Primers and primer sets for detection of bacteria using lamp assays

Abstract

The present invention relates to compositions, methods, uses, and kits useful for detecting bacterial genomes present in a sample of interest. Specifically, the disclosure relates to nucleic acid primers and primer sets that allow detection of Gram-positive bacterial genomes present in a sample using loop-mediated isothermal amplification (LAMP).

Description

[0001] Primers and primer sets for detection of bacteria using LAMP assays

[0002] FIELD OF INVENTION

[0003] The present invention relates to compositions, methods, uses, and kits useful for detecting bacterial genomes present in a sample of interest. Specifically, the disclosure relates to nucleic acid primers and primer sets that allow detection of Gram-positive bacterial genomes present in a sample using loop-mediated isothermal amplification (LAMP).

[0004] BACKGROUND OF THE INVENTION

[0005] Mastitis is one of the most prevalent diseases in the dairy industry. Bovine mastitis, specifically, is an inflammation of the mammary glands which is routinely caused by multiple reasons, such as physical trauma as well as bacterial infection. Bovine mastitis not only negatively impacts the animal's health, but also leads to decreased milk production, resulting in steep losses for the dairy industry. In order to control such bacterial infections, antibiotics are routinely administered to animals that show signs and symptoms of such inflammation.

[0006] However, as is commonly known, bovine mastitis can be caused by different bacteria, belonging to both Gram-positive and Gram-negative groups. Infections caused by Gram-positive bacteria generally require a different treatment compared to infections caused by Gram-negative bacteria. However, often, the antibiotics administered to the animals do not take into account the type or identity of the bacteria causing the infection. This is due to the difficulty in being able to quickly, effectively, and reliably detect the cause of said infections. Additionally, the biological samples from these animals of interest typically include certain amounts of non-pathogenic bacteria as well, which do not cause the disease but can interfere with diagnosis methods leading to false positive results. Therefore, the lack of such specific diagnostic methods for the detection of disease-causing bacteria leads to excessive, unnecessary, and ineffective antibiotic usage. Additionally, milk from animals that are being treated with antibiotics cannot be marketed until the drug residues have exited their system, further leading to losses for the dairy industry.

[0007] In this regard, there is a need for reliable diagnostic methods, which can inform the veterinarians and farmers about the presence of type of disease causing bacteria, so they can tailor the treatment accordingly and avoid unnecessary losses. Current gold standard bacterial detection methods rely on bacterial culture techniques, which require skilled technicians, fully equipped laboratory infrastructure, and multiple days to obtain results, making them inaccessible and expensive. Other molecular detection methods have been developed to address the shortcomings of bacterial culturing techniques, such as amplification of target genomes using polymerase chain reaction technologies. PCR methods, although better in turnaround times and sensitivity & specificity compared with the bacterial culture methods, require thermal cycling between extreme temperatures. This results in the need for precise temperature control, specialized equipment which demands high energy, and skilled personnel. To address these issues, isothermal amplification methods for molecular detection have been developed, which operate at a constant temperature. These technologies include loop-mediated isothermal amplification (LAMP), and rolling circle amplification (RCA), amongst others.

[0008] Different LAMP methods have been developed which provide fast, sensitive, and specific detection of pathogenic bacteria, without the need for specialized equipment as in PCR methods. For example, CN107541567 discloses at least 8 different primer sets for detecting 8 bacterial pathogens involved in mastitis infections. However, CN107541567 does not provide a primer set for the detection of Staphylococcus bacteria, which is one of the main causative agents of bovine mastitis. WO2022 / 115318A discloses primer sets for detecting various bacteria using a LAMP assay. However, six different primers are needed to detect a single species of bacteria, making the assay very complex and resource intensive. Furthermore, WO2022115318A does not disclose detection from diverse matrices, such as milk. Notably, none of these methods are aimed towards enabling specific detection of disease-causing, Gram-positive bacteria in samples that also comprise other, e.g. non-pathogenic, bacteria.

[0009] SUMMARY OF THE INVENTION

[0010] The present inventors have surprisingly found that simplified primers and primer sets as described herein can be used to detect genomes of bacteria of interest in biological samples. Therefore, in a first aspect, the present invention provides primers and primer sets. These are particularly suitable for the detection of genomes from Gram-positive bacteria.

[0011] In some embodiments, a set of isolated nucleic acid primers according to the invention comprises (a) a BIP primer having a length of 30 to 50 nucleotides, hybridizing to a region between 1 to 200 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene, such as a BIP primer comprising a sequence identical or substantially identical to CTGGGGAGTACGACCGCAAGNNNNCATGCTCCACCGCTTGTG (SEQ ID

[0012] NO: 1); (b) a FIP primer comprising a sequence identical or substantially identical to

[0013] GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4), such as a FIP primer comprising sequence having at least 85% sequence identity

[0014] GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4) or CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2); optionally (c) an LB primer comprising a sequence identical or substantially identical to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3), such as an LB primer comprising a sequence having at least 85% sequence identity to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); and optionally (d) an LF primer comprising a sequence identical or substantially identical to TGCNGCACTAAGNNNCG (SEQ ID NO: 5), such as an LF primer comprising a sequence having at least 85% sequence identity to TGCNGCACTAAGNNNCG (SEQ ID NO: 5). In a further and preferred particular embodiment, it is provided that if (i) the FIP primer comprises a sequence having at least 85% sequence identity to SEQ ID NO: 2, or

[0015] (ii) the FIP primer comprises a sequence having at least 85% sequence identity to SEQ ID NO: 4 wherein three or more nucleotides at position 5-8 of SEQ ID NO: 4 are deleted or replaced by another nucleotide, then the set of isolated nucleic acid primers comprises the LB primer; and provided that if three or more nucleotides at position 39-42 of SEQ ID NO: 4 or position 31-34 of SEQ ID NO: 2 are deleted or replaced by another nucleotide, then the set of isolated nucleic acid primers comprises the LF primer; wherein N is at each occurrence independently any nucleotide.

[0016] In a another further embodiment, it is provided that if eight or more nucleotides starting from the 5' end of the FIP primer are deleted, then the set of isolated nucleic acid primers comprises the LB primer; and provided that if four or more nucleotides starting from the 3' end of the FIP primer are deleted, then the set of isolated nucleic acid primers comprises the LF primer; wherein N is at each occurrence independently any nucleotide.

[0017] In some embodiments, the set of nucleic acid primers as provided herein comprises a FIP primer such that 1 or 2 or 3 of the four nucleotides at the 3' end of the FIP primer are independently replaced by another nucleotide, or wherein one to four nucleotides starting from the 3' end of the FIP primer are deleted; provided that if four nucleotides starting from the 3' end of the FIP primer are deleted, then the set of isolated nucleic acid primers comprises an LF primer as described herein.

[0018] In some embodiments, the set of nucleic acid primers as provided herein is such that the LF primer comprises a sequence identical or substantially identical to TGCAGCACTAAGGGGCG (SEQ ID NO: 6), such as a sequence having at least 85% sequence identity to TGCAGCACTAAGGGGCG (SEQ ID NO: 6).

[0019] In some embodiments, the set of nucleic acid primers as provided herein is such that the LF primer comprises a sequence identical or substantially identical to TGCGGCACTAAGCCCCG (SEQ ID NO: 7), such as a sequence having at least 85% sequence identity to TGCGGCACTAAGCCCCG (SEQ ID NO: 7). In some embodiments, the set of nucleic acid primers as provided herein is such that the BIP primer comprises a sequence having at least 85% sequence identity to CTGGGGAGTACGACCGCAAGNNNNCATGCTCCACCGCTTGTG (SEQ ID NO: 1), wherein N is at each occurrence independently any nucleotide.

[0020] In some embodiments, the set of nucleic acid primers as provided herein is such that the BIP primer comprises a sequence identical or substantially identical to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8), such as a sequence having at least 85% sequence identity to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8).

[0021] In some embodiments, the invention provides a set of isolated nucleic acid primers for loop- mediated isothermal amplification (LAMP), comprising a BIP primer comprising the sequence CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP primer comprising the sequence CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2); an LB primer comprising the sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); an LF-1 primer comprising the sequence TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer comprising the sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

[0022] In some embodiments, the invention provides a set of isolated nucleic acid primers for loop- mediated isothermal amplification (LAMP), comprising a BIP primer having the sequence CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP primer having the sequence GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4); an LB primer having the sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); an LF-1 primer having the sequence TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer with sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

[0023] In addition, the present invention also provides methods using different primers and primer sets as described herein, for LAMP based detection of genomes from Gram-positive bacteria in biological samples, in a fast, specific, and sensitive manner.

[0024] In some embodiments, the invention provides a method, particularly an in vitro method, for detecting at least part of a Gram-positive bacterial genome in a sample, comprising: (a) providing a sample ; (b) amplifying a specific region of the bacterial genome by contacting sample from step (a) with the primer set of any one of the embodiments disclosed herein; and (c) detecting or identifying the presence or absence of the amplified product.

[0025] In some embodiments, the invention provides a method for detecting at least part of a Gram positive bacterial genome in a sample, comprising: (a) amplifying a specific region of the bacterial genome by contacting a sample with the primer set of any one of the embodiments disclosed herein; and

[0026] (b) detecting or identifying the presence or absence of the amplified product.

[0027] In some embodiments, the method is such that the sample comprises both a Gram-positive and Gram-negative bacterial genome.

[0028] In some embodiments, the method is such that the sample comprises at least one mastitis causing pathogen.

[0029] In some embodiments, the method is such that the Gram-positive bacterial genome is derived from a bacteria selected from the group comprising Staphylococcus and Streptococcus.

[0030] In some embodiments, the method is such that the Gram-negative bacterial genome is derived from a bacteria selected from the group comprising Serratia, Klebsiella, and Escherichia.

[0031] In some embodiments, the method is such that the sample is derived from milk, preferably cow's milk.

[0032] In some embodiments, the invention provides for use of the primer set according to any of the embodiments disclosed herein for detecting at least part of a Gram-positive bacterial genome in a sample.

[0033] In some embodiments, the present invention provides a kit for detecting at least one mastitis pathogen in a sample comprising the primer set according to any of the embodiments disclosed herein.

[0034] BRI EF DESCRIPTION OF TH E DRAWI NG

[0035] Fig 1: depicts secondary structure prediction at 65°C of product amplification by an FIP primer binding

[0036] Fig 2: depicts secondary structure prediction at 65°C of product amplification by a BIP primer binding

[0037] Fig 3: depicts the detection of Gram-positive bacteria using the present invention

[0038] Fig 4: depicts the detection of Gram-positive bacteria using the present invention

[0039] DETAILED DESCRIPTION OF THEINVENTION

[0040] As used herein, the terms "comprising" and "including" are inclusive or open-ended and do not exclude additional unrecited elements, compositional components, or method steps. Accordingly, the terms "comprising" and "including" encompass the more restrictive terms "consisting essentially of" and "consisting of".

[0041] The term "nucleic acid" or "oligonucleotide" or "polynucleotide" refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.

[0042] As used herein, the term "nucleotide" encompasses the natural nucleotides (i.e. A,T,G, C in DNA and A,U,G,C in RNA) as well as any known analogues of natural nucleotides insofar as they have similar structural, functional, and binding properties as the natural reference nucleotides.

[0043] The term "primer" is used to refer to short nucleic acid sequences, generally DNA in nature, typically of 10 or more nucleotides in length, and can be synthesized using any available methods.

[0044] The term "isolated" refers to biological components that have been separated or purified from other biological components, in / around which they may naturally occur or may be synthesized with or from, up to a substantial degree. As such, isolated nucleic acids include at least those nucleic acids that are purified by standard purification methods, those prepared using recombinant expression technology in a host cell, as well as those chemically synthesized nucleic acids.

[0045] The term "substantially" as used herein represents a measure close to the stated measurement that still functions as desired and enables the same desired result. The term "substantially identical to" in relation to sequences refers to a sequence identity of at least 85%, particularly at least 90%, more particularly at least 95%. Preferably it refers to a sequence identity of at least 97%, even more preferably at least 99%. More in particular, when referring to a sequence identity of at least 85%, it will be understood that another embodiment is presented wherein the sequence identity is at least 90%, more in particular at least 95%. A preferred embodiment related thereto is a sequence identity of at least 97%, a more preferred embodiment related thereto is a sequence identity of at least 99%. Evidently, such mentions include the particular situation of a sequence that has 100% sequence identity.

[0046] The term "genome" refers to the complete genetic material of an organism (e.g. bacterial genome).

[0047] As used herein, "sample" refers to any kind of sample to be tested for the presence or absence of bacteria. For example, a sample may be obtained from a biological subject, including, but not restricted to, a sample of body fluids (e.g. milk, blood, blood plasma, serum, or urine), organs, tissues, fractions, and cells isolated from mammals. Samples may also include extracts from a biological sample, for example, an antigen or a nucleic acid from a biological fluid (e.g., milk, blood, urine or the environment). Samples also include a sample not derived from a biological subject, for example, a solution that contains bacteria. Preferably, the sample is a body fluid obtained from a biological subject. In a particular embodiment, a sample refers to a previously isolated sample. In some embodiments, the sample is derived from a mammal (e.g., cow, camel, buffalo, goat, sheep, sow). In some preferred embodiments, the sample is or is derived from mammalian milk. Examples of milk include, but are not limited to, cow's milk (bovine milk), camel milk, buffalo milk, goat's milk, sheep's milk, and sow milk. Optionally the milk is acidified, e.g. by addition of an acid (such as citric, acetic or lactic acid), or mixed, e.g. with water. The milk may be raw or processed, e.g. by filtering, sterilizing, pasteurizing, homogenizing, etc., or it may be reconstituted dried milk. A preferred example of "bovine milk" according to the present invention is cow's milk. Further, sample may be used directly or be processed before use.

[0048] In a particular embodiment, the sample is a milk sample obtained from a cow that is suspected of having mastitis. In a further embodiment, the sample is a milk sample obtained from a cow that has mastitis.

[0049] The term "mastitis" as used herein refers to inflammation of the mammary glands of an animal.

[0050] Mastitis may be due to bacterial infection, such as Gram-positive or Gram-negative bacterial infection.

[0051] The terms "hybridize" and "hybridization" and "anneal" refer to a process in which sufficiently complementary single-stranded nucleic acid acids come together to form double-stranded nucleic acids through hydrogen bonds via Watson-Crick base pairing. In a slightly broader sense, this process may occur between nucleic acid strands with full complementarity between them, or even between nucleic acid strands with some mismatched sequences, i.e. partial complementarity. These terms further encompasses embodiments in which at least a portion of the nucleic acid is hybridized, as well as those embodiments in which an entire nucleic acid is hybridized. Hydrogen bonds may be between adenine and thymine or uracil

[0052] (A and T or U), cytosine and guanine (C and G), or other non-conventional base pairs.

[0053] Loop mediated isothermal amplification

[0054] Compositions disclosed in the present invention (i.e. primers and primer sets) can be used in loop mediated isothermal amplification (LAMP) reactions. LAMP relates to a nucleic acid amplification method which takes place at a relatively constant temperature, typically between 60-65°C, in the presence of a specific group of primers. As is known to a person skilled in the art, LAMP methods typically employ target sequence binding primers, commonly considered to be 'essential primers' and known as forward inner primer (FIP), backward inner primer (BIP), forward displacement primer (F3), and backward displacement primer (B3), together with two 'optional' primers for accelerating amplification, namely forward loop primer (LF) and backward loop primer (LB). Reaction buffers suitable for LAMP are known to the skilled person and available commercially as well.

[0055] When referring to amplification of nucleic acids, such as DNA, the amplification is preferably performed at a relatively constant temperature. This is also referred to herein as isothermal. In a further embodiment, the amplification is performed at a relatively constant temperature between about 55°C and about 70°C, particularly between about 58°C and about 67°C, preferably between about 60°C and 65°C.

[0056] The LAMP reaction starts by binding of the so-called 'essential primers' with the target sequence, followed by rounds of polymerase based nucleic acid amplification, strand displacement, and further primer binding, resulting in amplified nucleic acid strands. The primers are designed in such a way that the amplified nucleic acid strands can make single-stranded loop structures due to self-complementarity. Loop specific primers, e.g. LF and LB, can then bind to these loop structures and enable further formation of amplified nucleic acid strands. The repetition of these multi-step cycles in LAMP reactions, therefore, results in the amplification of target nucleic acids, enabling fast and specific detection.

[0057] The inventors have identified specific conserved sequences in the 16S rRNA sequences of Grampositive and Gram-negative bacteria that can function as a target sequence for nucleic-acid based detection systems, such as LAMP. This invention, therefore, relates firstly to compositions (i.e. primers and primer sets) based on these conserved sequences which are suitable for use in nucleic-acid based detection reactions, such as LAMP.

[0058] Primers and primer sets

[0059] The present invention provides a set of isolated nucleic acid primers, comprising (a) a BIP primer having a length of 30 to 50 nucleotides, hybridizing to a region between 1 to 200 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene; such as a BIP primer comprising a sequence identical or substantially identical to CTGGGGAGTACGACCGCAAGNNNNCATGCTCCACCGCTTGTG (SEQ ID NO: 1), and (b) a FIP primer comprising a sequence identical or substantially identical to GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4) or

[0060] CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2), wherein N is at each occurrence independently any nucleotide. The inventors have found that these two specific primers can enable detection of Gram-positive bacterial genomes in samples of interest.

[0061] In some embodiments, the present invention provides a set of isolated nucleic acid primers as described herein, comprising a BIP primer having a length of 30 to 50 nucleotides, particularly 35 to 50 nucleotides, more particularly 37 to 50 nucleotides. In particular, the present invention provides a BIP primer having a length of 40 to 50 nucleotides, preferably 40 to 47 nucleotides, more preferably 40 to 45 nucleotides. In a further embodiment, the present invention provides a BIP primer having a length of 42 nucleotides.

[0062] In some embodiments, the present invention provides a set of isolated nucleic acid primers as described herein, comprising a BIP primer hybridizing to a region between 1 to 200 nucleotides, preferably between 1 to 180 nucleotides, more preferably between 1 to 160 nucleotides, even more preferably between 1 to 140 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene. In particular, the present invention provides a BIP primer hybridizing to a region between 1 to 120 nucleotides, more particularly between 1 to 110 nucleotides, even more particularly between 20 to 110 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene. In a further embodiment, the present invention provides a BIP primer hybridizing between 30 to 110 nucleotides, preferably between 40 to 110 nucleotides, more preferably between 50 to 110 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene. In a particular embodiment, the present invention provides a BIP primer hybridizing between 55 to 110 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene. In yet another particular embodiment, the present invention provides a BIP primer hybridizing between 58 to 102 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene.

[0063] In some embodiments, the present invention provides a set of isolated nucleic acid primers as described herein, comprising a BIP primer having a length of 30 to 50 nucleotides, hybridizing to a region between 40 to 110 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene. In some embodiments, the present invention provides a set of isolated nucleic acid primers as described herein, comprising a BIP primer having a length of 40 to 50 nucleotides, hybridizing to a region between 40 to 110 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene. In some embodiments, the present invention provides a set of isolated nucleic acid primers as described herein, comprising a BIP primer having a length of 40 to 45 nucleotides, hybridizing to a region between 40 to 110 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene.

[0064] In some embodiments, the present invention provides a set of isolated nucleic acid primers as described herein, comprising a BIP primer having a length of 30 to 50 nucleotides, hybridizing to a region between 55 to 110 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene. In some embodiments, the present invention provides a set of isolated nucleic acid primers as described herein, comprising a BIP primer having a length of 40 to 50 nucleotides, hybridizing to a region between 55 to 110 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene. In some embodiments, the present invention provides a set of isolated nucleic acid primers as described herein, comprising a BIP primer having a length of 40 to 45 nucleotides, hybridizing to a region between 55 to 110 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene.

[0065] In some embodiments, the present invention provides a set of isolated nucleic acid primers as described herein, comprising a BIP primer having a length of 42 nucleotides, hybridizing to a region between 58 to 102 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene.

[0066] The hybridization capability of a BIP primer according to the invention, as described herein, can be checked with reference to, for example, the 16S rRNA gene with reference ID NR_118997.2 ( https: / / www.ncbi.nlm.nih.gov / nuccore / NR 118997.2 / ). For example, the complete length of a BIP primer may hybridize inside the specified region of 16S rRNA gene. For example, a BIP primer according to the invention may be 42 nucleotides long, binding at position 59 to 101 downstream of 3' end of the FIP primer in the 16S rRNA gene sequence according to GenBank reference ID NR_118997.2 sequence.

[0067] In a particular embodiment, a BIP primer hybridizing to a specific region downstream of the 3' end of the FIP primer in a 16S rRNA gene refers to a BIP primer that is substantially identical to the complement of a nucleic acid sequence in said region. Thus, in a particular embodiment, a BIP primer that has a sequence that has at least 85% sequence identity to the complement of a nucleic acid sequence in said region. Therefore, as one particular example, if a BIP primer having a length of 42 nucleotides, hybridizing to a region between 58 to 102 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene is described herein, it refers in a particular embodiment to a BIP primer having a length of 42 nucleotides and a sequence that has at least 85% sequence identity to the complement of a sequence in the region that is located between 58 to 102 nucleotides downstream of the 3' end of the FIP primer in a 16S rRNA gene.

[0068] In some embodiments, the present invention provides a set of isolated nucleic acid primers for enabling specific detection of Gram-positive bacteria, comprising a BIP primer comprising a sequence having at least 85% sequence identity to CTGGGGAGTACGACCGCAAGNNNNCATGCTCCACCGCTTGTG (SEQ

[0069] ID NO: 8) and a FIP primer comprising a sequence having at least 85% sequence identity to

[0070] GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4) or

[0071] CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2).

[0072] In some embodiments, the present invention provides a set of isolated nucleic acid primers which additionally comprises, together with any of the combinations of primers herein, Gram-positive specific loop primers. As such, in some embodiments, the present invention provides a set of isolated nucleic acid primers comprising, together with any of the combinations of primers herein, an LB primer comprising a sequence identical or substantially identical to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3), such as a sequence having at least 85% sequence identity to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3). In some embodiments, the present invention provides a set of isolated nucleic acid primers comprising, together with any of the combinations of primers herein, an LF primer comprising a sequence identical or substantially identical to TGCNGCACTAAGNNNCG (SEQ ID NO: 5), such as a sequence having at least 85% sequence identity to TGCNGCACTAAGNNNCG (SEQ ID NO: 5); wherein N is at each occurrence independently any nucleotide. In some embodiments, the present invention provides a set of isolated nucleic acid primers comprising, together with any of the combinations of primers herein, both an LB primer comprising a sequence identical or substantially identical to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3) and an LF primer comprising a sequence identical or substantially identical to TGCNGCACTAAGNNNCG (SEQ ID NO: 5); wherein N is at each occurrence independently any nucleotide. In some embodiments, the present invention provides a set of isolated nucleic acid primers comprising, together with any of the combinations of primers herein, both an LB primer comprising a sequence having at least 85% sequence identity to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3) and an LF primer comprising a sequence having at least 85% sequence identity to TGCNGCACTAAGNNNCG (SEQ ID NO: 5); wherein N is at each occurrence independently any nucleotide. The inventors have found that the further addition of these Gram-positive loop primers allows to detect a broad range of Gram-positive bacteria and accelerate the amplification reaction.

[0073] In some embodiments, the invention provides a set of isolated nucleic acid primers according to any of the embodiments herein, such that 1 or 2 or 3 of the lastfour nucleotides on 3' end of the FIP primer as described herein are optionally independently replaced by another nucleotide. The present invention also provides a set of isolated nucleic acid primers as per any of the embodiments herein, wherein one to four nucleotides at the 3' end of the FIP primer as described herein are optionally deleted, with the proviso that if four nucleotides are deleted then the primer set comprises an LF primer according to the invention. The inventors have found that some flexibility is allowed in the sequence of primers provided in this specification, and therefore some mutations can be included in the primer sequences without negatively impacting their functionality.

[0074] The present invention provides a set of isolated nucleic acid primers comprising LF primers with specific sequences. As such, in some embodiments, the present invention provides a set of isolated nucleic acid primers as per any of the embodiments herein, such that the LF primer comprises a sequence identical or substantially identical to TGCAGCACTAAGGGGCG (SEQ ID NO: 6), such as a sequence having at least 85% sequence identity to TGCAGCACTAAGGGGCG (SEQ ID NO: 6). In some embodiments, the present invention provides a set of isolated nucleic acid primers as per any of the embodiments herein, such that the LF primer comprises a sequence identical or substantially identical to TGCGGCACTAAGCCCCG (SEQ ID NO: 7), such as a sequence having at least 85% sequence identity to TGCGGCACTAAGCCCCG (SEQ ID NO: 7). In some embodiments, the primer set according to any of the embodiments herein, comprises both an LF primer comprising a sequence identical or substantially identical to TGCAGCACTAAGGGGCG (SEQ ID NO: 6) ), such as a sequence having at least 85% sequence identity to TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF primer comprising a sequence identical or substantially identical to TGCGGCACTAAGCCCCG (SEQ ID NO: 7), such as a sequence having at least 85% sequence identity to TGCGGCACTAAGCCCCG (SEQ ID NO: 7). The inventors have surprisingly found that these specific sequences of LF primers especially function to enable the detection of a broad range of Gram-positive bacterial species and also accelerate the amplification reactions.

[0075] The present invention provides a set of nucleic acid primers according to any of the embodiments herein, such that the BIP primer comprises a sequence identical or substantially identical to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8), such as a sequence having at least 85% sequence identity to CTGGGGAGTACGACCGCAAGNNNNCATGCTCCACCGCTTGTG (SEQ ID NO: 1). The inventors have identified the said specific sequence for the BIP primer to be particularly suitable for the detection of Gram-positive bacteria.

[0076] The present invention provides a set of isolated nucleic acid primer according to any of the embodiments herein, wherein it is preferably provided that if (i) the FIP primer comprises a sequence having at least 85% sequence identity to SEQ ID NO: 2, or (ii) the FIP primer comprises a sequence having at least 85% sequence identity to SEQ ID NO: 4 wherein three or more nucleotides at position 5-8 of SEQ ID NO: 4 are deleted or replaced by another nucleotide, then the set of isolated nucleic acid primers comprises the LB primer. The inventors have identified that the AGTG nucleotides in 5' region of SEQ ID NO: 4 are important for discriminating Gram-positive bacteria in the presence of other Gram-negative bacteria. Therefore, if a set of isolated nucleic acid primers according to the invention comprises a FIP primer comprising SEQ ID NO: 2 (which does not have the AGTG nucleotides in the 5' region) or a FIP primer with, for example, 85% identity to SEQ ID NO: 4 wherein these nucleotides are missing or replaced, LB primer allows to provide additional discriminatory power to detect Gram positive bacteria in the presence of Gram negative bacteria.

[0077] The present invention provides a set of isolated nucleic acid primers according to any of the embodiments herein, wherein it is preferably provided that if three or more nucleotides at position 39-42 of SEQ ID NO: 4 or position 31-34 of SEQ ID NO: 2 are deleted or replaced by another nucleotide, then the set of isolated nucleic acid primers comprises the LF primer. The inventors have surprisingly found that the AGTG nucleotides in the 3' region of a FIP primer according to the invention provide additional discriminatory power to detect Gram positive bacteria in the presence of Gram negative bacteria. Therefore, if three or more of these nucleotides are deleted, the primer set according to the invention requires LF primer to provide the additional discriminatory power. The inventors have further found that even if eight nucleotides are deleted from SEQ ID NO: 4, which corresponds to SEQ ID NO: 2, even four more nucleotides from the resulting SEQ ID NO: 2 can be deleted. In this case, if the deletion is in the AGTG nucleotides on 3' end, then the addition of an LF primer as described herein provides additional discriminatory power to distinguish Gram positive bacteria in the presence of Gram negative bacteria.

[0078] In some embodiments, the present invention provides a set of isolated nucleic acid primers accordingto any of the embodiments herein, wherein the AGTG nucleotides in the 3' region of a FIP primer are present (thus not changed or deleted).

[0079] In some embodiments, the present invention provides a set of isolated nucleic acid primers according to any of the embodiments here, wherein the AGTG nucleotides in the 5' region of a FIP primer, for example according to SEQ ID NO: 4, are present (thus not changed or deleted).

[0080] The present invention provides a set of isolated nucleic acid primers for enabling specific detection of Gram-positive bacteria, comprising a BIP primer comprising sequence CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP primer comprising sequence CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2) or sequence GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4); an LB primer comprising sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); an LF-1 primer comprising sequence TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer comprising sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7). The inventors have identified that this preferred combination of specific primer sequences is considered to be especially suitable for detecting Gram-positive bacterial genomes using LAMP reactions.

[0081] In a particular embodiment, the present invention provides a set of isolated nucleic acid primers for enabling specific detection of Gram-positive bacteria, comprising a BIP primer comprising sequence CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP primer comprising sequence CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2); an LB primer comprising sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); an LF-1 primer comprising sequence TGCAGCACTAAGGGGCG (SEQ D NO: 6), and an LF-2 primer comprising sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

[0082] In a preferred embodiment, the present invention provides a set of isolated nucleic acid primers for enabling specific detection of Gram-positive bacteria, comprising a BIP primer comprising sequence CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP primer comprising sequence GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4); an LB primer comprising sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); an LF-1 primer comprising sequence TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer comprising sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

[0083] As understood by the skilled person based on the description herein, the invention provides a BIP primer comprising a sequence identical or substantially identical to CTGGGGAGTACGACCGCAAGNNNNCATGCTCCACCGCTTGTG (SEQ ID NO: 1). Thus, in a particular embodiment, the present invention provides a BIP primer having a sequence with at least 97% sequence identity, more particularly at least 99% sequence identity, to CTGGGGAGTACGACCGCAAGNNNNCATGCTCCACCGCTTGTG (SEQ ID NO: 1). In a further embodiment, the sequence of the BIP primer consists of CTGGGGAGTACGACCGCAAGNNNNCATGCTCCACCGCTTGTG (SEQ ID NO: 1). In particular, the invention comprises a BIP primer comprising a sequence identical or substantially identical to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8). Thus, in a particular embodiment, the present invention provides a BIP primer having a sequence with at least 97% sequence identity, more particularly at least 99% sequence identity, to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8). In a further embodiment, the sequence of the BIP primer consists of CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8).

[0084] As is evident to a person skilled in the art based on the description herein, the invention provides a FIP primer comprising a sequence identical or substantially identical to GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4). In some embodiments, the invention comprises a FIP primer such that 1 or 2 or 3 of the last four nucleotides on 3' end of said FIP primer are independently replaced by another nucleotide. In some embodiments, the present invention comprises a FIP primer as disclosed herein, wherein one to four nucleotides at the 3' end of the FIP primer are deleted. Thus, in a particular embodiment, the present invention provides a FIP primer having a sequence with at least 97% sequence identity, more particularly at least 99% sequence identity, to GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4). In a further embodiment, the sequence of the FIP primer consists of GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4). In particular, the invention comprises a FIP primer comprising a sequence substantially identical to CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2). Thus, in a particular embodiment, the present invention provides a FIP primer having a sequence with at least 85% sequence identity, preferably 90% sequence identity, more preferably 95% sequence identity to SEQ ID NO: 2. In particular the present invention provides a FIP primer having 97% sequence identity, more particularly at least 99% sequence identity, to SEQ ID NO: 2. In a further embodiment, the sequence of the FIP primer consists of SEQ ID NO: 2.

[0085] As understood by a person skilled in the art based on the description herein, the invention provides an LB primer comprising a sequence identical or substantially identical to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3). Thus, in a particular embodiment, the present invention provides an LB primer having a sequence with at least 85% sequence identity, preferably 90% sequence identity, more preferably 95% sequence identity to SEQ ID NO: 3. In particular, the present invention provides an LB primer having 97% sequence identity, more particularly at least 99% sequence identity, to SEQ ID NO: 3. In a further embodiment, the sequence of the LB primer consists of SEQ ID NO: 3.

[0086] As understood by a person skilled in the art based on the description herein, the invention provides an LF primer comprising a sequence identical or substantially identical to TGCNGCACTAAGNNNCG (SEQ ID NO: 5); wherein N is at each occurrence independently any nucleotide. Thus, in a particular embodiment, the present invention provides an LF primer having a sequence with at least 85% sequence identity, preferably 90% sequence identity, more preferably 95% sequence identity to SEQ ID NO: 5. In particular, the present invention provides an LF primer having 97% sequence identity, more particularly at least 99% sequence identity, to SEQ ID NO: 5. In a further embodiment, the sequence of the LF primer consists of SEQ ID NO: 5.

[0087] In particular, the invention provides an LF primer comprising a sequence identical or substantially identical to TGCAGCACTAAGGGGCG (SEQ ID NO: 6). Thus, in a particular embodiment, the present invention provides an LF primer having a sequence with at Ieast85% sequence identity, preferably 90% sequence identity, more preferably 95% sequence identity to SEQ ID NO: 6. In particular, the present invention provides an LF primer having 97% sequence identity, more particularly at least 99% sequence identity, to SEQ ID NO: 6. In a further embodiment, the sequence of the LF primer consists of SEQ ID NO:

[0088] 6. n particular, the invention provides an LF primer comprising a sequence identical or substantially identical to TGCGGCACTAAGCCCCG (SEQ ID NO: 7). Thus, in a particular embodiment, the present invention provides an LF primer having a sequence with at least 85% sequence identity, preferably 90% sequence identity, more preferably 95% sequence identity to SEQ ID NO: 7. In particular, the present invention provides an LF primer having 97% sequence identity, more particularly at least 99% sequence identity, to SEQ ID NO: 7. In a further embodiment, the sequence of the LF primer consists of SEQ ID NO: 7.

[0089] Preferably, the invention comprises a first LF primer comprising a sequence identical or substantially identical to TGCAGCACTAAGGGGCG (SEQ ID NO: 6) and a second LF primer comprising a sequence identical or substantially identical to TGCGGCACTAAGCCCCG (SEQ ID NO: 7). Thus, in a preferred embodiment, the present invention provides a first LF primer having a sequence with at least 85% sequence identity, preferably 90% sequence identity, more preferably 95% sequence identity, even more preferably 97% sequence identity, and more particularly at least 99% sequence identity, to SEQ ID NO: 6 and a second LF primer having a sequence with at least 85% sequence identity, preferably 90% sequence identity, more preferably 95% sequence identity, even more preferably 97% sequence identity, and more particularly at least 99% sequence identity, to SEQ ID NO: 7. In a further embodiment, the sequence of the first LF primer consists of SEQ ID NO: 5 and the sequence of the second LF primer consists of SEQ ID NO: 5. In yet another embodiment, the sequence of first LF primer consists of SEQ ID NO: 6 and the sequence of the second LF primer consists of SEQ ID NO: 7.

[0090] In some embodiments, the present invention provides a set of isolated nucleic acid primers for enabling specific detection of Gram-positive bacteria, comprising a BIP primer comprising a sequence with at least 85% sequence identity to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP primer comprising a sequence with at least 85% sequence identity to CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2); an LB primer comprising a sequence with at least 85% sequence identity to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); an LF-1 primer comprising a sequence with at least 85% sequence identity to TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer comprising a sequence with at least 85% sequence identity to TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

[0091] In some embodiments, the present invention provides a set of isolated nucleic acid primers for enabling specific detection of Gram-positive bacteria, comprising a BIP primer comprising a sequence with at least 85% sequence identity to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP primer comprising a sequence with at least 85% sequence identity to GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4); an LB primer comprising a sequence with at least 85% sequence identity to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); an LF- 1 primer comprising a sequence with at least 85% sequence identity to TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer comprising a sequence with at least 85% sequence identity to TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

[0092] As is evident to a person skilled in the art, any and all of the embodiments provided herein, including (but not restricted to) the primers and primer sets, types of samples, lists of Gram-positive and Gram-negative bacteria, and the like, can be combined in different ways in order to practice the intended invention.

[0093] Specificity of primers and primer sets for nucleic acid detection

[0094] The present invention provides primers and primer sets for the detection of Gram-positive bacteria, such that the Gram-positive bacteria are detected in a specific manner from a sample comprising other DNA as well. The inventors have convincingly found that the primers and primer sets of the present invention enable specific detection of different species of Gram-positive bacteria whilst not detecting nucleic acid from Gram-negative bacteria or non-bacterial DNA that may be present in a sample of interest. In this regard, in some embodiments, the present invention provides primers and primer sets for the detection of Gram-positive bacterial genomes. Preferably, the primers and primer sets of the present invention allow for significantly higher amplification of Gram-positive bacteria compared with Gramnegative bacteria. In some embodiments, the Gram-positive bacteria are selected from the group comprising Bacillota. In some embodiments, the Gram-positive bacteria are selected from the group comprising Bacilli. In some embodiments, the Gram-positive bacteria are selected from the group comprising Bacillales and Lactobacillales. In a preferred embodiment, the Gram-positive bacteria are selected from the group comprising Staphylococcaceae and Streptococcaceae. In another preferred embodiment, the Gram-positive bacteria are selected from the group comprising Staphylococcus and Streptococcus. In yet another preferred embodiment, the Gram-positive bacteria are selected from the group comprising Staphylococcus aureus, Streptococcus dysgalactiae, Staphylococcus simulance, Streptococcus uberis, and Staphylococcus epidermis.

[0095] Alternatively, in some embodiments, the Gram-negative bacteria are selected from the group comprising Pseudomonadota. In some embodiments, the Gram-negative bacteria are selected from the group comprising Gammaproteobacteria. In some embodiments, the Gram-negative bacteria are selected from the group comprising Enterobacterales. In a preferred embodiment, the Gram-negative bacteria are selected from the group comprising Enterobacteriaceae and Yersiniaceae. In another preferred embodiment, the Gram-negative bacteria are selected from the group comprising Escherichia, Klebsiella, and Serratia. In yet another preferred embodiment, the Gram-negative bacteria are selected from the group comprising Escherichia coli, Klebsiella pneumoniae, and Serratia marcescens.

[0096] In another embodiment, the present invention provides primers and primer sets that enable the detection of Gram-positive bacteria from a sample of body fluid. In a further embodiment, said sample is mammalian milk. In a preferred embodiment, said sample is dairy milk. In yet another preferred embodiment, said sample is cow's milk.

[0097] Sensitivity of primers and primer sets for nucleic acid detection

[0098] The present invention provides primers and primer sets which enable sensitive detection of Grampositive bacteria, down to a few gene and genome copies. The inventors have interestingly found that the primers and primer sets of the present invention enable detection of target nucleic acids in a very sensitive manner, even from samples with very limited amounts of target nucleic acids. In this regard, in some embodiments, the present invention provides primers and primer sets for the detection of target nucleic acids from a sample comprising less than 3000 gene copies, or less than 600 gene copies, or less than 120 gene copies, or less than 24 gene copies. In another embodiment, the present invention provides primers and primer sets for detection of target nucleic acids from a sample comprising less than 500 genome copies, or less than 100 genome copies, or less than 20 genome copies, or less than 4 genome copies.

[0099] Methods of detection

[0100] The inventors found that the primers and primer sets of the present invention can be used in LAMP-based methods to enable the detection of at least part of a Gram-positive bacterial genome. In one embodiment, the present invention provides a method for detecting the presence of a Gram-positive bacterium in a sample, comprising performing a nucleic acid amplification reaction with the primer set of the invention on the sample and detecting the presence or absence of amplified nucleic acids. As will be understood from the disclosures herein, the methods of the invention comprising amplification with primers are performed in vitro. In a further embodiment, the presence or absence of amplified nucleic acids indicates respectively the presence or absence of a Gram-positive bacterium. In this regard, the present invention provides a method for detecting at least part of a Gram-positive bacterial genome in a sample, comprising: (a) providing a sample; (b) amplifying a specific region of the bacterial genome by contacting the sample from step (a) with the primer set of any of the embodiments comprised herein; and (c) detecting or identifying the presence or absence of the amplified product. In a particular embodiment, providing a sample in step (a) further comprises extraction nucleic acids from the sample to obtain an extracted sample. In a particular further embodiment, the presence or absence of the amplified product indicates respectively the presence or absence of at least part of the Gram-positive bacterial genome in the sample.

[0101] In some embodiments, the present invention provides a method for detecting at least part of a Gram-positive bacterial genome in a sample, comprising: (a) amplifying a specific region of the bacterial genome by contacting the sample with the primer set of any of the embodiments comprised herein; and (b) detecting or identifying the presence or absence of the amplified product. In a particular embodiment, the presence or absence of the amplified product indicates respectively the presence or absence of at least part of the Gram-positive bacterial genome in the sample.

[0102] In particular, the present invention provides a method of detection of at least part of Grampositive bacterial genome comprising steps (a)-(c) as indicated herein, wherein the sample in (a) comprises both a Gram-positive and Gram-negative bacterial genome. The inventors found that the primers and primer sets of the present invention are able to detect at least part of a genome of a Gram-positive bacteria in a sample, even in the presence of other bacterial genomes, using LAMP-based methods.

[0103] As will be understood from the description of the invention disclosed herein, the bacterium that is detected in the methods of the invention is preferably a Gram-positive bacterium, unless contradicted from the context.

[0104] In another embodiment, the bacterium described herein is a pathogenic bacterium, such as a mastitis causing pathogenic bacterium. Therefore, in another preferred embodiment, the bacterium is a Gram-positive mastitis causing pathogenic bacterium. Particularly a Gram-positive mastitis causing pathogenic bacterium from the Bacillota, or from a subgroup, genera or species within the Bacillota listed herein.

[0105] In some embodiments, the present invention provides methods for detecting at least part of a Gram-positive bacterial genome comprising steps (a)-(c) as indicated herein, wherein the sample comprises at least one mastitis causing pathogen. It is known that bacterial infection is one of the causes of mastitis, particularly in dairy animals. Notably, such infection can arise from both Gram-positive and Gram-negative bacteria. In this regard, the conclusive detection of the type of bacteria causing mastitis is of particular importance for deciding on the course of treatment. Interestingly, the inventors have found the primers and primer sets of the present invention to enable specific detection of Gram-positive bacteria using LAMP-based methods from samples comprising mastitis causing pathogens. In some embodiments, the present invention provides methods for detecting at least part of a Gram-positive bacterial genome comprising steps (a)-(c) as indicated herein, wherein the bacterial genomes is derived from bacteria selected from the group comprising Staphylococcus and Streptococcus. Considering that, of the many different Gram-positive bacteria known to cause mastitis, the majority of infections result from Staphylococcus and Streptococcus species, it is of particular importance that the inventors have found the primers and primer sets of the present invention to be suitable for detecting a broad range of Gram-positive bacteria, including Staphylococcus and Streptococcus species.

[0106] The present invention provides methods for detecting at least part of a Gram-positive bacterial genome comprising steps (a)-(c) as indicated herein, wherein the sample comprises bacterial genomes derived from Gram-negative bacteria selected from the group comprising Serratia, Klebsiella, and Escherichia species. Since many Gram-negative bacteria are also known to cause mastitis, including those from Serratia, Klebsiella, and Escherichia species, it is particularly noteworthy that the inventors have found the primers and primer sets of the invention to be able to specifically detect genomes of Grampositive bacteria from samples comprising genomes of Gram-negative bacteria, such as Serratia, Klebsiella, and Escherichia species.

[0107] The present invention provides methods for detecting at least part of a Gram-positive bacterial genome comprising steps (a)-(c) as indicated herein from samples derived from milk, and preferably from cow's milk. Since mastitis in dairy animals results in huge losses for the dairy industry, and because the bacteria causing mastitis can be present in the milk of the infected animals, it is particularly relevant that the inventors have found that the primers and primer sets of the present invention can enable detection of bacterial genomes of interest in biological samples as defined herein, such as samples derived from milk. Therefore, the methods of the present invention can provide valuable information to the veterinarians and farmers regarding the type of bacteria causing infection, helping them in deciding the efficient course of treatment.

[0108] In another particular embodiment, the present invention provides a method, particularly an in vitro method, for determining if an infection is caused by a Gram-positive bacterium, the method comprising step (a) amplifying a specific region of the bacterial genome by contacting a sample with the primer set of any of the embodiments comprised herein; and (b) detecting or identifying the presence or absence of the amplified product. More in particular, the present invention provides a method for determining whether an infection is caused by a Gram-positive or Gram-negative bacterium, the method comprising steps (a)-(b) as indicated herein. In a further embodiment, the infection is mastitis. Therefore, in another particular embodiment, the present invention provides a method, particularly an in vitro method, for determining if an infection is caused by a Gram-positive bacterium, the method comprising step (a) providing a sample; (b) amplifying a specific region of the bacterial genome by contacting the sample from step (a) with the primer set of any of the embodiments comprised herein; and (c) detecting or identifying the presence or absence of the amplified product. More in particular, the present invention provides a method for determining whether an infection is caused by a Gram-positive or Gram-negative bacterium, the method comprising steps (a)-(c) as indicated herein. In a further embodiment, the infection is mastitis.

[0109] In a particular embodiment, the present invention provides a method, particularly an in vitro method, for determining if mastitis is caused by a Gram-positive bacterium, the method comprising the steps of:

[0110] - contacting a sample that has been obtained from an animal that is suspected of having mastitis with a primer set of the invention and amplifying DNA in the sample with the primer set, and

[0111] - detecting or identifying the presence or absence of the amplified product, wherein the presence of amplified product indicates that mastitis is caused by a Gram-positive bacterium.

[0112] Therefore, in a particular embodiment, the present invention provides a method, particularly an in vitro method, for determining if mastitis is caused by a Gram-positive bacterium, the method comprising the steps of:

[0113] - providing a sample that has been obtained from an animal that is suspected of having mastitis;

[0114] - contacting the sample with a primer set of the invention and amplifying DNA in the sample with the primer set, and

[0115] - detecting or identifying the presence or absence of the amplified product, wherein the presence of amplified product indicates that mastitis is caused by a Gram-positive bacterium.

[0116] As will be understood by the skilled person from the disclosures herein, in a particular embodiment, the present invention provides a method for determining if mastitis is caused by a Grampositive bacterium, the method comprising the steps of:

[0117] - contacting a milk sample that has been obtained from a cow that is suspected of having mastitis with a primer set comprising a BIP primer comprising sequence CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP primer comprising sequence CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2) or

[0118] GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4); an LB primer comprising sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); an LF-1 primer comprising sequence TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer comprising sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7);

[0119] - performing isothermal amplification of DNA in the sample with said primer set between 60-65°C; and

[0120] - detecting or identifying the presence or absence of the amplified product; wherein the presence of amplified product indicates that mastitis is caused by a Gram-positive bacterium.

[0121] As will be understood by the skilled person from the disclosures herein, in a particular embodiment, the present invention provides a method for determining if mastitis is caused by a Grampositive bacterium, the method comprising the steps of:

[0122] - providing a milk sample that has been obtained from a cow that is suspected of having mastitis;

[0123] - contacting said milk sample with a primer set comprising a BIP primer comprising sequence

[0124] CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP primer comprising sequence CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2) or

[0125] GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4); an LB primer comprising sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); an LF-1 primer comprising sequence TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer comprising sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7);

[0126] - performing isothermal amplification of DNA in the sample with said primer set between 60-65°C; and

[0127] - detecting or identifying the presence or absence of the amplified product; wherein the presence of amplified product indicates that mastitis is caused by a Gram-positive bacterium.

[0128] In some embodiments, the present invention provides methods for detection of bacterial genomes in a sample prior to administering requisite treatment to the infected animal. As such, the present invention provides methods of detection of Gram-positive bacterial genome from a sample, comprising the method steps, such as steps (a)-(c), as disclosed herein, followed by administration of suitable treatment. Thus, the present invention also provides the determination methods as described herein, further comprising administration of a suitable treatment if amplified product is detected or identified. Thus, the present invention also provides the determination methods as described herein, further comprising administration of a suitable treatment if it is indicated that mastitis is caused by a Grampositive bacterium. As is evident to a person skilled in the art, any and all of the embodiments provided herein, including (but not restricted to) the primers and primer sets, type of samples, lists of Gram-positive and Gram-negative bacteria, and the like, can be combined in different ways in order to practice the intended invention.

[0129] Use of primers and primer sets

[0130] The present invention provides for use of any of the primers and primer sets disclosed herein for the detection of at least a part of a Gram-positive bacterial genome in a sample. The inventors have found that the primers and primer sets of the present invention can be used for the detection of Gram-positive bacterial genomes, or parts thereof, in a sample.

[0131] In particular, the present invention provides for the use of preferred primers and primer sets as disclosed herein for the detection of at least a part of a Gram-positive bacterial genome in a sample.

[0132] As is evident to a person skilled in the art, any and all of the embodiments provided herein, including (but not restricted to) the primers and primer sets, type of samples, lists of Gram-positive and Gram-negative bacteria, and the like, can be combined in different ways in order to practice the intended invention.

[0133] Kits for detection

[0134] The present invention relates to kits comprising primers and primer sets as disclosed herein, for detecting target genomes of interest in a sample. Therefore, some embodiments provide a kit for detecting at least one mastitis causing pathogen in a sample, said kit comprising primers and primer sets as disclosed herein.

[0135] In one embodiment, the present invention provides a kit comprising (a) a BIP primer having a length of 30 to 50 nucleotides, hybridizing to a region between 1 to 200 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene, such as a BIP primer comprising a sequence identical or substantially identical to CTGGGGAGTACGACCGCAAGNNNNCATGCTCCACCGCTTGTG (SEQ ID NO: 1); (b) a FIP primer comprising a sequence identical or substantially identical to GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4) or

[0136] CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2), such as a FIP primer comprising a sequence having at least 85% sequence identity to GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4) or CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2). In some embodiments, the present invention provides a kit comprising, together with any of the combinations of primers herein, Gram-positive loop primers. In some embodiments, the present invention provides a kit comprising, together with any of the combinations of primers herein, an LB primer comprising a sequence identical or substantially identical to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3), such as an LB primer comprising a sequence having at least 85% sequence identity to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3). In some embodiments, the present invention provides a kit, together with any of the combinations of primers herein, comprising an LF primer comprising a sequence identical or substantially identical to TGCNGCACTAAGNNNCG (SEQ ID NO: 5), such as an LF primer comprising a sequence having at least 85% sequence identity to TGCNGCACTAAGNNNCG (SEQ ID NO: 5); wherein N is at each occurrence independently any nucleotide. In some embodiments, the present invention provides a kit, together with any of the combinations of primers herein, comprising both an LB primer comprising a sequence identical or substantially identical to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3), such as an LB primer comprising a sequence having at least 85% sequence identity to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3), and an LF primer comprising a sequence identical or substantially identical to TGCNGCACTAAGNNNCG (SEQ ID NO: 5), such as an LF primer comprising a sequence having at least 85% sequence identity to TGCNGCACTAAGNNNCG (SEQ ID NO: 5); wherein N is at each occurrence independently any nucleotide. The inventors have found that the further addition of these Gram-positive loop primers to a kit allows to detect a broad range of Gram-positive bacteria and accelerate the amplification reaction.

[0137] In some embodiments, the invention provides a kit according to any of the embodiments herein, such that 1 or 2 or 3 of the last four nucleotides on 3' end of a FIP primer are independently replaced by another nucleotide. The present invention also provides a kit as per any of the embodiments herein, wherein one to four nucleotides at the 3' end of the FIP primer are deleted, with the proviso that if four nucleotides are deleted then the kit comprises an LF primer according to the invention. The inventors have found that some flexibility is allowed in the sequence of primers provided in this specification, and therefore some mutations can be included in the primer sequences without negatively impacting their functionality.

[0138] In some embodiments, the invention provides a kit according to any of the embodiments herein, such that the FIP primer comprises a sequence having at least 85% sequence identity to SEQ ID NO: 2, and the set of isolated nucleic acid primers comprises the LB primer.

[0139] In some embodiments, the invention provides a kit according to any of the embodiments herein, such that the FIP primer comprises a sequence having at least 85% sequence identity to SEQ ID NO: 4 wherein three or more nucleotides at position 5-8 of SEQ ID NO: 4 are deleted or replaced by another nucleotide, and the set of isolated nucleic acid primers comprises the LB primer.

[0140] In some embodiments, the invention provides a kit according to any of the embodiments herein, such that three or more nucleotides at position 39-42 of SEQ ID NO: 4 are deleted or replaced by another nucleotide, and the set of isolated nucleic acid primers comprises the LF primer.

[0141] In some embodiments, the invention provides a kit according to any of the embodiments herein, such that three or more nucleotides at position 31-34 of SEQ ID NO: 2 are deleted or replaced by another nucleotide, and the set of isolated nucleic acid primers comprises the LF primer.

[0142] The present invention provides a kit comprising LF primers with specific sequences. The inventors have surprisingly found that certain specific sequences of LF primers especially function to enable detection of a broad range of Gram-positive bacterial species and also accelerate the amplification reactions. Therefore, in some embodiments, the present invention provides a kit as per any of the embodiments herein, such that the LF primer comprises a sequence identical or substantially identical to TGCAGCACTAAGGGGCG (SEQ ID NO: 6), such as a sequence having at least 85% sequence identity to TGCAGCACTAAGGGGCG (SEQ ID NO: 6). In some embodiments, the present invention provides a kit as per any of the embodiments herein, such that the LF primer comprises a sequence identical or substantially identical to TGCGGCACTAAGCCCCG (SEQ ID NO: 7), such as a sequence having at least 85% sequence identity to TGCGGCACTAAGCCCCG (SEQ ID NO: 7). In some embodiments, the kit according to any of the embodiments herein, comprises both an LF primer comprising a sequence identical or substantially identical to TGCAGCACTAAGGGGCG (SEQ ID NO: 6), such as a sequence having at least 85% sequence identity to TGCAGCACTAAGGGGCG (SEQ ID NO: 6) and an LF primer comprising a sequence identical or substantially identical to TGCGGCACTAAGCCCCG (SEQ ID NO: 7), such as a sequence having at least 85% sequence identity to TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

[0143] The present invention provides a kit according to any of the embodiments herein, such that the BIP primer comprises a sequence identical or substantially identical to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8), such as a sequence having at least 85% sequence identity to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8). The inventors have identified that a kit comprising a BIP primer comprising a specific sequence is particularly suitable for the detection of Gram-positive bacteria.

[0144] The present invention provides a kit comprising a set of isolated nucleic acid primers suitable for LAMP reactions for enabling specific detection of Gram-positive bacteria. The inventors have identified a preferred combination of specific primer sequences which is considered to be especially suitable for detecting Gram-positive bacterial genomes using LAMP reactions. Therefore, the present invention provides a kit comprising a BIP primer comprising sequence CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP primer comprising sequence CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2); an LB primer comprising sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); an LF-1 primer comprising sequence TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer comprising sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

[0145] In some embodiments, the present invention provides a kit comprising a BIP primer comprising sequence CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP primer comprising sequence GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4); an LB primer comprising sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); an LF-1 primer comprising sequence TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer comprising sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

[0146] As is evident to a person skilled in the art, any and all of the embodiments provided herein, including (but not restricted to) the primers and primer sets, type of samples, lists of Gram-positive and Gram-negative bacteria, and the like, may be combined in different ways in order to practice the intended invention.

[0147] Detection of Gram-negative bacteria

[0148] In an alternative aspect, the present invention provides methods for detecting Gram-negative bacterial genomes, or parts thereof, from samples of interest that comprise Gram-positive bacteria or non- bacterial DNA. The inventors have found that specific combinations of primers targeting 16S rRNA gene can enable specific and sensitive detection of Gram-negative bacterial genomes. Therefore, in some embodiments, the present invention provides a set of isolated nucleic acid primers, comprising a BIP primer comprising a sequence identical or substantially identical to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8), such as a sequence having at least 85% sequence identity to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP-N1 primer comprising a sequence identical or substantially identical to GCGGTCGATTTAACGCGTTAGCCACGCCGTAAACGATGTCGA (SEQ ID NO: 12), such as a sequence having at least 85% sequence identity to GCGGTCGATTTAACGCGTTAGCCACGCCGTAAACGATGTCGA (SEQ ID NO: 12), and an LB primer comprising a sequence identical or substantially identical to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3), such as a sequence having at least 85% sequence identity to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3).

[0149] In some embodiments, the present invention provides a set of isolated nucleic acid primers, comprising a BIP primer comprising a sequence identical or substantially identical to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8), such as a sequence having at least 85% sequence identity to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8); a FIP-N1 primer comprising a sequence identical or substantially identical to GCGGTCGATTTAACGCGTTAGCCACGCCGTAAACGATGTCGA (SEQ ID NO: 12), such as a sequence having at least 85% sequence identity to GCGGTCGATTTAACGCGTTAGCCACGCCGTAAACGATGTCGA (SEQ ID NO: 12), an LB primer comprising a sequence identical or substantially identical to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3), such as a sequence having at least 85% sequence identity to GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3), and an LF-3 primer comprising a sequence identical or substantially identical to TCCGGAAGCCACGCCTCAA (SEQ ID NO: 11), such as a sequence having at least 85% sequence identity to TCCGGAAGCCACGCCTCAA (SEQ ID NO: 11). The inventors have found that by using the additional Gram-negative specific loop primer, broad range of Gram-negative bacterial genomes, or parts thereof, can be detected and the reactions can also be accelerated.

[0150] The present invention is further described in the following numbered embodiments.

[0151] Embodiment 1

[0152] A set of isolated nucleic acid primers, comprising (a) a BIP primer comprising a sequence identical or substantially identical to CTGGGGAGTACGACCGCAAGNNNNCATGCTCCACCGCTTGTG (SEQ ID NO: 1);

[0153] (b) a FIP primer comprising a sequence identical or substantially identical to GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4); optionally (c) an LB primer comprising a sequence identical or substantially identical to

[0154] GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); and optionally (d) an LF primer comprising a sequence identical or substantially identical to

[0155] TGCNGCACTAAGNNNCG (SEQ ID NO: 5); provided that if eight or more nucleotides starting from the 5' end of the FIP primer are deleted, then the set of isolated nucleic acid primers comprises the LB primer; and provided that if four or more nucleotides starting from the 3' end of the FIP primer are deleted, then the set of isolated nucleic acid primers comprises the LF primer; wherein N is at each occurrence independently any nucleotide.

[0156] Embodiment 2

[0157] The set of nucleic acid primer according to embodiment 1, wherein

[0158] 1 or 2 or 3 of the four nucleotides at the 3' end of the FIP primer are optionally independently replaced by another nucleotide, or wherein one to four nucleotides starting from the 3' end of the FIP are optionally deleted; provided that if four nucleotides starting from the 3' end of the FIP primer are deleted, then the set of isolated nucleic acid primers comprises the LF primer.

[0159] Embodiment 3

[0160] The set of nucleic acid primers according to embodiment 1 or 2, wherein the LF primer comprises a sequence identical or substantially identical to TGCAGCACTAAGGGGCG (SEQ ID NO: 6).

[0161] Embodiment 4

[0162] The set of nucleic acid primers according to embodiment 1 or 2, wherein the LF primer comprises a sequence identical or substantially identical to TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

[0163] Embodiment 5

[0164] The set of nucleic acid primers according to any one of embodiment 1-4, wherein the BIP primer comprises a sequence identical or substantially identical to CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8).

[0165] Embodiment 6

[0166] A set of isolated nucleic acid primers according to any one of the previous embodiments for loop-mediated isothermal amplification (LAMP), comprising

[0167] (a) a BIP primer having the sequence CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8);

[0168] (b) a FIP primer having the sequence CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4);

[0169] (c) an LB primer having the sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3);

[0170] (d) an LF-1 primer having the sequence TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer with sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7). Embodiment 7

[0171] A LAMP method for detecting at least part of a Gram positive bacterial genome in a sample, comprising:

[0172] (a) providing a previously isolated sample;

[0173] (b) amplifying a specific region of the bacterial genome by contacting a sample from step (a) with the primer set of any one of embodiments 1-6; and

[0174] (c) detecting or identifying the presence or absence of the amplified product.

[0175] Embodiment 8

[0176] The method according to embodiment 7, wherein the sample comprises both a Gram positive and Gram negative bacterial genome.

[0177] Embodiment 9

[0178] The method according to any one of embodiments 7 to 8, wherein the sample comprises at least one mastitis causing pathogen.

[0179] Embodiment 10

[0180] The method according to any one of embodiments 7 to 9, wherein the Gram positive bacterial genome is derived from a bacteria selected from the group comprising Staphylococcus and Streptococcus.

[0181] Embodiment 11

[0182] The method according to any one of embodiments 8 to 10, wherein the Gram negative bacterial genome is derived from a bacteria selected from the group comprising Serratia, Klebsiella, and Escherichia.

[0183] Embodiment 12

[0184] The method according to any one of embodiments 7 to 11, wherein the sample is derived from milk, preferably cow's milk.

[0185] Embodiment 13

[0186] Use of the primer set according to any of the embodiments 1 to 6 for detecting at least part of a Gram positive bacterial genome in a sample. Embodiment 14

[0187] A kit for detecting at least one mastitis pathogen in a sample comprising the primer set according to any of the embodiments 1 to 6.

[0188] Embodiment 15

[0189] A set of isolated nucleic acid primers according to any one of the previous embodiments for loop-mediated isothermal amplification (LAMP), comprising

[0190] (a) a BIP primer having the sequence CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID

[0191] NO: 8);

[0192] (b) a FIP primer having the sequence CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2);

[0193] (c) an LB primer having the sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3);

[0194] (d) an LF-1 primer having the sequence TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer with sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

[0195] Embodiment 16

[0196] A set of isolated nucleic acid primers according to any one of the previous embodiments for loop-mediated isothermal amplification (LAMP), comprising

[0197] (a) a BIP primer having the sequence CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8);

[0198] (b) a FIP primer having the sequence GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2);

[0199] (c) an LB primer having the sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3);

[0200] (d) an LF-1 primer having the sequence TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer with sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

[0201] EXAMPLES

[0202] The working examples provided herein are only for illustrative purposes and are not at all considered to be limiting the scope of the present invention. Example 1 - Primer design

[0203] The 16S rRNA sequences representative of Gram-positive and Gram-negative bacteria were aligned in order to identify a conserved sequence which is suitable as the target for designing primers. The aligned sequences harbored a distinct four nucleotide stretch which was conserved across Gram-positive bacteria but was different in the Gram-negative bacteria genomes.

[0204] Primer Explorer v5.0 software was used to design the different primers. In order to design BIP and FIP primers, the identified conserved sequence was designated as the target site to be detected. For FIP, additionally, the four distinct nucleotides were fixed to be at 3' end, and forward loop length was fixed at 45. All other parameters were kept as default. Based on the BIP original and FIP primer sequences obtained from the software, some modification were made to arrive at the final primers. Firstly, LB and LF-1 were designed using the same software. The LF-2, LF-3, and alternative FIP primer sequences were designed manually in order to cover a broad range of sequences from bacteria of interest. Additionally, in order to avoid dimer formation, a linker was included in the BIP primer generated by the software to arrive at the final BIP primers. The primer sequences are presented in Table 1.

[0205] Table 1: Primer sequences

[0206] Wherein N at each occurrence is independently any nucleotide.

[0207] Example 2 - Detection of target bacteria using designed primers Different combinations of primers were used for the detection of 8 different bacteria samples using the LAMP assay. The 1X primer mix was prepared with final concentration of 0.8 μM for FIP primers, 0.5 μM for BIP primers, and 0.2 μM for each of the LB and LF primers, depending on the combination used for the specific reactions.

[0208] The reaction mixture also comprised lxisothermal master mix ISO-004 (consisting of a strand- displacing GspSSD2.0 DNA polymerase large fragment from Geobacillus spp., reaction buffer, MgSO4, and dNTPs) and a double-stranded DNA binding dye Syto9 at a final concentration of 2 μM (OptiGene Ltd.). The reaction was prepared in a final volume of 25 μL with the different components as in Table 2.

[0209] Table 2: LAMP reaction For no template control, DNA sample mentioned in Table 3 was replaced with molecular grade water.

[0210] The LAMP reaction was run at 65°C for 40 min on Isothermal Fluorescence real time PCR — Gene- 8C device (Hangzhou Allsheng Instruments Co.,). Fluorescence readings were acquired using the 6- carboxyfluorescein (FAM) channel and time-to-peak values (Ct in min) were determined when fluorescence signal crossed the threshold.

[0211] As seen in Table 3, combination of FIP-2 primer (SEQ ID. 4) and BIP-1 primer (SEQ ID. 8) enables detection of Gram-positive bacteria (Rx11) in less than 25 mins (indicated with + in the Table 3). Primer combinations Rx2, Rx3, and Rx10 enable detection of Gram-positive bacteria in less than 15 mins (indicated with ++ in the Table 3). Primer combinations Rxl and Rx9 enable detection of Gram-positive bacteria in less than 10 mins (indicated with +++ in the Table 3). Primer combination Rx4, Rx5, and Rx6 are inconclusive since they give results for both Gram-positive and Gram-negative bacterial genomes.

[0212]

[0213] Wherein "+ / -" indicates that entity is not always detected, "+" and "++" and "+++" indicate that entity is always detected, and "-" and "--" and " --- " indicate that entity is not detected.

[0214] Example 3 - Mutated primer sequences for detection of bacteria

[0215] Primer sequences with different mutations were designed to test how much flexibility could be tolerated in the main primer sequences without affecting specificity of the LAMP assay. The reactions were set up as described in Example 2, with the modifications as described hereunder. Firstly, the mutated primer was used together with BIP-1 primer, LB primer, LF-1 primer, and LF-2 primers. With regards to the

[0216] DNA sample, 105genome copies of Staphylococcus aureus or Streptococcus uberis or Escherichia coli or

[0217] Serratia marcescens were added to the respective reactions.

[0218] Table 4 lists the different deletion mutations generated in FIP primer sequence, starting from the

[0219] Fl P-2 sequence, and the corresponding results of the LAMP assay for the detection of Gram-positive and

[0220] Gram-negative bacteria with the said mutated primers. Please note that "+++" indicates detection of target bacteria in less than 10 mins, whilst indicates no detection even after 40 minutes.

[0221] As can be seen from Table 4, these alternative primer sequences still allow detection of Grampositive bacteria, and do not detect Gram-negative bacteria.

[0222]

[0223] Table 4: Deletions in FIP primer and delection of bacteria

[0224] Wherein "+++" indicates that entity is always detected an " -" indicates that entity is not detected. Table 5 and 6 lists the different mismatch mutations generated in FIP primer sequence, starting from the FIP-2 sequence, along with the result of LAMP assay for detecting Gram-positive and Gram- negative bacteria when the said mutated primer was used. Please note that "+++" indicates detection of target bacteria in less than 10 mins, whilst "-" indicates no detection even after 40 minutes.

[0225] As can be seen from Table 5 and 6, the designed primer tolerates mutations very well, and in most cases results in positively detecting the Gram-positive bacteria and not the Gram-negative bacteria. Notably, when all four nucleotides on 3' end are mutated, the primer loses its specificity. This clearly indicates the pivotal role that the conserved AGTG sequence on 3' end of the designed FIP primer plays for specifically detecting Gram-positive bacteria in a sample.

[0226] Table 5: Mismatch mutations in FIP primer and detection of bacteria Table 6: Mismatch mutations in FIP primer and detection of bacteria (contd.)

[0227] Example 4 - Specificity of primers for LAMP assay

[0228] The LAMP assay was conducted as explained previously, with the modification that 8 ng of purified

[0229] DNA from each of the indicated bacteria was used in the corresponding reaction mix instead of DNA sample. For evaluating any cross-reactivity with other DNA in cow's milk, Bovine Genomic DNA was extracted from a cow milk sample using a standard DNA extraction kit for food (Qiagen). 5 μl of Bovine

[0230] Genomic DNA (5 ng total) was used in place of DNA sample. The primer combination of Table 7 A was used with the reaction conditions presented in Table 7B. Table 7A: Primer Combination; Concentration and volume for single reaction used for experiment

[0231] Table 7B: Reaction conditions As seen in Table 7C, the primer combination of Table 7A enables specific detection of different

[0232] Gram-positive bacteria, such as Staphylococcus aureus, Staphylococcus dysgalactiae, Staphylococcus simulance, Streptococcus uberis, and Staphylococcus epidermis. Notably, Gram-negative bacteria present in the sample, such as Escherichia coli, Klebsiella Pneumoniae, and Serratia marcescens are not detected. Moreover, there is no cross-reactivity with any non-bacterial DNA present in cow's milk, as can be seen by lack of any signal in reaction 9 in Table 7C.

[0233] Table 7C: Specificity of the LAMP assay for different Gram-positive bacteria

[0234] Wherein "+++" indicates that entity is always detected and "---" indicates that entity is not detected. Example 5 - Sensitivity of LAM P assay

[0235] The sensitivity of primers for detection of target bacteria with LAMP assay was tested using the reaction indicated in Example 2, with the modification that the primer combination of Table 7A was used and 5-fold dilution of Staphylococcus aureus purified DNA ranging between 1.5pg (500 Genome copies and below 2.4fg (0.8 Genome Copies) was used. No template control (NTC) was set up using molecular grade water in place of DNA sample.

[0236] As seen in Table 8, the LAMP assay with the primers from the present invention was able to detect the target bacteria down to 24 target gene copies, which corresponds to 4 genome copies.

[0237] Table 8: Sensitivity of LAMP assay

[0238] Example 6 - Primer dimer formation due to BIP sequence

[0239] In order to evaluate auto-dimer formation, LAMP assays were conducted without presence of certain primers. The general reaction set-up was as in Example 2, with the modification that BIP original sequence and Fl P-2 were, independently, either absent or present in 2 μM concentration, whilst the LB, LF-1, and LF-1 were independently either absent or present in 1 μM final concentration. The combination of primers used in different reactions is indicated in Table 9. Nuclease free water was used as a nontemplate control. The dimer formation was observed by a slight increase in the background (Base line) of fluorescence with increasing time of reaction.

[0240] Table 9 provides an overview of the different reaction mixes that were tested and an indication of whether dimers were observed or not. As can be seen from the results, there is primer dimer formation in all reaction mixtures, except Mix3 which does not include the BIP original primer sequence. Together with the results from Mix 7, this indicates that the BIP primer was responsible for dimer formation. In view of these results, the BIP original sequence was modified with a linker to reduce primer dimer formation and increase the assay efficiency, as exemplified in BIP and BIP-1 sequences in Table 1. Table 9: Primer dimer formation in different reaction conditions

[0241] Example 7 - Detection of Gram-negative bacteria Alternatively, a primer set was tested for the specific detection of Gram-negative bacteria in a sample using particular combinations of designed primers. The reaction was set-up as in Example 2, with the DNA sample comprising the relevant Gram-negative bacteria derived DNA.

[0242] As seen in Table 10, primer combination Rx7 enables detection of Gram-negative bacterial genomes in a sample in less than 25 mins (indicated with + Table 10) while primer combination Rx8 enables detection in less than 10 mins (indicated with +++ in Table 10).

[0243] Table 10: Detection of Gram-negative bacterial genome

[0244] Wherein "+" and "+++" indicate that entity is always detected, and " indicates that entity is not detected. Example 8 - Detection of Gram-positive bacteria in a mixture with Gram-negative bacteria

[0245] In order to assess the possibility of the primer sets of the invention to detect Gram-positive bacteria in the presence of Gram-negative bacteria, an assay was performed as in Example 4, except for the amount and mixture of bacterial DNA. The bacterial DNA combinations in the sample and the LAMP results are shown in Table 11.

[0246] Table 11:

[0247] These results clearly demonstrate that the primer sets of the invention are able to detect Grampositive bacteria, also in the presence of Gram-negative bacteria.

[0248] Example 9 - Detection of Gram positive bacteria in milk samples

[0249] In order to assess whether the primer sets of the invention allow to identify Gram positive bacteria in complex milk samples, different Gram positive and Gram negative bacteria were spiked in a normal milk sample at a concentration of 105bacteria per milliliter. Total DNA was extracted from these samples using a standard DNA extraction method, using a starting sample volume of 400 μL and a final elution volume of 100 μL. 5 μM extracted DNA was used in the LAMP assay as described in Example 4. The setup and results are shown in Tables 12 and 13.

[0250] Table 12: Detection of Gram-positive bacteria in milk samples spiked with Gram-positive bacteria

[0251] Table 13: Negative control detection of Gram-positive bacteria in milk samples spiked with Gram-negative bacteria

[0252] Example 10: Detection of Gram negative bacteria in milk samples

[0253] In order to assess whether the Gram negative specific primer sets of the invention allow to identify Gram negative bacteria in complex milk samples, different Gram positive and Gram negative bacteria were spiked in a normal milk sample at a concentration of 105bacteria per milliliter. Total DNA was extracted from these samples using a standard DNA extraction method, using a starting sample volume of 400 μL and a final elution volume of 100 μL. 5 μM extracted DNA was used in the LAMP assay as described in Example 7. The setup and results are shown in Tables 14 and 15.

[0254] Table 14: Detection of Gram-negative bacteria in milk samples spiked with Gram-negative bacteria Table 15: Negative control detection of Gram-negative bacteria in milk samples spiked with Gram-positive bacteria

Claims

Claims1. A set of isolated nucleic acid primers, comprising(a) a BIP primer having a length of 30 to 50 nucleotides, hybridizing to a region between 1 to 200 nucleotides downstream of 3' end of the FIP primer in a 16S rRNA gene;(b) a FIP primer comprising a sequence having at least 85% sequence identity toGCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 4) or CTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ ID NO: 2); optionally (c) an LB primer comprising a sequence having at least 85% sequence identity toGTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3); and optionally (d) an LF primer comprising a sequence having at least 85% sequence identity to TGCNGCACTAAGNNNCG (SEQ ID NO: 5); provided that if (i) the FIP primer comprises a sequence having at least 85% sequence identity to SEQ ID NO: 2, or(ii) the FIP primer comprises a sequence having at least 85% sequence identity to SEQ ID NO: 4 wherein three or more nucleotides at position 5-8 of SEQ ID NO: 4 are deleted or replaced by another nucleotide, then the set of isolated nucleic acid primers comprises the LB primer; and provided that if three or more nucleotides at position 39-42 of SEQ ID NO: 4 or position 31-34 of SEQ ID NO: 2 are deleted or replaced by another nucleotide, then the set of isolated nucleic acid primers comprises the LF primer; wherein N is at each occurrence independently any nucleotide.

2. The set of nucleic acid primers according to claim 1, wherein the LF primer comprises a sequence having at least 85% sequence identity to TGCAGCACTAAGGGGCG (SEQ ID NO: 6).

3. The set of nucleic acid primers according to claim 1, wherein the LF primer comprises a sequence having at least 85% sequence identity to TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

4. The set of nucleic acid primers according to any one of claims 1-3, wherein the BIP primer comprises a sequence having at least 85% sequence identity toCTGGGGAGTACGACCGCAAGNNNNCATGCTCCACCGCTTGTG (SEQ ID NO: 1).

5. The set of nucleic acid primers according to any one of claims 1-4, wherein the BIP primer comprises a sequence having at least 85% sequence identity toCTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8).

6. A set of isolated nucleic acid primers according to any one of the previous claims for loop-mediated isothermal amplification (LAMP), comprising(a) a BIP primer having the sequence CTGGGGAGTACGACCGCAAGTTTTCATGCTCCACCGCTTGTG (SEQ ID NO: 8);(b) a FIP primer having the sequence GCGGAGTGCTTAATGCGTTAGCCACGCCGTAAACGATGAGTG (SEQ IDNO: 4);(c) an LB primer having the sequence GTTGAAACTCAAAGGAATTGACGG (SEQ ID NO: 3);(d) an LF-1 primer having the sequence TGCAGCACTAAGGGGCG (SEQ ID NO: 6), and an LF-2 primer with sequence TGCGGCACTAAGCCCCG (SEQ ID NO: 7).

7. An in vitro LAMP method for detecting at least part of a Gram positive bacterial genome in a sample, comprising:(a) amplifying a specific region of the bacterial genome by contacting a sample with the primer set of any one of claims 1-6; and(b) detecting or identifying the presence or absence of the amplified product.

8. The method according to claim 7, wherein the sample comprises both a Gram positive and Gram negative bacterial genome.

9. The method according to any one of claims 7 to 8, wherein the sample comprises at least one mastitis causing pathogen.

10. The method according to any one of claims 7 to 9, wherein the Gram positive bacterial genome is derived from a bacteria selected from the group comprising Staphylococcus and Streptococcus.

11. The method according to any one of claims 8 to 10, wherein the Gram negative bacterial genome is derived from a bacteria selected from the group comprising Serratia, Klebsiella, and Escherichia.

12. The method according to any one of claims 7 to 11, wherein the sample is derived from milk, preferably cow's milk.

13. Use of the primer set according to any of the claims 1 to 6 for detecting at least part of a Gram positive bacterial genome in a sample.

14. A kit for detecting at least one mastitis pathogen in a sample comprising the primer set according to any of the claims 1 to 6.

Images