Polynucleotides encoding cystic fibrosis transmembrane conductance regulator for the treatment of cystic fibrosis

Abstract

This disclosure relates to delivery vehicles comprising payload molecules, e.g., mRNA for the treatment of cystic fibrosis (CF). Nucleic acid therapeutics (e.g., mRNAs) when administered in vivo encode cystic fibrosis transmembrane conductance regulator (CFTR). Nucleic acid therapeutics (e.g., mRNAs) of the disclosure increase and / or restore deficient levels of CFTR expression and / or activity in subjects.

Description

Attorney Docket No.45817-0138WO1 / MTX968.20 POLYNUCLEOTIDES ENCODING CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR FOR THE TREATMENT OF CYSTIC FIBROSIS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. Provisional Application No.63 / 463,829, filed on May 3, 2023, the contents of which are hereby incorporated by reference. SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on April 30, 2024, is named 45817- 0138WO1_SL.xml and is 7,333,434 bytes in size. BACKGROUND

[0003] Cystic Fibrosis ("CF") is an autosomal recessive disease characterized by the abnormal buildup of sticky and thick mucus in patients. CF is also known as cystic fibrosis of the pancreas, fibrocystic disease of the pancreas, or muscoviscidosis. Mucus is an important bodily fluid that lubricates and protects the lungs, reproductive system, digestive system, and other organs. However, CF patients produce thick and sticky mucus, which reduces the size of the airways leading to chronic coughing, wheezing, inflammation, bacterial infections, fibrosis, and cysts in the lungs. Additionally, most CF patients have mucus blocking the ducts in the pancreas, which prevents the release of insulin and digestive enzymes leading to diarrhea, malnutrition, poor growth, and weight loss. Gershman A.J. et al., Cleve Clin J Med. 73: 1065-1074 (2006). CF has an estimated incidence of 1 in 2,500 to 3,500 in Caucasian births, but is much more rare in other populations. Ratjen F. et al., Lancet 361: 681-689 (2003).

[0004] The principal gene associated with CF is Cystic Fibrosis Transmembrane Conductance Regulator ("CFTR") (NM_000492, NP_000483;Attorney Docket No.45817-0138WO1 / MTX968.20 XM_011515751, XP_011514053; XM_011515752, XP_011514054; XM_011515753, XP_011514055; XM_011515754, XP_011514056; also referred to as ATP-Binding Cassette Sub-Family C, Member 7 ("ABCC7")). CFTR is an enzyme (E.C.3.6.3.49) that plays a critical role in transport pathways and functions as a chloride ion channel. Lack of functional CFTR prevents excretion of chloride ions and leads to increased sodium ion absorption. Welsh, M. J. et al., J. Clin. Invest.80: 1523-1526 (1987). This causes water to move from the mucus to cells resulting in a more viscous mucus. CFTR localizes to the cytoplasm, endosomes, extracellular space, and plasma membrane of cells. The protein is 1480 amino acids long. A complete or partial loss of CFTR function leads to thick and sticky mucus causing difficulty breathing, digestive problems, and shortened life span. SUMMARY

[0005] The present disclosure provides delivery vehicles and messenger RNAs (mRNAs) for the treatment of cystic fibrosis. The nucleic acid therapeutics of the invention are particularly well-suited for the treatment of cystic fibrosis as the technology provides for the targeted delivery, e.g., intracellular delivery of mRNA or other nucleic acid molecule encoding a cystic fibrosis transmembrane conductance regulator (CFTR) polypeptide followed by de novo synthesis of functional CFTR polypeptide within target cells.

[0006] In one aspect, the disclosure features a lipid nanoparticle comprising: (i) a lipid amine that is a compound of Formula IX:R2and R3are each C2-20 alkyl, wherein: (a) the C2-20alkyl is substituted by NH2;Attorney Docket No.45817-0138WO1 / MTX968.20 (b) one non-terminal carbon of the C2-20 alkyl is optionally replaced with NH; and (c) R2and R3are the same or different; j is 0 or 1; k is 0, 1, 2, or 3; l is 0 or 1; m is 0, 1, or 2; n is 0 or 1; j and l are not both 0; and when j is 0, then l is 1; with the proviso that the compound is other than: ,Attorney Docket No.45817-0138WO1 / MTX968.20and (ii) a messenger RNA (mRNA) comprising an open reading frame (ORF) encoding the cystic fibrosis transmembrane conductance regulator (CFTR) polypeptide of SEQ ID NO:3.

[0007] In some embodiments, the lipid amine is a compound of Formula IXa: a salt thereof.

[0008] In some embodiments, the lipid amine is a compound of Formula IXb:Attorney Docket No.45817-0138WO1 / MTX968.20

[0009] In some embodiments, the lipid amine is a compound of Formula IXc: a salt thereof. is a compound of Formula IXd:.. R1is. R2and R3are each C2-15alkyl substituted byNH2.

[0015] In some embodiments, R2and R3are each C2-15alkyl substituted by NH2, and wherein one non-terminal carbon of the C2-15 alkyl is optionally replaced with NH.

[0016] In some embodiments, R2and R3are each C2-12 alkyl substituted by NH2.Attorney Docket No.45817-0138WO1 / MTX968.20

[0017] In some embodiments, R2and R3are each C2-12 alkyl substituted by NH2, and wherein one non-terminal carbon of the C2-12alkyl is optionally replaced with NH.

[0018] In some embodiments, R2and R3are each C2-10alkyl substituted by NH2.

[0019] In some embodiments, R2and R3are each C2-10alkyl substituted by NH2, and wherein one non-terminal carbon of the C2-10 alkyl is optionally replaced with NH.

[0020] In some embodiments, R2and R3are each C5-10 alkyl substituted by NH2.

[0021] In some embodiments, R2and R3are each C5-10alkyl substituted by NH2, and wherein one non-terminal carbon of the C5-10 alkyl is optionally replaced with NH.

[0022] In some embodiments, R2and R3are each C5-6 alkyl substituted by NH2.

[0023] In some embodiments, R2and R3are each C5-6 alkyl substituted by NH2, and wherein one non-terminal carbon of the C5-6alkyl is optionally replaced with NH.

[0024] In some embodiments, each of R2and R3is independently selected from ,Attorney Docket No.45817-0138WO1 / MTX968.20 , , , , ,,.

[0027] In some embodiments, R2 and R3 are the same.

[0028] In some embodiments, R2and R3are different.

[0029] In some embodiments, the lipid amine is a compound selected from:Attorney Docket No.45817-0138WO1 / MTX968.20 Structure SA No. SA1Attorney Docket No.45817-0138WO1 / MTX968.20 SA6 0

[0030] In some embodiments, the lipid amine is a compound selected from:Attorney Docket No.45817-0138WO1 / MTX968.20 Structure SA No. SA1Attorney Docket No.45817-0138WO1 / MTX968.20 SA8

[0033] In some embodiments, the lipid amine is Compound SA4:Attorney Docket No.45817-0138WO1 / MTX968.20 a salt

[0034] a salt thereof. SA1:.identical to the nucleotide sequence of SEQ ID NO:8.

[0037] In some embodiments, the ORF is at least 85% identical to the nucleotide sequence of SEQ ID NO:8.

[0038] In some embodiments, the ORF is at least 90% identical to the nucleotide sequence of SEQ ID NO:8.

[0039] In some embodiments, the ORF is at least 95% identical to the nucleotide sequence of SEQ ID NO:8.

[0040] In some embodiments, the ORF is at least 96% identical to the nucleotide sequence of SEQ ID NO:8.Attorney Docket No.45817-0138WO1 / MTX968.20

[0041] In some embodiments, the ORF is at least 97% identical to the nucleotide sequence of SEQ ID NO:8.

[0042] In some embodiments, the ORF is at least 98% identical to the nucleotide sequence of SEQ ID NO:8.

[0043] In some embodiments, the ORF is at least 99% identical to the nucleotide sequence of SEQ ID NO:8.

[0044] In some embodiments, the ORF is identical to the nucleotide sequence of SEQ ID NO:8.

[0045] In some embodiments, the mRNA comprises a 5' untranslated region (UTR) comprising the nucleotide sequence of SEQ ID NO:50.

[0046] In some embodiments, the mRNA comprises a 3' UTR comprising the nucleotide sequence of SEQ ID NO:139.

[0047] In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO:37.

[0048] In some embodiments, the mRNA comprises a 5′ terminal cap comprising m7G-ppp-Gm.

[0049] In some embodiments, the mRNA comprises a poly-A region comprising A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211).

[0050] In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO:24.

[0051] In some embodiments, the mRNA comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof.

[0052] In some embodiments, all of the uracils of the mRNA are N1- methylpseudouracils.

[0053] In some embodiments, the lipid nanoparticle comprises an ionizable lipid. In some embodiments, the ionizable lipid isAttorney Docket No.45817-0138WO1 / MTX968.20

[0054] In some embodiments, the lipid nanoparticle comprises: an ionizable lipid; a phospholipid; a structural lipid; and a PEG-lipid. In some embodiments: the ionizable lipid is (Compound II), or a saltthe phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); the structural lipid is cholesterol; and the PEG-lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG-2k).

[0055] In some embodiments: the ionizable lipid is (Compound II), or a saltthe phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); the structural lipid is cholesterol; the PEG-lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG-2k); and the lipid amine is compound SA1:Attorney Docket No.45817-0138WO1 / MTX968.20 .

[0056] In some embodiments: the ionizable lipid is (Compound II), or a saltthe phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); the structural lipid is cholesterol; the PEG-lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG-2k); the lipid amine is compound SA1:ID NO:8.

[0057] In some embodiments:Attorney Docket No.45817-0138WO1 / MTX968.20 the ionizable lipid is (Compound II), or a saltsn- 3-phosphocholine (DSPC); the structural lipid is cholesterol; the PEG-lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG-2k); the lipid amine is compound SA1: of SEQ ID NO:37.

[0058] In some embodiments: the ionizable lipid is (Compound II), or a saltthe phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); the structural lipid is cholesterol; the PEG-lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG-2k); the lipid amine is compound SA1:Attorney Docket No.45817-0138WO1 / MTX968.20 NO:24.RNA (mRNA) comprising an open reading frame (ORF) encoding the cystic fibrosis transmembrane conductance regulator (CFTR) polypeptide of SEQ ID NO:3, wherein the ORF is at least 80% identical to the nucleotide sequence of SEQ ID NO:8.

[0060] In some embodiments, the ORF is at least 85% identical to the nucleotide sequence of SEQ ID NO:8.

[0061] In some embodiments, the ORF is at least 90% identical to the nucleotide sequence of SEQ ID NO:8.

[0062] In some embodiments, the ORF is at least 95% identical to the nucleotide sequence of SEQ ID NO:8.

[0063] In some embodiments, the ORF is at least 96% identical to the nucleotide sequence of SEQ ID NO:8.

[0064] In some embodiments, the ORF is at least 97% identical to the nucleotide sequence of SEQ ID NO:8.

[0065] In some embodiments, the ORF is at least 98% identical to the nucleotide sequence of SEQ ID NO:8.

[0066] In some embodiments, the ORF is at least 99% identical to the nucleotide sequence of SEQ ID NO:8.

[0067] In some embodiments, the ORF is identical to the nucleotide sequence of SEQ ID NO:8.

[0068] In some embodiments, the mRNA comprises a 5' untranslated region (UTR) comprising the nucleotide sequence of SEQ ID NO:50.

[0069] In some embodiments, the mRNA comprises a 3' UTR comprising the nucleotide sequence of SEQ ID NO:139.Attorney Docket No.45817-0138WO1 / MTX968.20

[0070] In some embodiments, the nucleotide sequence of SEQ ID NO:37.

[0071] In some embodiments, the mRNA comprises a 5′ terminal cap comprising m7G-ppp-Gm.

[0072] In some embodiments, the mRNA comprises a poly-A region comprising A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211).

[0073] In some embodiments, the nucleotide sequence of SEQ ID NO:24.

[0074] In another aspect, the disclosure features a messenger RNA (mRNA) comprising an open reading frame (ORF) encoding the cystic fibrosis transmembrane conductance regulator (CFTR) polypeptide of SEQ ID NO:3, wherein the mRNA comprises a poly-A region comprising A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211).

[0075] In some embodiments, the mRNA comprises a 5' untranslated region (UTR) comprising the nucleotide sequence of SEQ ID NO:50.

[0076] In some embodiments, the mRNA comprises a 3' UTR comprising the nucleotide sequence of SEQ ID NO:139.

[0077] In some embodiments, the mRNA comprises a 5′ terminal cap comprising m7G-ppp-Gm.

[0078] In some embodiments, the mRNA comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof.

[0079] In some embodiments, all of the uracils of the mRNA are N1- methylpseudouracils.

[0080] In another aspect, the disclosure features a lipid nanoparticle comprising an mRNA described herein.

[0081] In some embodiments, the lipid nanoparticle comprises: an ionizable lipid; a phospholipid; a structural lipid; a PEG-lipid; and a cationic agent.

[0082] In some embodiments, in the ionizable lipid isAttorney Docket No.45817-0138WO1 / MTX968.20 (Compound II) or a saltsome agent is a salt thereof. lipid isa salt thereof.the ionizable lipid is (Compound II) or a saltthe phospholipid is 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC); the structural lipid is cholesterol; the PEG lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol- 2000 (DMG-PEG-2k); and the cationic agent isAttorney Docket No.45817-0138WO1 / MTX968.20 sequence of

[0087] In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO:37.

[0088] In some embodiments, the mRNA comprises the nucleotide sequence of SEQ ID NO:24.

[0089] In another aspect, the disclosure features a method of treating or preventing cystic fibrosis in a human subject in need thereof, comprising administering to the human subject a lipid nanoparticle described herein or an mRNA described herein.

[0090] In another aspect, the disclosure features a method of preventing cystic fibrosis in a human subject having cystic fibrosis-causing mutations in both copies of the CFTR gene, comprising administering to the human subject a lipid nanoparticle described herein or an mRNA described herein.

[0091] In some embodiments, the cystic fibrosis-causing mutations are selected from the group consisting of G542X, W1282X, R553X, F508del, N1303K, I507del, G551D, S549N, D1152H, R347P, and R117H.

[0092] In some embodiments, the administering is to the respiratory tract or lung of the human subject. BRIEF DESCRIPTION OF THE DRAWINGS

[0093] Figure 1 is a graph showing chloride transport (current) versus dose in CF-HBE cells administered lipid nanoparticles containing SA1 or GL-67 and any one of several different CFTR mRNAs.

[0094] Figure 2 is a graph showing chloride transport (current) in CF-HBE cells administered lipid nanoparticles containing SA1 or GL-67 and any one of several different CFTR mRNAs at a dose of 0.5 μg / well.Attorney Docket No.45817-0138WO1 / MTX968.20

[0095] Figure 3 is a graph showing fold change in peak current in CF-HBE cells administered 10 different CFTR mRNA constructs, each as compared to the 1036 CFTR mRNA construct.

[0096] Figures 4A-4C are graphs showing chloride transport (current) in CF- HBE cells administered lipid nanoparticles containing idT-stabilized wild-type CFTR mRNA (1036) compared against non-stabilized mRNAs encoding wild-type CFTR (1038 and 1039) (Figure 4A), non-stabilized mRNAs encoding CFTR GoF1 (1043) or CFTR GoF2 (1044) (Figure 4B), and (C) idT-stabilized mRNAs encoding CFTR GoF1 (1053) or CFTR GoF2 (1054) (Figure 4C).

[0097] Figure 5 is a series of graphs showing chloride transport (current) in CF-HBE cells administered lipid nanoparticles containing: wild-type CFTR mRNA construct 1036 formulated in a lipid nanoparticle containing Compound II, DSPC, cholesterol, DMG-PEG-2k, and GL-67 (designated “A”); wild-type CFTR mRNA construct 1036 formulated in a lipid nanoparticle containing Compound II, DSPC, cholesterol, DMG-PEG-2k, and SA1 (designated “B”); CFTR GoF1 mRNA construct 1053 formulated in a lipid nanoparticle containing Compound II, DSPC, cholesterol, DMG-PEG-2k, and SA1 (designated “C”); and CFTR GoF2 mRNA construct 1054 formulated in a lipid nanoparticle containing Compound II, DSPC, cholesterol, DMG- PEG-2k, and SA1 (designated “D”).

[0098] Figure 6 is a series of graphs showing RNA purity over time for LNP1 and LNP2 at 25°C, 5°C, -20°C, and -70°C. In all graphs, LNP2 is the top line and LNP1 is the bottom line.

[0099] Figure 7 is a graph depicting particle size for LNP1 and LNP3 following repeated cycling from -70°C to -20°C. LNP1 is the top line and LNP3 is the bottom line.

[0100] Figure 8 is a series of graphs showing particle size, encapsulation efficiency, mRNA purity, and protein expression for LNP1 and LNP2 pre- nebulization (open circles) and post-nebulization (solid circles).Attorney Docket No.45817-0138WO1 / MTX968.20 DETAILED DESCRIPTION

[0101] The present disclosure provides therapeutics for the treatment of cystic fibrosis (CF). Cystic fibrosis (CF) is a progressive, genetic disease that causes persistent lung infections and limits the ability to breathe over time. This disease is characterized by the presence of mutations in both copies of the gene for the cystic fibrosis transmembrane conductance regulator (CFTR) protein. Without CFTR, which is involved in the production of sweat, digestive fluids and mucus, secretions that are usually thin instead become thick. The subject delivery vehicles enable delivery of payloads to airways to ameliorate disease. In one embodiment, a payload comprises nucleic acid molecules or molecules capable of modifying DNA of cells present in airways. In particular, mRNA therapeutics are particularly well-suited for the treatment of CF as the technology provides for the intracellular delivery of mRNA encoding CFTR followed by de novo synthesis of functional CFTR protein within target cells. After delivery of mRNA to the target cells, the desired CFTR protein is expressed by the cells’ own translational machinery, and hence, fully functional CFTR protein replaces the defective or missing protein.

[0102] Certain embodiments of the therapeutic technology of the instant disclosure also feature delivery of a therapeutic payload encoding CFTR via a lipid nanoparticle (LNP) delivery system. The subject lipid nanoparticles (LNPs) are an ideal platform for the safe and effective delivery of payload to target cells in the lungs. In particular, LNPs have the unique ability to deliver nucleic acids by a mechanism involving cellular uptake, intracellular transport and endosomal release or endosomal escape. Additionally, the payloads of the invention for treating CF may be delivered to pulmonary tissue using oral or nasal inhalation administration methods. Prior art methods for delivering CFTR gene therapy vectors using both viral and non- viral systems, have been developed and tested in the lungs of CF patients (Griesenbach, U. and Alton, E. W. F. W. Adv. Drug Deliv. Rev.61:128-139 (2009)). However, delivery of these vectors have been plagued with problems. For instance the development of humoral immunity is a problem for adenoviral vectors. The LNP formulations of the invention provide advantages for pulmonary delivery of payloads,Attorney Docket No.45817-0138WO1 / MTX968.20 e.g., nucleic acids such as the mRNA encoding CFTR, enabling effective levels of CFTR expression while avoiding eliciting dangerous immune responses. 1. Cystic Fibrosis Transmembrane Conductance Regulator (CFTR)

[0103] Cystic Fibrosis Transmembrane Conductance Regulator (CFTR; EC 3.6.3.49) is an ABC transporter-class ion channel. It conducts chloride and thiocyanate ions across epithelial cell membranes. The structure of the approximately 168 kDa CFTR, which is highly conserved amongst organisms, consists of seven domains. CFTR contains two transmembrane domains with six transmembrane helices each. Additionally, CFTR contains two nucleotide binding domains, two ABC transporter domains, and one PDZ-binding domain. The nucleotide binding domains are used for binding and hydrolyzing ATP, ABC transporters move ions across the plasma membrane, and the PDZ-binding domain anchors CFTR to the plasma membrane. CFTR usually exists in dimer units in the plasma membrane of the cell.

[0104] The most well-known health issue involving CFTR is cystic fibrosis (CF), an autosomal recessive genetic disorder where non-functional CFTR prevents excretion of chloride ions and leads to increased sodium ion absorption, leading to more viscous mucus. This is caused by gene mutations that, in most cases, produce non-functional CFTR.

[0105] The coding sequence (CDS) for wild type CFTR canonical mRNA sequence is described at the NCBI Reference Sequence database (RefSeq) under accession number NM_000492.3 ("Homo sapiens cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) (CFTR), mRNA"). The wild type CFTR canonical protein sequence, corresponding to isoform 1 (SEQ ID NO:1), is described at the RefSeq database under accession number NP_000483.3 ("Cystic fibrosis transmembrane conductance regulator [ Homo sapiens]").

[0106] The CFTR isoform 1 protein is 1480 amino acids long. It is noted that the specific nucleic acid sequences encoding the reference protein sequence in the Ref Seq sequences are the coding sequence (CDS) as indicated in the respective RefSeq database entry. Isoforms 2 and 3 are produced by alternative splicing.Attorney Docket No.45817-0138WO1 / MTX968.20

[0107] In certain aspects, the disclosure provides a polynucleotide (e.g., a RNA, e.g., a mRNA) comprising a nucleotide sequence (e.g., an open reading frame (ORF)) encoding a CFTR polypeptide.

[0108] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a nucleotide sequence (e.g., an ORF) of the invention encodes the gain of function CFTR mutant referred to herein as “GoF1”, which contains the H1402S mutation and corresponds to the amino acid sequence set forth in SEQ ID NO:2

[0109] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a nucleotide sequence (e.g., an ORF) of the invention encodes the gain of function CFTR mutant referred to herein as “GoF2” contains the ΔRI, 2PT, and H1402S mutations and corresponds to the amino acid sequence set forth in SEQ ID NO:3. 2. Polynucleotides and Open Reading Frames (ORFs)

[0110] The instant invention features mRNAs for use in treating or preventing CF. The mRNAs featured for use in the invention are administered to subjects and encode human CFTR protein in vivo. Accordingly, the invention relates to polynucleotides, e.g., mRNA, comprising an open reading frame of linked nucleosides encoding CFTR GoF1 (SEQ ID NO:2), CFTR GoF2 (SEQ ID NO:3), isoforms thereof, functional fragments thereof, and fusion proteins comprising CFTR. Specifically, the invention provides sequence-optimized polynucleotides comprising nucleotides encoding the polypeptide sequence of CFTR GoF1 or CFTR GoF2 or sequences having high sequence identity with those sequence optimized polynucleotides.

[0111] In certain aspects, the invention provides polynucleotides (e.g., a RNA such as an mRNA) that comprise a nucleotide sequence (e.g., an ORF) encoding one or more CFTR polypeptides. In some embodiments, the encoded CFTR polypeptide of the invention can be selected from: (i) a gain of function CFTR polypeptide (e.g., having the same or essentially the same length as CFTR GoF1 or CFTR GoF2);Attorney Docket No.45817-0138WO1 / MTX968.20 (ii) a functional fragment of a CFTR polypeptide described herein (e.g., a truncated (e.g., deletion of carboxy, amino terminal, or internal regions) sequence shorter than CFTR, but still retaining CFTR enzymatic activity); (iii) a variant thereof (e.g., full length or truncated CFTR proteins in which one or more amino acids have been replaced, e.g., variants that retain all or most of the CFTR activity of the polypeptide with respect to a reference protein (e.g., any natural or artificial variants known in the art)); or (iv) a fusion protein comprising (i) a CFTR protein (e.g., SEQ ID NO:2 or SEQ ID NO:3), an isoform thereof or a variant thereof, and (ii) a heterologous protein.

[0112] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention increases CFTR protein expression levels and / or detectable CFTR enzymatic activity levels in cells when introduced in those cells, e.g., by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100%, compared to CFTR protein expression levels and / or detectable CFTR enzymatic activity levels in the cells prior to the administration of the polynucleotide of the invention. CFTR protein expression levels and / or CFTR enzymatic activity can be measured according to methods know in the art. In some embodiments, the polynucleotide is introduced to the cells in vitro. In some embodiments, the polynucleotide is introduced to the cells in vivo.

[0113] In some embodiments, the polynucleotides (e.g., a RNA, e.g., an mRNA) of the invention comprise a nucleotide sequence (e.g., an ORF) that encodes CFTR GoF1 (SEQ ID NO:2) or CFTR GoF2 (SEQ ID NO:3).

[0114] In some embodiments, the polynucleotides (e.g., a RNA, e.g., an mRNA) of the invention comprise a nucleotide sequence (e.g., an ORF) encoding a functional CFTR fragment. In some embodiments, the CFTR fragment has a CFTR activity which is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the CFTR activity of the corresponding full length CFTR. In some embodiments, the polynucleotides (e.g., a RNA, e.g., an mRNA) of theAttorney Docket No.45817-0138WO1 / MTX968.20 invention comprising an ORF encoding a functional CFTR fragment is sequence optimized.

[0115] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a CFTR fragment that has higher CFTR enzymatic activity than the corresponding full length CFTR. Thus, in some embodiments the CFTR fragment has a CFTR activity which is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% higher than the CFTR activity of the corresponding full length CFTR.

[0116] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding CFTR GoF1 (SEQ ID NO:2), wherein the nucleotide sequence is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence of SEQ ID NO:7.

[0117] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding CFTR GoF2 (SEQ ID NO:3), wherein the nucleotide sequence is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence of SEQ ID NO:8.

[0118] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF, e.g., the sequence of SEQ ID NO:8) encoding CFTR GoF2 further comprises a 5′-UTR (e.g., SEQ ID NO:50) and a 3′-UTR (e.g., SEQ ID NO:139). In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises the sequence of SEQ ID NO:37. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises the sequence of SEQ ID NO:24. In a further embodiment, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a 5′ terminal cap (e.g., m7G-ppp-Gm-AG, Cap0, Cap1, ARCA, inosine, N1-methyl- guanosine, 2′-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino- guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5′ methylG cap, or an analog thereof) and a poly-A-tail region (e.g., about 100 nucleotides in length). InAttorney Docket No.45817-0138WO1 / MTX968.20 some embodiments, the mRNA comprises a polyA tail. In some instances, the poly A tail is 100 nucleotides in length (SEQ ID NO:195). In some instances, the poly A tail is protected (e.g., with an inverted deoxy-thymidine). In some instances, the poly A tail comprises A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). In some instances, the poly A tail is A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211).

[0119] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF, e.g., the sequence of SEQ ID NO:7) encoding CFTR GoF1 further comprises a 5′-UTR (e.g., SEQ ID NO:50) and a 3′-UTR (e.g., SEQ ID NO:139). In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises the sequence of SEQ ID NO:36. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises the sequence of SEQ ID NO:23. In a further embodiment, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a 5′ terminal cap (e.g., m7G-ppp-Gm-AG, Cap0, Cap1, ARCA, inosine, N1-methyl- guanosine, 2′-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino- guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5′ methylG cap, or an analog thereof) and a poly-A-tail region (e.g., about 100 nucleotides in length). In some embodiments, the mRNA comprises a polyA tail. In some instances, the poly A tail is 100 nucleotides in length (SEQ ID NO:195). In some instances, the poly A tail is protected (e.g., with an inverted deoxy-thymidine). In some instances, the poly A tail comprises A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). In some instances, the poly A tail is A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211).

[0120] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) encoding a CFTR polypeptide (e.g., CFTR GoF1 or CFTR GoF2 ) further comprises at least one nucleic acid sequence that is noncoding, e.g., a microRNA binding site. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention further comprises a 5′-UTR (e.g., SEQ ID NO:50) and a 3′UTR (e.g., SEQ ID NO:139). In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises the sequence of SEQ ID NO:8. In some embodiments, theAttorney Docket No.45817-0138WO1 / MTX968.20 polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises the sequence of SEQ ID NO:7. In a further embodiment, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a 5′ terminal cap (e.g., m7G-ppp-Gm-AG, Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2′-fluoro-guanosine, 7-deaza-guanosine, 8-oxo- guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5′ methylG cap, or an analog thereof) and a poly-A-tail region (e.g., about 100 nucleotides in length, e.g., A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211)).

[0121] In some embodiments, the mRNA of the invention comprises an ORF encoding the polypeptide of SEQ ID NO:3 and a poly-A region comprising A100- UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211).

[0122] In some embodiments, the mRNA of the invention comprises an ORF encoding the polypeptide of SEQ ID NO:2 and a poly-A region comprising A100- UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211).

[0123] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises the nucleotide sequence of SEQ ID NO:8.

[0124] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises the nucleotide sequence of SEQ ID NO:37.

[0125] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises the nucleotide sequence of SEQ ID NO:24.

[0126] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises the nucleotide sequence of SEQ ID NO:7.

[0127] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises the nucleotide sequence of SEQ ID NO:36.

[0128] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises the nucleotide sequence of SEQ ID NO:23.

[0129] In some embodiments, the polynucleotide of the invention comprising a nucleotide sequence (e.g., an ORF) encoding a CFTR polypeptide (e.g., the wild- type sequence, functional fragment, or variant thereof) is DNA or RNA. In some embodiments, the polynucleotide of the invention is RNA. In some embodiments, the polynucleotide of the invention is, or functions as, a mRNA. In some embodiments, the mRNA comprises a nucleotide sequence (e.g., an ORF) that encodes at least oneAttorney Docket No.45817-0138WO1 / MTX968.20 CFTR polypeptide, and is capable of being translated to produce the encoded CFTR polypeptide in vitro, in vivo, in situ or ex vivo.

[0130] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises a sequence-optimized nucleotide sequence (e.g., an ORF) encoding a CFTR polypeptide (e.g., CFTR GoF1 or CFTR GoF2), wherein the polynucleotide comprises at least one chemically modified nucleobase, e.g., N1-methylpseudouracil or 5-methoxyuracil. In certain embodiments, all uracils in the polynucleotide are N1-methylpseudouracils. In other embodiments, all uracils in the polynucleotide are 5-methoxyuracils. In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds to miR-142 and / or a miRNA binding site that binds to miR-126.

[0131] In some embodiments, the payload for treating CF, e.g., a polynucleotide disclosed herein (e.g., an mRNA comprising an ORF encoding the CFTR GoF2 polypeptide of SEQ ID NO:3 or the CFTR GoF1 polypeptide of SEQ ID NO:2) is formulated with a lipid nanoparticle comprising a lipid amine of a compound of Formula IX, e.g., any one of SA1-SA10. In some embodiments, the lipid nanoparticle comprises Compound II, DSPC, cholesterol, DMG-PEG-2k, and lipid amine, e.g., with a mole ratio of about 47.6±25:9.5±8:36.6±20:1.4±1.25:4.9±2.5. In some embodiments, the lipid nanoparticle comprises Compound II, DSPC, Cholesterol, DMG-PEG-2k, and lipid amine, e.g., with a mole ratio of about 47.6±12.5:9.5±4:36.6±10:1.4±0.75:4.9±1.25. In some embodiments, the lipid nanoparticle comprises Compound II, DSPC, Cholesterol, DMG-PEG-2k, and lipid amine, e.g., with a mole ratio of about 47.6:9.5:36.6:1.4:4.9. In some embodiments, the lipid nanoparticle comprises Compound VI, DSPC, Cholesterol, Compound I or PEG-DMG, and lipid amine, e.g., with a mole ratio of about 47.6±25:9.5±8:36.6±20:1.4±1.25:4.9±2.5. In some embodiments, the lipid nanoparticle comprises Compound VI, DSPC, Cholesterol, Compound I or PEG- DMG, and lipid amine, e.g., with a mole ratio of about 47.6±12.5:9.5±4:36.6±10:1.4±0.75:4.9±1.25. In some embodiments, the lipid nanoparticle comprises Compound VI, DSPC, Cholesterol, Compound I or PEG- DMG, and lipid amine, e.g., with a mole ratio of about 47.6:9.5:36.6:1.4:4.9. In some embodiments, the lipid nanoparticle comprises Compound II, DSPC, Cholesterol,Attorney Docket No.45817-0138WO1 / MTX968.20 DMG-PEG-2k, and lipid amine, e.g., with a mole ratio of about 47.3±25:9.5±8:36.4±20:1.4±1.25:5.5±2.5. In some embodiments, the lipid nanoparticle comprises Compound II, DSPC, Cholesterol, DMG-PEG-2k, and lipid amine, e.g., with a mole ratio of about 47.3±12.5:9.5±4:36.4±10:1.4±0.75:5.5±1.25. In some embodiments, the lipid nanoparticle comprises Compound II, DSPC, Cholesterol, DMG-PEG-2k, and lipid amine, e.g., with a mole ratio of about 47.3:9.5:36.4:1.4:5.5. In some embodiments, the lipid nanoparticle comprises Compound VI, DSPC, Cholesterol, Compound I or PEG-DMG, and lipid amine, e.g., with a mole ratio of about 47.3±25:9.5±8:36.4±20:1.4±1.25:5.5±2.5. In some embodiments, the lipid nanoparticle comprises Compound VI, DSPC, Cholesterol, Compound I or PEG-DMG, and lipid amine, e.g., with a mole ratio of about 47.3±12.5:9.5±4:36.4±10:1.4±0.75:5.5±1.25. In some embodiments, the lipid nanoparticle comprises Compound VI, DSPC, Cholesterol, Compound I or PEG- DMG, and lipid amine, e.g., with a mole ratio of about 47.3:9.5:36.4:1.4:5.5. In some embodiments, the lipid nanoparticle comprises Compound II, DSPC, Cholesterol, DMG-PEG-2k, and lipid amine, e.g., with a mole ratio of about 45.8±25:10.5±8:36.8±20:1.4±1.25:5.5±2.5. In some embodiments, the lipid nanoparticle comprises Compound II, DSPC, Cholesterol, DMG-PEG-2k, and lipid amine, e.g., with a mole ratio of about 45.8±12.5:10.5±4:36.8±10:1.4±0.75:5.5±1.25 In some embodiments, the lipid nanoparticle comprises Compound II, DSPC, Cholesterol, DMG-PEG-2k, and lipid amine, e.g., with a mole ratio of about 45.8:10.5:36.8:1.4:5.5. In some embodiments, the lipid nanoparticle comprises Compound VI, DSPC, Cholesterol, Compound I or PEG-DMG, and lipid amine, e.g., with a mole ratio of about 45.8±25:10.5±8:36.8±20:1.4±1.25:5.5±2.5. In some embodiments, the lipid nanoparticle comprises Compound VI, DSPC, Cholesterol, Compound I or PEG-DMG, and lipid amine, e.g., with a mole ratio of about 45.8±12.5:10.5±4:36.8±10:1.4±0.75:5.5±1.25. In some embodiments, the lipid nanoparticle comprises Compound VI, DSPC, Cholesterol, and Compound I or PEG- DMG, e.g., with a mole ratio of about 45.8±6.25:10.5±2:36.8±5:1.4±0.375:5.5±0.625. In some embodiments, the lipid nanoparticle comprises Compound VI, DSPC, Cholesterol, Compound I or PEG-DMG, and lipid amine, e.g., with a mole ratio ofAttorney Docket No.45817-0138WO1 / MTX968.20 about 45.8:10.5:36.8:1.4:5.5. In some embodiments, the lipid nanoparticle comprises Compound II, DSPC, Cholesterol, DMG-PEG-2k, and SA1.

[0132] In some embodiments, a polynucleotide (e.g., a RNA, e.g., a mRNA) disclosed herein is formulated with a lipid nanoparticle comprising a lipid amine of a compound of Formula IX.

[0133] In some embodiments, an mRNA encoding the CFTR GoF2 polypeptide of SEQ ID NO:3 is formulated with a lipid nanoparticle comprising a lipid amine of a compound of Formula IX.

[0134] In some embodiments, an mRNA encoding the CFTR GoF2 polypeptide of SEQ ID NO:3 is formulated with a lipid nanoparticle comprising the lipid amine SA1.

[0135] In some embodiments, an mRNA encoding the CFTR GoF2 polypeptide of SEQ ID NO:3 is formulated with a lipid nanoparticle comprising Compound II, DSPC, Cholesterol, DMG-PEG-2k, and SA1.

[0136] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:8 is formulated with a lipid nanoparticle comprising a lipid amine of a compound of Formula IX.

[0137] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:8 is formulated with a lipid nanoparticle comprising the lipid amine SA1.

[0138] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:8 is formulated with a lipid nanoparticle comprising Compound II, DSPC, Cholesterol, DMG-PEG-2k, and SA1.

[0139] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:37 is formulated with a lipid nanoparticle comprising a lipid amine of a compound of Formula IX.

[0140] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:37 is formulated with a lipid nanoparticle comprising the lipid amine SA1.

[0141] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:37 is formulated with a lipid nanoparticle comprising Compound II, DSPC, Cholesterol, DMG-PEG-2k, and SA1.Attorney Docket No.45817-0138WO1 / MTX968.20

[0142] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:24 is formulated with a lipid nanoparticle comprising a lipid amine of a compound of Formula IX.

[0143] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:24 is formulated with a lipid nanoparticle comprising the lipid amine SA1.

[0144] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:24 is formulated with a lipid nanoparticle comprising Compound II, DSPC, Cholesterol, DMG-PEG-2k, and SA1.

[0145] In some embodiments, an mRNA encoding the CFTR GoF1 polypeptide of SEQ ID NO:2 is formulated with a lipid nanoparticle comprising a lipid amine of a compound of Formula IX.

[0146] In some embodiments, an mRNA encoding the CFTR GoF1 polypeptide of SEQ ID NO:2 is formulated with a lipid nanoparticle comprising the lipid amine SA1.

[0147] In some embodiments, an mRNA encoding the CFTR GoF1 polypeptide of SEQ ID NO:2 is formulated with a lipid nanoparticle comprising Compound II, DSPC, Cholesterol, DMG-PEG-2k, and SA1.

[0148] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:7 is formulated with a lipid nanoparticle comprising a lipid amine of a compound of Formula IX.

[0149] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:7 is formulated with a lipid nanoparticle comprising the lipid amine SA1.

[0150] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:7 is formulated with a lipid nanoparticle comprising Compound II, DSPC, Cholesterol, DMG-PEG-2k, and SA1.

[0151] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:36 is formulated with a lipid nanoparticle comprising a lipid amine of a compound of Formula IX.

[0152] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:36 is formulated with a lipid nanoparticle comprising the lipid amine SA1.Attorney Docket No.45817-0138WO1 / MTX968.20

[0153] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:36 is formulated with a lipid nanoparticle comprising Compound II, DSPC, Cholesterol, DMG-PEG-2k, and SA1.

[0154] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:23 is formulated with a lipid nanoparticle comprising a lipid amine of a compound of Formula IX.

[0155] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:23 is formulated with a lipid nanoparticle comprising the lipid amine SA1.

[0156] In some embodiments, an mRNA comprising the sequence set forth in SEQ ID NO:23 is formulated with a lipid nanoparticle comprising Compound II, DSPC, Cholesterol, DMG-PEG-2k, and SA1. 3. Signal Sequences

[0157] The polynucleotides (e.g., a RNA, e.g., an mRNA) of the invention can also comprise nucleotide sequences that encode additional features that facilitate trafficking of the encoded polypeptides to therapeutically relevant sites. One such feature that aids in protein trafficking is the signal sequence, or targeting sequence. The peptides encoded by these signal sequences are known by a variety of names, including targeting peptides, transit peptides, and signal peptides. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) that encodes a signal peptide operably linked to a nucleotide sequence that encodes a CFTR polypeptide described herein.

[0158] In some embodiments, the "signal sequence" or "signal peptide" is a polynucleotide or polypeptide, respectively, which is from about 30-210, e.g., about 45-80 or 15-60 nucleotides (e.g., about 20, 30, 40, 50, 60, or 70 amino acids) in length that, optionally, is incorporated at the 5′ (or N-terminus) of the coding region or the polypeptide, respectively. Addition of these sequences results in trafficking the encoded polypeptide to a desired site, such as the endoplasmic reticulum or the mitochondria through one or more targeting pathways. Some signal peptides areAttorney Docket No.45817-0138WO1 / MTX968.20 cleaved from the protein, for example by a signal peptidase after the proteins are transported to the desired site.

[0159] In some embodiments, the polynucleotide of the invention comprises a nucleotide sequence encoding a CFTR polypeptide, wherein the nucleotide sequence further comprises a 5′ nucleic acid sequence encoding a heterologous signal peptide. 4. Sequence Optimization of Nucleotide Sequence Encoding a CFTR Polypeptide

[0160] The polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention is sequence optimized. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a CFTR polypeptide, optionally, a nucleotide sequence (e.g., an ORF) encoding another polypeptide of interest, a 5′-UTR, a 3′-UTR, the 5′ UTR or 3′ UTR optionally comprising at least one microRNA binding site, optionally a nucleotide sequence encoding a linker, a polyA tail, or any combination thereof), in which the ORF(s) are sequence optimized.

[0161] A sequence-optimized nucleotide sequence, e.g., a codon-optimized mRNA sequence encoding a CFTR polypeptide, is a sequence comprising at least one synonymous nucleobase substitution with respect to a reference sequence.

[0162] A sequence-optimized nucleotide sequence can be partially or completely different in sequence from the reference sequence. For example, a reference sequence encoding polyserine uniformly encoded by UCU codons can be sequence-optimized by having 100% of its nucleobases substituted (for each codon, U in position 1 replaced by A, C in position 2 replaced by G, and U in position 3 replaced by C) to yield a sequence encoding polyserine which would be uniformly encoded by AGC codons. The percentage of sequence identity obtained from a global pairwise alignment between the reference polyserine nucleic acid sequence and the sequence-optimized polyserine nucleic acid sequence would be 0%. However, the protein products from both sequences would be 100% identical.

[0163] Some sequence optimization (also sometimes referred to codon optimization) methods are known in the art (and discussed in more detail below) and can be useful to achieve one or more desired results. These results can include, e.g.,Attorney Docket No.45817-0138WO1 / MTX968.20 matching codon frequencies in certain tissue targets and / or host organisms to ensure proper folding; biasing G / C content to increase mRNA stability or reduce secondary structures; minimizing tandem repeat codons or base runs that can impair gene construction or expression; customizing transcriptional and translational control regions; inserting or removing protein trafficking sequences; removing / adding post translation modification sites in an encoded protein (e.g., glycosylation sites); adding, removing or shuffling protein domains; inserting or deleting restriction sites; modifying ribosome binding sites and mRNA degradation sites; adjusting translational rates to allow the various domains of the protein to fold properly; and / or reducing or eliminating problem secondary structures within the polynucleotide. Sequence optimization tools, algorithms and services are known in the art, non- limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and / or proprietary methods.

[0164] Codon options for each amino acid are given in TABLE 1. TABLE 1. Codon Options Amino Acid Single Letter Codon Options CodeAttorney Docket No.45817-0138WO1 / MTX968.20 Selenocysteine Sec UGA in mRNA in presence of Selenocysteine insertion element (SECIS) A)of the invention comprises a sequence-optimized nucleotide sequence (e.g., an ORF) encoding a CFTR polypeptide, a functional fragment, or a variant thereof, wherein the CFTR polypeptide, functional fragment, or a variant thereof encoded by the sequence- optimized nucleotide sequence has improved properties (e.g., compared to a CFTR polypeptide, functional fragment, or a variant thereof encoded by a reference nucleotide sequence that is not sequence optimized), e.g., improved properties related to expression efficacy after administration in vivo. Such properties include, but are not limited to, improving nucleic acid stability (e.g., mRNA stability), increasing translation efficacy in the target tissue, reducing the number of truncated proteins expressed, improving the folding or prevent misfolding of the expressed proteins, reducing toxicity of the expressed products, reducing cell death caused by the expressed products, increasing and / or decreasing protein aggregation.

[0166] In some embodiments, the sequence-optimized nucleotide sequence (e.g., an ORF) is codon optimized for expression in human subjects, having structural and / or chemical features that avoid one or more of the problems in the art, for example, features which are useful for optimizing formulation and delivery of nucleic acid-based therapeutics while retaining structural and functional integrity; overcoming a threshold of expression; improving expression rates; half-life and / or protein concentrations; optimizing protein localization; and avoiding deleterious bio- responses such as the immune response and / or degradation pathways.

[0167] In some embodiments, the polynucleotides of the invention comprise a nucleotide sequence (e.g., a nucleotide sequence (e.g., an ORF) encoding a CFTR polypeptide, a nucleotide sequence (e.g., an ORF) encoding another polypeptide of interest, a 5′-UTR, a 3′-UTR, a microRNA binding site, a nucleic acid sequence encoding a linker, or any combination thereof) that is sequence-optimized according to a method comprising:Attorney Docket No.45817-0138WO1 / MTX968.20 (i) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a CFTR polypeptide) with an alternative codon to increase or decrease uridine content to generate a uridine-modified sequence; (ii) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a CFTR polypeptide) with an alternative codon having a higher codon frequency in the synonymous codon set; (iii) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a CFTR polypeptide) with an alternative codon to increase G / C content; or (iv) a combination thereof.

[0168] In some embodiments, the sequence-optimized nucleotide sequence (e.g., an ORF encoding a CFTR polypeptide) has at least one improved property with respect to the reference nucleotide sequence.

[0169] In some embodiments, the sequence optimization method is multiparametric and comprises one, two, three, four, or more methods disclosed herein and / or other optimization methods known in the art.

[0170] Features, which can be considered beneficial in some embodiments of the invention, can be encoded by or within regions of the polynucleotide and such regions can be upstream (5′) to, downstream (3′) to, or within the region that encodes the CFTR polypeptide. These regions can be incorporated into the polynucleotide before and / or after sequence-optimization of the protein encoding region or open reading frame (ORF). Examples of such features include, but are not limited to, untranslated regions (UTRs), microRNA sequences, Kozak sequences, oligo(dT) sequences, poly-A tail, and detectable tags and can include multiple cloning sites that can have XbaI recognition.

[0171] In some embodiments, the polynucleotide of the invention comprises a 5′ UTR, a 3′ UTR and / or a microRNA binding site. In some embodiments, the polynucleotide comprises two or more 5′ UTRs and / or 3′ UTRs, which can be the same or different sequences. In some embodiments, the polynucleotide comprises two or more microRNA binding sites, which can be the same or different sequences. Any portion of the 5′ UTR, 3′ UTR, and / or microRNA binding site, including none, can be sequence-optimized and can independently contain one or more different structural or chemical modifications, before and / or after sequence optimization.Attorney Docket No.45817-0138WO1 / MTX968.20

[0172] In some embodiments, after optimization, the polynucleotide is reconstituted and transformed into a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes. For example, the optimized polynucleotide can be reconstituted and transformed into chemically competent E. coli, yeast, neurospora, maize, drosophila, etc. where high copy plasmid-like or chromosome structures occur by methods described herein. 5. Sequence-Optimized Nucleotide Sequences Encoding CFTR Polypeptides

[0173] In some embodiments, the polynucleotide of the invention comprises a sequence-optimized nucleotide sequence encoding a CFTR polypeptide disclosed herein. In some embodiments, the polynucleotide of the invention comprises an open reading frame (ORF) encoding a CFTR polypeptide, wherein the ORF has been sequence optimized.

[0174] An exemplary sequence-optimized nucleotide sequence encoding CFTR GoF2 is set forth as SEQ ID NO:8. An exemplary sequence-optimized nucleotide sequence encoding CFTR GoF1 is set forth as SEQ ID NO:7. In some embodiments, the sequence optimized CFTR sequence, fragment, and variant thereof are used to practice the methods disclosed herein.

[0175] In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a CFTR polypeptide, comprises from 5′ to 3′ end: (i) a 5′ cap provided herein, for example, m7G-ppp-Gm; (ii) a 5′ UTR, such as the sequences provided herein, for example, SEQ ID NO:50; (iii) an open reading frame encoding CFTR GoF2, e.g., a sequence optimized nucleic acid sequence encoding CFTR set forth as SEQ ID NO:8; (iv) at least one stop codon (if not present at 5′ terminus of 3′UTR); (v) a 3′ UTR, such as the sequences provided herein, for example, SEQ ID NO:139; and (vi) a poly-A tail provided above (e.g., A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211)).Attorney Docket No.45817-0138WO1 / MTX968.20 In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a CFTR polypeptide, comprises from 5′ to 3′ end: (i) a 5′ cap provided herein, for example, m7G-ppp-Gm; (ii) a 5′ UTR, such as the sequences provided herein, for example, SEQ ID NO:50; (iii) an open reading frame encoding CFTR GoF1, e.g., a sequence optimized nucleic acid sequence encoding CFTR set forth as SEQ ID NO:7; (iv) at least one stop codon (if not present at 5′ terminus of 3′UTR); (v) a 3′ UTR, such as the sequences provided herein, for example, SEQ ID NO139; and (vi) a poly-A tail provided above (e.g., A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211)). In certain embodiments, all uracils in the polynucleotide are N1-methylpseudouracil (G5). In certain embodiments, all uracils in the polynucleotide are 5-methoxyuracil (G6).

[0176] The sequence-optimized nucleotide sequences disclosed herein are distinct from the corresponding wild type nucleotide acid sequences and from other known sequence-optimized nucleotide sequences, e.g., these sequence-optimized nucleic acids have unique compositional characteristics.

[0177] In some embodiments, the percentage of uracil or thymine nucleobases in a sequence-optimized nucleotide sequence (e.g., encoding a CFTR polypeptide, a functional fragment, or a variant thereof) is modified (e.g., reduced) with respect to the percentage of uracil or thymine nucleobases in the reference wild-type nucleotide sequence. Such a sequence is referred to as a uracil-modified or thymine-modified sequence. The percentage of uracil or thymine content in a nucleotide sequence can be determined by dividing the number of uracils or thymines in a sequence by the total number of nucleotides and multiplying by 100. In some embodiments, the sequence- optimized nucleotide sequence has a lower uracil or thymine content than the uracil or thymine content in the reference wild-type sequence. In some embodiments, the uracil or thymine content in a sequence-optimized nucleotide sequence of the invention is greater than the uracil or thymine content in the reference wild-type sequence and still maintain beneficial effects, e.g., increased expression and / orAttorney Docket No.45817-0138WO1 / MTX968.20 reduced Toll-Like Receptor (TLR) response when compared to the reference wild- type sequence.

[0178] Methods for optimizing codon usage are known in the art. For example, an ORF of any one or more of the sequences provided herein may be codon optimized. Codon optimization, in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove / add post translation modification sites in encoded protein (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the protein to fold properly; or reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art - non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and / or proprietary methods. In some embodiments, the open reading frame (ORF) sequence is optimized using optimization algorithms. 6. Characterization of Sequence Optimized Nucleic Acids

[0179] In some embodiments of the invention, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a sequence optimized nucleic acid disclosed herein encoding a CFTR polypeptide can be tested to determine whether at least one nucleic acid sequence property (e.g., stability when exposed to nucleases) or expression property has been improved with respect to the non-sequence optimized nucleic acid.

[0180] As used herein, "expression property" refers to a property of a nucleic acid sequence either in vivo (e.g., translation efficacy of a synthetic mRNA after administration to a subject in need thereof) or in vitro (e.g., translation efficacy of a synthetic mRNA tested in an in vitro model system). Expression properties include but are not limited to the amount of protein produced by an mRNA encoding a CFTR polypeptide after administration, and the amount of soluble or otherwise functionalAttorney Docket No.45817-0138WO1 / MTX968.20 protein produced. In some embodiments, sequence optimized nucleic acids disclosed herein can be evaluated according to the viability of the cells expressing a protein encoded by a sequence optimized nucleic acid sequence (e.g., a RNA, e.g., an mRNA) encoding a CFTR polypeptide disclosed herein.

[0181] In a given embodiment, a plurality of sequence optimized nucleic acids disclosed herein (e.g., a RNA, e.g., an mRNA) containing codon substitutions with respect to the non-optimized reference nucleic acid sequence can be characterized functionally to measure a property of interest, for example an expression property in an in vitro model system, or in vivo in a target tissue or cell. a. Optimization of Nucleic Acid Sequence Intrinsic Properties

[0182] In some embodiments of the invention, the desired property of the polynucleotide is an intrinsic property of the nucleic acid sequence. For example, the nucleotide sequence (e.g., a RNA, e.g., an mRNA) can be sequence optimized for in vivo or in vitro stability. In some embodiments, the nucleotide sequence can be sequence optimized for expression in a given target tissue or cell. In some embodiments, the nucleic acid sequence is sequence optimized to increase its plasma half-life by preventing its degradation by endo and exonucleases.

[0183] In other embodiments, the nucleic acid sequence is sequence optimized to increase its resistance to hydrolysis in solution, for example, to lengthen the time that the sequence optimized nucleic acid or a pharmaceutical composition comprising the sequence optimized nucleic acid can be stored under aqueous conditions with minimal degradation.

[0184] In other embodiments, the sequence optimized nucleic acid can be optimized to increase its resistance to hydrolysis in dry storage conditions, for example, to lengthen the time that the sequence optimized nucleic acid can be stored after lyophilization with minimal degradation. b. Nucleic Acids Sequence Optimized for Protein Expression

[0185] In some embodiments of the invention, the desired property of the polynucleotide is the level of expression of a CFTR polypeptide encoded by aAttorney Docket No.45817-0138WO1 / MTX968.20 sequence optimized sequence disclosed herein. Protein expression levels can be measured using one or more expression systems. In some embodiments, expression can be measured in cell culture systems, e.g., CHO cells or HEK293 cells. In some embodiments, expression can be measured using in vitro expression systems prepared from extracts of living cells, e.g., rabbit reticulocyte lysates, or in vitro expression systems prepared by assembly of purified individual components. In other embodiments, the protein expression is measured in an in vivo system, e.g., mouse, rabbit, monkey, etc.

[0186] In some embodiments, protein expression in solution form can be desirable. Accordingly, in some embodiments, a reference sequence can be sequence optimized to yield a sequence optimized nucleic acid sequence having optimized levels of expressed proteins in soluble form. Levels of protein expression and other properties such as solubility, levels of aggregation, and the presence of truncation products (i.e., fragments due to proteolysis, hydrolysis, or defective translation) can be measured according to methods known in the art, for example, using electrophoresis (e.g., native or SDS-PAGE) or chromatographic methods (e.g., HPLC, size exclusion chromatography, etc.). c. Optimization of Target Tissue or Target Cell Viability

[0187] In some embodiments, the expression of heterologous therapeutic proteins encoded by a nucleic acid sequence can have deleterious effects in the target tissue or cell, reducing protein yield, or reducing the quality of the expressed product (e.g., due to the presence of protein fragments or precipitation of the expressed protein in inclusion bodies), or causing toxicity.

[0188] Accordingly, in some embodiments of the invention, the sequence optimization of a nucleic acid sequence disclosed herein, e.g., a nucleic acid sequence encoding a CFTR polypeptide, can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid.

[0189] Heterologous protein expression can also be deleterious to cells transfected with a nucleic acid sequence for autologous or heterologous transplantation. Accordingly, in some embodiments of the present disclosure the sequence optimization of a nucleic acid sequence disclosed herein can be used toAttorney Docket No.45817-0138WO1 / MTX968.20 increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid sequence. Changes in cell or tissue viability, toxicity, and other physiological reaction can be measured according to methods known in the art. d. Reduction of Immune and / or Inflammatory Response

[0190] In some cases, the administration of a sequence optimized nucleic acid encoding CFTR polypeptide or a functional fragment thereof can trigger an immune response, which could be caused by (i) the therapeutic agent (e.g., an mRNA encoding a CFTR polypeptide), or (ii) the expression product of such therapeutic agent (e.g., the CFTR polypeptide encoded by the mRNA), or (iv) a combination thereof. Accordingly, in some embodiments of the present disclosure the sequence optimization of nucleic acid sequence (e.g., an mRNA) disclosed herein can be used to decrease an immune or inflammatory response triggered by the administration of a nucleic acid encoding a CFTR polypeptide or by the expression product of CFTR encoded by such nucleic acid.

[0191] In some cases, an inflammatory response can be measured by detecting increased levels of one or more inflammatory cytokines using methods known in the art, e.g., ELISA. The term "inflammatory cytokine" refers to cytokines that are elevated in an inflammatory response. Examples of inflammatory cytokines include interleukin-6 (IL-6), CXCL1 (chemokine (C-X-C motif) ligand 1; also known as GRO ^, interferon- ^ (IFN ^), tumor necrosis factor ^ (TNF ^), interferon ^-induced protein 10 (IP-10), or granulocyte-colony stimulating factor (G-CSF). The term inflammatory cytokines includes also other cytokines associated with inflammatory responses known in the art, e.g., interleukin-1 (IL-1), interleukin-8 (IL-8), interleukin- 12 (IL-12), interleukin-13 (Il-13), interferon α (IFN-α), etc. 7. Modified Nucleotide Sequences Encoding CFTR Polypeptides

[0192] In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a chemically modified nucleobase, for example, a chemically modified uracil, e.g., pseudouracil, N1-methylpseudouracil, 5- methoxyuracil, or the like. In some embodiments, the mRNA is a uracil-modifiedAttorney Docket No.45817-0138WO1 / MTX968.20 sequence comprising an ORF encoding a CFTR polypeptide, wherein the mRNA comprises a chemically modified nucleobase, for example, a chemically modified uracil, e.g., pseudouracil, N1-methylpseudouracil, or 5-methoxyuracil.

[0193] In certain aspects of the invention, when the modified uracil base is connected to a ribose sugar, as it is in polynucleotides, the resulting modified nucleoside or nucleotide is referred to as modified uridine. In some embodiments, uracil in the polynucleotide is at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least 90%, at least 95%, at least 99%, or about 100% modified uracil. In one embodiment, uracil in the polynucleotide is at least 95% modified uracil. In another embodiment, uracil in the polynucleotide is 100% modified uracil.

[0194] In embodiments where uracil in the polynucleotide is at least 95% modified uracil overall uracil content can be adjusted such that an mRNA provides suitable protein expression levels while inducing little to no immune response. In some embodiments, the uracil content of the ORF is between about 100% and about 150%, between about 100% and about 110%, between about 105% and about 115%, between about 110% and about 120%, between about 115% and about 125%, between about 120% and about 130%, between about 125% and about 135%, between about 130% and about 140%, between about 135% and about 145%, between about 140% and about 150% of the theoretical minimum uracil content in the corresponding wild- type ORF (%UTM). In other embodiments, the uracil content of the ORF is between about 121% and about 136% or between 123% and 134% of the %UTM. In some embodiments, the uracil content of the ORF encoding a CFTR polypeptide is about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, or about 150% of the %UTM. In this context, the term "uracil" can refer to modified uracil and / or naturally occurring uracil.

[0195] In some embodiments, the uracil content in the ORF of the mRNA encoding a CFTR polypeptide of the invention is less than about 30%, about 25%, about 20%, about 15%, or about 10% of the total nucleobase content in the ORF. In some embodiments, the uracil content in the ORF is between about 10% and about 20% of the total nucleobase content in the ORF. In other embodiments, the uracil content in the ORF is between about 10% and about 25% of the total nucleobaseAttorney Docket No.45817-0138WO1 / MTX968.20 content in the ORF. In one embodiment, the uracil content in the ORF of the mRNA encoding a CFTR polypeptide is less than about 20% of the total nucleobase content in the open reading frame. In this context, the term "uracil" can refer to modified uracil and / or naturally occurring uracil.

[0196] In further embodiments, the ORF of the mRNA encoding a CFTR polypeptide having modified uracil and adjusted uracil content has increased Cytosine (C), Guanine (G), or Guanine / Cytosine (G / C) content (absolute or relative). In some embodiments, the overall increase in C, G, or G / C content (absolute or relative) of the ORF is at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 10%, at least about 15%, at least about 20%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% relative to the G / C content (absolute or relative) of the wild-type ORF. In some embodiments, the G, the C, or the G / C content in the ORF is less than about 100%, less than about 90%, less than about 85%, or less than about 80% of the theoretical maximum G, C, or G / C content of the corresponding wild type nucleotide sequence encoding the CFTR polypeptide (%GTMX; %CTMX, or %G / CTMX). In some embodiments, the increases in G and / or C content (absolute or relative) described herein can be conducted by replacing synonymous codons with low G, C, or G / C content with synonymous codons having higher G, C, or G / C content. In other embodiments, the increase in G and / or C content (absolute or relative) is conducted by replacing a codon ending with U with a synonymous codon ending with G or C.

[0197] In further embodiments, the ORF of the mRNA encoding a CFTR polypeptide of the invention comprises modified uracil and has an adjusted uracil content containing less uracil pairs (UU) and / or uracil triplets (UUU) and / or uracil quadruplets (UUUU) than the corresponding wild-type nucleotide sequence encoding the CFTR polypeptide. In some embodiments, the ORF of the mRNA encoding a CFTR polypeptide of the invention contains no uracil pairs and / or uracil triplets and / or uracil quadruplets. In some embodiments, uracil pairs and / or uracil triplets and / or uracil quadruplets are reduced below a certain threshold, e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 occurrences in the ORF of the mRNA encoding the CFTR polypeptide. In a particular embodiment, theAttorney Docket No.45817-0138WO1 / MTX968.20 ORF of the mRNA encoding the CFTR polypeptide of the invention contains less than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 non- phenylalanine uracil pairs and / or triplets. In another embodiment, the ORF of the mRNA encoding the CFTR polypeptide contains no non-phenylalanine uracil pairs and / or triplets.

[0198] In further embodiments, the ORF of the mRNA encoding a CFTR polypeptide of the invention comprises modified uracil and has an adjusted uracil content containing less uracil-rich clusters than the corresponding wild-type nucleotide sequence encoding the CFTR polypeptide. In some embodiments, the ORF of the mRNA encoding the CFTR polypeptide of the invention contains uracil-rich clusters that are shorter in length than corresponding uracil-rich clusters in the corresponding wild-type nucleotide sequence encoding the CFTR polypeptide.

[0199] In further embodiments, alternative lower frequency codons are employed. At least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% of the codons in the CFTR polypeptide–encoding ORF of the modified uracil-comprising mRNA are substituted with alternative codons, each alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set. The ORF also has adjusted uracil content, as described above. In some embodiments, at least one codon in the ORF of the mRNA encoding the CFTR polypeptide is substituted with an alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set.

[0200] In some embodiments, the adjusted uracil content, CFTR polypeptide- encoding ORF of the modified uracil-comprising mRNA exhibits expression levels of CFTR when administered to a mammalian cell that are higher than expression levels of CFTR from the corresponding wild-type mRNA. In some embodiments, the mammalian cell is a mouse cell, a rat cell, or a rabbit cell. In other embodiments, the mammalian cell is a monkey cell or a human cell. In some embodiments, the human cell is a HeLa cell, a BJ fibroblast cell, or a peripheral blood mononuclear cellAttorney Docket No.45817-0138WO1 / MTX968.20 (PBMC). In some embodiments, CFTR is expressed at a level higher than expression levels of CFTR from the corresponding wild-type mRNA when the mRNA is administered to a mammalian cell in vivo. In some embodiments, the mRNA is administered to mice, rabbits, rats, monkeys, or humans. In one embodiment, mice are null mice. In some embodiments, the mRNA is administered to mice in an amount of about 0.01 mg / kg, about 0.05 mg / kg, about 0.1 mg / kg, or 0.2 mg / kg or about 0.5 mg / kg. In some embodiments, the mRNA is administered intravenously or intramuscularly. In other embodiments, the CFTR polypeptide is expressed when the mRNA is administered to a mammalian cell in vitro. In some embodiments, the expression is increased by at least about 2-fold, at least about 5-fold, at least about 10- fold, at least about 50-fold, at least about 500-fold, at least about 1500-fold, or at least about 3000-fold. In other embodiments, the expression is increased by at least about 10%, about 20%, about 30%, about 40%, about 50%, 60%, about 70%, about 80%, about 90%, or about 100%.

[0201] In some embodiments, adjusted uracil content, CFTR polypeptide- encoding ORF of the modified uracil-comprising mRNA exhibits increased stability. In some embodiments, the mRNA exhibits increased stability in a cell relative to the stability of a corresponding wild-type mRNA under the same conditions. In some embodiments, the mRNA exhibits increased stability including resistance to nucleases, thermal stability, and / or increased stabilization of secondary structure. In some embodiments, increased stability exhibited by the mRNA is measured by determining the half-life of the mRNA (e.g., in a plasma, serum, cell, or tissue sample) and / or determining the area under the curve (AUC) of the protein expression by the mRNA over time (e.g., in vitro or in vivo). An mRNA is identified as having increased stability if the half-life and / or the AUC is greater than the half-life and / or the AUC of a corresponding wild-type mRNA under the same conditions.

[0202] In some embodiments, the mRNA of the present invention induces a detectably lower immune response (e.g., innate or acquired) relative to the immune response induced by a corresponding wild-type mRNA under the same conditions. In other embodiments, the mRNA of the present disclosure induces a detectably lower immune response (e.g., innate or acquired) relative to the immune response induced by an mRNA that encodes for a CFTR polypeptide but does not comprise modifiedAttorney Docket No.45817-0138WO1 / MTX968.20 uracil under the same conditions, or relative to the immune response induced by an mRNA that encodes for a CFTR polypeptide and that comprises modified uracil but that does not have adjusted uracil content under the same conditions. The innate immune response can be manifested by increased expression of pro-inflammatory cytokines, activation of intracellular PRRs (RIG-I, MDA5, etc), cell death, and / or termination or reduction in protein translation. In some embodiments, a reduction in the innate immune response can be measured by expression or activity level of Type 1 interferons (e.g., IFN-α, IFN-β, IFN-κ, IFN-δ, IFN-ε, IFN-τ, IFN-ω, and IFN-ζ) or the expression of interferon-regulated genes such as the toll-like receptors (e.g., TLR7 and TLR8), and / or by decreased cell death following one or more administrations of the mRNA of the invention into a cell.

[0203] In some embodiments, the expression of Type-1 interferons by a mammalian cell in response to the mRNA of the present disclosure is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9%, or greater than 99.9% relative to a corresponding wild-type mRNA, to an mRNA that encodes a CFTR polypeptide but does not comprise modified uracil, or to an mRNA that encodes a CFTR polypeptide and that comprises modified uracil but that does not have adjusted uracil content. In some embodiments, the interferon is IFN-β. In some embodiments, cell death frequency caused by administration of mRNA of the present disclosure to a mammalian cell is 10%, 25%, 50%, 75%, 85%, 90%, 95%, or over 95% less than the cell death frequency observed with a corresponding wild-type mRNA, an mRNA that encodes for a CFTR polypeptide but does not comprise modified uracil, or an mRNA that encodes for a CFTR polypeptide and that comprises modified uracil but that does not have adjusted uracil content. In some embodiments, the mammalian cell is a BJ fibroblast cell. In other embodiments, the mammalian cell is a splenocyte. In some embodiments, the mammalian cell is that of a mouse or a rat. In other embodiments, the mammalian cell is that of a human. In one embodiment, the mRNA of the present disclosure does not substantially induce an innate immune response of a mammalian cell into which the mRNA is introduced. 8. Methods for Modifying PolynucleotidesAttorney Docket No.45817-0138WO1 / MTX968.20

[0204] The disclosure includes modified polynucleotides comprising a polynucleotide described herein (e.g., a polynucleotide, e.g. mRNA, comprising a nucleotide sequence encoding a CFTR polypeptide). The modified polynucleotides can be chemically modified and / or structurally modified. When the polynucleotides of the present invention are chemically and / or structurally modified the polynucleotides can be referred to as "modified polynucleotides."

[0205] The present disclosure provides for modified nucleosides and nucleotides of a polynucleotide (e.g., RNA polynucleotides, such as mRNA polynucleotides) encoding a CFTR polypeptide. A "nucleoside" refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase"). A “nucleotide" refers to a nucleoside including a phosphate group. Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides.

[0206] The modified polynucleotides disclosed herein can comprise various distinct modifications. In some embodiments, the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, a modified polynucleotide, introduced to a cell can exhibit one or more desirable properties, e.g., improved protein expression, reduced immunogenicity, or reduced degradation in the cell, as compared to an unmodified polynucleotide.

[0207] In some embodiments, a polynucleotide of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide) is structurally modified. As used herein, a "structural" modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, structural modifications are of a chemical nature andAttorney Docket No.45817-0138WO1 / MTX968.20 hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G". The same polynucleotide can be structurally modified from "ATCG" to "ATCCCG". Here, the dinucleotide "CC" has been inserted, resulting in a structural modification to the polynucleotide.

[0208] Therapeutic compositions of the present disclosure comprise, in some embodiments, at least one nucleic acid (e.g., RNA) having an open reading frame encoding CFTR GoF2 (e.g., SEQ ID NO:8), wherein the nucleic acid comprises nucleotides and / or nucleosides that can be standard (unmodified) or modified as is known in the art. In some embodiments, nucleotides and nucleosides of the present disclosure comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally-occurring modified nucleotides and nucleosides or non-naturally occurring modified nucleotides and nucleosides. Such modifications can include those at the sugar, backbone, or nucleobase portion of the nucleotide and / or nucleoside as are recognized in the art.

[0209] In some embodiments, a naturally-occurring modified nucleotide or nucleotide of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the widely recognized MODOMICS database.

[0210] In some embodiments, a non-naturally occurring modified nucleotide or nucleoside of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides can be found, inter alia, in published US application Nos. PCT / US2012 / 058519; PCT / US2013 / 075177; PCT / US2014 / 058897; PCT / US2014 / 058891; PCT / US2014 / 070413; PCT / US2015 / 36773; PCT / US2015 / 36759; PCT / US2015 / 36771; or PCT / IB2017 / 051367 all of which are incorporated by reference herein.

[0211] In some embodiments, at least one RNA (e.g., mRNA) of the present disclosure is not chemically modified and comprises the standard ribonucleotides consisting of adenosine, guanosine, cytosine and uridine. In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those present in transcribed RNA (e.g. A, G, C, or U). In someAttorney Docket No.45817-0138WO1 / MTX968.20 embodiments, nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those present in DNA (e.g. dA, dG, dC, or dT).

[0212] Hence, nucleic acids of the disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids) can comprise standard nucleotides and nucleosides, naturally-occurring nucleotides and nucleosides, non-naturally- occurring nucleotides and nucleosides, or any combination thereof.

[0213] Nucleic acids of the disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids), in some embodiments, comprise various (more than one) different types of standard and / or modified nucleotides and nucleosides. In some embodiments, a particular region of a nucleic acid contains one, two or more (optionally different) types of standard and / or modified nucleotides and nucleosides.

[0214] In some embodiments, a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid), introduced to a cell or organism, exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.

[0215] In some embodiments, a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid), introduced into a cell or organism, may exhibit reduced immunogenicity in the cell or organism, respectively (e.g., a reduced innate response) relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.

[0216] Nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids), in some embodiments, comprise non-natural modified nucleotides that are introduced during synthesis or post-synthesis of the nucleic acids to achieve desired functions or properties. The modifications may be present on internucleotide linkages, purine or pyrimidine bases, or sugars. The modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a nucleic acid may be chemically modified.

[0217] The present disclosure provides for modified nucleosides and nucleotides of a nucleic acid (e.g., RNA nucleic acids, such as mRNA nucleic acids). A “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine orAttorney Docket No.45817-0138WO1 / MTX968.20 pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). A “nucleotide” refers to a nucleoside, including a phosphate group. Modified nucleotides may by synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non- natural nucleosides. Nucleic acids can comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acids would comprise regions of nucleotides.

[0218] Modified nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides comprising non- standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures, such as, for example, in those nucleic acids having at least one chemical modification. One example of such non-standard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of base / sugar or linker may be incorporated into nucleic acids of the present disclosure.

[0219] In some embodiments, modified nucleobases in nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) comprise N1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (ψ). In some embodiments, modified nucleobases in nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) comprise 5- methoxymethyl uridine, 5-methylthio uridine, 1-methoxymethyl pseudouridine, 5- methyl cytidine, and / or 5-methoxy cytidine. In some embodiments, the polyribonucleotide includes a combination of at least two (e.g., 2, 3, 4 or more) of any of the aforementioned modified nucleobases, including but not limited to chemical modifications.

[0220] In some embodiments, a RNA nucleic acid of the disclosure comprises N1-methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions of the nucleic acid.Attorney Docket No.45817-0138WO1 / MTX968.20

[0221] In some embodiments, a RNA nucleic acid of the disclosure comprises N1-methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.

[0222] In some embodiments, a RNA nucleic acid of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions of the nucleic acid.

[0223] In some embodiments, a RNA nucleic acid of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.

[0224] In some embodiments, a RNA nucleic acid of the disclosure comprises uridine at one or more or all uridine positions of the nucleic acid.

[0225] In some embodiments, nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a nucleic acid can be uniformly modified with N1-methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with N1-methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above.

[0226] The nucleic acids of the present disclosure may be partially or fully modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) may be uniformly modified in a nucleic acid of the disclosure, or in a predetermined sequence region thereof (e.g., in the mRNA including or excluding the polyA tail). In some embodiments, all nucleotides X in a nucleic acid of the present disclosure (or in a sequence region thereof) are modified nucleotides, wherein X may be any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.

[0227] The nucleic acid may contain from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one orAttorney Docket No.45817-0138WO1 / MTX968.20 more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of unmodified A, G, U, or C.

[0228] The nucleic acids may contain at a minimum 1% and at maximum 100% modified nucleotides, or any intervening percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the nucleic acids may contain a modified pyrimidine such as a modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the nucleic acid is replaced with a modified uracil (e.g., a 5-substituted uracil). The modified uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the nucleic acid is replaced with a modified cytosine (e.g., a 5-substituted cytosine). The modified cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). 9. Untranslated Regions (UTRs)Attorney Docket No.45817-0138WO1 / MTX968.20

[0229] Untranslated regions (UTRs) are nucleic acid sections of a polynucleotide before a start codon (5′ UTR) and after a stop codon (3′ UTR) that are not translated. In some embodiments, a polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of the invention comprising an open reading frame (ORF) encoding a CFTR polypeptide further comprises UTR (e.g., a 5′ UTR or functional fragment thereof, a 3′ UTR or functional fragment thereof, or a combination thereof).

[0230] A UTR (e.g., 5′ UTR or 3′ UTR) can be homologous or heterologous to the coding region in a polynucleotide. In some embodiments, the UTR is homologous to the ORF encoding the CFTR polypeptide. In some embodiments, the UTR is heterologous to the ORF encoding the CFTR polypeptide.

[0231] In some embodiments, the polynucleotide comprises two or more 5′ UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences. In some embodiments, the polynucleotide comprises two or more 3′ UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences.

[0232] In some embodiments, the 5′ UTR or functional fragment thereof, 3′ UTR or functional fragment thereof, or any combination thereof is sequence optimized.

[0233] In some embodiments, the 5′UTR or functional fragment thereof, 3′ UTR or functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, e.g., N1-methylpseudouracil or 5- methoxyuracil.

[0234] UTRs can have features that provide a regulatory role, e.g., increased or decreased stability, localization and / or translation efficiency. A polynucleotide comprising a UTR can be administered to a cell, tissue, or organism, and one or more regulatory features can be measured using routine methods. In some embodiments, a functional fragment of a 5′ UTR or 3′ UTR comprises one or more regulatory features of a full length 5′ or 3′ UTR, respectively.

[0235] Natural 5′UTRs bear features that play roles in translation initiation. They harbor signatures like Kozak sequences that are commonly known to be involved in the process by which the ribosome initiates translation of many genes.Attorney Docket No.45817-0138WO1 / MTX968.20 Kozak sequences have the consensus CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another ‘G’.5′ UTRs also have been known to form secondary structures that are involved in elongation factor binding.

[0236] By engineering the features typically found in abundantly expressed genes of specific target organs, one can enhance the stability and protein production of a polynucleotide. For example, introduction of 5′ UTR of liver-expressed mRNA, such as albumin, serum amyloid A, Apolipoprotein A / B / E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII, can enhance expression of polynucleotides in hepatic cell lines or liver. Likewise, use of 5′UTR from other tissue-specific mRNA to improve expression in that tissue is possible for muscle (e.g., MyoD, Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells (e.g., Tie-1, CD36), for myeloid cells (e.g., C / EBP, AML1, G-CSF, GM-CSF, CD11b, MSR, Fr-1, i-NOS), for leukocytes (e.g., CD45, CD18), for adipose tissue (e.g., CD36, GLUT4, ACRP30, adiponectin) and for lung epithelial cells (e.g., SP-A / B / C / D).

[0237] In some embodiments, UTRs are selected from a family of transcripts whose proteins share a common function, structure, feature or property. For example, an encoded polypeptide can belong to a family of proteins (i.e., that share at least one function, structure, feature, localization, origin, or expression pattern), which are expressed in a particular cell, tissue or at some time during development. The UTRs from any of the genes or mRNA can be swapped for any other UTR of the same or different family of proteins to create a new polynucleotide.

[0238] In some embodiments, the 5′ UTR and the 3′ UTR can be heterologous. In some embodiments, the 5′ UTR can be derived from a different species than the 3′ UTR. In some embodiments, the 3′ UTR can be derived from a different species than the 5′ UTR.

[0239] Co-owned International Patent Application No. PCT / US2014 / 021522 (Publ. No. WO / 2014 / 164253, incorporated herein by reference in its entirety) provides a listing of exemplary UTRs that can be utilized in the polynucleotide of the present invention as flanking regions to an ORF.

[0240] Additional exemplary UTRs of the application include, but are not limited to, one or more 5′UTR and / or 3′UTR derived from the nucleic acid sequenceAttorney Docket No.45817-0138WO1 / MTX968.20 of: a globin, such as an α- or β-globin (e.g., a Xenopus, mouse, rabbit, or human globin); a strong Kozak translational initiation signal; a CYBA (e.g., human cytochrome b-245 α polypeptide); an albumin (e.g., human albumin7); a HSD17B4 (hydroxysteroid (17-β) dehydrogenase); a virus (e.g., a tobacco etch virus (TEV), a Venezuelan equine encephalitis virus (VEEV), a Dengue virus, a cytomegalovirus (CMV) (e.g., CMV immediate early 1 (IE1)), a hepatitis virus (e.g., hepatitis B virus), a sindbis virus, or a PAV barley yellow dwarf virus); a heat shock protein (e.g., hsp70); a translation initiation factor (e.g., elF4G); a glucose transporter (e.g., hGLUT1 (human glucose transporter 1)); an actin (e.g., human α or β actin); a GAPDH; a tubulin; a histone; a citric acid cycle enzyme; a topoisomerase (e.g., a 5′UTR of a TOP gene lacking the 5′ TOP motif (the oligopyrimidine tract)); a ribosomal protein Large 32 (L32); a ribosomal protein (e.g., human or mouse ribosomal protein, such as, for example, rps9); an ATP synthase (e.g., ATP5A1 or the β subunit of mitochondrial H+-ATP synthase); a growth hormone e (e.g., bovine (bGH) or human (hGH)); an elongation factor (e.g., elongation factor 1 α1 (EEF1A1)); a manganese superoxide dismutase (MnSOD); a myocyte enhancer factor 2A (MEF2A); a β-F1-ATPase, a creatine kinase, a myoglobin, a granulocyte-colony stimulating factor (G-CSF); a collagen (e.g., collagen type I, alpha 2 (Col1A2), collagen type I, alpha 1 (Col1A1), collagen type VI, alpha 2 (Col6A2), collagen type VI, alpha 1 (Col6A1)); a ribophorin (e.g., ribophorin I (RPNI)); a low density lipoprotein receptor-related protein (e.g., LRP1); a cardiotrophin-like cytokine factor (e.g., Nnt1); calreticulin (Calr); a procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (Plod1); and a nucleobindin (e.g., Nucb1).

[0241] In some embodiments, the 5′ UTR is selected from the group consisting of a β-globin 5′ UTR; a 5′UTR containing a strong Kozak translational initiation signal; a cytochrome b-245 α polypeptide (CYBA) 5′ UTR; a hydroxysteroid (17-β) dehydrogenase (HSD17B4) 5′ UTR; a Tobacco etch virus (TEV) 5′ UTR; a Venezuelen equine encephalitis virus (TEEV) 5′ UTR; a 5′ proximal open reading frame of rubella virus (RV) RNA encoding nonstructural proteins; a Dengue virus (DEN) 5′ UTR; a heat shock protein 70 (Hsp70) 5′ UTR; a eIF4G 5′ UTR; a GLUT15′ UTR; functional fragments thereof and any combination thereof.Attorney Docket No.45817-0138WO1 / MTX968.20

[0242] In some embodiments, the 3′ UTR is selected from the group consisting of a β-globin 3′ UTR; a CYBA 3′ UTR; an albumin 3′ UTR; a growth hormone (GH) 3′ UTR; a VEEV 3′ UTR; a hepatitis B virus (HBV) 3′ UTR; α-globin 3′UTR; a DEN 3′ UTR; a PAV barley yellow dwarf virus (BYDV-PAV) 3′ UTR; an elongation factor 1 α1 (EEF1A1) 3′ UTR; a manganese superoxide dismutase (MnSOD) 3′ UTR; a β subunit of mitochondrial H(+)-ATP synthase (β-mRNA) 3′ UTR; a GLUT13′ UTR; a MEF2A 3′ UTR; a β-F1-ATPase 3′ UTR; functional fragments thereof and combinations thereof.

[0243] Wild-type UTRs derived from any gene or mRNA can be incorporated into the polynucleotides of the invention. In some embodiments, a UTR can be altered relative to a wild type or native UTR to produce a variant UTR, e.g., by changing the orientation or location of the UTR relative to the ORF; or by inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. In some embodiments, variants of 5′ or 3′ UTRs can be utilized, for example, mutants of wild type UTRs, or variants wherein one or more nucleotides are added to or removed from a terminus of the UTR.

[0244] Additionally, one or more synthetic UTRs can be used in combination with one or more non-synthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc.2013 8(3):568-82, the contents of which are incorporated herein by reference in their entirety.

[0245] UTRs or portions thereof can be placed in the same orientation as in the transcript from which they were selected or can be altered in orientation or location. Hence, a 5′ and / or 3′ UTR can be inverted, shortened, lengthened, or combined with one or more other 5′ UTRs or 3′ UTRs.

[0246] In some embodiments, the polynucleotide comprises multiple UTRs, e.g., a double, a triple or a quadruple 5′ UTR or 3′ UTR. For example, a double UTR comprises two copies of the same UTR either in series or substantially in series. For example, a double beta-globin 3′UTR can be used (see US2010 / 0129877, the contents of which are incorporated herein by reference in its entirety).

[0247] The polynucleotides of the invention can comprise combinations of features. For example, the ORF can be flanked by a 5′UTR that comprises a strong Kozak translational initiation signal and / or a 3′UTR comprising an oligo(dT)Attorney Docket No.45817-0138WO1 / MTX968.20 sequence for templated addition of a poly-A tail. A 5′UTR can comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different UTRs (see, e.g., US2010 / 0293625, herein incorporated by reference in its entirety).

[0248] Other non-UTR sequences can be used as regions or subregions within the polynucleotides of the invention. For example, introns or portions of intron sequences can be incorporated into the polynucleotides of the invention. Incorporation of intronic sequences can increase protein production as well as polynucleotide expression levels. In some embodiments, the polynucleotide of the invention comprises an internal ribosome entry site (IRES) instead of or in addition to a UTR (see, e.g., Yakubov et al., Biochem. Biophys. Res. Commun.2010394(1):189-193, the contents of which are incorporated herein by reference in their entirety). In some embodiments, the polynucleotide comprises an IRES instead of a 5′ UTR sequence. In some embodiments, the polynucleotide comprises an ORF and a viral capsid sequence. In some embodiments, the polynucleotide comprises a synthetic 5′ UTR in combination with a non-synthetic 3′ UTR.

[0249] In some embodiments, the UTR can also include at least one translation enhancer polynucleotide, translation enhancer element, or translational enhancer elements (collectively, "TEE," which refers to nucleic acid sequences that increase the amount of polypeptide or protein produced from a polynucleotide. As a non-limiting example, the TEE can be located between the transcription promoter and the start codon. In some embodiments, the 5′ UTR comprises a TEE.

[0250] In one aspect, a TEE is a conserved element in a UTR that can promote translational activity of a nucleic acid such as, but not limited to, cap-dependent or cap-independent translation. a.5′ UTR sequences

[0251] 5′ UTR sequences are important for ribosome recruitment to the mRNA and have been reported to play a role in translation (Hinnebusch A, et al., (2016) Science, 352:6292: 1413-6).

[0252] Disclosed herein, inter alia, is a polynucleotide, e.g., mRNA, comprising an open reading frame encoding a CFTR polypeptide (e.g., SEQ ID NO:2Attorney Docket No.45817-0138WO1 / MTX968.20 or SEQ ID NO:3) which polynucleotide has a 5′ UTR that confers an increased half- life, increased expression and / or increased activity of the polypeptide encoded by said polynucleotide, or of the polynucleotide itself. In an embodiment, a polynucleotide disclosed herein comprises: (a) a 5′-UTR (e.g., as provided in Table 2 or a variant or fragment thereof); (b) a coding region comprising a stop element (e.g., as described herein); and (c) a 3′-UTR (e.g., as described herein), and LNP compositions comprising the same. In an embodiment, the polynucleotide comprises a 5′-UTR comprising a sequence provided in Table 2 or a variant or fragment thereof (e.g., a functional variant or fragment thereof). In an embodiment, the polynucleotide comprises a 5′-UTR comprising the sequence of SEQ ID NO:50. In an embodiment, the polynucleotide comprises a 5′-UTR comprising the sequence of SEQ ID NO:139.

[0253] In an embodiment, the polynucleotide having a 5′ UTR sequence provided in Table 2 or a variant or fragment thereof, has an increase in the half-life of the polynucleotide, e.g., about 1.5-20-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20-fold, or more. In an embodiment, the increase in half life is about 1.5-fold or more. In an embodiment, the increase in half life is about 2-fold or more. In an embodiment, the increase in half life is about 3-fold or more. In an embodiment, the increase in half life is about 4-fold or more. In an embodiment, the increase in half life is about 5-fold or more.

[0254] In an embodiment, the polynucleotide having a 5′ UTR sequence provided in Table 2 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the 5′UTR results in about 1.5-20-fold increase in level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase in level and / or activity is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20-fold, or more. In an embodiment, the increase in level and / or activity is about 1.5-fold or more. In an embodiment, the increase in level and / or activity is about 2-fold or more. In an embodiment, the increase in level and / or activity is about 3-fold or more. In an embodiment, the increase in level and / or activity is about 4-fold or more. In an embodiment, the increase in level and / or activity is about 5-fold or more.Attorney Docket No.45817-0138WO1 / MTX968.20

[0255] In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 5′ UTR, has a different 5′ UTR, or does not have a 5′ UTR described in Table 2 or a variant or fragment thereof. In an embodiment, the increase in half-life of the polynucleotide is measured according to an assay that measures the half-life of a polynucleotide.

[0256] In an embodiment, the increase in level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide is measured according to an assay that measures the level and / or activity of a polypeptide.

[0257] In an embodiment, the 5′ UTR comprises a sequence provided in Table 2 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 5′ UTR sequence provided in Table 2, or a variant or a fragment thereof. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57 or SEQ ID NO: 58.

[0258] In an embodiment, a 5′ UTR sequence provided in Table 2 has a first nucleotide which is an A. In an embodiment, a 5′ UTR sequence provided in Table 2 has a first nucleotide which is a G. Table 2: 5′ UTR sequences SEQ ID Sequence Sequence AAU U A C AAttorney Docket No.45817-0138WO1 / MTX968.20 SEQ ID Sequence Sequence NO: name G C UAA A C A C n inAttorney Docket No.45817-0138WO1 / MTX968.20 SEQ ID Sequence Sequence NO: name GGGGUGCCGUAAGAAttorney Docket No.45817-0138WO1 / MTX968.20 SEQ ID Sequence Sequence NO: name AGAA AA0. In an embodiment, the variant of SEQ ID NO: 50 comprises a nucleic acid sequence of Formula A: G G A A A U C G C A A A A (N2)X(N3)XC U (N4)X(N5)XC G C G U U A G A U U U C U U U U A G U U U U C U N6 N7 C A A C U A G C A A G C U U U U U G U U C U C G C C (N8C C)x (SEQ ID NO: 59), wherein: (N2)xis a uracil and x is an integer from 0 to 5, e.g., wherein x =3 or 4; (N3)x is a guanine and x is an integer from 0 to 1; (N4)xis a cytosine and x is an integer from 0 to 1; (N5)x is a uracil and x is an integer from 0 to 5, e.g., wherein x =2 or 3; N6 is a uracil or cytosine; N7 is a uracil or guanine; N8 is adenine or guanine and x is an integer from 0 to 1.Attorney Docket No.45817-0138WO1 / MTX968.20

[0260] In an embodiment (N2)x is a uracil and x is 0. In an embodiment (N2)x is a uracil and x is 1. In an embodiment (N2)xis a uracil and x is 2. In an embodiment (N2)x is a uracil and x is 3. In an embodiment, (N2)x is a uracil and x is 4. In an embodiment (N2)xis a uracil and x is 5. In an embodiment, (N3)x is a guanine and x is 0. In an embodiment, (N3)x is a guanine and x is 1.

[0261] In an embodiment, (N4)x is a cytosine and x is 0. In an embodiment, (N4)x is a cytosine and x is 1.

[0262] In an embodiment (N5)x is a uracil and x is 0. In an embodiment (N5)x is a uracil and x is 1. In an embodiment (N5)x is a uracil and x is 2. In an embodiment (N5)xis a uracil and x is 3. In an embodiment, (N5)xis a uracil and x is 4. In an embodiment (N5)x is a uracil and x is 5.

[0263] In an embodiment, N6is a uracil. In an embodiment, N6is a cytosine.

[0264] In an embodiment, N7 is a uracil. In an embodiment, N7 is a guanine.

[0265] In an embodiment, N8is an adenine and x is 0. In an embodiment, N8is an adenine and x is 1.

[0266] In an embodiment, N8is a guanine and x is 0. In an embodiment, N8is a guanine and x is 1.

[0267] In an embodiment, the 5′ UTR comprises a variant of SEQ ID NO:50. In an embodiment, the variant of SEQ ID NO: 50 comprises a sequence with at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 50. In an embodiment, the variant of SEQ ID NO: 50 comprises a sequence with at least 50% identity to SEQ ID NO: 50. In an embodiment, the variant of SEQ ID NO: 50 comprises a sequence with at least 60% identity to SEQ ID NO: 50. In an embodiment, the variant of SEQ ID NO: 50 comprises a sequence with at least 70% identity to SEQ ID NO: 50. In an embodiment, the variant of SEQ ID NO: 50 comprises a sequence with at least 80% identity to SEQ ID NO: 50. In an embodiment, the variant of SEQ ID NO: 50 comprises a sequence with at least 90% identity to SEQ ID NO:50. In an embodiment, the variant of SEQ ID NO:50 comprises a sequence with at least 95% identity to SEQ ID NO:50. In an embodiment, the variant of SEQ ID NO:50 comprises a sequence with at least 96% identity to SEQ ID NO:50. In an embodiment, the variant of SEQ ID NO:50 comprises a sequenceAttorney Docket No.45817-0138WO1 / MTX968.20 with at least 97% identity to SEQ ID NO:50. In an embodiment, the variant of SEQ ID NO:50 comprises a sequence with at least 98% identity to SEQ ID NO:50. In an embodiment, the variant of SEQ ID NO:50 comprises a sequence with at least 99% identity to SEQ ID NO:50.

[0268] In an embodiment, the variant of SEQ ID NO:50 comprises a uridine content of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80%. In an embodiment, the variant of SEQ ID NO:50 comprises a uridine content of at least 5%. In an embodiment, the variant of SEQ ID NO:50 comprises a uridine content of at least 10%. In an embodiment, the variant of SEQ ID NO:50 comprises a uridine content of at least 20%. In an embodiment, the variant of SEQ ID NO:50 comprises a uridine content of at least 30%. In an embodiment, the variant of SEQ ID NO:50 comprises a uridine content of at least 40%. In an embodiment, the variant of SEQ ID NO:50 comprises a uridine content of at least 50%. In an embodiment, the variant of SEQ ID NO:50 comprises a uridine content of at least 60%. In an embodiment, the variant of SEQ ID NO:50 comprises a uridine content of at least 70%. In an embodiment, the variant of SEQ ID NO:50 comprises a uridine content of at least 80%.

[0269] In an embodiment, the variant of SEQ ID NO:50 comprises at least 2, 3, 4, 5, 6 or 7 consecutive uridines (e.g., a polyuridine tract). In an embodiment, the polyuridine tract in the variant of SEQ ID NO:50 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In an embodiment, the polyuridine tract in the variant of SEQ ID NO:50 comprises 4 consecutive uridines. In an embodiment, the polyuridine tract in the variant of SEQ ID NO:50 comprises 5 consecutive uridines.

[0270] In an embodiment, the variant of SEQ ID NO:64 comprises at least 2, 3, 4, 5, 6 or 7 consecutive uridines (e.g., a polyuridine tract). In an embodiment, the polyuridine tract in the variant of SEQ ID NO:64 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In an embodiment, the polyuridine tract in the variant of SEQ ID NO:64 comprises 4 consecutive uridines. In an embodiment, the polyuridine tract in the variant of SEQ ID NO:64 comprises 5 consecutive uridines.Attorney Docket No.45817-0138WO1 / MTX968.20

[0271] In an embodiment, the variant of SEQ ID NO:50 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 polyuridine tracts. In an embodiment, the variant of SEQ ID NO:50 comprises 3 polyuridine tracts. In an embodiment, the variant of SEQ ID NO:50 comprises 4 polyuridine tracts. In an embodiment, the variant of SEQ ID NO:50 comprises 5 polyuridine tracts.

[0272] In an embodiment, one or more of the polyuridine tracts are adjacent to a different polyuridine tract. In an embodiment, each of, e.g., all, the polyuridine tracts are adjacent to each other, e.g., all of the polyuridine tracts are contiguous.

[0273] In an embodiment, one or more of the polyuridine tracts are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18.19, 20, 30, 40, 50 or 60 nucleotides. In an embodiment, each of, e.g., all of, the polyuridine tracts are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18.19, 20, 30, 40, 50 or 60 nucleotides.

[0274] In an embodiment, a first polyuridine tract and a second polyuridine tract are adjacent to each other.

[0275] In an embodiment, a subsequent, e.g., third, fourth, fifth, sixth or seventh, eighth, ninth, or tenth, polyuridine tract is separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18.19, 20, 30, 40, 50 or 60 nucleotides from the first polyuridine tract, the second polyuridine tract, or any one of the subsequent polyuridine tracts.

[0276] In an embodiment, a first polyuridine tract is separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18.19, 20, 30, 40, 50 or 60 nucleotides from a subsequent polyuridine tract, e.g., a second, third, fourth, fifth, sixth or seventh, eighth, ninth, or tenth polyuridine tract. In an embodiment, one or more of the subsequent polyuridine tracts are adjacent to a different polyuridine tract.

[0277] In an embodiment, the 5′ UTR comprises a Kozak sequence, e.g., a GCCRCC nucleotide sequence, wherein R is an adenine or guanine. In an embodiment, the Kozak sequence is disposed at the 3′ end of the 5′UTR sequence.

[0278] In an aspect, the polynucleotide (e.g., mRNA) comprising an open reading frame encoding a CFTR polypeptide and comprising a 5′ UTR sequence disclosed herein is formulated as an LNP. In an embodiment, the LNP compositionAttorney Docket No.45817-0138WO1 / MTX968.20 comprises: (i) an ionizable lipid, e.g., an amino lipid; (ii) a sterol or other structural lipid; (iii) a non-cationic helper lipid or phospholipid; and (iv) a PEG-lipid.

[0279] In another aspect, the LNP compositions of the disclosure are used in a method of treating CF in a subject.

[0280] In an aspect, an LNP composition comprising a polynucleotide disclosed herein encoding a CFTR polypeptide, e.g., as described herein, can be administered with an additional agent, e.g., as described herein. b.3′ UTR sequences

[0281] 3′UTR sequences have been shown to influence translation, half-life, and subcellular localization of mRNAs (Mayr C., Cold Spring Harb Persp Biol 2019 Oct 1;11(10):a034728).

[0282] Disclosed herein, inter alia, is a polynucleotide, e.g., mRNA, comprising an open reading frame encoding a CFTR polypeptide (e.g., SEQ ID NO:2 or SEQ ID NO:3) which polynucleotide has a 3′ UTR that confers an increased half- life, increased expression and / or increased activity of the polypeptide encoded by said polynucleotide, or of the polynucleotide itself. In an embodiment, a polynucleotide disclosed herein comprises: (a) a 5′-UTR (e.g., as described herein); (b) a coding region comprising a stop element (e.g., as described herein); and (c) a 3′-UTR (e.g., as provided in Table 3 or a variant or fragment thereof), and LNP compositions comprising the same. In an embodiment, the polynucleotide comprises a 3′-UTR comprising a sequence provided in Table 3 or a variant or fragment thereof.

[0283] In some embodiments, disclosed herein is a polynucleotide, e.g., mRNA, comprising an ORF encoding a CFTR polypeptide and a 3′ UTR comprising the nucleic acid sequence of SEQ ID NO:139.

[0284] In an embodiment, the polynucleotide having a 3′ UTR sequence provided in Table 3 or a variant or fragment thereof, results in an increased half-life of the polynucleotide, e.g., about 1.5-10-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, or more. In an embodiment, the increase in half-life is about 1.5-fold or more. In an embodiment, the increase in half-life is about 2-fold or more. In an embodiment, the increase in half-life is about 3-fold or more. In an embodiment, theAttorney Docket No.45817-0138WO1 / MTX968.20 increase in half-life is about 4-fold or more. In an embodiment, the increase in half- life is about 5-fold or more. In an embodiment, the increase in half-life is about 6-fold or more. In an embodiment, the increase in half-life is about 7-fold or more. In an embodiment, the increase in half-life is about 8-fold. In an embodiment, the increase in half-life is about 9-fold or more. In an embodiment, the increase in half-life is about 10-fold or more.

[0285] In an embodiment, the polynucleotide having a 3′ UTR sequence provided in Table 3 or a variant or fragment thereof, results in a polynucleotide with a mean half-life score of greater than 10.

[0286] In an embodiment, the polynucleotide having a 3′ UTR sequence provided in Table 3 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide.

[0287] In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 3′ UTR, has a different 3′ UTR, or does not have a 3′ UTR of Table 3 or a variant or fragment thereof.

[0288] In an embodiment, the polynucleotide comprises a 3′ UTR sequence provided in Table 3 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3′ UTR sequence provided in Table 3, or a fragment thereof. In an embodiment, the 3′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, or SEQ ID NO:115.

[0289] In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 100, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 100. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 101, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 101. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 102, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 102. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 103, or a sequenceAttorney Docket No.45817-0138WO1 / MTX968.20 with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 103. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 104, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 104. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 105, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 105. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 106, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 106. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 107, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 107. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 108, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 108. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 109, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 109. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 110, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 110. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 111, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 111. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 112, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 112. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 113, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 113. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 114, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 114. In an embodiment, the 3′ UTR comprises the sequence of SEQ ID NO: 115, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 115. Table 3: 3′ UTR sequencesAttorney Docket No.45817-0138WO1 / MTX968.20 SEQ Sequence Sequence ID information C U G U G G U A G G C G G A G A A G G C GAttorney Docket No.45817-0138WO1 / MTX968.20 SEQ Sequence Sequence ID information C C G C C G C C U C C U C C C C C U G C U GAttorney Docket No.45817-0138WO1 / MTX968.20 SEQ Sequence Sequence ID information G A U C GUA G U C U G U C C U C C U U U C CAttorney Docket No.45817-0138WO1 / MTX968.20 SEQ Sequence Sequence ID information U U U U U U U U G U G G A A G C A C G C U CAttorney Docket No.45817-0138WO1 / MTX968.20 SEQ Sequence Sequence ID information C U Gbinding site, e.g., as described herein, which binds to a miR present in a human cell. In an embodiment, the 3′ UTR comprises a miRNA binding site of SEQ ID NO: 212, SEQ ID NO: 174, SEQ ID NO: 152 or a combination thereof. In an embodiment, the 3′ UTR comprises a plurality of miRNA binding sites, e.g., 2, 3, 4, 5, 6, 7 or 8 miRNA binding sites. In an embodiment, the plurality of miRNA binding sites comprises the same or different miRNA binding sites. miR122 bs = CAAACACCAUUGUCACACUCCA (SEQ ID NO: 212) miR-142-3p bs = UCCAUAAAGUAGGAAACACUACA (SEQ ID NO: 174) miR-126 bs = CGCAUUAUUACUCACGGUACGA (SEQ ID NO: 152)

[0291] In an aspect, disclosed herein is a polynucleotide encoding a polypeptide, wherein the polynucleotide comprises: (a) a 5′-UTR, e.g., as described herein; (b) a coding region comprising a stop element (e.g., as described herein); and (c) a 3′-UTR (e.g., as described herein).

[0292] In an aspect, an LNP composition comprising a polynucleotide comprising an open reading frame encoding a CFTR polypeptide (e.g., SEQ ID NO:2 or SEQ ID NO:3) and comprising a 3′ UTR disclosed herein comprises: (i) an ionizable lipid, e.g., an amino lipid; (ii) a sterol or other structural lipid; (iii) a non- cationic helper lipid or phospholipid; and (iv) a PEG-lipid.

[0293] In another aspect, the LNP compositions of the disclosure are used in a method of treating CF in a subject.

[0294] In an aspect, an LNP composition comprising a polynucleotide disclosed herein encoding a CFTR polypeptide, e.g., as described herein, can be administered with an additional agent, e.g., as described herein.Attorney Docket No.45817-0138WO1 / MTX968.20 10. MicroRNA (miRNA) Binding Sites

[0295] Polynucleotides of the invention can include regulatory elements, for example, microRNA (miRNA) binding sites, transcription factor binding sites, structured mRNA sequences and / or motifs, artificial binding sites engineered to act as pseudo-receptors for endogenous nucleic acid binding molecules, and combinations thereof. In some embodiments, polynucleotides including such regulatory elements are referred to as including “sensor sequences”.

[0296] In some embodiments, a polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of the invention comprises an open reading frame (ORF) encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). Inclusion or incorporation of miRNA binding site(s) provides for regulation of polynucleotides of the invention, and in turn, of the polypeptides encoded therefrom, based on tissue-specific and / or cell-type specific expression of naturally-occurring miRNAs.

[0297] The present invention also provides pharmaceutical compositions and formulations that comprise any of the polynucleotides described above. In some embodiments, the composition or formulation further comprises a delivery agent.

[0298] In some embodiments, the composition or formulation can contain a polynucleotide comprising a sequence optimized nucleic acid sequence disclosed herein which encodes a polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a polynucleotide (e.g., an ORF) having significant sequence identity to a sequence optimized nucleic acid sequence disclosed herein which encodes a polypeptide. In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds

[0299] A miRNA, e.g., a natural-occurring miRNA, is a 19-25 nucleotide long noncoding RNA that binds to a polynucleotide and down-regulates gene expression either by reducing stability or by inhibiting translation of the polynucleotide. A miRNA sequence comprises a “seed” region, i.e., a sequence in the region ofAttorney Docket No.45817-0138WO1 / MTX968.20 positions 2-8 of the mature miRNA. A miRNA seed can comprise positions 2-8 or 2- 7 of the mature miRNA.

[0300] microRNAs derive enzymatically from regions of RNA transcripts that fold back on themselves to form short hairpin structures often termed a pre-miRNA (precursor-miRNA). A pre-miRNA typically has a two-nucleotide overhang at its 3′ end, and has 3′ hydroxyl and 5′ phosphate groups. This precursor-mRNA is processed in the nucleus and subsequently transported to the cytoplasm where it is further processed by DICER (a RNase III enzyme), to form a mature microRNA of approximately 22 nucleotides. The mature microRNA is then incorporated into a ribonuclear particle to form the RNA-induced silencing complex, RISC, which mediates gene silencing. Art-recognized nomenclature for mature miRNAs typically designates the arm of the pre-miRNA from which the mature miRNA derives; "5p" means the microRNA is from the 5 prime arm of the pre-miRNA hairpin and "3p" means the microRNA is from the 3 prime end of the pre-miRNA hairpin. A miR referred to by number herein can refer to either of the two mature microRNAs originating from opposite arms of the same pre-miRNA (e.g., either the 3p or 5p microRNA). All miRs referred to herein are intended to include both the 3p and 5p arms / sequences, unless particularly specified by the 3p or 5p designation.

[0301] As used herein, the term “microRNA (miRNA or miR) binding site” refers to a sequence within a polynucleotide, e.g., within a DNA or within an RNA transcript, including in the 5′UTR and / or 3′UTR, that has sufficient complementarity to all or a region of a miRNA to interact with, associate with or bind to the miRNA. In some embodiments, a polynucleotide of the invention comprising an ORF encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). In exemplary embodiments, a 5′ UTR and / or 3′ UTR of the polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) comprises the one or more miRNA binding site(s).

[0302] A miRNA binding site having sufficient complementarity to a miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated regulation of a polynucleotide, e.g., miRNA-mediated translational repression or degradation of the polynucleotide. In exemplary aspects of the invention, a miRNA binding site having sufficient complementarity to the miRNA refers to a degree ofAttorney Docket No.45817-0138WO1 / MTX968.20 complementarity sufficient to facilitate miRNA-mediated degradation of the polynucleotide, e.g., miRNA-guided RNA-induced silencing complex (RISC)- mediated cleavage of mRNA. The miRNA binding site can have complementarity to, for example, a 19-25 nucleotide long miRNA sequence, to a 19-23 nucleotide long miRNA sequence, or to a 22 nucleotide long miRNA sequence. A miRNA binding site can be complementary to only a portion of a miRNA, e.g., to a portion less than 1, 2, 3, or 4 nucleotides of the full length of a naturally-occurring miRNA sequence, or to a portion less than 1, 2, 3, or 4 nucleotides shorter than a naturally-occurring miRNA sequence. Full or complete complementarity (e.g., full complementarity or complete complementarity over all or a significant portion of the length of a naturally- occurring miRNA) is preferred when the desired regulation is mRNA degradation.

[0303] In some embodiments, a miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with an miRNA seed sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA seed sequence. In some embodiments, a miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with an miRNA sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA sequence. In other embodiments, the sequence is not completely complementary. In some embodiments, a miRNA binding site has complete complementarity with a miRNA sequence but for 1, 2, or 3 nucleotide substitutions, terminal additions, and / or truncations.

[0304] In some embodiments, the miRNA binding site is the same length as the corresponding miRNA. In other embodiments, the miRNA binding site is one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve nucleotide(s) shorter than the corresponding miRNA at the 5′ terminus, the 3′ terminus, or both. In still other embodiments, the microRNA binding site is two nucleotides shorter than the corresponding microRNA at the 5′ terminus, the 3′ terminus, or both. The miRNA binding sites that are shorter than the corresponding miRNAs are still capable of degrading the mRNA incorporating one or more of the miRNA binding sites or preventing the mRNA from translation.Attorney Docket No.45817-0138WO1 / MTX968.20

[0305] In some embodiments, the miRNA binding site binds the corresponding mature miRNA that is part of an active RISC containing Dicer. In another embodiment, binding of the miRNA binding site to the corresponding miRNA in RISC degrades the mRNA containing the miRNA binding site or prevents the mRNA from being translated. In some embodiments, the miRNA binding site has sufficient complementarity to miRNA so that a RISC complex comprising the miRNA cleaves the polynucleotide comprising the miRNA binding site. In other embodiments, the miRNA binding site has imperfect complementarity so that a RISC complex comprising the miRNA induces instability in the polynucleotide comprising the miRNA binding site. In another embodiment, the miRNA binding site has imperfect complementarity so that a RISC complex comprising the miRNA represses transcription of the polynucleotide comprising the miRNA binding site.

[0306] In some embodiments, the miRNA binding site has one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve mismatch(es) from the corresponding miRNA.

[0307] In some embodiments, the miRNA binding site has at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty- one contiguous nucleotides complementary to at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one, respectively, contiguous nucleotides of the corresponding miRNA.

[0308] By engineering one or more miRNA binding sites into a polynucleotide of the invention, the polynucleotide can be targeted for degradation or reduced translation, provided the miRNA in question is available. This can reduce off-target effects upon delivery of the polynucleotide. For example, if a polynucleotide of the invention is not intended to be delivered to a tissue or cell but ends up is said tissue or cell, then a miRNA abundant in the tissue or cell can inhibit the expression of the gene of interest if one or multiple binding sites of the miRNA are engineered into the 5′ UTR and / or 3′ UTR of the polynucleotide. Thus, in someAttorney Docket No.45817-0138WO1 / MTX968.20 embodiments, incorporation of one or more miRNA binding sites into an mRNA of the disclosure may reduce the hazard of off-target effects upon nucleic acid molecule delivery and / or enable tissue-specific regulation of expression of a polypeptide encoded by the mRNA. In yet other embodiments, incorporation of one or more miRNA binding sites into an mRNA of the disclosure can modulate immune responses upon nucleic acid delivery in vivo. In further embodiments, incorporation of one or more miRNA binding sites into an mRNA of the disclosure can modulate accelerated blood clearance (ABC) of lipid-comprising compounds and compositions described herein.

[0309] Conversely, miRNA binding sites can be removed from polynucleotide sequences in which they naturally occur to increase protein expression in specific tissues. For example, a binding site for a specific miRNA can be removed from a polynucleotide to improve protein expression in tissues or cells containing the miRNA.

[0310] Regulation of expression in multiple tissues can be accomplished through introduction or removal of one or more miRNA binding sites, e.g., one or more distinct miRNA binding sites. The decision whether to remove or insert a miRNA binding site can be made based on miRNA expression patterns and / or their profilings in tissues and / or cells in development and / or disease. Identification of miRNAs, miRNA binding sites, and their expression patterns and role in biology have been reported (e.g., Bonauer et al., Curr Drug Targets 201011:943-949; Anand and Cheresh Curr Opin Hematol 201118:171-176; Contreras and Rao Leukemia 2012 26:404-413 (2011 Dec 20. doi: 10.1038 / leu.2011.356); Bartel Cell 2009136:215-233; Landgraf et al, Cell, 2007129:1401-1414; Gentner and Naldini, Tissue Antigens. 201280:393-403 and all references therein; each of which is incorporated herein by reference in its entirety).

[0311] Examples of tissues where miRNA are known to regulate mRNA, and thereby protein expression, include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), myeloid cells (miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-1d, miR-149), kidney (miR-192, miR-194, miR- 204), and lung epithelial cells (let-7, miR-133, miR-126).Attorney Docket No.45817-0138WO1 / MTX968.20

[0312] Specifically, miRNAs are known to be differentially expressed in immune cells (also called hematopoietic cells), such as antigen presenting cells (APCs) (e.g., dendritic cells and macrophages), macrophages, monocytes, B lymphocytes, T lymphocytes, granulocytes, natural killer cells, etc. Immune cell specific miRNAs are involved in immunogenicity, autoimmunity, the immune- response to infection, inflammation, as well as unwanted immune response after gene therapy and tissue / organ transplantation. Immune cells specific miRNAs also regulate many aspects of development, proliferation, differentiation and apoptosis of hematopoietic cells (immune cells). For example, miR-142 and miR-146 are exclusively expressed in immune cells, particularly abundant in myeloid dendritic cells. It has been demonstrated that the immune response to a polynucleotide can be shut-off by adding miR-142 binding sites to the 3′-UTR of the polynucleotide, enabling more stable gene transfer in tissues and cells. miR-142 efficiently degrades exogenous polynucleotides in antigen presenting cells and suppresses cytotoxic elimination of transduced cells (e.g., Annoni A et al., blood, 2009, 114, 5152-5161; Brown BD, et al., Nat med.2006, 12(5), 585-591; Brown BD, et al., blood, 2007, 110(13): 4144-4152, each of which is incorporated herein by reference in its entirety).

[0313] An antigen-mediated immune response can refer to an immune response triggered by foreign antigens, which, when entering an organism, are processed by the antigen presenting cells and displayed on the surface of the antigen presenting cells. T cells can recognize the presented antigen and induce a cytotoxic elimination of cells that express the antigen.

[0314] Introducing one or more (e.g., one, two, or three) miR-142 binding sites into the 5′ UTR and / or 3′UTR of a polynucleotide of the invention can selectively repress gene expression in antigen presenting cells through miR-142 mediated degradation, limiting antigen presentation in antigen presenting cells (e.g., dendritic cells) and thereby preventing antigen-mediated immune response after the delivery of the polynucleotide. The polynucleotide is then stably expressed in target tissues or cells without triggering cytotoxic elimination.

[0315] In some embodiments, it may be beneficial to target the same cell type with multiple miRs and to incorporate binding sites to each of the 3p and 5p arm if both are abundant (e.g., both miR-142-3p and miR142-5p are abundant inAttorney Docket No.45817-0138WO1 / MTX968.20 hematopoietic stem cells). Thus, in certain embodiments, polynucleotides of the invention contain two or more (e.g., two, three, four or more) miR bindings sites from: (i) the group consisting of miR-142, miR-144, miR-150, miR-155 and miR-223 (which are expressed in many hematopoietic cells); or (ii) the group consisting of miR-142, miR150, miR-16 and miR-223 (which are expressed in B cells); or the group consisting of miR-223, miR-451, miR-26a, miR-16 (which are expressed in progenitor hematopoietic cells).

[0316] In some embodiments, it may also be beneficial to combine various miRs such that multiple cell types of interest are targeted at the same time (e.g., miR- 142 and miR-126 to target many cells of the hematopoietic lineage and endothelial cells). Thus, for example, in certain embodiments, polynucleotides of the invention comprise two or more (e.g., two, three, four or more) miRNA bindings sites, wherein: (i) at least one of the miRs targets cells of the hematopoietic lineage (e.g., miR-142, miR-144, miR-150, miR-155 or miR-223) and at least one of the miRs targets plasmacytoid dendritic cells, platelets or endothelial cells (e.g., miR-126); or (ii) at least one of the miRs targets B cells (e.g., miR-142, miR150, miR-16 or miR-223) and at least one of the miRs targets plasmacytoid dendritic cells, platelets or endothelial cells (e.g., miR-126); or (iii) at least one of the miRs targets progenitor hematopoietic cells (e.g., miR-223, miR-451, miR-26a or miR-16) and at least one of the miRs targets plasmacytoid dendritic cells, platelets or endothelial cells (e.g., miR- 126); or (iv) at least one of the miRs targets cells of the hematopoietic lineage (e.g., miR-142, miR-144, miR-150, miR-155 or miR-223), at least one of the miRs targets B cells (e.g., miR-142, miR150, miR-16 or miR-223) and at least one of the miRs targets plasmacytoid dendritic cells, platelets or endothelial cells (e.g., miR-126); or any other possible combination of the foregoing four classes of miR binding sites (i.e., those targeting the hematopoietic lineage, those targeting B cells, those targeting progenitor hematopoietic cells and / or those targeting plasmacytoid dendritic cells / platelets / endothelial cells).

[0317] In one embodiment, to modulate immune responses, polynucleotides of the present invention can comprise one or more miRNA binding sequences that bind to one or more miRs that are expressed in conventional immune cells or any cell that expresses TLR7 and / or TLR8 and secrete pro-inflammatory cytokines and / orAttorney Docket No.45817-0138WO1 / MTX968.20 chemokines (e.g., in immune cells of peripheral lymphoid organs and / or splenocytes and / or endothelial cells). It has now been discovered that incorporation into an mRNA of one or more miRs that are expressed in conventional immune cells or any cell that expresses TLR7 and / or TLR8 and secrete pro-inflammatory cytokines and / or chemokines (e.g., in immune cells of peripheral lymphoid organs and / or splenocytes and / or endothelial cells) reduces or inhibits immune cell activation (e.g., B cell activation, as measured by frequency of activated B cells) and / or cytokine production (e.g., production of IL-6, IFN- ^ and / or TNF ^). Furthermore, it has now been discovered that incorporation into an mRNA of one or more miRs that are expressed in conventional immune cells or any cell that expresses TLR7 and / or TLR8 and secrete pro-inflammatory cytokines and / or chemokines (e.g., in immune cells of peripheral lymphoid organs and / or splenocytes and / or endothelial cells) can reduce or inhibit an anti-drug antibody (ADA) response against a protein of interest encoded by the mRNA.

[0318] In another embodiment, to modulate accelerated blood clearance of a polynucleotide delivered in a lipid-comprising compound or composition, polynucleotides of the invention can comprise one or more miR binding sequences that bind to one or more miRNAs expressed in conventional immune cells or any cell that expresses TLR7 and / or TLR8 and secrete pro-inflammatory cytokines and / or chemokines (e.g., in immune cells of peripheral lymphoid organs and / or splenocytes and / or endothelial cells). It has now been discovered that incorporation into an mRNA of one or more miR binding sites reduces or inhibits accelerated blood clearance (ABC) of the lipid-comprising compound or composition for use in delivering the mRNA. Furthermore, it has now been discovered that incorporation of one or more miR binding sites into an mRNA reduces serum levels of anti-PEG anti- IgM (e.g., reduces or inhibits the acute production of IgMs that recognize polyethylene glycol (PEG) by B cells) and / or reduces or inhibits proliferation and / or activation of plasmacytoid dendritic cells following administration of a lipid- comprising compound or composition comprising the mRNA.

[0319] In some embodiments, miR sequences may correspond to any known microRNA expressed in immune cells, including but not limited to those taught in US Publication US2005 / 0261218 and US Publication US2005 / 0059005, the contents ofAttorney Docket No.45817-0138WO1 / MTX968.20 which are incorporated herein by reference in their entirety. Non-limiting examples of miRs expressed in immune cells include those expressed in spleen cells, myeloid cells, dendritic cells, plasmacytoid dendritic cells, B cells, T cells and / or macrophages. For example, miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24 and miR-27 are expressed in myeloid cells, miR-155 is expressed in dendritic cells, B cells and T cells, miR-146 is upregulated in macrophages upon TLR stimulation and miR-126 is expressed in plasmacytoid dendritic cells. In certain embodiments, the miR(s) is expressed abundantly or preferentially in immune cells. For example, miR-142 (miR-142-3p and / or miR-142-5p), miR-126 (miR-126-3p and / or miR-126-5p), miR-146 (miR-146-3p and / or miR-146-5p) and miR-155 (miR- 155-3p and / or miR155-5p) are expressed abundantly in immune cells. These microRNA sequences are known in the art and, thus, one of ordinary skill in the art can readily design binding sequences or target sequences to which these microRNAs will bind based upon Watson-Crick complementarity.

[0320] In one embodiment, the polynucleotide of the invention comprises three copies of the same miRNA binding site. In certain embodiments, use of three copies of the same miR binding site can exhibit beneficial properties as compared to use of a single miRNA binding site.

[0321] In another embodiment, the polynucleotide of the invention comprises two or more (e.g., two, three, four) copies of at least two different miR binding sites expressed in immune cells.

[0322] In another embodiment, the polynucleotide of the invention comprises at least two miR binding sites for microRNAs expressed in immune cells, wherein one of the miR binding sites is for miR-142-3p. In various embodiments, the polynucleotide of the invention comprises binding sites for miR-142-3p and miR-155 (miR-155-3p or miR-155-5p), miR-142-3p and miR-146 (miR-146-3 or miR-146-5p), or miR-142-3p and miR-126 (miR-126-3p or miR-126-5p).

[0323] In another embodiment, the polynucleotide of the invention comprises at least two miR binding sites for microRNAs expressed in immune cells, wherein one of the miR binding sites is for miR-126-3p. In various embodiments, the polynucleotide of the invention comprises binding sites for miR-126-3p and miR-155Attorney Docket No.45817-0138WO1 / MTX968.20 (miR-155-3p or miR-155-5p), miR-126-3p and miR-146 (miR-146-3p or miR-146- 5p), or miR-126-3p and miR-142 (miR-142-3p or miR-142-5p).

[0324] In another embodiment, the polynucleotide of the invention comprises at least two miR binding sites for microRNAs expressed in immune cells, wherein one of the miR binding sites is for miR-142-5p. In various embodiments, the polynucleotide of the invention comprises binding sites for miR-142-5p and miR-155 (miR-155-3p or miR-155-5p), miR-142-5p and miR-146 (miR-146-3 or miR-146-5p), or miR-142-5p and miR-126 (miR-126-3p or miR-126-5p).

[0325] In yet another embodiment, the polynucleotide of the invention comprises at least two miR binding sites for microRNAs expressed in immune cells, wherein one of the miR binding sites is for miR-155-5p. In various embodiments, the polynucleotide of the invention comprises binding sites for miR-155-5p and miR-142 (miR-142-3p or miR-142-5p), miR-155-5p and miR-146 (miR-146-3 or miR-146-5p), or miR-155-5p and miR-126 (miR-126-3p or miR-126-5p).

[0326] In some embodiments, a polynucleotide of the invention comprises a miRNA binding site, wherein the miRNA binding site comprises one or more nucleotide sequences selected from Table 4, including one or more copies of any one or more of the miRNA binding site sequences. In some embodiments, a polynucleotide of the invention further comprises at least one, two, three, four, five, six, seven, eight, nine, ten, or more of the same or different miRNA binding sites selected from Table 4, including any combination thereof.

[0327] In some embodiments, the miRNA binding site binds to miR-142 or is complementary to miR-142. In some embodiments, the miR-142 comprises SEQ ID NO:172. In some embodiments, the miRNA binding site binds to miR-142-3p or miR-142-5p. In some embodiments, the miR-142-3p binding site comprises SEQ ID NO:174. In some embodiments, the miR-142-5p binding site comprises SEQ ID NO:210. In some embodiments, the miRNA binding site comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO:174 or SEQ ID NO:210.

[0328] In some embodiments, the miRNA binding site binds to miR-126 or is complementary to miR-126. In some embodiments, the miR-126 comprises SEQ ID NO: 150. In some embodiments, the miRNA binding site binds to miR-126-3p orAttorney Docket No.45817-0138WO1 / MTX968.20 miR-126-5p. In some embodiments, the miR-126-3p binding site comprises SEQ ID NO: 152. In some embodiments, the miR-126-5p binding site comprises SEQ ID NO: 154. In some embodiments, the miRNA binding site comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO: 152 or SEQ ID NO: 154.

[0329] In one embodiment, the 3′ UTR comprises two miRNA binding sites, wherein a first miRNA binding site binds to miR-142 and a second miRNA binding site binds to miR-126. TABLE 4. miR-142, miR-126, and miR-142 and miR-126 binding sites SEQ ID NO. Description Sequence GACAGUGCAGUCACCCAUAAAGUAGAAAGCA C A A

[0330] In some embodiments, a miRNA binding site is inserted in the polynucleotide of the invention in any position of the polynucleotide (e.g., the 3′ UTR). In some embodiments, the 3′ UTR comprises a miRNA binding site. The insertion site in the polynucleotide can be anywhere in the polynucleotide as long as the insertion of the miRNA binding site in the polynucleotide does not interfere with the translation of a functional polypeptide in the absence of the corresponding miRNA; and in the presence of the miRNA, the insertion of the miRNA binding site in the polynucleotide and the binding of the miRNA binding site to the corresponding miRNA are capable of degrading the polynucleotide or preventing the translation of the polynucleotide.Attorney Docket No.45817-0138WO1 / MTX968.20

[0331] In some embodiments, a miRNA binding site is inserted in at least about 30 nucleotides downstream from the stop codon of an ORF in a polynucleotide of the invention comprising the ORF. In some embodiments, a miRNA binding site is inserted in at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about 100 nucleotides downstream from the stop codon of an ORF in a polynucleotide of the invention. In some embodiments, a miRNA binding site is inserted in about 10 nucleotides to about 100 nucleotides, about 20 nucleotides to about 90 nucleotides, about 30 nucleotides to about 80 nucleotides, about 40 nucleotides to about 70 nucleotides, about 50 nucleotides to about 60 nucleotides, about 45 nucleotides to about 65 nucleotides downstream from the stop codon of an ORF in a polynucleotide of the invention.

[0332] In some embodiments, a miRNA binding site is inserted within the 3′ UTR immediately following the stop codon of the coding region within the polynucleotide of the invention, e.g., mRNA. In some embodiments, if there are multiple copies of a stop codon in the construct, a miRNA binding site is inserted immediately following the final stop codon. In some embodiments, a miRNA binding site is inserted further downstream of the stop codon, in which case there are 3′ UTR bases between the stop codon and the miR binding site(s).

[0333] In one embodiment, a codon optimized open reading frame encoding a polypeptide of interest comprises a stop codon and the at least one microRNA binding site is located within the 3′ UTR 1-100 nucleotides after the stop codon. In one embodiment, the codon optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 3′ UTR 30-50 nucleotides after the stop codon. In another embodiment, the codon optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 3′Attorney Docket No.45817-0138WO1 / MTX968.20 UTR at least 50 nucleotides after the stop codon. In other embodiments, the codon optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 3′ UTR immediately after the stop codon, or within the 3′ UTR 15-20 nucleotides after the stop codon or within the 3′ UTR 70-80 nucleotides after the stop codon. In other embodiments, the 3′ UTR comprises more than one miRNA binding site (e.g., 2-4 miRNA binding sites), wherein there can be a spacer region (e.g., of 10-100, 20-70 or 30-50 nucleotides in length) between each miRNA binding site. In another embodiment, the 3′ UTR comprises a spacer region between the end of the miRNA binding site(s) and the poly A tail nucleotides. For example, a spacer region of 10-100, 20-70 or 30-50 nucleotides in length can be situated between the end of the miRNA binding site(s) and the beginning of the poly A tail.

[0334] In one embodiment, the 3′ UTR comprises more than one stop codon, wherein at least one miRNA binding site is positioned downstream of the stop codons. For example, a 3′ UTR can comprise 1, 2 or 3 stop codons. Non-limiting examples of triple stop codons that can be used include: UGAUAAUAG, UGAUAGUAA, UAAUGAUAG, UGAUAAUAA, UGAUAGUAG, UAAUGAUGA, UAAUAGUAG, UGAUGAUGA, UAAUAAUAA, and UAGUAGUAG. Within a 3′ UTR, for example, 1, 2, 3 or 4 miRNA binding sites, e.g., miR-142-3p binding sites, can be positioned immediately adjacent to the stop codon(s) or at any number of nucleotides downstream of the final stop codon. When the 3′ UTR comprises multiple miRNA binding sites, these binding sites can be positioned directly next to each other in the construct (i.e., one after the other) or, alternatively, spacer nucleotides can be positioned between each binding site.

[0335] In one embodiment, the 3′ UTR comprises three stop codons with a single miR-142-3p binding site located downstream of the 3rd stop codon.

[0336] In one embodiment, the polynucleotide of the invention comprises a 5′ UTR comprising the nucleotide sequence of SEQ ID NO:58, a codon optimized open reading frame encoding CFTR, a 3′ UTR comprising the at least one miRNA binding site for a miR expressed in immune cells, and a 3′ tailing region of linked nucleosides. In various embodiments, the 3′ UTR comprises 1-4, at least two, one, two, three orAttorney Docket No.45817-0138WO1 / MTX968.20 four miRNA binding sites for miRs expressed in immune cells, preferably abundantly or preferentially expressed in immune cells.

[0337] In one embodiment, the at least one miRNA expressed in immune cells is a miR-142-3p microRNA binding site. In one embodiment, the miR-142-3p microRNA binding site comprises the sequence shown in SEQ ID NO:174.

[0338] In one embodiment, the at least one miRNA expressed in immune cells is a miR-126 microRNA binding site. In one embodiment, the miR-126 binding site is a miR-126-3p binding site. In one embodiment, the miR-126-3p microRNA binding site comprises the sequence shown in SEQ ID NO:152.

[0339] Non-limiting exemplary sequences for miRs to which a microRNA binding site(s) of the disclosure can bind include the following: miR-142-3p (SEQ ID NO:173), miR-142-5p (SEQ ID NO:175), miR-146-3p (SEQ ID NO:155), miR-146- 5p (SEQ ID NO:156), miR-155-3p (SEQ ID NO:157), miR-155-5p (SEQ ID NO:158), miR-126-3p (SEQ ID NO:151), miR-126-5p (SEQ ID NO:153), miR-16-3p (SEQ ID NO:159), miR-16-5p (SEQ ID NO:160), miR-21-3p (SEQ ID NO:161), miR-21-5p (SEQ ID NO:162), miR-223-3p (SEQ ID NO:163), miR-223-5p (SEQ ID NO:164), miR-24-3p (SEQ ID NO:165), miR-24-5p (SEQ ID NO:166), miR-27-3p (SEQ ID NO:167) and miR-27-5p (SEQ ID NO:168). Other suitable miR sequences expressed in immune cells (e.g., abundantly or preferentially expressed in immune cells) are known and available in the art, for example at the University of Manchester’s microRNA database, miRBase. Sites that bind any of the aforementioned miRs can be designed based on Watson-Crick complementarity to the miR, typically 100% complementarity to the miR, and inserted into an mRNA construct of the disclosure as described herein.

[0340] In another embodiment, a polynucleotide of the present invention (e.g., and mRNA, e.g., the 3′ UTR thereof) can comprise at least one miRNA binding site to thereby reduce or inhibit accelerated blood clearance, for example by reducing or inhibiting production of IgMs, e.g., against PEG, by B cells and / or reducing or inhibiting proliferation and / or activation of pDCs, and can comprise at least one miRNA binding site for modulating tissue expression of an encoded protein of interest.Attorney Docket No.45817-0138WO1 / MTX968.20

[0341] miRNA gene regulation can be influenced by the sequence surrounding the miRNA such as, but not limited to, the species of the surrounding sequence, the type of sequence (e.g., heterologous, homologous, exogenous, endogenous, or artificial), regulatory elements in the surrounding sequence and / or structural elements in the surrounding sequence. The miRNA can be influenced by the 5′UTR and / or 3′UTR. As a non-limiting example, a non-human 3′UTR can increase the regulatory effect of the miRNA sequence on the expression of a polypeptide of interest compared to a human 3′ UTR of the same sequence type.

[0342] In one embodiment, other regulatory elements and / or structural elements of the 5′ UTR can influence miRNA mediated gene regulation. One example of a regulatory element and / or structural element is a structured IRES (Internal Ribosome Entry Site) in the 5′ UTR, which is necessary for the binding of translational elongation factors to initiate protein translation. EIF4A2 binding to this secondarily structured element in the 5′-UTR is necessary for miRNA mediated gene expression (Meijer HA et al., Science, 2013, 340, 82-85, herein incorporated by reference in its entirety). The polynucleotides of the invention can further include this structured 5′ UTR in order to enhance microRNA mediated gene regulation.

[0343] At least one miRNA binding site can be engineered into the 3′ UTR of a polynucleotide of the invention. In this context, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more miRNA binding sites can be engineered into a 3′ UTR of a polynucleotide of the invention. For example, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 miRNA binding sites can be engineered into the 3′UTR of a polynucleotide of the invention. In one embodiment, miRNA binding sites incorporated into a polynucleotide of the invention can be the same or can be different miRNA sites. A combination of different miRNA binding sites incorporated into a polynucleotide of the invention can include combinations in which more than one copy of any of the different miRNA sites are incorporated. In another embodiment, miRNA binding sites incorporated into a polynucleotide of the invention can target the same or different tissues in the body. As a non-limiting example, through the introduction of tissue-, cell-type-, or disease-specific miRNA binding sites in the 3′-UTR of aAttorney Docket No.45817-0138WO1 / MTX968.20 polynucleotide of the invention, the degree of expression in specific cell types (e.g., myeloid cells, endothelial cells, etc.) can be reduced.

[0344] In one embodiment, a miRNA binding site can be engineered near the 5′ terminus of the 3′UTR, about halfway between the 5′ terminus and 3′ terminus of the 3′UTR and / or near the 3′ terminus of the 3′ UTR in a polynucleotide of the invention. As a non-limiting example, a miRNA binding site can be engineered near the 5′ terminus of the 3′UTR and about halfway between the 5′ terminus and 3′ terminus of the 3′UTR. As another non-limiting example, a miRNA binding site can be engineered near the 3′ terminus of the 3′UTR and about halfway between the 5′ terminus and 3′ terminus of the 3′ UTR. As yet another non-limiting example, a miRNA binding site can be engineered near the 5′ terminus of the 3′ UTR and near the 3′ terminus of the 3′ UTR.

[0345] In another embodiment, a 3′UTR can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites. The miRNA binding sites can be complementary to a miRNA, miRNA seed sequence, and / or miRNA sequences flanking the seed sequence.

[0346] In some embodiments, the expression of a polynucleotide of the invention can be controlled by incorporating at least one sensor sequence in the polynucleotide and Formulating the polynucleotide for administration. As a non- limiting example, a polynucleotide of the invention can be targeted to a tissue or cell by incorporating a miRNA binding site and Formulating the polynucleotide in a lipid nanoparticle comprising an ionizable amino lipid, including any of the lipids described herein.

[0347] A polynucleotide of the invention can be engineered for more targeted expression in specific tissues, cell types, or biological conditions based on the expression patterns of miRNAs in the different tissues, cell types, or biological conditions. Through introduction of tissue-specific miRNA binding sites, a polynucleotide of the invention can be designed for optimal protein expression in a tissue or cell, or in the context of a biological condition.

[0348] In some embodiments, a polynucleotide of the invention can be designed to incorporate miRNA binding sites that either have 100% identity to known miRNA seed sequences or have less than 100% identity to miRNA seed sequences.Attorney Docket No.45817-0138WO1 / MTX968.20 In some embodiments, a polynucleotide of the invention can be designed to incorporate miRNA binding sites that have at least: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to known miRNA seed sequences. The miRNA seed sequence can be partially mutated to decrease miRNA binding affinity and as such result in reduced downmodulation of the polynucleotide. In essence, the degree of match or mis-match between the miRNA binding site and the miRNA seed can act as a rheostat to more finely tune the ability of the miRNA to modulate protein expression. In addition, mutation in the non-seed region of a miRNA binding site can also impact the ability of a miRNA to modulate protein expression.

[0349] In one embodiment, a miRNA sequence can be incorporated into the loop of a stem loop.

[0350] In another embodiment, a miRNA seed sequence can be incorporated in the loop of a stem loop and a miRNA binding site can be incorporated into the 5′ or 3′ stem of the stem loop.

[0351] In some embodiments, a polynucleotide of the invention can include at least one miRNA in order to dampen the antigen presentation by antigen presenting cells. The miRNA can be the complete miRNA sequence, the miRNA seed sequence, the miRNA sequence without the seed, or a combination thereof. As a non-limiting example, a miRNA incorporated into a polynucleotide of the invention can be specific to the hematopoietic system. As another non-limiting example, a miRNA incorporated into a polynucleotide of the invention to dampen antigen presentation is miR-142-3p.

[0352] In some embodiments, a polynucleotide of the invention can include at least one miRNA in order to dampen expression of the encoded polypeptide in a tissue or cell of interest. As a non-limiting example a polynucleotide of the invention can include at least one miR-142-3p binding site, miR-142-3p seed sequence, miR- 142-3p binding site without the seed, miR-142-5p binding site, miR-142-5p seed sequence, miR-142-5p binding site without the seed, miR-146 binding site, miR-146 seed sequence and / or miR-146 binding site without the seed sequence.

[0353] In some embodiments, a polynucleotide of the invention can comprise at least one miRNA binding site in the 3′UTR in order to selectively degrade mRNA therapeutics in the immune cells to subdue unwanted immunogenic reactions causedAttorney Docket No.45817-0138WO1 / MTX968.20 by therapeutic delivery. As a non-limiting example, the miRNA binding site can make a polynucleotide of the invention more unstable in antigen presenting cells. Non-limiting examples of these miRNAs include miR-142-5p, miR-142-3p, miR- 146a-5p, and miR-146-3p.

[0354] In one embodiment, a polynucleotide of the invention comprises at least one miRNA sequence in a region of the polynucleotide that can interact with a RNA binding protein.

[0355] In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprising (i) a sequence-optimized nucleotide sequence (e.g., an ORF) encoding a CFTR polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof) and (ii) a miRNA binding site (e.g., a miRNA binding site that binds to miR-142) and / or a miRNA binding site that binds to miR-126. 11. Regions having a 5′ Cap

[0356] The disclosure also includes a polynucleotide that comprises both a 5′ Cap and a polynucleotide of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide to be expressed).

[0357] The 5′ cap structure of a natural mRNA is involved in nuclear export, increasing mRNA stability and binds the mRNA Cap Binding Protein (CBP), which is responsible for mRNA stability in the cell and translation competency through the association of CBP with poly(A) binding protein to form the mature cyclic mRNA species. The cap further assists the removal of 5′ proximal introns during mRNA splicing.

[0358] Endogenous mRNA molecules can be 5′-end capped generating a 5′- ppp-5′-triphosphate linkage between a terminal guanosine cap residue and the 5′- terminal transcribed sense nucleotide of the mRNA molecule. This 5′-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and / or anteterminal transcribed nucleotides of the 5′ end of the mRNA can optionally also be 2′-O-methylated.5′-decapping through hydrolysis and cleavage of the guanylate cap structure can target a nucleic acid molecule, such as an mRNA molecule, for degradation.Attorney Docket No.45817-0138WO1 / MTX968.20

[0359] In some embodiments, the polynucleotides of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide) incorporate a cap moiety.

[0360] In some embodiments, polynucleotides of the present invention comprise a non-hydrolyzable cap structure preventing decapping and thus increasing mRNA half-life. Because cap structure hydrolysis requires cleavage of 5′-ppp-5′ phosphorodiester linkages, modified nucleotides can be used during the capping reaction. For example, a Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) can be used with α-thio-guanosine nucleotides according to the manufacturer's instructions to create a phosphorothioate linkage in the 5′-ppp-5′ cap. Additional modified guanosine nucleotides can be used such as α-methyl-phosphonate and seleno-phosphate nucleotides.

[0361] Additional modifications include, but are not limited to, 2′-O- methylation of the ribose sugars of 5′-terminal and / or 5′-anteterminal nucleotides of the polynucleotide (as mentioned above) on the 2′-hydroxyl group of the sugar ring. Multiple distinct 5′-cap structures can be used to generate the 5′-cap of a nucleic acid molecule, such as a polynucleotide that functions as an mRNA molecule. Cap analogs, which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (i.e., endogenous, wild-type or physiological) 5′-caps in their chemical structure, while retaining cap function. Cap analogs can be chemically (i.e., non-enzymatically) or enzymatically synthesized and / or linked to the polynucleotides of the invention.

[0362] For example, the Anti-Reverse Cap Analog (ARCA) cap contains two guanines linked by a 5′-5′-triphosphate group, wherein one guanine contains an N7 methyl group as well as a 3′-O-methyl group (i.e., N7,3′-O-dimethyl-guanosine-5′- triphosphate-5′-guanosine (m7G-3′mppp-G; which can equivalently be designated 3′ O-Me-m7G(5′)ppp(5′)G). The 3′-O atom of the other, unmodified, guanine becomes linked to the 5′-terminal nucleotide of the capped polynucleotide. The N7- and 3′-O- methlyated guanine provides the terminal moiety of the capped polynucleotide.

[0363] Another exemplary cap is mCAP, which is similar to ARCA but has a 2′-O-methyl group on guanosine (i.e., N7,2′-O-dimethyl-guanosine-5′-triphosphate-5′- guanosine, m7Gm-ppp-G).Attorney Docket No.45817-0138WO1 / MTX968.20

[0364] Another exemplary cap is m7G-ppp-Gm-A (i.e., N7,guanosine-5′- triphosphate-2′-O-dimethyl-guanosine-adenosine).

[0365] In some embodiments, the cap is a dinucleotide cap analog. As a non- limiting example, the dinucleotide cap analog can be modified at different phosphate positions with a boranophosphate group or a phosphoroselenoate group such as the dinucleotide cap analogs described in U.S. Patent No. US 8,519,110, the contents of which are herein incorporated by reference in its entirety.

[0366] In another embodiment, the cap is a cap analog is a N7-(4- chlorophenoxyethyl) substituted dinucleotide form of a cap analog known in the art and / or described herein. Non-limiting examples of a N7-(4-chlorophenoxyethyl) substituted dinucleotide form of a cap analog include a N7-(4-chlorophenoxyethyl)- G(5′)ppp(5′)G and a N7-(4-chlorophenoxyethyl)-m3′-OG(5′)ppp(5′)G cap analog (See, e.g., the various cap analogs and the methods of synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 201321:4570-4574; the contents of which are herein incorporated by reference in its entirety). In another embodiment, a cap analog of the present invention is a 4-chloro / bromophenoxyethyl analog.

[0367] Polynucleotides of the invention can also be capped post-manufacture (whether IVT or chemical synthesis), using enzymes, in order to generate more authentic 5′-cap structures. As used herein, the phrase "more authentic" refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a "more authentic" feature is better representative of an endogenous, wild-type, natural or physiological cellular function and / or structure as compared to synthetic features or analogs, etc., of the prior art, or which outperforms the corresponding endogenous, wild-type, natural or physiological feature in one or more respects. Non-limiting examples of more authentic 5′cap structures of the present invention are those that, among other things, have enhanced binding of cap binding proteins, increased half-life, reduced susceptibility to 5′ endonucleases and / or reduced 5′decapping, as compared to synthetic 5′cap structures known in the art (or to a wild-type, natural or physiological 5′cap structure). For example, recombinant Vaccinia Virus Capping Enzyme and recombinant 2′-O- methyltransferase enzyme can create a canonical 5′-5′-triphosphate linkage between the 5′-terminal nucleotide of a polynucleotide and a guanine cap nucleotide whereinAttorney Docket No.45817-0138WO1 / MTX968.20 the cap guanine contains an N7 methylation and the 5′-terminal nucleotide of the mRNA contains a 2′-O-methyl. Such a structure is termed the Cap1 structure. This cap results in a higher translational-competency and cellular stability and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5′cap analog structures known in the art. Cap structures include, but are not limited to, 7mG(5′)ppp(5′)N1pN2p (cap 0), 7mG(5′)ppp(5′)N1mpNp (cap 1), and 7mG(5′)- ppp(5′)N1mpN2mp (cap 2).

[0368] As a non-limiting example, capping chimeric polynucleotides post- manufacture can be more efficient as nearly 100% of the chimeric polynucleotides can be capped. This is in contrast to ~80% when a cap analog is linked to a chimeric polynucleotide in the course of an in vitro transcription reaction.

[0369] According to the present invention, 5′ terminal caps can include endogenous caps or cap analogs. According to the present invention, a 5′ terminal cap can comprise a guanine analog. Useful guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2′fluoro-guanosine, 7-deaza-guanosine, 8-oxo- guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0370] Also provided herein are exemplary caps including those that can be used in co-transcriptional capping methods for ribonucleic acid (RNA) synthesis, using RNA polymerase, e.g., wild type RNA polymerase or variants thereof, e.g., such as those variants described herein. In one embodiment, caps can be added when RNA is produced in a “one-pot” reaction, without the need for a separate capping reaction. Thus, the methods, in some embodiments, comprise reacting a polynucleotide template with an RNA polymerase variant, nucleoside triphosphates, and a cap analog under in vitro transcription reaction conditions to produce RNA transcript.

[0371] As used here the term “cap” includes the inverted G nucleotide and can comprise one or more additional nucleotides 3’ of the inverted G nucleotide, e.g., 1, 2, 3, or more nucleotides 3’ of the inverted G nucleotide and 5’ to the 5’ UTR, e.g., a 5’ UTR described herein.

[0372] Exemplary caps comprise a sequence of GG, GA, or GGA, wherein the underlined, italicized G is an in inverted G nucleotide followed by a 5’-5’- triphosphate group.Attorney Docket No.45817-0138WO1 / MTX968.20

[0373] In one embodiment, a cap comprises a compound of formula (I) a;ring B1 is a modified or unmodified Guanine; ring B2and ring B3each independently is a nucleobase or a modified nucleobase; X2is O, S(O)p, NR24or CR25R26in which p is 0, 1, or 2; Y0 is O or CR6R7; Y1 is O, S(O)n, CR6R7, or NR8, in which n is 0, 1 , or 2; each --- is a single bond or absent, wherein when each --- is a single bond, Yi is O, S(O)n, CR6R7, or NR8; and when each --- is absent, Y1 is void; Y2 is (OP(O)R4)m in which m is 0, 1, or 2, or -O-(CR40R41)u-Q0-(CR42R43)v-, in which Q0 is a bond, O, S(O)r, NR44, or CR45R46, r is 0, 1 , or 2, and each of u and v independently is 1, 2, 3 or 4; each R2 and R2' independently is halo, LNA, or OR3; each R3independently is H, C1-C6alkyl, C2-C6alkenyl, or C2-C6alkynyl and R3, when being C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, is optionally substitutedAttorney Docket No.45817-0138WO1 / MTX968.20 with one or more of halo, OH and C1-C6 alkoxyl that is optionally substituted with one or more OH or OC(O)-C1-C6alkyl; each R4 and R4' independently is H, halo, C1-C6 alkyl, OH, SH, SeH, or BH3-; each of R6, R7, and R8, independently, is -Q1-T1, in which Q1is a bond or C1- C3 alkyl linker optionally substituted with one or more of halo, cyano, OH and C1-C6 alkoxy, and T1is H, halo, OH, COOH, cyano, or Rs1, in which Rs1is C1-C3alkyl, C2- C6 alkenyl, C2-C6 alkynyl, C1- C6 alkoxyl, C(O)O-C1-C6 alkyl, C3-C8 cycloalkyl, C6- C10 aryl, NR31R32, (NR31R32R33)+, 4 to 12- membered heterocycloalkyl, or 5- or 6- membered heteroaryl, and Rs1 is optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O-C1- C6alkyl, cyano, C1-C6alkoxyl, NR31R32, (NR31R32R33)+, C3-C8cycloalkyl, C6- C10 aryl, 4 to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl; each of R10, R11, R12, R13R14, and R15, independently, is -Q2-T2, in which Q2is a bond or C1-C3 alkyl linker optionally substituted with one or more of halo, cyano, OH and C1-C6alkoxy, and T2is H, halo, OH, NH2, cyano, NO2, N3, Rs2, or ORs2, in which Rs2 is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl, C6-C10 aryl, NHC(O)-C1-C6alkyl, NR31R32, (NR31R32R33)+, 4 to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl, and Rs2 is optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C1-C6alkyl, COOH, C(O)O-C1-C6 alkyl, cyano, C1 - C6 alkoxyl, NR31R32, (NR31R32R33)+, C3- C8cycloalkyl, C6-C10aryl, 4 to 12-membered heterocycloalkyl, and 5- or 6- membered heteroaryl; or alternatively R12 together with R14 is oxo, or R13 together with R15is oxo, each of R20, R21, R22, and R23 independently is -Q3-T3, in which Q3 is a bond or C1-C3alkyl linker optionally substituted with one or more of halo, cyano, OH and C1-C6 alkoxy, and T3 is H, halo, OH, NH2, cyano, NO2, N3, RS3, or ORS3, in which RS3is C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, C3-C8cycloalkyl, C6-C10aryl, NHC(O)-C1-C6 alkyl, mono-C1-C6 alkylamino, di-C1-C6 alkylamino, 4 to 12- membered heterocycloalkyl, or 5- or 6-membered heteroaryl, and Rs3 is optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O-C1-C6 alkyl, cyano, C1-C6 alkoxyl, amino,Attorney Docket No.45817-0138WO1 / MTX968.20 mono-C1-C6 alkylamino, di-C1-C6 alkylamino, C3-C8 cycloalkyl, C6-C10 aryl, 4 to 12- membered heterocycloalkyl, and 5- or 6-membered heteroaryl; each of R24, R25, and R26 independently is H or C1-C6 alkyl; each of R27and R28independently is H or OR29; or R27and R28together form O-R30-O; each R29 independently is H, C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl and R29, when being C1-C6alkyl, C2-C6alkenyl, or C2-C6alkynyl, is optionally substituted with one or more of halo, OH and C1-C6 alkoxyl that is optionally substituted with one or more OH or OC(O)-C1-C6 alkyl; R30 is C1-C6 alkylene optionally substituted with one or more of halo, OH and C1-C6 alkoxyl; each of R31, R32, and R33, independently is H, C1-C6alkyl, C3-C8cycloalkyl, C6-C10 aryl, 4 to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl; each of R40, R41, R42, and R43independently is H, halo, OH, cyano, N3, OP(O)R47R48, or C1-C6 alkyl optionally substituted with one or more OP(O)R47R48, or one R41and one R43, together with the carbon atoms to which they are attached and Q0, form C4-C10 cycloalkyl, 4- to 14-membered heterocycloalkyl, C6-C10 aryl, or 5- to 14-membered heteroaryl, and each of the cycloalkyl, heterocycloalkyl, phenyl, or 5- to 6-membered heteroaryl is optionally substituted with one or more of OH, halo, cyano, N3, oxo, OP(O)R47R48, C1-C6alkyl, C1-C6haloalkyl, COOH, C(O)O-C1-C6alkyl, C1-C6 alkoxyl, C1-C6 haloalkoxyl, amino, mono-C1-C6 alkylamino, and di-C1- C6alkylamino; R44 is H, C1-C6 alkyl, or an amine protecting group; each of R45and R46independently is H, OP(O)R47R48, or C1-C6alkyl optionally substituted with one or more OP(O)R47R48, and each of R47and R48, independently is H, halo, C1-C6alkyl, OH, SH, SeH, or BH3. It should be understood that a cap analog, as provided herein, may include any of the cap analogs described in international publication WO 2017 / 066797, published on 20 April 2017, incorporated by reference herein in its entirety.

[0374] In some embodiments, the B2 middle position can be a non-ribose molecule, such as arabinose.

[0375] In some embodiments R2 is ethyl-based.Attorney Docket No.45817-0138WO1 / MTX968.20

[0376] Thus, in some embodiments, a cap comprises the following structure:Attorney Docket No.45817-0138WO1 / MTX968.20

[0378] In yet other embodiments, a cap comprises the following structure:. embodiments, R is a methyl group (e.g., C1 alkyl). In some embodiments, R is an ethyl group (e.g., C2alkyl).

[0381] In some embodiments, a cap comprises a sequence selected from the following sequences: GAA, GAC, GAG, GAU, GCA, GCC, GCG, GCU, GGA , GGC, GGG, GGU, GUA, GUC, GUG, and GUU. In some embodiments, a cap comprises GAA. In some embodiments, a cap comprises GAC. In someAttorney Docket No.45817-0138WO1 / MTX968.20 embodiments, a cap comprises GAG. In some embodiments, a cap comprises GAU. In some embodiments, a cap comprises GCA. In some embodiments, a cap comprises GCC. In some embodiments, a cap comprises GCG. In some embodiments, a cap comprises GCU. In some embodiments, a cap comprises GGA. In some embodiments, a cap comprises GGC. In some embodiments, a cap comprises GGG. In some embodiments, a cap comprises GGU. In some embodiments, a cap comprises GUA. In some embodiments, a cap comprises GUC. In some embodiments, a cap comprises GUG. In some embodiments, a cap comprises GUU.

[0382] In some embodiments, a cap comprises a sequence selected from the following sequences: m7GpppApA, m7GpppApC, m7GpppApG, m7GpppApU, m7GpppCpA, m7GpppCpC, m7GpppCpG, m7GpppCpU, m7GpppGpA, m7GpppGpC, m7GpppGpG, m7GpppGpU, m7GpppUpA, m7GpppUpC, m7GpppUpG, and m7GpppUpU.

[0383] In some embodiments, a cap comprises m7GpppApA. In some embodiments, a cap comprises m7GpppApC. In some embodiments, a cap comprises m7GpppApG. In some embodiments, a cap comprises m7GpppApU. In some embodiments, a cap comprises m7GpppCpA. In some embodiments, a cap comprises m7GpppCpC. In some embodiments, a cap comprises m7GpppCpG. In some embodiments, a cap comprises m7GpppCpU. In some embodiments, a cap comprises m7GpppGpA. In some embodiments, a cap comprises m7GpppGpC. In some embodiments, a cap comprises m7GpppGpG. In some embodiments, a cap comprises m7GpppGpU. In some embodiments, a cap comprises m7GpppUpA. In some embodiments, a cap comprises m7GpppUpC. In some embodiments, a cap comprises m7GpppUpG. In some embodiments, a cap comprises m7GpppUpU.

[0384] A cap, in some embodiments, comprises a sequence selected from the following sequences: m7G3 ^OMepppApA, m7G3 ^OMepppApC, m7G3 ^OMepppApG, m7G3 ^OMepppApU, m7G3 ^OMepppCpA, m7G3 ^OMepppCpC, m7G3 ^OMepppCpG, m7G3^OMepppCpU, m7G3^OMepppGpA, m7G3^OMepppGpC, m7G3^OMepppGpG, m7G3^OMepppGpU, m7G3^OMepppUpA, m7G3^OMepppUpC, m7G3^OMepppUpG, and m7G3 ^OMepppUpU.Attorney Docket No.45817-0138WO1 / MTX968.20

[0385] In some embodiments, a cap comprises m7G3 ^OMepppApA. In some embodiments, a cap comprises m7G3 ^OMepppApC. In some embodiments, a cap comprises m7G3^OMepppApG. In some embodiments, a cap comprises m7G3^OMepppApU. In some embodiments, a cap comprises m7G3^OMepppCpA. In some embodiments, a cap comprises m7G3 ^OMepppCpC. In some embodiments, a cap comprises m7G3 ^OMepppCpG. In some embodiments, a cap comprises m7G3^OMepppCpU. In some embodiments, a cap comprises m7G3^OMepppGpA. In some embodiments, a cap comprises m7G3^OMepppGpC. In some embodiments, a cap comprises m7G3 ^OMepppGpG. In some embodiments, a cap comprises m7G3 ^OMepppGpU. In some embodiments, a cap comprises m7G3 ^OMepppUpA. In some embodiments, a cap comprises m7G3^OMepppUpC. In some embodiments, a cap comprises m7G3^OMepppUpG. In some embodiments, a cap comprises m7G3 ^OMepppUpU.

[0386] A cap, in other embodiments, comprises a sequence selected from the following sequences: m7G3^OMepppA2^OMepA, m7G3^OMepppA2^OMepC, m7G3 ^OMepppA2 ^OMepG, m7G3 ^OMepppA2 ^OMepU, m7G3 ^OMepppC2 ^OMepA, m7G3 ^OMepppC2 ^OMepC, m7G3 ^OMepppC2 ^OMepG, m7G3 ^OMepppC2 ^OMepU, m7G3^OMepppG2^OMepA, m7G3^OMepppG2^OMepC, m7G3^OMepppG2^OMepG, m7G3^OMepppG2^OMepU, m7G3^OMepppU2^OMepA, m7G3^OMepppU2^OMepC, m7G3 ^OMepppU2 ^OMepG, and m7G3 ^OMepppU2 ^OMepU.

[0387] In some embodiments, a cap comprises m7G3 ^OMepppA2 ^OMepA. In some embodiments, a cap comprises m7G3^OMepppA2^OMepC. In some embodiments, a cap comprises m7G3^OMepppA2^OMepG. In some embodiments, a cap comprises m7G3 ^OMepppA2 ^OMepU. In some embodiments, a cap comprises m7G3 ^OMepppC2 ^OMepA. In some embodiments, a cap comprises m7G3 ^OMepppC2 ^OMepC. In some embodiments, a cap comprises m7G3^OMepppC2^OMepG. In some embodiments, a cap comprises m7G3^OMepppC2^OMepU. In some embodiments, a cap comprises m7G3 ^OMepppG2 ^OMepA. In some embodiments, a cap comprises m7G3 ^OMepppG2 ^OMepC. In some embodiments, a cap comprises m7G3^OMepppG2^OMepG. In some embodiments, a cap comprisesAttorney Docket No.45817-0138WO1 / MTX968.20 m7G3 ^OMepppG2 ^OMepU. In some embodiments, a cap comprises m7G3 ^OMepppU2 ^OMepA. In some embodiments, a cap comprises m7G3^OMepppU2^OMepC. In some embodiments, a cap comprises m7G3^OMepppU2^OMepG. In some embodiments, a cap comprises m7G3 ^OMepppU2 ^OMepU.

[0388] A cap, in still other embodiments, comprises a sequence selected from the following sequences: m7GpppA2^OMepA, m7GpppA2^OMepC, m7GpppA2^OMepG, m7GpppA2 ^OMepU, m7GpppC2 ^OMepA, m7GpppC2 ^OMepC, m7GpppC2 ^OMepG, m7GpppC2 ^OMepU, m7GpppG2 ^OMepA, m7GpppG2 ^OMepC, m7GpppG2 ^OMepG, m7GpppG2^OMepU, m7GpppU2^OMepA, m7GpppU2^OMepC, m7GpppU2^OMepG, and m7GpppU2^OMepU.

[0389] In some embodiments, a cap comprises m7GpppA2 ^OMepA. In some embodiments, a cap comprises m7GpppA2 ^OMepC. In some embodiments, a cap comprises m7GpppA2^OMepG. In some embodiments, a cap comprises m7GpppA2^OMepU. In some embodiments, a cap comprises m7GpppC2^OMepA. In some embodiments, a cap comprises m7GpppC2 ^OMepC. In some embodiments, a cap comprises m7GpppC2 ^OMepG. In some embodiments, a trinucleotide cap comprises m7GpppC2^OMepU. In some embodiments, a cap comprises m7GpppG2^OMepA. In some embodiments, a cap comprises m7GpppG2^OMepC. In some embodiments, a cap comprises m7GpppG2 ^OMepG. In some embodiments, a cap comprises m7GpppG2 ^OMepU. In some embodiments, a cap comprises m7GpppU2 ^OMepA. In some embodiments, a cap comprises m7GpppU2^OMepC. In some embodiments, a cap comprises m7GpppU2^OMepG. In some embodiments, a cap comprises m7GpppU2 ^OMepU.

[0390] In some embodiments, a cap comprises m7Gpppm6A2’OmepG. In some embodiments, a cap comprises m7Gpppe6A2’OmepG.

[0391] In some embodiments, a cap comprises GAG. In some embodiments, a cap comprises GCG. In some embodiments, a cap comprises GUG. In some embodiments, a cap comprises GGG.Attorney Docket No.45817-0138WO1 / MTX968.20

[0392] In some embodiments, a cap comprises any one of the following structures: or .

[0393] In some embodiments, the cap comprisesm7GpppN1N2N3, where N1, N2, and N3 are optional (i.e., can be absent or one or more can be present) and are independently a natural, a modified, or an unnatural nucleoside base. In some embodiments,m7G is further methylated, e.g., at the 3’ position. In some embodiments, them7G comprises an O-methyl at the 3’ position. In some embodiments N1, N2, and N3 if present, optionally, are independently an adenine, a uracil, a guanidine, a thymine, or a cytosine. In some embodiments, one or more (or all) of N1, N2, and N3, if present, are methylated, e.g., at the 2’ position. In someAttorney Docket No.45817-0138WO1 / MTX968.20 embodiments, one or more (or all) of N1, N2, and N3, if present have an O-methyl at the 2’ position.

[0394] In some embodiments, the cap comprises the following structure:unnatural nucleoside based; and R1, R2, R3, and R4 are independently OH or O- methyl. In some embodiments, R3is O-methyl and R4is OH. In some embodiments, R3 and R4 are O-methyl. In some embodiments, R4 is O-methyl. In some embodiments, R1is OH, R2is OH, R3is O-methyl, and R4is OH. In some embodiments, R1 is OH, R2 is OH, R3 is O-methyl, and R4 is O-methyl. In some embodiments, at least one of R1and R2is O-methyl, R3is O-methyl, and R4is OH. In some embodiments, at least one of R1 and R2 is O-methyl, R3 is O-methyl, and R4 is O-methyl.

[0395] In some embodiments, B1, B3, and B3are natural nucleoside bases. In some embodiments, at least one of B1, B2, and B3 is a modified or unnatural base. In some embodiments, at least one of B1, B2, and B3is N6-methyladenine. In some embodiments, B1 is adenine, cytosine, thymine, or uracil. In some embodiments, B1 is adenine, B2is uracil, and B3is adenine. In some embodiments, R1and R2are OH, R3 and R4 are O-methyl, B1 is adenine, B2 is uracil, and B3 is adenine.

[0396] In some embodiments the cap comprises a sequence selected from the following sequences: GAAA, GACA, GAGA, GAUA, GCAA, GCCA, GCGA, GCUA, GGAA, GGCA, GGGA, GGUA, GUCA, and GUUA. In some embodiments the cap comprises a sequence selected from the following sequences: GAAG, GACG,Attorney Docket No.45817-0138WO1 / MTX968.20 GAGG, GAUG, GCAG, GCCG, GCGG, GCUG, GGAG, GGCG, GGGG, GGUG, GUCG, GUGG, and GUUG. In some embodiments the cap comprises a sequence selected from the following sequences: GAAU, GACU, GAGU, GAUU, GCAU, GCCU, GCGU, GCUU, GGAU, GGCU, GGGU, GGUU, GUAU, GUCU, GUGU, and GUUU. In some embodiments the cap comprises a sequence selected from the following sequences: GAAC, GACC, GAGC, GAUC, GCAC, GCCC, GCGC, GCUC, GGAC, GGCC, GGGC, GGUC, GUAC, GUCC, GUGC, and GUUC.

[0397] A cap, in some embodiments, comprises a sequence selected from the following sequences: m7G3 ^OMepppApApN, m7G3 ^OMepppApCpN, m7G3 ^OMepppApGpN, m7G3 ^OMepppApUpN, m7G3 ^OMepppCpApN, m7G3^OMepppCpCpN, m7G3^OMepppCpGpN, m7G3^OMepppCpUpN, m7G3^OMepppGpApN, m7G3^OMepppGpCpN, m7G3^OMepppGpGpN, m7G3 ^OMepppGpUpN, m7G3 ^OMepppUpApN, m7G3 ^OMepppUpCpN, m7G3 ^OMepppUpGpN, and m7G3 ^OMepppUpUpN, where N is a natural, a modified, or an unnatural nucleoside base.

[0398] A cap, in other embodiments, comprises a sequence selected from the following sequences: m7G3^OMepppA2^OMepApN, m7G3^OMepppA2^OMepCpN, m7G3 ^OMepppA2 ^OMepGpN, m7G3 ^OMepppA2 ^OMepUpN, m7G3 ^OMepppC2 ^OMepApN, m7G3 ^OMepppC2 ^OMepCpN, m7G3 ^OMepppC2 ^OMepGpN, m7G3 ^OMepppC2 ^OMepUpN, m7G3^OMepppG2^OMepApN, m7G3^OMepppG2^OMepCpN, m7G3^OMepppG2^OMepGpN, m7G3^OMepppG2^OMepUpN, m7G3^OMepppU2^OMepApN, m7G3^OMepppU2^OMepCpN, m7G3 ^OMepppU2 ^OMepGpN, and m7G3 ^OMepppU2 ^OMepUpN, where N is a natural, a modified, or an unnatural nucleoside base.

[0399] A cap, in still other embodiments, comprises a sequence selected from the following sequences: m7GpppA2 ^OMepApN, m7GpppA2 ^OMepCpN, m7GpppA2^OMepGpN, m7GpppA2^OMepUpN, m7GpppC2^OMepApN, m7GpppC2^OMepCpN, m7GpppC2^OMepGpN, m7GpppC2^OMepUpN, m7GpppG2 ^OMepApN, m7GpppG2 ^OMepCpN, m7GpppG2 ^OMepGpN, m7GpppG2 ^OMepUpN, m7GpppU2 ^OMepApN, m7GpppU2 ^OMepCpN, m7GpppU2^OMepGpN, and m7GpppU2^OMepUpN, where N is a natural, a modified, or an unnatural nucleoside base.Attorney Docket No.45817-0138WO1 / MTX968.20

[0400] A cap, in other embodiments, comprises a sequence selected from the following sequences: m7G3^OMepppA2^OMepA2^OMepN, m7G3^OMepppA2^OMepC2^OMepN, m7G3^OMepppA2^OMepG2^OMepN, m7G3^OMepppA2^OMepU2^OMepN, m7G3 ^OMepppC2 ^OMepA2 ^OMepN, m7G3 ^OMepppC2 ^OMepC2 ^OMepN, m7G3 ^OMepppC2 ^OMepG2 ^OMepN, m7G3 ^OMepppC2 ^OMepU2 ^OMepN, m7G3^OMepppG2^OMepA2^OMepN, m7G3^OMepppG2^OMepC2^OMepN, m7G3^OMepppG2^OMepG2^OMepN, m7G3^OMepppG2^OMepU2^OMepN, m7G3 ^OMepppU2 ^OMepA2 ^OMepN, m7G3 ^OMepppU2 ^OMepC2 ^OMepN, m7G3 ^OMepppU2 ^OMepG2 ^OMepN, and m7G3 ^OMepppU2 ^OMepU2 ^OMepN, where N is a natural, a modified, or an unnatural nucleoside base.

[0401] A cap, in still other embodiments, comprises a sequence selected from the following sequences: m7GpppA2^OMepA2^OMepN, m7GpppA2^OMepC2^OMepN, m7GpppA2^OMepG2^OMepN, m7GpppA2^OMepU2^OMepN, m7GpppC2^OMepA2^OMepN, m7GpppC2 ^OMepC2 ^OMepN, m7GpppC2 ^OMepG2 ^OMepN, m7GpppC2 ^OMepU2 ^OMepN, m7GpppG2 ^OMepA2 ^OMepN, m7GpppG2 ^OMepC2 ^OMepN, m7GpppG2 ^OMepG2 ^OMepN, m7GpppG2^OMepU2^OMepN, m7GpppU2^OMepA2^OMepN, m7GpppU2^OMepC2^OMepN, m7GpppU2^OMepG2^OMepN, and m7GpppU2^OMepU2^OMepN, where N is a natural, a modified, or an unnatural nucleoside base.

[0402] In some embodiments, a cap comprises GGAG. In some embodiments, a cap comprises the following structure: (X).Attorney Docket No.45817-0138WO1 / MTX968.20 12. Poly-A Tails

[0403] In some embodiments, the polynucleotides of the present disclosure (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide) further comprise a poly-A tail. In further embodiments, terminal groups on the poly-A tail can be incorporated for stabilization. In other embodiments, a poly- A tail comprises des-3′ hydroxyl tails.

[0404] During RNA processing, a long chain of adenine nucleotides (poly-A tail) can be added to a polynucleotide such as an mRNA molecule in order to increase stability. Immediately after transcription, the 3′ end of the transcript can be cleaved to free a 3′ hydroxyl. Then poly-A polymerase adds a chain of adenine nucleotides to the RNA. The process, called polyadenylation, adds a poly-A tail that can be between, for example, approximately 80 to approximately 250 residues long, including approximately 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240 or 250 residues long. In one embodiment, the poly-A tail is 100 nucleotides in length (SEQ ID NO:195).

[0405] PolyA tails can also be added after the construct is exported from the nucleus.

[0406] According to the present invention, terminal groups on the poly A tail can be incorporated for stabilization. Polynucleotides of the present invention can include des-3′ hydroxyl tails. They can also include structural moieties or 2'-Omethyl modifications as taught by Junjie Li, et al. (Current Biology, Vol.15, 1501–1507, August 23, 2005, the contents of which are incorporated herein by reference in its entirety).

[0407] The polynucleotides of the present invention can be designed to encode transcripts with alternative polyA tail structures including histone mRNA. According to Norbury, "Terminal uridylation has also been detected on human replication- dependent histone mRNAs. The turnover of these mRNAs is thought to be important for the prevention of potentially toxic histone accumulation following the completion or inhibition of chromosomal DNA replication. These mRNAs are distinguished by their lack of a 3ʹ poly(A) tail, the function of which is instead assumed by a stableAttorney Docket No.45817-0138WO1 / MTX968.20 stem–loop structure and its cognate stem–loop binding protein (SLBP); the latter carries out the same functions as those of PABP on polyadenylated mRNAs" (Norbury, "Cytoplasmic RNA: a case of the tail wagging the dog," Nature Reviews Molecular Cell Biology; AOP, published online 29 August 2013; doi:10.1038 / nrm3645) the contents of which are incorporated herein by reference in its entirety.

[0408] Unique poly-A tail lengths provide certain advantages to the polynucleotides of the present invention. Generally, the length of a poly-A tail, when present, is greater than 30 nucleotides in length. In another embodiment, the poly-A tail is greater than 35 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides).

[0409] In some embodiments, the polynucleotide or region thereof includes from about 30 to about 3,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 750, from 30 to 1,000, from 30 to 1,500, from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250, from 50 to 500, from 50 to 750, from 50 to 1,000, from 50 to 1,500, from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to 500, from 100 to 750, from 100 to 1,000, from 100 to 1,500, from 100 to 2,000, from 100 to 2,500, from 100 to 3,000, from 500 to 750, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 2,500, from 500 to 3,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 2,500, from 1,000 to 3,000, from 1,500 to 2,000, from 1,500 to 2,500, from 1,500 to 3,000, from 2,000 to 3,000, from 2,000 to 2,500, and from 2,500 to 3,000).

[0410] In some embodiments, the poly-A tail is designed relative to the length of the overall polynucleotide or the length of a particular region of the polynucleotide. This design can be based on the length of a coding region, the length of a particular feature or region or based on the length of the ultimate product expressed from the polynucleotides.

[0411] In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% greater in length than the polynucleotide or feature thereof. The poly-A tail can also be designed as a fraction of the polynucleotides to which it belongs. In thisAttorney Docket No.45817-0138WO1 / MTX968.20 context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct, a construct region or the total length of the construct minus the poly-A tail. Further, engineered binding sites and conjugation of polynucleotides for Poly-A binding protein can enhance expression.

[0412] Additionally, multiple distinct polynucleotides can be linked together via the PABP (Poly-A binding protein) through the 3′-end using modified nucleotides at the 3′-terminus of the poly-A tail. Transfection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12hr, 24hr, 48hr, 72hr and day 7 post-transfection.

[0413] In some embodiments, the polynucleotides of the present invention are designed to include a polyA-G Quartet region. The G-quartet is a cyclic hydrogen bonded array of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of the poly-A tail. The resultant polynucleotide is assayed for stability, protein production and other parameters including half-life at various time points. It has been discovered that the polyA-G quartet results in protein production from an mRNA equivalent to at least 75% of that seen using a poly-A tail of 120 nucleotides alone (SEQ ID NO:196).

[0414] In some embodiments, the polyA tail comprises an alternative nucleoside, e.g., inverted thymidine. PolyA tails comprising an alternative nucleoside, e.g., inverted thymidine, may be generated as described herein. For instance, mRNA constructs may be modified by ligation to stabilize the poly(A) tail. Ligation may be performed using 0.5-1.5 mg / mL mRNA (5′ Cap1, 3′ A100), 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM TCEP, 1000 units / mL T4 RNA Ligase 1, 1 mM ATP, 20% w / v polyethylene glycol 8000, and 5:1 molar ratio of modifying oligo to mRNA. Modifying oligo has a sequence of 5’-phosphate- AAAAAAAAAAAAAAAAAAAA-(inverted deoxythymidine (idT) (SEQ ID NO:209)) (see below). Ligation reactions are mixed and incubated at room temperature (~22°C) for, e.g., 4 hours. Stable tail mRNA are purified by, e.g., dT purification, reverse phase purification, hydroxyapatite purification, ultrafiltration into water, and sterile filtration. The resulting stable tail-containing mRNAs contain the following structure at the 3’end, starting with the polyA region: A100-Attorney Docket No.45817-0138WO1 / MTX968.20 UCUAGAAAAAAAAAAAAAAAAAAAA-inverted deoxythymidine (SEQ ID NO:211).

[0415] Modifying oligo to stabilize tail (5’-phosphate- AAAAAAAAAAAAAAAAAAAA-(inverted deoxythymidine)(SEQ ID NO:209)):

[0416] A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). In some instances, the polyA tail consists of A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). 13. Start codon region

[0417] The invention also includes a polynucleotide that comprises both a start codon region and the polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide). In some embodiments, the polynucleotides of the present invention can have regions that are analogous to or function like a start codon region.

[0418] In some embodiments, the translation of a polynucleotide can initiate on a codon that is not the start codon AUG. Translation of the polynucleotide can initiate on an alternative start codon such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG (see Touriol et al. Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro PLoS ONE, 2010 5:11; the contents of each of which are herein incorporated by reference in its entirety).Attorney Docket No.45817-0138WO1 / MTX968.20

[0419] As a non-limiting example, the translation of a polynucleotide begins on the alternative start codon ACG. As another non-limiting example, polynucleotide translation begins on the alternative start codon CTG or CUG. As yet another non- limiting example, the translation of a polynucleotide begins on the alternative start codon GTG or GUG.

[0420] Nucleotides flanking a codon that initiates translation such as, but not limited to, a start codon or an alternative start codon, are known to affect the translation efficiency, the length and / or the structure of the polynucleotide. (See, e.g., Matsuda and Mauro PLoS ONE, 20105:11; the contents of which are herein incorporated by reference in its entirety). Masking any of the nucleotides flanking a codon that initiates translation can be used to alter the position of translation initiation, translation efficiency, length and / or structure of a polynucleotide.

[0421] In some embodiments, a masking agent can be used near the start codon or alternative start codon in order to mask or hide the codon to reduce the probability of translation initiation at the masked start codon or alternative start codon. Non-limiting examples of masking agents include antisense locked nucleic acids (LNA) polynucleotides and exon-junction complexes (EJCs) (See, e.g., Matsuda and Mauro describing masking agents LNA polynucleotides and EJCs (PLoS ONE, 20105:11); the contents of which are herein incorporated by reference in its entirety).

[0422] In another embodiment, a masking agent can be used to mask a start codon of a polynucleotide in order to increase the likelihood that translation will initiate on an alternative start codon. In some embodiments, a masking agent can be used to mask a first start codon or alternative start codon in order to increase the chance that translation will initiate on a start codon or alternative start codon downstream to the masked start codon or alternative start codon.

[0423] In some embodiments, a start codon or alternative start codon can be located within a perfect complement for a miRNA binding site. The perfect complement of a miRNA binding site can help control the translation, length and / or structure of the polynucleotide similar to a masking agent. As a non-limiting example, the start codon or alternative start codon can be located in the middle of a perfect complement for a miRNA binding site. The start codon or alternative start codon can be located after the first nucleotide, second nucleotide, third nucleotide, fourthAttorney Docket No.45817-0138WO1 / MTX968.20 nucleotide, fifth nucleotide, sixth nucleotide, seventh nucleotide, eighth nucleotide, ninth nucleotide, tenth nucleotide, eleventh nucleotide, twelfth nucleotide, thirteenth nucleotide, fourteenth nucleotide, fifteenth nucleotide, sixteenth nucleotide, seventeenth nucleotide, eighteenth nucleotide, nineteenth nucleotide, twentieth nucleotide or twenty-first nucleotide.

[0424] In another embodiment, the start codon of a polynucleotide can be removed from the polynucleotide sequence in order to have the translation of the polynucleotide begin on a codon that is not the start codon. Translation of the polynucleotide can begin on the codon following the removed start codon or on a downstream start codon or an alternative start codon. In a non-limiting example, the start codon ATG or AUG is removed as the first 3 nucleotides of the polynucleotide sequence in order to have translation initiate on a downstream start codon or alternative start codon. The polynucleotide sequence where the start codon was removed can further comprise at least one masking agent for the downstream start codon and / or alternative start codons in order to control or attempt to control the initiation of translation, the length of the polynucleotide and / or the structure of the polynucleotide. 14. Stop Codon Region

[0425] The invention also includes a polynucleotide that comprises both a stop codon region and the polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide). In some embodiments, the polynucleotides of the present invention can include at least two stop codons before the 3′ untranslated region (UTR). The stop codon can be selected from TGA, TAA and TAG in the case of DNA, or from UGA, UAA and UAG in the case of RNA. In some embodiments, the polynucleotides of the present invention include the stop codon TGA in the case or DNA, or the stop codon UGA in the case of RNA, and one additional stop codon. In a further embodiment the addition stop codon can be TAA or UAA. In another embodiment, the polynucleotides of the present invention include three consecutive stop codons, four stop codons, or more.Attorney Docket No.45817-0138WO1 / MTX968.20 15. Combination of mRNA elements

[0426] Any of the polynucleotides disclosed herein can comprise one, two, three, or all of the following elements: (a) a 5’-UTR, e.g., as described herein; (b) a coding region comprising a stop element (e.g., as described herein); (c) a 3’-UTR (e.g., as described herein) and; optionally (d) a 3’ stabilizing region, e.g., as described herein. Also disclosed herein are LNP compositions comprising the same.

[0427] In an embodiment, a polynucleotide of the disclosure comprises (a) a 5’ UTR described in Table 2 or a variant or fragment thereof and (b) a coding region comprising a stop element provided herein. In an embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In an embodiment, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein.

[0428] In an embodiment, a polynucleotide of the disclosure comprises (a) a 5’ UTR described in Table 2 or a variant or fragment thereof and (c) a 3’ UTR described in Table 3 or a variant or fragment thereof. In an embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In an embodiment, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein.

[0429] In an embodiment, a polynucleotide of the disclosure comprises (c) a 3’ UTR described in Table 3 or a variant or fragment thereof and (b) a coding region comprising a stop element provided herein. In an embodiment, the polynucleotide comprises a sequence provided in Table 5. In an embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In an embodiment, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein.

[0430] In an embodiment, a polynucleotide of the disclosure comprises (a) a 5’ UTR described in Table 2 or a variant or fragment thereof; (b) a coding region comprising a stop element provided herein; and (c) a 3’ UTR described in Table 3 or a variant or fragment thereof. In an embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. InAttorney Docket No.45817-0138WO1 / MTX968.20 an embodiment, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein. Table 5: Exemplary 3’ UTR and stop element sequences SEQ ID Sequence NO information Sequence C C A C C A C C A C C A C C A C C A C C A C C A C C A G C C UAttorney Docket No.45817-0138WO1 / MTX968.20 SEQ ID Sequence NO information Sequence A C G A C U C G A C U C C G C U C G A G A C C A G C U16. Identification and Ratio Determination (IDR) Sequences

[0431] An Identification and Ratio Determination (IDR) sequence is a sequence of a biological molecule (e.g., nucleic acid or protein) that, when combined with the sequence of a target biological molecule, serves to identify the target biological molecule. Typically, an IDR sequence is a heterologous sequence that isAttorney Docket No.45817-0138WO1 / MTX968.20 incorporated within or appended to a sequence of a target biological molecule and can be used as a reference to identify the target molecule. Thus, in some embodiments, a nucleic acid (e.g., mRNA) comprises (i) a target sequence of interest (e.g., a coding sequence encoding a therapeutic and / or antigenic peptide or protein); and (ii) a unique IDR sequence.

[0432] An RNA species (e.g., RNA having a given coding sequence) may comprise an IDR sequence that differs from the IDR sequence of other RNA species (e.g., RNA(s) having different coding sequence(s)). Each IDR sequence thus identifies a particular RNA species, and so the abundance of IDR sequences may be measured to determine the abundance of each RNA species in a composition. Use of distinct IDR sequences to identify RNA species allows for analysis of multivalent RNA compositions (e.g., containing multiple RNA species) containing RNA species with similar coding sequences and / or lengths, which could otherwise be difficult to distinguish using PCR- or chromatography-based analysis of full-length RNAs.

[0433] Each RNA species in a multivalent RNA composition may comprise an IDR sequence that is not a sequence isomer of an IDR sequence of another RNA species in a multivalent RNA composition (e.g., the IDR sequence does not have the same number of adenosine nucleotides, the same number of cytosine nucleotides, the same number of guanine nucleotides, and the same number of uracil nucleotides, as another IDR sequence in the composition, even if those sequences have different sequences). Having identical nucleotide compositions causes sequence isomers to have the same mass, presenting a challenge to distinguishing sequence isomers using mass-based identification methods (e.g., mass spectrometry).

[0434] Each RNA species in a multivalent RNA composition may comprise an IDR sequence having a mass that differs from the mass of IDR sequences of each other RNA species in a multivalent RNA composition. For example, the mass of each IDR sequence may differ from the mass of other IDR sequences by at least 9 Da, at least 25 Da, at least 25 Da, or at least 50 Da. Use of IDR sequences with distinct masses allows RNA fragments comprising different IDR sequences to be distinguished using mass-based analysis methods (e.g., mass spectrometry), which do not require reverse transcription, amplification, or sequencing of RNAs.Attorney Docket No.45817-0138WO1 / MTX968.20

[0435] Each RNA species in an RNA composition may comprises an IDR sequence with a different length. For example, each IDR sequence may have a length independently selected from 0 to 25 nucleotides. The length of a nucleic acid influences the rate at which the nucleic acid traverses a chromatography column, and so the use of IDR sequences of different lengths on different RNA species allows RNA fragments having different IDR sequences to be distinguished using chromatography-based methods (e.g., LC-UV).

[0436] IDR sequences may be chosen such that no IDR sequence comprises a start codon, ‘AUG’. Lack of a start codon in an IDR sequence prevents undesired translation of nucleotide sequences within and / or downstream from the IDR sequence.

[0437] IDR sequences may be chosen such that no IDR sequence comprises a recognition site for a restriction enzyme. In one example, no IDR sequence comprises a recognition site for XbaI, ‘UCUAG’. Lack of a recognition site for a restriction enzyme (e.g., XbaI recognition site ‘UCUAG’) allows the restriction enzyme to be used in generating and modifying a DNA template for in vitro transcription, without affecting the IDR sequence or sequence of the transcribed RNA. 17. Polynucleotide Comprising an mRNA Encoding a CFTR Polypeptide

[0438] In certain embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a CFTR polypeptide, comprises from 5′ to 3′ end: (i) a 5′ cap provided above; (ii) a 5′ UTR, such as the sequences provided above; (iii) an ORF encoding CFTR GoF2 (SEQ ID NO:3), wherein the ORF has at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:8; (iv) at least one stop codon; (v) a 3′ UTR, such as the sequences provided above; and (vi) a poly-A tail provided above.Attorney Docket No.45817-0138WO1 / MTX968.20

[0439] In certain embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a CFTR polypeptide, comprises from 5′ to 3′ end: (i) a 5′ cap provided above; (ii) a 5′ UTR, such as the sequences provided above; (iii) an ORF encoding CFTR GoF1 (SEQ ID NO:2), wherein the ORF has at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:7; (iv) at least one stop codon; (v) a 3′ UTR, such as the sequences provided above; and (vi) a poly-A tail provided above.

[0440] In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds to miRNA-142. In some embodiments, the 5′ UTR comprises the miRNA binding site. In some embodiments, the 3′ UTR comprises the miRNA binding site.

[0441] In some embodiments, a polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, or 100% identical to the protein sequence of CFTR GoF2 (SEQ ID NO:3).

[0442] In some embodiments, a polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, or 100% identical to the protein sequence of CFTR GoF1 (SEQ ID NO:2).

[0443] Exemplary CFTR nucleotide constructs are described below:

[0444] SEQ ID NO:37 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO:50, CFTR GoF2 ORF of SEQ ID NO:8, and 3′ UTR of SEQ ID NO:139.

[0445] SEQ ID NO:36 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO:50, CFTR GoF1 ORF of SEQ ID NO:7, and 3′ UTR of SEQ ID NO:139.Attorney Docket No.45817-0138WO1 / MTX968.20

[0446] In certain embodiments, in a construct with SEQ ID NO:37 or 36, all uracils therein are replaced by N1-methylpseudouracil. In certain embodiments, in a construct with SEQ ID NO:37 or 36, all uracils therein are replaced by N1-methylpseudouracil. 18. Methods of Making Polynucleotides

[0447] The present disclosure also provides methods for making a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide) or a complement thereof.

[0448] In some aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a CFTR polypeptide, can be constructed using in vitro transcription (IVT). In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a CFTR polypeptide, can be constructed by chemical synthesis using an oligonucleotide synthesizer.

[0449] In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a CFTR polypeptide is made by using a host cell. In certain aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a CFTR polypeptide is made by one or more combination of the IVT, chemical synthesis, host cell expression, or any other methods known in the art.

[0450] Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof, can totally or partially naturally replace occurring nucleosides present in the candidate nucleotide sequence and can be incorporated into a sequence-optimized nucleotide sequence (e.g., a RNA, e.g., an mRNA) encoding a CFTR polypeptide. The resultant polynucleotides, e.g., mRNAs, can then be examined for their ability to produce protein and / or produce a therapeutic outcome. a. In Vitro Transcription / Enzymatic Synthesis

[0451] The present disclosure also provides methods for making a polynucleotide disclosed herein or a complement thereof. In some aspects, a polynucleotide (e.g., an mRNA) disclosed herein can be constructed using in vitro transcription.Attorney Docket No.45817-0138WO1 / MTX968.20

[0452] In other aspects, a polynucleotide (e.g., an mRNA) disclosed herein can be constructed by chemical synthesis using an oligonucleotide synthesizer. In other aspects, a polynucleotide (e.g., an mRNA) disclosed herein is made by using a host cell. In certain aspects, a polynucleotide (e.g., an mRNA) disclosed herein is made by one or more combination of the IVT, chemical synthesis, host cell expression, or any other methods known in the art.

[0453] Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof, can totally or partially naturally replace occurring nucleosides present in the candidate nucleotide sequence and can be incorporated into a sequence-optimized nucleotide sequence (e.g., an mRNA) encoding a CFTR polypeptide. The resultant mRNAs can then be examined for their ability to produce CFTR and / or produce a therapeutic outcome.

[0454] While RNA can be made synthetically using methods well known in the art, in one embodiment an RNA transcript (e.g., mRNA transcript) is synthesized by contacting a DNA template with a RNA polymerase (e.g., a T7 RNA polymerase or a T7 RNA polymerase variant) under conditions that result in the production of RNA transcript.

[0455] In some aspects, the present disclosure provides methods of performing an IVT (in vitro transcription) reaction, comprising contacting a DNA template with the RNA polymerase (e.g., a T7 RNA polymerase, such as a T7 RNA polymerase variant) in the presence of nucleoside triphosphates and buffer under conditions that result in the production of RNA transcripts.

[0456] Other aspects of the present disclosure provide capping methods, e.g., co-transcriptional capping methods or other methods known in the art. In one embodiment, a capping method comprises reacting a polynucleotide template with a T7 RNA polymerase variant, nucleoside triphosphates, and a cap analog under in vitro transcription reaction conditions to produce RNA transcript.

[0457] IVT conditions typically require a purified linear DNA template containing a promoter, nucleoside triphosphates, a buffer system that includes dithiothreitol (DTT) and magnesium ions, and a RNA polymerase. The exact conditions used in the transcription reaction depend on the amount of RNA needed for a specific application. Typical IVT reactions are performed by incubating a DNAAttorney Docket No.45817-0138WO1 / MTX968.20 template with a RNA polymerase and nucleoside triphosphates, including GTP, ATP, CTP, and UTP (or nucleotide analogs) in a transcription buffer. A RNA transcript having a 5 ^ terminal guanosine triphosphate is produced from this reaction.

[0458] A deoxyribonucleic acid (DNA) is simply a nucleic acid template for RNA polymerase. A DNA template may include a polynucleotide encoding a CFTR polypeptide. A DNA template, in some embodiments, includes a RNA polymerase promoter (e.g., a T7 RNA polymerase promoter) located 5' from and operably linked to polynucleotide encoding a CFTR polypeptide. A DNA template may also include a nucleotide sequence encoding a polyadenylation (polyA) tail located at the 3' end of the gene of interest.

[0459] Polypeptides of interest include, but are not limited to, biologics, antibodies, antigens (vaccines), and therapeutic proteins. The term “protein” encompasses peptides.

[0460] A RNA transcript, in some embodiments, is the product of an IVT reaction and, as will be understood by one of ordinary skill in the art, the DNA template for making an RNA molecule is known based on base complementarity. A RNA transcript, in some embodiments, is a messenger RNA (mRNA) that includes a nucleotide sequence encoding a polypeptide of interest linked to a polyA tail. In some embodiments, the mRNA is modified mRNA (mmRNA), which includes at least one modified nucleotide.

[0461] A nucleotide includes a nitrogenous base, a five-carbon sugar (ribose or deoxyribose), and at least one phosphate group. Nucleotides include nucleoside monophosphates, nucleoside diphosphates, and nucleoside triphosphates. A nucleoside monophosphate (NMP) includes a nucleobase linked to a ribose and a single phosphate; a nucleoside diphosphate (NDP) includes a nucleobase linked to a ribose and two phosphates; and a nucleoside triphosphate (NTP) includes a nucleobase linked to a ribose and three phosphates. Nucleotide analogs are compounds that have the general structure of a nucleotide or are structurally similar to a nucleotide. Nucleotide analogs, for example, include an analog of the nucleobase, an analog of the sugar and / or an analog of the phosphate group(s) of a nucleotide.

[0462] A nucleoside includes a nitrogenous base and a 5-carbon sugar. Thus, a nucleoside plus a phosphate group yields a nucleotide. Nucleoside analogs areAttorney Docket No.45817-0138WO1 / MTX968.20 compounds that have the general structure of a nucleoside or are structurally similar to a nucleoside. Nucleoside analogs, for example, include an analog of the nucleobase and / or an analog of the sugar of a nucleoside.

[0463] It should be understood that the term “nucleotide” includes naturally- occurring nucleotides, synthetic nucleotides and modified nucleotides, unless indicated otherwise. Examples of naturally-occurring nucleotides used for the production of RNA, e.g., in an IVT reaction, as provided herein include adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), uridine triphosphate (UTP), and 5-methyluridine triphosphate (m5UTP). In some embodiments, adenosine diphosphate (ADP), guanosine diphosphate (GDP), cytidine diphosphate (CDP), and / or uridine diphosphate (UDP) are used.

[0464] Examples of nucleotide analogs include, but are not limited to, antiviral nucleotide analogs, phosphate analogs (soluble or immobilized, hydrolyzable or non-hydrolyzable), dinucleotide, trinucleotide, tetranucleotide, e.g., a cap analog, or a precursor / substrate for enzymatic capping (vaccinia or ligase), a nucleotide labeled with a functional group to facilitate ligation / conjugation of cap or 5 ^ moiety (IRES), a nucleotide labeled with a 5 ^ PO4to facilitate ligation of cap or 5 ^ moiety, or a nucleotide labeled with a functional group / protecting group that can be chemically or enzymatically cleaved. Examples of antiviral nucleotide / nucleoside analogs include, but are not limited, to Ganciclovir, Entecavir, Telbivudine, Vidarabine and Cidofovir.

[0465] Modified nucleotides may include modified nucleobases. For example, a RNA transcript (e.g., mRNA transcript) of the present disclosure may include a modified nucleobase selected from pseudouridine (ψ), 1-methylpseudouridine (m1ψ), 1-ethylpseudouridine, 2-thiouridine, 4’-thiouridine, 2-thio-1-methyl-1-deaza- pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine , 2-thio- dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2- thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio- pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5- methoxyuridine (mo5U) and 2’-O-methyl uridine. In some embodiments, a RNA transcript (e.g., mRNA transcript) includes a combination of at least two (e.g., 2, 3, 4 or more) of the foregoing modified nucleobases.Attorney Docket No.45817-0138WO1 / MTX968.20

[0466] The nucleoside triphosphates (NTPs) as provided herein may comprise unmodified or modified ATP, modified or unmodified UTP, modified or unmodified GTP, and / or modified or unmodified CTP. In some embodiments, NTPs of an IVT reaction comprise unmodified ATP. In some embodiments, NTPs of an IVT reaction comprise modified ATP. In some embodiments, NTPs of an IVT reaction comprise unmodified UTP. In some embodiments, NTPs of an IVT reaction comprise modified UTP. In some embodiments, NTPs of an IVT reaction comprise unmodified GTP. In some embodiments, NTPs of an IVT reaction comprise modified GTP. In some embodiments, NTPs of an IVT reaction comprise unmodified CTP. In some embodiments, NTPs of an IVT reaction comprise modified CTP.

[0467] The concentration of nucleoside triphosphates and cap analog present in an IVT reaction may vary. In some embodiments, NTPs and cap analog are present in the reaction at equimolar concentrations. In some embodiments, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction is greater than 1:1. For example, the molar ratio of cap analog to nucleoside triphosphates in the reaction may be 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 25:1, 50:1, or 100:1. In some embodiments, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction is less than 1:1. For example, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction may be 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:50, or 1:100.

[0468] The composition of NTPs in an IVT reaction may also vary. For example, ATP may be used in excess of GTP, CTP and UTP. As a non-limiting example, an IVT reaction may include 7.5 millimolar GTP, 7.5 millimolar CTP, 7.5 millimolar UTP, and 3.75 millimolar ATP. The same IVT reaction may include 3.75 millimolar cap analog (e.g., trinucleotide cap). In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:1:0.5:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:0.5:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:0.5:1:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 0.5:1:1:1:0.5.

[0469] In some embodiments, a RNA transcript (e.g., mRNA transcript) includes a modified nucleobase selected from pseudouridine (ψ), 1-Attorney Docket No.45817-0138WO1 / MTX968.20 methylpseudouridine (m1ψ), 5-methoxyuridine (mo5U), 5-methylcytidine (m5C), α- thio-guanosine and α-thio-adenosine. In some embodiments, a RNA transcript (e.g., mRNA transcript)a combination of at least two (e.g., 2, 3, 4 or more) of the foregoing modified nucleobases.

[0470] In some embodiments, a RNA transcript (e.g., mRNA transcript) includes pseudouridine (ψ). In some embodiments, a RNA transcript (e.g., mRNA transcript) includes 1-methylpseudouridine (m1ψ). In some embodiments, a RNA transcript (e.g., mRNA transcript) includes 5-methoxyuridine (mo5U). In some embodiments, a RNA transcript (e.g., mRNA transcript) includes 5-methylcytidine (m5C). In some embodiments, a RNA transcript (e.g., mRNA transcript) includes α- thio-guanosine. In some embodiments, a RNA transcript (e.g., mRNA transcript) includes α-thio-adenosine.

[0471] In some embodiments, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) is uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a polynucleotide can be uniformly modified with 1-methylpseudouridine (m1ψ), meaning that all uridine residues in the mRNA sequence are replaced with 1- methylpseudouridine (m1ψ). Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as any of those set forth above. Alternatively, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) may not be uniformly modified (e.g., partially modified, part of the sequence is modified). Each possibility represents a separate embodiment of the present invention.

[0472] In some embodiments, the buffer system contains tris. The concentration of tris used in an IVT reaction, for example, may be at least 10 mM, at least 20 mM, at least 30 mM, at least 40 mM, at least 50 mM, at least 60 mM, at least 70 mM, at least 80 mM, at least 90 mM, at least 100 mM or at least 110 mM phosphate. In some embodiments, the concentration of phosphate is 20-60 mM or 10- 100 mM.

[0473] In some embodiments, the buffer system contains dithiothreitol (DTT). The concentration of DTT used in an IVT reaction, for example, may be at least 1 mM, at least 5 mM, or at least 50 mM. In some embodiments, the concentration ofAttorney Docket No.45817-0138WO1 / MTX968.20 DTT used in an IVT reaction is 1-50 mM or 5-50 mM. In some embodiments, the concentration of DTT used in an IVT reaction is 5 mM.

[0474] In some embodiments, the buffer system contains magnesium. In some embodiments, the molar ratio of NTP to magnesium ions (Mg2+; e.g., MgCl2) present in an IVT reaction is 1:1 to 1:5. For example, the molar ratio of NTP to magnesium ions may be 1:1, 1:2, 1:3, 1:4 or 1:5.

[0475] In some embodiments, the molar ratio of NTP plus cap analog (e.g., trinucleotide cap, such as GAG) to magnesium ions (Mg2+; e.g., MgCl2) present in an IVT reaction is 1:1 to 1:5. For example, the molar ratio of NTP+trinucleotide cap (e.g., GAG) to magnesium ions may be 1:1, 1:2, 1:3, 1:4 or 1:5.

[0476] In some embodiments, the buffer system contains Tris-HCl, spermidine (e.g., at a concentration of 1-30 mM), TRITON®X-100 (polyethylene glycol p-(1,1,3,3-tetramethylbutyl)-phenyl ether) and / or polyethylene glycol (PEG).

[0477] The addition of nucleoside triphosphates (NTPs) to the 3 ^ end of a growing RNA strand is catalyzed by a polymerase, such as T7 RNA polymerase, for example, any one or more of the T7 RNA polymerase variants (e.g., G47A) of the present disclosure. In some embodiments, the RNA polymerase (e.g., T7 RNA polymerase variant) is present in a reaction (e.g., an IVT reaction) at a concentration of 0.01 mg / ml to 1 mg / ml. For example, the RNA polymerase may be present in a reaction at a concentration of 0.01 mg / mL, 0.05 mg / ml, 0.1 mg / ml, 0.5 mg / ml or 1.0 mg / ml.

[0478] In some embodiments, the polynucleotide of the present disclosure is an IVT polynucleotide. Traditionally, the basic components of an mRNA molecule include at least a coding region, a 5′UTR, a 3′UTR, a 5′ cap and a poly-A tail. The IVT polynucleotides of the present disclosure can function as mRNA but are distinguished from wild-type mRNA in their functional and / or structural design features which serve, e.g., to overcome existing problems of effective polypeptide production using nucleic-acid based therapeutics.

[0479] The primary construct of an IVT polynucleotide comprises a first region of linked nucleotides that is flanked by a first flanking region and a second flaking region. This first region can include, but is not limited to, the encoded CFTR polypeptide. The first flanking region can include a sequence of linked nucleosidesAttorney Docket No.45817-0138WO1 / MTX968.20 which function as a 5’ untranslated region (UTR) such as the 5’ UTR of SEQ ID NO:58. The IVT encoding a CFTR polypeptide can comprise at its 5 terminus a signal sequence region encoding one or more signal sequences. The flanking region can comprise a region of linked nucleotides comprising one or more complete or incomplete 5′ UTRs sequences. The flanking region can also comprise a 5′ terminal cap. The second flanking region can comprise a region of linked nucleotides comprising one or more complete or incomplete 3′ UTRs which can encode the native 3’ UTR of a CFTR polypeptide or a non-native 3’ UTR such as, but not limited to, a heterologous 3’ UTR or a synthetic 3’ UTR. The flanking region can also comprise a 3′ tailing sequence. The 3’ tailing sequence can be, but is not limited to, a polyA tail, a polyA-G quartet and / or a stem loop sequence.

[0480] Additional and exemplary features of IVT polynucleotide architecture and methods of making a polynucleotide are disclosed in International PCT application WO 2017 / 201325, filed on 18 May 2017, the entire contents of which are hereby incorporated by reference. b. Chemical synthesis

[0481] Standard methods can be applied to synthesize an isolated polynucleotide sequence encoding an isolated polypeptide of interest, such as a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide). For example, a single DNA or RNA oligomer containing a codon-optimized nucleotide sequence coding for the particular isolated polypeptide can be synthesized. In other aspects, several small oligonucleotides coding for portions of the desired polypeptide can be synthesized and then ligated. In some aspects, the individual oligonucleotides typically contain 5′ or 3′ overhangs for complementary assembly.

[0482] A polynucleotide disclosed herein (e.g., a RNA, e.g., an mRNA) can be chemically synthesized using chemical synthesis methods and potential nucleobase substitutions known in the art. See, for example, International Publication Nos. WO2014093924, WO2013052523; WO2013039857, WO2012135805, WO2013151671; U.S. Publ. No. US20130115272; or U.S. Pat. Nos. US8999380 or US8710200, all of which are herein incorporated by reference in their entireties.Attorney Docket No.45817-0138WO1 / MTX968.20 c. Quantification of Expressed Polynucleotides Encoding CFTR

[0483] In some embodiments, the polynucleotides of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide), their expression products, as well as degradation products and metabolites can be quantified according to methods known in the art.

[0484] In some embodiments, the polynucleotides of the present invention can be quantified in exosomes or when derived from one or more bodily fluid. As used herein "bodily fluids" include peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, and umbilical cord blood. Alternatively, exosomes can be retrieved from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta.

[0485] In the exosome quantification method, a sample of not more than 2mL is obtained from the subject and the exosomes isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof. In the analysis, the level or concentration of a polynucleotide can be an expression level, presence, absence, truncation or alteration of the administered construct. It is advantageous to correlate the level with one or more clinical phenotypes or with an assay for a human disease biomarker.

[0486] The assay can be performed using construct specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or combinations thereof while the exosomes can be isolated using immunohistochemical methods such as enzyme linked immunosorbent assay (ELISA)Attorney Docket No.45817-0138WO1 / MTX968.20 methods. Exosomes can also be isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof.

[0487] These methods afford the investigator the ability to monitor, in real time, the level of polynucleotides remaining or delivered. This is possible because the polynucleotides of the present invention differ from the endogenous forms due to the structural or chemical modifications.

[0488] In some embodiments, the polynucleotide can be quantified using methods such as, but not limited to, ultraviolet visible spectroscopy (UV / Vis). A non- limiting example of a UV / Vis spectrometer is a NANODROP® spectrometer (ThermoFisher, Waltham, MA). The quantified polynucleotide can be analyzed in order to determine if the polynucleotide can be of proper size, check that no degradation of the polynucleotide has occurred. Degradation of the polynucleotide can be checked by methods such as, but not limited to, agarose gel electrophoresis, HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE) and capillary gel electrophoresis (CGE). 19. Additional Payload Molecules

[0489] In addition to the mRNA payload molecules described in detail above, the LNP delivery vehicles of the invention can be used to deliver other payload molecules. The compositions of the disclosure can be used to deliver a wide variety of different agents for treating CF to an airway cell. An airway cell can be a cell lining the respiratory tract. The therapeutic agent is capable of mediating (e.g., directly mediating or via a bystander effect) a therapeutic effect in such an airway cell. Typically the therapeutic agent delivered by the composition is a nucleic acid molecule that increase expression of a CFTR polypeptide, e.g., an mRNA molecule as set forth above,although other types of molecules that can effect genetic changes inAttorney Docket No.45817-0138WO1 / MTX968.20 cells of a subject to improve expression of a CFTR polypeptide can also be administered using the subject LNPs.

[0490] For example, In one embodiment, the therapeutic agent is an agent that enhances (i.e., increases, stimulates, upregulates) protein expression. Non-limiting examples of types of therapeutic agents that can be used for enhancing protein expression include RNAs, mRNAs, dsRNAs, CRISPR / Cas9 technology, ssDNAs and DNAs (e.g., expression vectors).

[0491] In one embodiment, the therapeutic agent is a DNA therapeutic agent. The DNA molecule can be a double-stranded DNA, a single-stranded DNA (ssDNA), or a molecule that is a partially double-stranded DNA, i.e., has a portion that is double-stranded and a portion that is single-stranded. In some cases the DNA molecule is triple-stranded or is partially triple-stranded, i.e., has a portion that is triple stranded and a portion that is double stranded. The DNA molecule can be a circular DNA molecule or a linear DNA molecule.

[0492] A DNA therapeutic agent can be a DNA molecule that is capable of transferring a gene into a cell, e.g., that encodes and can express a transcript. For example, the DNA therapeutic agent can encode a protein of interest, to thereby increase expression of the protein of interest in an airway upon delivery by an LNP. In some embodiments, the DNA molecule can be naturally-derived, e.g., isolated from a natural source. In other embodiments, the DNA molecule is a synthetic molecule, e.g., a synthetic DNA molecule produced in vitro. In some embodiments, the DNA molecule is a recombinant molecule. Non-limiting exemplary DNA therapeutic agents include plasmid expression vectors and viral expression vectors.

[0493] The DNA therapeutic agents described herein, e.g., DNA vectors, can include a variety of different features. The DNA therapeutic agents described herein, e.g., DNA vectors, can include a non-coding DNA sequence. For example, a DNA sequence can include at least one regulatory element for a gene, e.g., a promoter, enhancer, termination element, polyadenylation signal element, splicing signal element, and the like. In some embodiments, the non-coding DNA sequence is an intron. In some embodiments, the non-coding DNA sequence is a transposon. In some embodiments, a DNA sequence described herein can have a non-coding DNA sequence that is operatively linked to a gene that is transcriptionally active. In otherAttorney Docket No.45817-0138WO1 / MTX968.20 embodiments, a DNA sequence described herein can have a non-coding DNA sequence that is not linked to a gene, i.e., the non-coding DNA does not regulate a gene on the DNA sequence.

[0494] In some embodiments, the payload comprises a genetic modulator, i.e., at least one component of a system which modifies a nucleic acid sequence in a DNA molecule, e.g., by altering a nucleobase, e.g., introducing an insertion, a deletion, a mutation (e.g., a missense mutation, a silent mutation or a nonsense mutation), a duplication, or an inversion, or any combination thereof. In some embodiments, the genetic modulator comprises a DNA base editor, CRISPR / Cas gene editing system, a zinc finger nuclease (ZFN) system, a Transcription activator-like effector nuclease (TALEN) system, a meganuclease system, or a transposase system, or any combination thereof.

[0495] In some embodiments, the genetic modulator comprises a template DNA. In some embodiments, the genetic modulator does not comprise a template DNA. In some embodiments, the genetic modulator comprises a template RNA. In some embodiments, the genetic modulator does not comprise a template RNA.

[0496] In some embodiments, the genetic modulator is a CRISPR / Cas gene editing system. In some embodiments, the CRISPR / Cas gene editing system comprises a guide RNA (gRNA) molecule comprising a targeting sequence specific to a sequence of a target gene and a peptide having nuclease activity, e.g., endonuclease activity, e.g., a Cas protein or a fragment (e.g., biologically active fragment) or a variant thereof, e.g., a Cas9 protein, a fragment (e.g., biologically active fragment) or a variant thereof; a Cas3 protein, a fragment (e.g., biologically active fragment) or a variant thereof; a Cas12a protein, a fragment (e.g., biologically active fragment) or a variant thereof; a Cas 12e protein, a fragment (e.g., biologically active fragment) or a variant thereof; a Cas 13 protein, a fragment (e.g., biologically active fragment) or a variant thereof; or a Cas14 protein, a fragment (e.g., biologically active fragment) or a variant thereof.

[0497] In some embodiments, the CRISPR / Cas gene editing system comprises a gRNA molecule comprising a targeting sequence specific to a sequence of a target gene, and a nucleic acid encoding a peptide having nuclease activity, e.g., endonuclease activity, e.g., a Cas protein or a fragment (e.g., biologically activeAttorney Docket No.45817-0138WO1 / MTX968.20 fragment) or variant thereof, e.g., a Cas9 protein, a fragment (e.g., biologically active fragment) or a variant thereof; a Cas3 protein, a fragment (e.g., biologically active fragment) or a variant thereof; a Cas12a protein, a fragment (e.g., biologically active fragment) or a variant thereof; a Cas12e protein, a fragment (e.g., biologically active fragment) or a variant thereof; a Cas13 protein, a fragment (e.g., biologically active fragment) or a variant thereof; or a Cas14 protein, a fragment (e.g., biologically active fragment) or a variant thereof.

[0498] In some embodiments, the CRISPR / Cas gene editing system comprises a nucleic acid encoding a gRNA molecule comprising a targeting sequence specific to a sequence of a target gene, and a Cas9 protein, a fragment (e.g., biologically active fragment) or a variant thereof.

[0499] In some embodiments, the CRISPR / Cas gene editing system comprises a nucleic acid encoding a gRNA molecule comprising a targeting sequence specific to a sequence of a target gene, and a nucleic acid encoding a Cas9 protein, a fragment (e.g., biologically active fragment) or a variant thereof.

[0500] In some embodiments, the CRISPR / Cas gene editing system further comprises a template DNA. In some embodiments, the CRISPR / Cas gene editing system further comprises a template RNA. In some embodiments, the CRISPR / Cas gene editing system further comprises a Reverse transcriptase.

[0501] In some embodiments of any of the methods, compositions, or cells disclosed herein, the genetic modulator is a zinc finger nuclease (ZFN) system. In some embodiments, the ZFN system comprises a peptide having: a Zinc finger DNA binding domain, a fragment (e.g., biologically active fragment) or a variant thereof; and / or nuclease activity, e.g., endonuclease activity. In some embodiments, the ZFN system comprises a peptide having a Zn finger DNA binding domain. In some embodiments, the Zn finger binding domain comprises 1, 2, 3, 4, 5, 6, 7, 8 or more Zinc fingers. In some embodiments, the ZFN system comprises a peptide having nuclease activity e.g., endonuclease activity. In some embodiments, the peptide having nuclease activity is a type-II restriction 1-like endonuclease, e.g., a FokI endonuclease. In some embodiments, the ZFN system comprises a nucleic acid encoding a peptide having: a Zinc finger DNA binding domain, a fragment (e.g.,Attorney Docket No.45817-0138WO1 / MTX968.20 biologically active fragment) or a variant thereof; and / or nuclease activity, e.g., endonuclease activity.

[0502] In some embodiments, the ZFN system comprises a nucleic acid encoding a peptide having a Zn finger DNA binding domain. In some embodiments, the Zn finger binding domain comprises 1, 2, 3, 4, 5, 6, 7, 8 or more Zinc fingers. In some embodiments, the ZFN system comprises a nucleic acid encoding a peptide having nuclease activity e.g., endonuclease activity. In some embodiments, the peptide having nuclease activity is a type-II restriction 1-like endonuclease, e.g., a FokI endonuclease.

[0503] In some embodiments, the system further comprises a template, e.g., template DNA.

[0504] In some embodiments of any of the methods, compositions, or cells disclosed herein, the genetic modulator is a Transcription activator-like effector nuclease (TALEN) system. In some embodiments, the system comprises a peptide having: a Transcription activator-like (TAL) effector DNA binding domain, a fragment (e.g., biologically active fragment) or a variant thereof; and / or nuclease activity, e.g., endonuclease activity. In some embodiments, the system comprises a peptide having a TAL effector DNA binding domain, a fragment (e.g., biologically active fragment) or a variant thereof. In some embodiments, the system comprises a peptide having nuclease activity, e.g., endonuclease activity. In some embodiments, the peptide having nuclease activity is a type-II restriction 1-like endonuclease, e.g., a FokI endonuclease.

[0505] In some embodiments, the system comprises a nucleic acid encoding a peptide having: a Transcription activator-like (TAL) effector DNA binding domain, a fragment (e.g., biologically active fragment) or a variant thereof; and / or nuclease activity, e.g., endonuclease activity. In some embodiments, the system comprises a nucleic acid encoding a peptide having a Transcription activator-like (TAL) effector DNA binding domain, a fragment (e.g., biologically active fragment) or a variant thereof. In some embodiments, the system comprises a nucleic acid encoding a peptide having nuclease activity, e.g., endonuclease activity. In some embodiments, the peptide having nuclease activity is a type-II restriction 1-like endonuclease, e.g., a FokI endonuclease.Attorney Docket No.45817-0138WO1 / MTX968.20

[0506] In some embodiments, the system further comprises a template, e.g., a template DNA.

[0507] In some embodiments of any of the methods, compositions, or cells disclosed herein, the genetic modulator is a meganuclease system. In some embodiments, the meganuclease system comprises a peptide having a DNA binding domain and nuclease activity, e.g., a homing endonuclease. In some embodiments, the homing endonuclease comprises a LAGLIDADG endonuclease, GIY-YIG endonuclease, HNH endonuclease, His-Cys box endonuclease or a PD-(D / E)XK endonuclease, or a fragment (e.g., biologically active fragment) or variant thereof, e.g., as described in Silva G. et al, (2011) Curr Gene Therapy 11(1): 11-27.

[0508] In some embodiments, the meganuclease system comprises a nucleic acid encoding a peptide having a DNA binding domain and nuclease activity, e.g., a homing endonuclease. In some embodiments, the homing endonuclease comprises a LAGLIDADG endonuclease, GIY-YIG endonuclease, HNH endonuclease, His-Cys box endonuclease or a PD-(D / E)XK endonuclease, or a fragment (e.g., biologically active fragment) or variant thereof, e.g., as described in Silva G. et al, (2011) Curr Gene Therapy 11(1): 11-27.

[0509] In some embodiments of any of the methods, compositions, or cells disclosed herein, the genetic modulator is a transposase system. In some embodiments, the transposase system comprises a nucleic acid sequence encoding a peptide having reverse transcriptase and / or nuclease activity, e.g., a retrotransposon, e.g., an LTR retrotransposon or a non-LTR retrotransposon. In some embodiments, the transposase system comprises a template, e.g., an RNA template.

[0510] In one embodiment, the therapeutic agent is an RNA therapeutic agent. The RNA molecule can be a single-stranded RNA, a double-stranded RNA (dsRNA) or a molecule that is a partially double-stranded RNA, i.e., has a portion that is double-stranded and a portion that is single-stranded. The RNA molecule can be a circular RNA molecule or a linear RNA molecule.

[0511] An RNA therapeutic agent can be an RNA therapeutic agent that is capable of transferring a gene into a cell, e.g., encodes a protein of interest, to thereby increase expression of the protein of interest in an airway cell. In some embodiments, the RNA molecule can be naturally-derived, e.g., isolated from a natural source. InAttorney Docket No.45817-0138WO1 / MTX968.20 other embodiments, the RNA molecule is a synthetic molecule, e.g., a synthetic RNA molecule produced in vitro.

[0512] Non-limiting examples of RNA therapeutic agents include messenger RNAs (mRNAs) (e.g., encoding a protein of interest), modified mRNAs (mmRNAs), mRNAs that incorporate a micro-RNA binding site(s) (miR binding site(s)), modified RNAs that comprise functional RNA elements, microRNAs (miRNAs), antagomirs, small (short) interfering RNAs (siRNAs) (including shortmers and dicer-substrate RNAs), RNA interference (RNAi) molecules, antisense RNAs, ribozymes, small hairpin RNAs (shRNA), locked nucleic acids (LNAs) and that encode components of CRISPR / Cas9 technology, each of which is described further in subsections below. In some embodiments, the RNA modulator comprises an RNA base editor system. In some embodiments, the RNA base editor system comprises: a deaminase, e.g., an RNA-specific adenosine deaminase (ADAR); a Cas protein, a fragment (e.g., biologically active fragment) or a variant thereof; and / or a guide RNA. In some embodiments, the RNA base editor system further comprises a template, e.g., a DNA or RNA template. Exemplary mRNA molecules for use in treating CF are set forth in detail above. 20. Methods of Making Polynucleotides

[0513] The present disclosure also provides methods for making a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide) or a complement thereof.

[0514] In some aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a CFTR polypeptide, can be constructed using in vitro transcription (IVT). In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a CFTR polypeptide, can be constructed by chemical synthesis using an oligonucleotide synthesizer.

[0515] In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a CFTR polypeptide is made by using a host cell. In certain aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, andAttorney Docket No.45817-0138WO1 / MTX968.20 encoding a CFTR polypeptide is made by one or more combination of the IVT, chemical synthesis, host cell expression, or any other methods known in the art.

[0516] Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof, can totally or partially naturally replace occurring nucleosides present in the candidate nucleotide sequence and can be incorporated into a sequence-optimized nucleotide sequence (e.g., a RNA, e.g., an mRNA) encoding a CFTR polypeptide. The resultant polynucleotides, e.g., mRNAs, can then be examined for their ability to produce protein and / or produce a therapeutic outcome. a. In Vitro Transcription / Enzymatic Synthesis

[0517] The present disclosure also provides methods for making a polynucleotide disclosed herein or a complement thereof. In some aspects, a polynucleotide (e.g., an mRNA) disclosed herein can be constructed using in vitro transcription.

[0518] In other aspects, a polynucleotide (e.g., an mRNA) disclosed herein can be constructed by chemical synthesis using an oligonucleotide synthesizer. In other aspects, a polynucleotide (e.g., an mRNA) disclosed herein is made by using a host cell. In certain aspects, a polynucleotide (e.g., an mRNA) disclosed herein is made by one or more combination of the IVT, chemical synthesis, host cell expression, or any other methods known in the art.

[0519] Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof, can totally or partially naturally replace occurring nucleosides present in the candidate nucleotide sequence and can be incorporated into a sequence-optimized nucleotide sequence (e.g., an mRNA) encoding a CFTR polypeptide. The resultant mRNAs can then be examined for their ability to produce CFTR and / or produce a therapeutic outcome.

[0520] While RNA can be made synthetically using methods well known in the art, in one embodiment an RNA transcript (e.g., mRNA transcript) is synthesized by contacting a DNA template with a RNA polymerase (e.g., a T7 RNA polymerase or a T7 RNA polymerase variant) under conditions that result in the production of RNA transcript.Attorney Docket No.45817-0138WO1 / MTX968.20

[0521] In some aspects, the present disclosure provides methods of performing an IVT (in vitro transcription) reaction, comprising contacting a DNA template with the RNA polymerase (e.g., a T7 RNA polymerase, such as a T7 RNA polymerase variant) in the presence of nucleoside triphosphates and buffer under conditions that result in the production of RNA transcripts.

[0522] Other aspects of the present disclosure provide capping methods, e.g., co-transcriptional capping methods or other methods known in the art. In one embodiment, a capping method comprises reacting a polynucleotide template with a T7 RNA polymerase variant, nucleoside triphosphates, and a cap analog under in vitro transcription reaction conditions to produce RNA transcript.

[0523] IVT conditions typically require a purified linear DNA template containing a promoter, nucleoside triphosphates, a buffer system that includes dithiothreitol (DTT) and magnesium ions, and a RNA polymerase. The exact conditions used in the transcription reaction depend on the amount of RNA needed for a specific application. Typical IVT reactions are performed by incubating a DNA template with a RNA polymerase and nucleoside triphosphates, including GTP, ATP, CTP, and UTP (or nucleotide analogs) in a transcription buffer. A RNA transcript having a 5 ^ terminal guanosine triphosphate is produced from this reaction.

[0524] A deoxyribonucleic acid (DNA) is simply a nucleic acid template for RNA polymerase. A DNA template may include a polynucleotide encoding a CFTR polypeptide. A DNA template, in some embodiments, includes a RNA polymerase promoter (e.g., a T7 RNA polymerase promoter) located 5' from and operably linked to polynucleotide encoding a CFTR polypeptide. A DNA template may also include a nucleotide sequence encoding a polyadenylation (polyA) tail located at the 3' end of the gene of interest.

[0525] Polypeptides of interest include, but are not limited to, biologics, antibodies, antigens (vaccines), and therapeutic proteins. The term “protein” encompasses peptides.

[0526] A RNA transcript, in some embodiments, is the product of an IVT reaction and, as will be understood by one of ordinary skill in the art, the DNA template for making an RNA molecule is known based on base complementarity. A RNA transcript, in some embodiments, is a messenger RNA (mRNA) that includes aAttorney Docket No.45817-0138WO1 / MTX968.20 nucleotide sequence encoding a polypeptide of interest linked to a polyA tail. In some embodiments, the mRNA is modified mRNA (mmRNA), which includes at least one modified nucleotide.

[0527] A nucleotide includes a nitrogenous base, a five-carbon sugar (ribose or deoxyribose), and at least one phosphate group. Nucleotides include nucleoside monophosphates, nucleoside diphosphates, and nucleoside triphosphates. A nucleoside monophosphate (NMP) includes a nucleobase linked to a ribose and a single phosphate; a nucleoside diphosphate (NDP) includes a nucleobase linked to a ribose and two phosphates; and a nucleoside triphosphate (NTP) includes a nucleobase linked to a ribose and three phosphates. Nucleotide analogs are compounds that have the general structure of a nucleotide or are structurally similar to a nucleotide. Nucleotide analogs, for example, include an analog of the nucleobase, an analog of the sugar and / or an analog of the phosphate group(s) of a nucleotide.

[0528] A nucleoside includes a nitrogenous base and a 5-carbon sugar. Thus, a nucleoside plus a phosphate group yields a nucleotide. Nucleoside analogs are compounds that have the general structure of a nucleoside or are structurally similar to a nucleoside. Nucleoside analogs, for example, include an analog of the nucleobase and / or an analog of the sugar of a nucleoside.

[0529] It should be understood that the term “nucleotide” includes naturally- occurring nucleotides, synthetic nucleotides and modified nucleotides, unless indicated otherwise. Examples of naturally-occurring nucleotides used for the production of RNA, e.g., in an IVT reaction, as provided herein include adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), uridine triphosphate (UTP), and 5-methyluridine triphosphate (m5UTP). In some embodiments, adenosine diphosphate (ADP), guanosine diphosphate (GDP), cytidine diphosphate (CDP), and / or uridine diphosphate (UDP) are used.

[0530] Examples of nucleotide analogs include, but are not limited to, antiviral nucleotide analogs, phosphate analogs (soluble or immobilized, hydrolyzable or non-hydrolyzable), dinucleotide, trinucleotide, tetranucleotide, e.g., a cap analog, or a precursor / substrate for enzymatic capping (vaccinia or ligase), a nucleotide labeled with a functional group to facilitate ligation / conjugation of cap or 5 ^ moiety (IRES), a nucleotide labeled with a 5 ^ PO4to facilitate ligation of cap or 5 ^ moiety, orAttorney Docket No.45817-0138WO1 / MTX968.20 a nucleotide labeled with a functional group / protecting group that can be chemically or enzymatically cleaved. Examples of antiviral nucleotide / nucleoside analogs include, but are not limited, to Ganciclovir, Entecavir, Telbivudine, Vidarabine and Cidofovir.

[0531] Modified nucleotides may include modified nucleobases. For example, a RNA transcript (e.g., mRNA transcript) of the present disclosure may include a modified nucleobase selected from pseudouridine (ψ), 1-methylpseudouridine (m1ψ), 1-ethylpseudouridine, 2-thiouridine, 4’-thiouridine, 2-thio-1-methyl-1-deaza- pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine , 2-thio- dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2- thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio- pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5- methoxyuridine (mo5U) and 2’-O-methyl uridine. In some embodiments, a RNA transcript (e.g., mRNA transcript) includes a combination of at least two (e.g., 2, 3, 4 or more) of the foregoing modified nucleobases.

[0532] The nucleoside triphosphates (NTPs) as provided herein may comprise unmodified or modified ATP, modified or unmodified UTP, modified or unmodified GTP, and / or modified or unmodified CTP. In some embodiments, NTPs of an IVT reaction comprise unmodified ATP. In some embodiments, NTPs of an IVT reaction comprise modified ATP. In some embodiments, NTPs of an IVT reaction comprise unmodified UTP. In some embodiments, NTPs of an IVT reaction comprise modified UTP. In some embodiments, NTPs of an IVT reaction comprise unmodified GTP. In some embodiments, NTPs of an IVT reaction comprise modified GTP. In some embodiments, NTPs of an IVT reaction comprise unmodified CTP. In some embodiments, NTPs of an IVT reaction comprise modified CTP.

[0533] The concentration of nucleoside triphosphates and cap analog present in an IVT reaction may vary. In some embodiments, NTPs and cap analog are present in the reaction at equimolar concentrations. In some embodiments, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction is greater than 1:1. For example, the molar ratio of cap analog to nucleoside triphosphates in the reaction may be 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 25:1, 50:1, or 100:1. In some embodiments, the molar ratio of cap analog (e.g.,Attorney Docket No.45817-0138WO1 / MTX968.20 trinucleotide cap) to nucleoside triphosphates in the reaction is less than 1:1. For example, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction may be 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:50, or 1:100.

[0534] The composition of NTPs in an IVT reaction may also vary. For example, ATP may be used in excess of GTP, CTP and UTP. As a non-limiting example, an IVT reaction may include 7.5 millimolar GTP, 7.5 millimolar CTP, 7.5 millimolar UTP, and 3.75 millimolar ATP. The same IVT reaction may include 3.75 millimolar cap analog (e.g., trinucleotide cap). In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:1:0.5:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:0.5:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:0.5:1:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 0.5:1:1:1:0.5.

[0535] In some embodiments, a RNA transcript (e.g., mRNA transcript) includes a modified nucleobase selected from pseudouridine (ψ), 1- methylpseudouridine (m1ψ), 5-methoxyuridine (mo5U), 5-methylcytidine (m5C), α- thio-guanosine and α-thio-adenosine. In some embodiments, a RNA transcript (e.g., mRNA transcript) includes a combination of at least two (e.g., 2, 3, 4 or more) of the foregoing modified nucleobases.

[0536] In some embodiments, a RNA transcript (e.g., mRNA transcript) includes pseudouridine (ψ). In some embodiments, a RNA transcript (e.g., mRNA transcript) includes 1-methylpseudouridine (m1ψ). In some embodiments, a RNA transcript (e.g., mRNA transcript) includes 5-methoxyuridine (mo5U). In some embodiments, a RNA transcript (e.g., mRNA transcript) includes 5-methylcytidine (m5C). In some embodiments, a RNA transcript (e.g., mRNA transcript) includes α- thio-guanosine. In some embodiments, a RNA transcript (e.g., mRNA transcript) includes α-thio-adenosine.

[0537] In some embodiments, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) is uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a polynucleotide can be uniformly modified with 1-methylpseudouridine (m1ψ), meaning that all uridine residues in the mRNA sequence are replaced with 1-Attorney Docket No.45817-0138WO1 / MTX968.20 methylpseudouridine (m1ψ). Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as any of those set forth above. Alternatively, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) may not be uniformly modified (e.g., partially modified, part of the sequence is modified). Each possibility represents a separate embodiment of the present invention.

[0538] In some embodiments, the buffer system contains tris. The concentration of tris used in an IVT reaction, for example, may be at least 10 mM, at least 20 mM, at least 30 mM, at least 40 mM, at least 50 mM, at least 60 mM, at least 70 mM, at least 80 mM, at least 90 mM, at least 100 mM or at least 110 mM phosphate. In some embodiments, the concentration of phosphate is 20-60 mM or 10- 100 mM.

[0539] In some embodiments, the buffer system contains dithiothreitol (DTT). The concentration of DTT used in an IVT reaction, for example, may be at least 1 mM, at least 5 mM, or at least 50 mM. In some embodiments, the concentration of DTT used in an IVT reaction is 1-50 mM or 5-50 mM. In some embodiments, the concentration of DTT used in an IVT reaction is 5 mM.

[0540] In some embodiments, the buffer system contains magnesium. In some embodiments, the molar ratio of NTP to magnesium ions (Mg2+; e.g., MgCl2) present in an IVT reaction is 1:1 to 1:5. For example, the molar ratio of NTP to magnesium ions may be 1:1, 1:2, 1:3, 1:4 or 1:5.

[0541] In some embodiments, the molar ratio of NTP plus cap analog (e.g., trinucleotide cap, such as GAG) to magnesium ions (Mg2+; e.g., MgCl2) present in an IVT reaction is 1:1 to 1:5. For example, the molar ratio of NTP+trinucleotide cap (e.g., GAG) to magnesium ions may be 1:1, 1:2, 1:3, 1:4 or 1:5.

[0542] In some embodiments, the buffer system contains Tris-HCl, spermidine (e.g., at a concentration of 1-30 mM), TRITON®X-100 (polyethylene glycol p-(1,1,3,3-tetramethylbutyl)-phenyl ether) and / or polyethylene glycol (PEG).

[0543] The addition of nucleoside triphosphates (NTPs) to the 3 ^ end of a growing RNA strand is catalyzed by a polymerase, such as T7 RNA polymerase, for example, any one or more of the T7 RNA polymerase variants (e.g., G47A) of the present disclosure. In some embodiments, the RNA polymerase (e.g., T7 RNAAttorney Docket No.45817-0138WO1 / MTX968.20 polymerase variant) is present in a reaction (e.g., an IVT reaction) at a concentration of 0.01 mg / ml to 1 mg / ml. For example, the RNA polymerase may be present in a reaction at a concentration of 0.01 mg / mL, 0.05 mg / ml, 0.1 mg / ml, 0.5 mg / ml or 1.0 mg / ml.

[0544] In some embodiments, the polynucleotide of the present disclosure is an IVT polynucleotide. Traditionally, the basic components of an mRNA molecule include at least a coding region, a 5′UTR, a 3′UTR, a 5′ cap and a poly-A tail. The IVT polynucleotides of the present disclosure can function as mRNA but are distinguished from wild-type mRNA in their functional and / or structural design features which serve, e.g., to overcome existing problems of effective polypeptide production using nucleic-acid based therapeutics.

[0545] The primary construct of an IVT polynucleotide comprises a first region of linked nucleotides that is flanked by a first flanking region and a second flaking region. This first region can include, but is not limited to, the encoded CFTR polypeptide. The first flanking region can include a sequence of linked nucleosides which function as a 5’ untranslated region (UTR) such as the 5’ UTR of SEQ ID NO:58. The IVT encoding a CFTR polypeptide can comprise at its 5 terminus a signal sequence region encoding one or more signal sequences. The flanking region can comprise a region of linked nucleotides comprising one or more complete or incomplete 5′ UTRs sequences. The flanking region can also comprise a 5′ terminal cap. The second flanking region can comprise a region of linked nucleotides comprising one or more complete or incomplete 3′ UTRs which can encode the native 3’ UTR of a CFTR polypeptide or a non-native 3’ UTR such as, but not limited to, a heterologous 3’ UTR or a synthetic 3’ UTR. The flanking region can also comprise a 3′ tailing sequence. The 3’ tailing sequence can be, but is not limited to, a polyA tail, a polyA-G quartet and / or a stem loop sequence.

[0546] Additional and exemplary features of IVT polynucleotide architecture and methods of making a polynucleotide are disclosed in International PCT application WO 2017 / 201325, filed on 18 May 2017, the entire contents of which are hereby incorporated by reference.Attorney Docket No.45817-0138WO1 / MTX968.20 b. Chemical synthesis

[0547] Standard methods can be applied to synthesize an isolated polynucleotide sequence encoding an isolated polypeptide of interest, such as a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide). For example, a single DNA or RNA oligomer containing a codon-optimized nucleotide sequence coding for the particular isolated polypeptide can be synthesized. In other aspects, several small oligonucleotides coding for portions of the desired polypeptide can be synthesized and then ligated. In some aspects, the individual oligonucleotides typically contain 5′ or 3′ overhangs for complementary assembly.

[0548] A polynucleotide disclosed herein (e.g., a RNA, e.g., an mRNA) can be chemically synthesized using chemical synthesis methods and potential nucleobase substitutions known in the art. See, for example, International Publication Nos. WO2014093924, WO2013052523; WO2013039857, WO2012135805, WO2013151671; U.S. Publ. No. US20130115272; or U.S. Pat. Nos. US8999380 or US8710200, all of which are herein incorporated by reference in their entireties. c. Quantification of Expressed Polynucleotides Encoding CFTR

[0549] In some embodiments, the polynucleotides of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide), their expression products, as well as degradation products and metabolites can be quantified according to methods known in the art.

[0550] In some embodiments, the polynucleotides of the present invention can be quantified in exosomes or when derived from one or more bodily fluid. As used herein "bodily fluids" include peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, and umbilical cord blood. Alternatively, exosomesAttorney Docket No.45817-0138WO1 / MTX968.20 can be retrieved from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta.

[0551] In the exosome quantification method, a sample of not more than 2mL is obtained from the subject and the exosomes isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof. In the analysis, the level or concentration of a polynucleotide can be an expression level, presence, absence, truncation or alteration of the administered construct. It is advantageous to correlate the level with one or more clinical phenotypes or with an assay for a human disease biomarker.

[0552] The assay can be performed using construct specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or combinations thereof while the exosomes can be isolated using immunohistochemical methods such as enzyme linked immunosorbent assay (ELISA) methods. Exosomes can also be isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof.

[0553] These methods afford the investigator the ability to monitor, in real time, the level of polynucleotides remaining or delivered. This is possible because the polynucleotides of the present invention differ from the endogenous forms due to the structural or chemical modifications.

[0554] In some embodiments, the polynucleotide can be quantified using methods such as, but not limited to, ultraviolet visible spectroscopy (UV / Vis). A non- limiting example of a UV / Vis spectrometer is a NANODROP® spectrometer (ThermoFisher, Waltham, MA). The quantified polynucleotide can be analyzed in order to determine if the polynucleotide can be of proper size, check that no degradation of the polynucleotide has occurred. Degradation of the polynucleotide can be checked by methods such as, but not limited to, agarose gel electrophoresis, HPLC based purification methods such as, but not limited to, strong anion exchangeAttorney Docket No.45817-0138WO1 / MTX968.20 HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE) and capillary gel electrophoresis (CGE). 21. Pharmaceutical Compositions and Formulations

[0555] The present invention provides pharmaceutical compositions and formulations that comprise any of the polynucleotides described above. In some embodiments, the composition or formulation further comprises a delivery agent.

[0556] In some embodiments, the composition or formulation can contain a polynucleotide comprising a sequence optimized nucleic acid sequence disclosed herein which encodes a CFTR polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide comprising a sequence optimized nucleic acid sequence disclosed herein which encodes a CFTR polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide comprising a sequence optimized nucleic acid sequence disclosed herein which encodes a CFTR polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a polynucleotide (e.g., an ORF) having significant sequence identity to a sequence optimized nucleic acid sequence disclosed herein which encodes a CFTR polypeptide. In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds miR-126, miR-142, miR-144, miR-146, miR- 150, miR-155, miR-16, miR-21, miR-223, miR-24, miR-27 and miR-26a.

[0557] Pharmaceutical compositions or formulation can optionally comprise one or more additional active substances, e.g., therapeutically and / or prophylactically active substances. Pharmaceutical compositions or formulation of the present invention can be sterile and / or pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceutical agents can be found, for example, in Remington: The Science and Practice of Pharmacy 21sted., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety). In some embodiments, compositions are administered to humans, human patients or subjects.Attorney Docket No.45817-0138WO1 / MTX968.20 For the purposes of the present disclosure, the phrase "active ingredient" generally refers to polynucleotides to be delivered as described herein.

[0558] Formulations and pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of associating the active ingredient with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping and / or packaging the product into a desired single- or multi-dose unit.

[0559] A pharmaceutical composition or formulation in accordance with the present disclosure can be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a "unit dose" refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient that would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

[0560] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure can vary, depending upon the identity, size, and / or condition of the subject being treated and further depending upon the route by which the composition is to be administered.

[0561] In some embodiments, the compositions and formulations described herein can contain at least one polynucleotide of the invention. As a non-limiting example, the composition or formulation can contain 1, 2, 3, 4 or 5 polynucleotides of the invention. In some embodiments, the compositions or formulations described herein can comprise more than one type of polynucleotide. In some embodiments, the composition or formulation can comprise a polynucleotide in linear and circular form. In another embodiment, the composition or formulation can comprise a circular polynucleotide and an in vitro transcribed (IVT) polynucleotide. In yet another embodiment, the composition or formulation can comprise an IVT polynucleotide, a chimeric polynucleotide and a circular polynucleotide.Attorney Docket No.45817-0138WO1 / MTX968.20

[0562] Although the descriptions of pharmaceutical compositions and formulations provided herein are principally directed to pharmaceutical compositions and formulations that are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals.

[0563] The present invention provides pharmaceutical formulations that comprise one or more polynucleotides described herein (e.g., one or more polynucleotides comprising nucleotide sequences encoding a CFTR polypeptide). In some instances, the present invention provides pharmaceutical formulations that comprise a polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide). The polynucleotides described herein can be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection; (3) permit the sustained or delayed release (e.g., from a depot formulation of the polynucleotide); (4) alter the biodistribution (e.g., target the polynucleotide to specific tissues or cell types); (5) increase the translation of encoded protein in vivo; and / or (6) alter the release profile of encoded protein in vivo. In some embodiments, the pharmaceutical formulation further comprises a delivery agent comprising, e.g., a compound having the Formula (I), e.g., Compound II or Compound B; or a compound having the Formula (III), (IV), (V), or (VI), e.g., Compound I or VI, or any combination thereof. In some embodiments, the delivery agent comprises an ionizable amino lipid (e.g., Compound II, VI, or B), a helper lipid (e.g., DSPC), a sterol (e.g., Cholesterol), and a PEG lipid (e.g., Compound I or PEG- DMG), e.g., with a mole ratio in the range of about (i) 40-50 mol% ionizable amino lipid (e.g., Compound II, VI, or B), optionally 45-50 mol% ionizable amino lipid, for example, 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol% for example about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%; (ii) 30-45 mol% sterol (e.g., cholesterol), optionally 35-42 mol% sterol, for example, 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 35-35 mol%, 35-36 mol%, 36-37 mol%, 37-38 mol%, 38-39 mol%, or 39-40 mol%, or 40-42 mol% sterol; (iii) 5-15 mol% helper lipid (e.g., DSPC), optionally 10-15 mol% helper lipid, for example, 5-6 mol%, 6-7 mol%, 7-8 mol%, 8- 9 mol%, 9-10 mol%, 10-11 mol%, 11-12 mol%, 12-13 mol%, 13-14 mol%, or 14-15Attorney Docket No.45817-0138WO1 / MTX968.20 mol% helper lipid; and (iv) 1-5% PEG lipid (e.g., Compound I or PEG-DMG), optionally 1-5 mol% PEG lipid, for example 1.5 to 2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol% PEG lipid. In some embodiments, the delivery agent comprises Compound B, Cholesterol, DSPC, and Compound I.

[0564] A pharmaceutically acceptable excipient, as used herein, includes, but are not limited to, any and all solvents, dispersion media, or other liquid vehicles, dispersion or suspension aids, diluents, granulating and / or dispersing agents, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, binders, lubricants or oil, coloring, sweetening or flavoring agents, stabilizers, antioxidants, antimicrobial or antifungal agents, osmolality adjusting agents, pH adjusting agents, buffers, chelants, cyoprotectants, and / or bulking agents, as suited to the particular dosage form desired. Various excipients for Formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference in its entirety).

[0565] Exemplary diluents include, but are not limited to, calcium or sodium carbonate, calcium phosphate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, etc., and / or combinations thereof.

[0566] Exemplary surface active agents and / or emulsifiers include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monooleate [TWEEN®80], sorbitan monopalmitate [SPAN®40], glyceryl monooleate, polyoxyethylene esters, polyethylene glycol fatty acid esters (e.g., CREMOPHOR®), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [BRIJ®30]), PLUORINC®F 68, POLOXAMER®188, etc. and / or combinations thereof.

[0567] Exemplary binding agents include, but are not limited to, starch, gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol), amino acids (e.g., glycine), natural and synthetic gums (e.g., acacia,Attorney Docket No.45817-0138WO1 / MTX968.20 sodium alginate), ethylcellulose, hydroxyethylcellulose, hydroxypropyl methylcellulose, etc., and combinations thereof.

[0568] Oxidation is a potential degradation pathway for mRNA, especially for liquid mRNA formulations. In order to prevent oxidation, antioxidants can be added to the formulations. Exemplary antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, ascorbyl palmitate, benzyl alcohol, butylated hydroxyanisole, m-cresol, methionine, butylated hydroxytoluene, monothioglycerol, sodium or potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, etc., and combinations thereof.

[0569] Exemplary chelating agents include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, trisodium edetate, etc., and combinations thereof.

[0570] Exemplary antimicrobial or antifungal agents include, but are not limited to, benzalkonium chloride, benzethonium chloride, methyl paraben, ethyl paraben, propyl paraben, butyl paraben, benzoic acid, hydroxybenzoic acid, potassium or sodium benzoate, potassium or sodium sorbate, sodium propionate, sorbic acid, etc., and combinations thereof.

[0571] Exemplary preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, ascorbic acid, butylated hydroxyanisol, ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), etc., and combinations thereof.

[0572] In some embodiments, the pH of polynucleotide solutions is maintained between pH 5 and pH 8 to improve stability. Exemplary buffers to control pH can include, but are not limited to sodium phosphate, sodium citrate, sodium succinate, histidine (or histidine-HCl), sodium malate, sodium carbonate, etc., and / or combinations thereof.

[0573] Exemplary lubricating agents include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium or magnesium lauryl sulfate, etc., and combinations thereof.Attorney Docket No.45817-0138WO1 / MTX968.20

[0574] The pharmaceutical composition or formulation described here can contain a cryoprotectant to stabilize a polynucleotide described herein during freezing. Exemplary cryoprotectants include, but are not limited to mannitol, sucrose, trehalose, lactose, glycerol, dextrose, etc., and combinations thereof.

[0575] The pharmaceutical composition or formulation described here can contain a bulking agent in lyophilized polynucleotide formulations to yield a "pharmaceutically elegant" cake, stabilize the lyophilized polynucleotides during long term (e.g., 36 month) storage. Exemplary bulking agents of the present invention can include, but are not limited to sucrose, trehalose, mannitol, glycine, lactose, raffinose, and combinations thereof.

[0576] In some embodiments, the pharmaceutical composition or formulation further comprises a delivery agent. The delivery agent of the present disclosure can include, without limitation, liposomes, lipid nanoparticles, lipidoids, polymers, lipoplexes, microvesicles, exosomes, peptides, proteins, cells transfected with polynucleotides, hyaluronidase, nanoparticle mimics, nanotubes, conjugates, and combinations thereof. 22. Delivery Agents

[0577] The present disclosure provides pharmaceutical compositions with advantageous properties. The lipid compositions described herein may be advantageously used in lipid nanoparticle compositions for the delivery of therapeutic and / or prophylactic agents, e.g., mRNAs, to mammalian cells or organs. For example, the lipids described herein have little or no immunogenicity. For example, the lipid compounds disclosed herein have a lower immunogenicity as compared to a reference lipid (e.g., MC3, KC2, or DLinDMA). For example, a formulation comprising a lipid disclosed herein and a therapeutic or prophylactic agent, e.g., mRNA, has an increased therapeutic index as compared to a corresponding formulation which comprises a reference lipid (e.g., MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent.

[0578] In certain embodiments, the present application provides pharmaceutical compositions comprising:Attorney Docket No.45817-0138WO1 / MTX968.20 (a) a polynucleotide comprising a nucleotide sequence encoding a CFTR polypeptide; and (b) a delivery agent. (a) Lipid Nanoparticle Formulations

[0579] In some embodiments, nucleic acids of the invention (e.g., a CFTR mRNA) are formulated in a lipid nanoparticle (LNP). Lipid nanoparticles typically comprise ionizable cationic lipid, non-cationic lipid, sterol and PEG lipid components along with the nucleic acid cargo of interest. The lipid nanoparticles can also include one or more lipid amines. The lipid nanoparticles of the invention can be generated using components, compositions, and methods as are generally known in the art, see for example PCT / US2016 / 052352; PCT / US2016 / 068300; PCT / US2017 / 037551; PCT / US2015 / 027400; PCT / US2016 / 047406; PCT / US2016000129; PCT / US2016 / 014280; PCT / US2016 / 014280; PCT / US2017 / 038426; PCT / US2014 / 027077; PCT / US2014 / 055394; PCT / US2016 / 52117; PCT / US2012 / 069610; PCT / US2017 / 027492; PCT / US2016 / 059575; PCT / US2016 / 069491; and PCT / US2022 / 048223, all of which are incorporated by reference herein in their entirety.

[0580] Nucleic acids of the present disclosure (e.g., a CFTR mRNA) are typically formulated in lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises at least one ionizable cationic lipid, at least one non-cationic lipid, at least one sterol, at least one polyethylene glycol (PEG)-modified lipid, and / or at least one or more lipid amine.

[0581] In some embodiments, the lipid nanoparticle comprises about 30 mol% to about 60 mol%, about 35 mol% to about 55 mol%, about 40 mol% to about 50 mol%, or about 45 mol% to about 50 mol% of ionizable lipid.

[0582] In some embodiments, the lipid nanoparticle comprises about 5 mol% to about 15 mol%, about 8 mol% to about 13 mol%, or about 10 mol% to about 12 mol% of non-cationic lipid like phospholipid.

[0583] In some embodiments, the lipid nanoparticle comprises about 20 mol% to about 60 mol%, about 30 mol% to about 50 mol%, or about 35 mol% to about 40Attorney Docket No.45817-0138WO1 / MTX968.20 mol% of sterol. In some embodiments, the LNP comprises about 35 mol% of sterol. In some embodiments, the LNP comprises about 40 mol% of sterol.

[0584] In some embodiments, the lipid nanoparticle comprises about 0.1 mol% to about 5.0 mol%, about 0.5 mol% to about 5.0 mol%, about 1.0 mol% to about 5.0 mol%, about 1.0 mol% to about 2.5 mol%, about 0.5 mol% to about 2.0 mol%, or about 1.0 mol% to about 1.5 mol% of PEG-lipid. In some embodiments, the LNP comprises about 1.5 mol % or about 3.0 mol % PEG-lipid. Certain of the LNPs provided herein comprise no or low levels of PEG-lipid. Some LNPs comprise less than 0.5 mol % PEG-lipid.

[0585] In some embodiments, the weight ratio of the lipid amine to nucleic acid in the lipid nanoparticle compositions is about 0.1:1 to about 15:1, about 0.2:1 to about 10:1, about 1:1 to about 10:1, about 1:1 to about 8:1, about 1:1 to about 7:1, about 1:1 to about 6:1, about 1:1 to about 5:1, about 1:1 to about 4:1, or about 1.25:1 to about 3.75:1. In some embodiments, a weight ratio of the lipid amine to payload is about 1.25:1, about 2.5:1, or about 3.75:1. In some embodiments, a molar ratio of the lipid amine to nucleic acid is about 0.1:1 to about 20:1, about 1.5:1 to about 10:1, about 1.5:1 to about 9:1, about 1.5:1 to about 8:1, about 1.5:1 to about 7:1, about 1.5:1 to about 6:1, or about 1.5:1 to about 5:1. In some embodiments, a molar ratio of the lipid amine to payload is about 1.5:1, about 2:1, about 3:1, about 4:1, or about 5:1. (b) Ionizable amino lipids

[0586] In some aspects, the disclosure relates to a compound of Formula (I): or its N-oxide, or a salt or isomer thereof,Attorney Docket No.45817-0138WO1 / MTX968.20 wherein Raα, Raβ, Raγ, and Raδare each independently selected from the group consisting of H, C2-12alkyl, and C2-12alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is selected from the group consisting of -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, , wherein denotes a pointR10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; each R6is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12alkyl or C2-12alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some embodiments of the compounds of Formula (I), R’ais R’branched; denotes a point of attachment; Raα, Raβ, Raγ,C1-14 alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12alkyl; l is 5; and m is 7.Attorney Docket No.45817-0138WO1 / MTX968.20

[0587] In some embodiments of the compounds of Formula (I), R’ais R’branched; a point of attachment; Raα, Raβ, Raγ, and R4is -(CH2)nOH; n is 2; each R5is H;- is a C1-12alkyl; l is 3; and m is 7.

[0588] In some embodiments of the compounds of Formula (I), R’ais R’branched; denotes a point of attachment; Raαis C2-12 alkyl; R3are each C1-14 alkyl; R4is6 alkyl); n2 is 2; R5is H; each R6is H; M and M’ are l is 5; and m is 7.

[0589] In some embodiments of the compounds of Formula (I), R’ais a point of attachment; Raα, C alkyl;41-14 R is - (CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; l is 5; and m is 7.

[0590] In some embodiments, the compound of Formula (I) is selected from: , ,Attorney Docket No.45817-0138WO1 / MTX968.20

[0591] is:(Compound II).

[0592] Formula (I) is: .

[0593] In(I) is: .

[0594] In(I) is: (Compound B).

[0595] In some aspects, the disclosure relates to a compound of Formula (Ia):Attorney Docket No.45817-0138WO1 / MTX968.20 its N-oxide, or a salt or isomer thereof,R’branched; wherein denotes a point of attachment;wherein are selected from the groupconsisting of H, C2-12alkyl, and C2-12R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, , wherein denotes a pointR10is Neach R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; each R6is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12alkyl or C2-12alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.Attorney Docket No.45817-0138WO1 / MTX968.20

[0596] In some aspects, the disclosure relates to a compound of Formula (Ib): or its N-oxide, or a salt or isomer thereof,R’brancheddenotes a point of attachment; wherein selected from the groupconsisting of H, C2-12 alkyl, and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14alkyl and C2-14alkenyl; R4is -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4, and 5; each R5is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; each R6is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0597] In some embodiments of Formula (I) or (Ib), R’ais R’branched; R’brancheddenotes a point of attachment; Raβ, Raγ, and Raδare each H;alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12alkyl; l is 5; and m is 7.Attorney Docket No.45817-0138WO1 / MTX968.20

[0598] In some embodiments of Formula (I) or (Ib), R’ais R’branched; R’brancheddenotes a point of attachment; Raβ, Raγ, and Raδare each alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H;are - ; R’ is a C1-12 alkyl; l is 3; and m is 7.

[0599] In some embodiments of Formula (I) or (Ib), R’ais R’branched; R’brancheddenotes a point of attachment; Raβand Raδare each H; Raγare each C1-14 alkyl; R4is -(CH2)nOH; n is 2; each R5is H;each is H; M and M’ are each -C(O)O-; R’ is a C1-12alkyl; l is 5; and m is 7.

[0600] In some aspects, the disclosure relates to a compound of Formula (Ic): its N-oxide, or a salt or isomer thereof,R’brancheddenotes a point of attachment; whereinselected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14alkyl and C2-14alkenyl;Attorney Docket No.45817-0138WO1 / MTX968.20 R10is N(R)2; each R is independently selected from the group consisting of C1-6alkyl, C2-3alkenyl, and H; n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5is independently selected from the group consisting of C1-3alkyl, C2-3 alkenyl, and H; each R6is independently selected from the group consisting of C1-3alkyl, C2-3 alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12alkyl or C2-12alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0601] In some ; denotes a point ofR2and R3are each C1-14alkyl; R4denotes a point of attachment; R10is NH(C1-6 alkyl)R6is H; M and M’ are each -C(O)O-; R’ is a C1-12alkyl; l is 5; and m is 7.

[0602] In some embodiments, the compound of Formula (Ic) is: (Compound A).

[0603] compound of Formula (II):Attorney Docket No.45817-0138WO1 / MTX968.20Raγand Raδare each independently selected from the group consisting of H, C1-12alkyl, and C2-12alkenyl, wherein at least one of Raγand Raδis selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; Rbγand Rbδare each independently selected from the group consisting of H, C1-12alkyl, and C2-12alkenyl, wherein at least one of Rbγand Rbδis selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14alkyl and C2-14alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, ,wherein denotes a point ...

Claims

Attorney Docket No.45817-0138WO1 / MTX968.20 WHAT IS CLAIMED IS:

1. A lipid nanoparticle comprising: (i) a lipid amine that is a compound of Formula IX:R2and R3are each C2-20alkyl, wherein: (a) the C2-20 alkyl is substituted by NH2; (b) one non-terminal carbon of the C2-20 alkyl is optionally replaced with NH; and (c) R2and R3are the same or different; j is 0 or 1; k is 0, 1, 2, or 3; l is 0 or 1; m is 0, 1, or 2; n is 0 or 1; j and l are not both 0; and when j is 0, then l is 1; with the proviso that the compound is other than:Attorney Docket No.45817-0138WO1 / MTX968.20Attorney Docket No.45817-0138WO1 / MTX968.20 ,and (ii) a messenger RNA (mRNA) comprising an open reading frame (ORF) encoding the cystic fibrosis transmembrane conductance regulator (CFTR) polypeptide of SEQ ID NO:

3.

2. The lipid nanoparticle of claim 1, wherein the lipid amine is a compound of Formula IXa: a salt thereof.the lipid amine is a compound of Formula IXb:is a compound of Formula IXc:Attorney Docket No.45817-0138WO1 / MTX968.20 a salt thereof. lipid amine is a compound ofa salt thereof. 5, wherein R1is.

7. any one 1-5, wherein R1is . of any one of claims 11-5, wherein R is .of any one of claims 1-8, wherein R2and R3are each C2-15alkyl substituted by NH2.

10. The lipid nanoparticle of any one of claims 1-8, wherein R2and R3are each C2-15 alkyl substituted by NH2, and wherein one non-terminal carbon of the C2-15alkyl is optionally replaced with NH.Attorney Docket No.45817-0138WO1 / MTX968.20 11. The lipid nanoparticle of any one of claims 1-8, wherein R2and R3are each C2-12alkyl substituted by NH2.

12. The lipid nanoparticle of any one of claims 1-8, wherein R2and R3are each C2-12 alkyl substituted by NH2, and wherein one non-terminal carbon of the C2-12alkyl is optionally replaced with NH.

13. The lipid nanoparticle of any one of claims 1-8, wherein R2and R3are each C2-10 alkyl substituted by NH2.

14. The lipid nanoparticle of any one of claims 1-8, wherein R2and R3are each C2-10 alkyl substituted by NH2, and wherein one non-terminal carbon of the C2-10 alkyl is optionally replaced with NH.

15. The lipid nanoparticle of any one of claims 1-8, wherein R2and R3are each C5-10alkyl substituted by NH2.

16. The lipid nanoparticle of any one of claims 1-8, wherein R2and R3are each C5-10 alkyl substituted by NH2, and wherein one non-terminal carbon of the C5-10alkyl is optionally replaced with NH.

17. The lipid nanoparticle of any one of claims 1-8, wherein R2and R3are each C5-6 alkyl substituted by NH2.

18. The lipid nanoparticle of any one of claims 1-8, wherein R2and R3are each C5-6 alkyl substituted by NH2, and wherein one non-terminal carbon of the C5-6 alkyl is optionally replaced with NH.

19. The lipid nanoparticle of any one of claims 1-8, wherein each of R2and R3is independently selected from , , ,Attorney Docket No.45817-0138WO1 / MTX968.20 ,independently selected from ,R3is independently selected .

22. The lipidR2and R3are the same.Attorney Docket No.45817-0138WO1 / MTX968.20 23. The lipid nanoparticle of any one of claims 1-8, wherein R2and R3are different.

24. The lipid nanoparticle of claim 1, wherein the lipid amine is a compound selected from: Structure SA No.Attorney Docket No.45817-0138WO1 / MTX968.20 SA5Attorney Docket No.45817-0138WO1 / MTX968.20 SA10 selectedfrom:Attorney Docket No.45817-0138WO1 / MTX968.20 SA526. The lipid nanoparticle of claim 1, wherein the lipid amine is a compound selected from:Attorney Docket No.45817-0138WO1 / MTX968.20 a28. The lipid nanoparticle of claim 1, wherein the lipid amine is Compound SA4:

29. The lipid nanoparticle of claim 1, wherein the lipid amine is compound SA1: a salt thereof.

30. The lipid nanoparticle of claim 1, wherein the lipid amine is compound SA1:Attorney Docket No.45817-0138WO1 / MTX968.20 .any one wherein the ORF is at least 80% identical to the nucleotide sequence of SEQ ID NO:

8.

32. The lipid nanoparticle of any one of claims 1 to 30, wherein the ORF is identical to the nucleotide sequence of SEQ ID NO:

8.

33. The lipid nanoparticle of any one of claims 1 to 32, wherein the mRNA comprises a 5' untranslated region (UTR) comprising the nucleotide sequence of SEQ ID NO:

50.

34. The lipid nanoparticle of any one of claims 1 to 33, wherein the mRNA comprises a 3' UTR comprising the nucleotide sequence of SEQ ID NO:

139.

35. The lipid nanoparticle of any one of claims 1 to 30, wherein the mRNA comprises the nucleotide sequence of SEQ ID NO:

37.

36. The lipid nanoparticle of any one of claims 1 to 35, wherein the mRNA comprises a 5′ terminal cap comprising m7G-ppp-Gm.

37. The lipid nanoparticle of any one of claims 1 to 36, wherein the mRNA comprises a poly-A region comprising A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211).Attorney Docket No.45817-0138WO1 / MTX968.20 38. The lipid nanoparticle of any one of claims 1 to 30, wherein the mRNA comprises the nucleotide sequence of SEQ ID NO:

24.

39. The lipid nanoparticle of any one of claims 1 to 37, wherein the mRNA comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof.

40. The lipid nanoparticle of claim 39, wherein all of the uracils of the mRNA are N1-methylpseudouracils.

41. The lipid nanoparticle of any one of claims 1 to 40, wherein the lipid nanoparticle comprises an ionizable lipid.

42. The lipid nanoparticle of claim 41, wherein the ionizable lipid is (Compound II), or a salt43. The lipid nanoparticle of any one of claims 1 to 40, wherein the lipid nanoparticle comprises: an ionizable lipid; a phospholipid; a structural lipid; and a PEG-lipid.

44. The lipid nanoparticle of claim 43, wherein:Attorney Docket No.45817-0138WO1 / MTX968.20 the ionizable lipid is (Compound II), or a saltthe phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); the structural lipid is cholesterol; and the PEG-lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG-2k).

45. The lipid nanoparticle of claim 43, wherein: the ionizable lipid is (Compound II), or a saltthe phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); the structural lipid is cholesterol; the PEG-lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol- 2000 (DMG-PEG-2k); and the lipid amine is compound SA1:Attorney Docket No.45817-0138WO1 / MTX968.20 .ORF is identical to the nucleotide sequence of SEQ ID NO:

8.

47. The lipid nanoparticle of claim 45, wherein the mRNA comprises the nucleotide sequence of SEQ ID NO:

37.

48. The lipid nanoparticle of claim 45, wherein the mRNA comprises the nucleotide sequence of SEQ ID NO:

24.

49. A messenger RNA (mRNA) comprising an open reading frame (ORF) encoding the cystic fibrosis transmembrane conductance regulator (CFTR) polypeptide of SEQ ID NO:3, wherein the ORF is at least 80% identical to the nucleotide sequence of SEQ ID NO:

8.

50. The mRNA of claim 49, wherein the ORF is identical to the nucleotide sequence of SEQ ID NO:

8.

51. The mRNA of claim 49 or 50, wherein the mRNA comprises a 5' untranslated region (UTR) comprising the nucleotide sequence of SEQ ID NO:

50.

52. The mRNA of any one of claims 49 to 51, wherein the mRNA comprises a 3' UTR comprising the nucleotide sequence of SEQ ID NO:139.Attorney Docket No.45817-0138WO1 / MTX968.20 53. The mRNA of claim 49, comprising the nucleotide sequence of SEQ ID NO:

37.

54. The mRNA of any one of claims 49 to 53, wherein the mRNA comprises a 5′ terminal cap comprising m7G-ppp-Gm.

55. The mRNA of any one of claims 49 to 54, wherein the mRNA comprises a poly-A region comprising A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211).

56. The mRNA of claim 49, comprising the nucleotide sequence of SEQ ID NO:

24.

57. A messenger RNA (mRNA) comprising an open reading frame (ORF) encoding the cystic fibrosis transmembrane conductance regulator (CFTR) polypeptide of SEQ ID NO:3, wherein the mRNA comprises a poly-A region comprising A100- UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211).

58. The mRNA of claim 57, wherein the mRNA comprises a 5' untranslated region (UTR) comprising the nucleotide sequence of SEQ ID NO:

50.

59. The mRNA of claim 57 or 58, wherein the mRNA comprises a 3' UTR comprising the nucleotide sequence of SEQ ID NO:

139.

60. The mRNA of any one of claims 57 to 59, wherein the mRNA comprises a 5′ terminal cap comprising m7G-ppp-Gm.Attorney Docket No.45817-0138WO1 / MTX968.20 61. The mRNA of any one of claims 49 to 60, wherein the mRNA comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof.

62. The mRNA of claim 61, wherein all of the uracils of the mRNA are N1- methylpseudouracils.

63. A lipid nanoparticle comprising the mRNA of any one of claims 49 to 62.

64. The lipid nanoparticle of claim 63, wherein the lipid nanoparticle comprises: an ionizable lipid; a phospholipid; a structural lipid; a PEG-lipid; and a cationic agent.

65. The lipid nanoparticle of claim 64, wherein the ionizable lipid is (Compound II) or a salt thereof.

66. The lipid nanoparticle of claim 64, wherein the cationic agent is a salt thereof.

67. The lipid nanoparticle of claim 64, wherein the ionizable lipid isAttorney Docket No.45817-0138WO1 / MTX968.20 (Compound II) or a salt thereof,a salt thereof.the ionizable lipid is (Compound II) or a salt thereof;phosphocholine (DSPC); the structural lipid is cholesterol; the PEG lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG-2k); and the cationic agent is a salt thereof.

69. The lipid nanoparticle of any one of claims 64 to 68, wherein the ORF is identical to the nucleotide sequence of SEQ ID NO:8.Attorney Docket No.45817-0138WO1 / MTX968.20 70. The lipid nanoparticle of any one of claims 64 to 68, wherein the mRNA comprises the nucleotide sequence of SEQ ID NO:

37.

71. The lipid nanoparticle of any one of claims 64 to 68, wherein the mRNA comprises the nucleotide sequence of SEQ ID NO:

24.

72. A method of treating or preventing cystic fibrosis in a human subject in need thereof, comprising administering to the human subject the lipid nanoparticle of any one of claims 1 to 48 or 63 to 71 or the mRNA of any one of claims 49 to 62.

73. A method of preventing cystic fibrosis in a human subject having cystic fibrosis-causing mutations in both copies of the CFTR gene, comprising administering to the human subject the lipid nanoparticle of any one of claims 1 to 48 or 63 to 71 or the mRNA of any one of claims 49 to 62.

74. The method of claim 73, wherein the cystic fibrosis-causing mutations are selected from the group consisting of G542X, W1282X, R553X, F508del, N1303K, I507del, G551D, S549N, D1152H, R347P, and R117H.

75. The method of any one of claims 72 to 74, wherein the administering is to the respiratory tract or lung of the human subject.

Images