol 30, 286-292), it was next determined if this pathway was activated by C3d.Analysis of gene expression in 18.81 B cells treated with C3d revealed that along with E2F1 , the genes encoding known E2 Fl partners were significantly increased in expression following C3d exposure while the gene encoding Prmt5 was decreased (FIG. 16). The results indicated that C3d activates E2F1 mediated gene transcription of IncRNAs which in turn provide peptides to load on MHC-I engaging T cell-dependent immune surveillance.

[0157] Consistent with an activation T cell-dependent responses it was found that T cells in bone marrow of VK*-MYC mice treated with C3d had increased expression of genes encoding granzyme K and C-C motif chemokine ligand 4 (CCL4). Gzmk encodes granzyme k and the message is expressed by CD8+ T cells in the inflammatory milieu (Jonsson et al., (2022). Sei Transl Med 14, eabo0686). A significant increase in the expression of C-X-C motif chemokine ligand 2, Cxcl2, and Interferon Alpha-Inducible Protein 27-Like Protein, Ifi2712a, were also found in granulocytes in bone marrow of VK*-MYC mice treated with C3d compared to granulocytes obtained from controls. CXCL2 is produced by neutrophils and is a potent chemoattractant for these cells. 1112712a is involved in apoptosis and its function in granulocytes is not well understood.REFERENCES1 Cowan, A. J. et al. Diagnosis and Management of Multiple Myeloma: A Review. JAMA 327, 464-477, doi:10.1001 / jama.2022.0003 (2022).2 Rajkumar, S. V. Multiple myeloma: 2022 update on diagnosis, risk stratification, and management. Am J Hematol 97, 1086-1107, doi: 10.1002 / ajh.26590 (2022).3 Knittel, G. et al. Insertional hypermutation in mineral oil-induced plasmacytomas. Ear J Immunol 44, 2785-2801, doi:10.1002 / eji.201344322 (2014).4 Overwijk, W. W. Human CD4(+) T cells spontaneously detect somatic mutations in cancer cells. Nat Med 21, 12-14, doi:10.1038 / nm.3783 (2015).5 Rodriguez-Martin, B. et al. Pan-cancer analysis of whole genomes identifies driver rearrangements promoted by LINE-1 retrotranspo sition. Nat Genet 52, 306-319, doi:10.1038 / s41588-019-0562-0 (2020).6 Consortium, I. T. P.-C. A. o. W. G. Pan-cancer analysis of whole genomes. Nature 578, 82-93, doi:10.1038 / s41586-020-1969-6 (2020).7 Hoyos, D. et al. Fundamental immune-oncogenicity trade-offs define driver mutation fitness. Nature 606, 172-179, doi:10.1038 / s41586-022-04696-z (2022).8 Samstein, R. M. et al. Tumor mutational load predicts survival after immunotherapy across multiple cancer types. Nat Genet 51, 202-206, doi:10.1038 / s41588-018-0312-8 (2019).9 Palmer, E. Negative selection— clearing out the bad apples from the T-cell repertoire. Nat Rev Immunol 3, 383-391, doi:10.1038 / nril085 (2003).10 Machado, H. E. et al. Diverse mutational landscapes in human lymphocytes. Nature 608, 724-732, doi:10.1038 / s41586-022-05072-7 (2022).11 Wang, C. L., Harper, R. A. & Wabl, M. Genome- wide somatic hypermutation. Proc Natl Acad Sci U SA 101, 7352-7356, doi: 10.1073 / pnas.0402009101 (2004).12 Chan, T. D. et al. Elimination of germinal-center-derived self-reactive B cells is governed by the location and concentration of self-antigen. Immunity 37, 893-904, doi: 10.1016 / j.immuni.2012.07.017 (2012).13 Tamura, H., Ishibashi, M., Sunakawa-Kii, M. & Inokuchi, K. PD-L1-PD-1 Pathway in the Pathophysiology of Multiple Myeloma. Cancers (Basel) 12, doi: 10.3390 / cancers 12040924 (2020).14 Victora, G. D. & Nussenzweig, M. C. Germinal Centers. Annu Rev Immunol 40, 413-442, doi: 10.1146 / annurev-immunol- 120419-022408 (2022) .15 Swamydas, M., Murphy, E. V., Ignatz-Hoover, J. J., Malek, E. & Driscoll, J. J.Deciphering mechanisms of immune escape to inform immunotherapeutic strategies in multiple myeloma. J Hematol Oncol 15, 17, doi:10.1186 / sl3045-022-01234-2 (2022).16 Chesi, M. et al. AID-dependent activation of a MYC transgene induces multiple myeloma in a conditional mouse model of post-germinal center malignancies. Cancer cell 13, 167-180, doi:10.1016 / j.ccr.2008.01.007 (2008).17 Chesi, M. et al. Drug response in a genetically engineered mouse model of multiple myeloma is predictive of clinical efficacy. Blood 120, 376-385, doi: 10.1182 / blood- 2012-02- 412783 (2012).18 Platt, J. L. et al. C3d regulates immune checkpoint blockade and enhances antitumor immunity. JCI Insight !, doi:10.1172 / jci.insight.90201 (2017).19 Chesi, M. et al. TAP antagonists induce anti-tumor immunity in multiple myeloma. Nat Med 22, 1411-1420, doi: 10.1038 / nm.4229 (2016).20 Guillerey, C. et al. Immunosurveillance and therapy of multiple myeloma are CD226 dependent. J Clin Invest 125, 2904, doi:10.1172 / JCI82646 (2015).21 Croucher, D. C. et al. Longitudinal single-cell analysis of a myeloma mouse model identifies subclonal molecular programs associated with progression. Nat Commun 12, 6322, doi:10.1038 / s41467-021-26598-w (2021).22 Dempsey, P. W., Allison, M. E., Akkaraju, S., Goodnow, C. C. & Fearon, D. T. C3d of complement as a molecular adjuvant: bridging innate and acquired immunity. Science 271, 348- 350, doi: 10.1126 / science.271.5247.348 (1996).23 Fearon, D. T. & Locksley, R. M. The instructive role of innate immunity in the acquired immune response. Science 272, 50-53 (1996).24 Jonsson, A. H. et al. Granzyme K(+) CD8 T cells form a core population in inflamed human tissue. Sci Transl Med 14, eabo0686, doi: 10.1126 / scitranslmed.abo0686 (2022).25 Rendo, M. J., Joseph, J. J., Phan, L. M. & DeStefano, C. B. CAR T-Cell Therapy for Patients with Multiple Myeloma: Current Evidence and Challenges. Blood Lymphat Cancer 12, 119-136, doi: 10.2147 / BLCTT.S327016 (2022).26 Simmons, G. L. & Castaneda Puglianini, O. T-Cell-Based Cellular Immunotherapy of Multiple Myeloma: Current Developments. Cancers (Basel) 14, doi: 10.3390 / cancers 14174249 (2022).27 Shah, N., Chari, A., Scott, E., Mezzi, K. & Usmani, S. Z. B-cell maturation antigen (BCM A) in multiple myeloma: rationale for targeting and current therapeutic approaches. Leukemia 34, 985-1005, doi:10.1038 / s41375-020-0734-z (2020).28 Chen, H. et al. Cytofkit: A Bioconductor Package for an Integrated Mass Cytometry Data Analysis Pipeline. PLoS Comput Biol 12, el005112, doi:10.1371 / joumal.pcbi.l005112 (2016).29 Levine, J. H. et al. Data-Driven Phenotypic Dissection of AML Reveals Progenitor-like Cells that Correlate with Prognosis. Cell 162, 184-197, doi:10.1016 / j.cell.2015.05.047 (2015).30 Zheng, G. X. et al. Massively parallel digital transcriptional profiling of single cells. Nat Commun 8, 14049, doi:10.1038 / ncommsl4049 (2017).31 Hao, Y. et al. Integrated analysis of multimodal single-cell data. Cell 184, 3573-3587 e3529, doi:10.1016 / j.cell.202L 04.048 (2021).32 Giudicelli, V. et al. IMGT((R)) Tmmunoinformatics Tools for Standardized V-DOMAIN Analysis. Methods Mol Biol 2453, 477-531, doi:10.1007 / 978-l-0716-2115-8_24 (2022).33 Alamyar, E., Giudicelli, V., Li, S., Duroux, P. & Lefranc, M. P. IMGT / HighV-QUEST: the IMGT(R) web portal for immunoglobulin (IG) or antibody and T cell receptor (TR) analysis from NGS high throughput and deep sequencing. Immunome research 8, 26 (2012).34 Alamyar, E., Duroux, P., Lefranc, M. P. & Giudicelli, V. IMGT((R)) tools for the nucleotide analysis of immunoglobulin (IG) and T cell receptor (TR) V-(D)-J repertoires, polymorphisms, and IG mutations: IMGT / V-QUEST and IMGT / HighV-QUEST for NGS. Methods Mol Biol 882, 569-604, doi:10.1007 / 978-l-61779-842-9_32 (2012).35 Li, S. et al. IMGT / HighV QUEST paradigm for T cell receptor IMGT clonotype diversity and next generation repertoire immunoprofiling. Nat Commun 4, 2333, doi:10.1038 / ncomms3333 (2013).36 H, I. J. et al. Antigen Receptor Galaxy: A User-Friendly, Web-Based Tool for Analysis and Visualization of T and B Cell Receptor Repertoire Data. J Immunol 198, 4156-4165, doi: 10.4049 / jimmunol.1601921 (2017).

Claims

CLAIMSWhat Is Claimed Is:

1. A composition comprising a recombinant, modified complement 3d (C3d) polypeptide.

2. The composition of claim 1, wherein the recombinant, modified C3d polypeptide comprises the amino acid sequence of SEQ ID NO.:2 and / or SEQ ID NO.:7.

3. The composition of either claim 1 or 2, wherein the recombinant, modified C3d polypeptide comprises a cell penetrating peptide sequence and / or a protein transduction domain.

4. The composition of any one of claims 1-3, wherein the protein transduction domain comprises the amino acid sequence of SEQ ID NO.:3.

5. The composition of any one of claims 1-4, further comprising a pharmaceutically acceptable carrier and / or excipient.

6. The composition of any one of claims 1-5, further comprising a cancer therapeutic agent.

7. A method of treating cancer in a subject comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising: a) recombinant complement 3d (C3d) polypeptide of SEQ ID NO.:2 and / or SEQ ID NO.:7; and b) a carrier and / or excipient. wherein administration of the pharmaceutical composition treats the cancer in the subject.

8. The method of claim 7, wherein administration of the pharmaceutical composition to the subject results in a detectable reduction in the number of cancer cells in the subject.

9. The method of either claim 7 or 8, wherein treating the cancer comprises reducing serum IgG and / or M protein in the subject.

10. The method of either claim 7 or 8, wherein treating the cancer comprises reducing paraproteinemia in the subject.

11. The method of either claim 7 or 8, wherein treating the cancer comprises increasing the production of polyclonal IgG in the subject.

12. The method of either claim 7 or 8, wherein treating the cancer comprises decreasing the tumor burden in the subject.

13. The method of claim 12, wherein decreasing the tumor burden comprises decreasing the number of transformed pre-malignant cells and / or malignant cells in the subject.

14. The method of either claim 7 or 8, wherein treating the cancer occurs without damaging non-malignant cells and / or normal plasma cell function in the subject.

15. The method of either claim 7 or 8, wherein treating the cancer comprises inducing remission of cancer in the subject.

16. The method of either claim 7 or 8, wherein the cancer is bladder cancer, breast cancer, colon cancer, kidney cancer, liver cancer, lung cancer, ovary cancer, cervix cancer, pancreas cancer, rectum cancer, prostate cancer, stomach cancer, epidermis cancer; a hematopoietic tumor of lymphoid or myeloid lineage, leukemia, myeloma, lymphoma, a tumor of mesenchymal origin, fibrosarcoma, rhabdomyosarcoma, melanoma, teratocarcinoma, neuroblastoma, glioma, adenocarcinoma, non- small lung cell carcinoma.

17. The method of either claim 7 or 8, wherein the cancer is myeloma.

18. The method of either claim 7 or 8, wherein treating the cancer comprises eliminating malignant clonal cells.

19. The method of claim 18, wherein the malignant clones have highly mutated Ig and / or express Ig class switched isotypes.

20. A method of treating or preventing cancer in a subject comprising administering to the subject a therapeutically or prophy lactically effective amount of a recombinant complement 3d (C3d) polypeptide of SEQ ID NO.:2 or SEQ ID NO.:7 to the subject.

21. Use of recombinant complement 3d (C3d) polypeptide of SEQ ID NO.:2 or SEQ ID NO.:7 in treating a disease or disorder characterized by evasion of immune surveillance and / or tumor- induced immunosuppression.

22. Use of recombinant complement 3d (C3d) polypeptide of SEQ ID NO.:2 or SEQ ID NO.: 7 of claim 21, wherein the disease or disorder is cancer.

23. A method of treating cancer in a subject comprising administering a therapeutically effective amount of a composition comprising recombinant, modified complement 3d (C3d) polypeptide to the subject.

24. The method of claim 23, wherein administering recombinant, modified C3d polypeptide induces a protective cell mediated immune response in the subject.

25. The method of any one of claims 23-24, wherein the cell mediated immune response selectively targets transformed cancer cells.

26. The method of any one of claims 23-25, wherein the cell mediated immune response spares non-transformed cells.

27. The method of any one of claims 23-26, wherein the cell mediated immune response is specific for the products of multiple mutations of somatic non-immunc globulin (Ig) genes.

28. The method of any one of claims 23-27, wherein the cell mediated immune response is specific for products encoded by long non-coding RNAs.

29. The method of any one of claims 23-28, wherein administering recombinant, modified C3d polypeptide reduces the presence of transformed clones in the subject.

30. The method of any one of claims 23-29, wherein administering recombinant, modified C3d polypeptide induces cell mediated immune responses that elimnate plasma cells harboring an elevated immune globulin (Ig) mutation burden.

31. The method of any one of claim 23-30, wherein the cancer is myeloma.