Barley with improved properties

EP4705469A1Pending Publication Date: 2026-03-11CARLSBERG BREWERIES AS
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-04-30
Publication Date
2026-03-11

AI Technical Summary

Technical Problem

The commercial malting process for barley is time-consuming and energy-intensive, particularly due to the need for extended steeping and germination periods, and high a-amylase activity can lead to premature sprouting and reduced grain quality.

Method used

Barley plants with a mutation in the CXE2L1 gene, which encodes a gain-of-function mutant polypeptide, exhibit enhanced hydrolytic enzyme activity, including a-amylase and p-glucanase, allowing for faster degradation of starch and cell wall polysaccharides, thus reducing malting time without compromising agronomical properties.

Benefits of technology

These mutant barley plants enable shorter malting times, increased enzyme activity, and reduced p-glucan content, resulting in improved beer production efficiency and quality while maintaining optimal agronomical characteristics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000011_0001
    Figure IMGF000011_0001
  • Figure IMGF000025_0001
    Figure IMGF000025_0001
  • Figure IMGF000026_0001
    Figure IMGF000026_0001
Patent Text Reader

Abstract

The invention relates to barley plants having a high α-amylase activity and fast β- glucan degradation during malting. The barley plants of the invention may for example carry a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a mutant CXE2L1 polypeptide. The invention further provides plant products prepared from said barley plants.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Barley with improved properties

[0002] Technical field

[0003] The present invention relates to barley plants having improved properties. In particular, the invention relates to barley plants having properties useful for production of barley based beverages, e.g. beer. The invention further relates to methods for production of barley based beverages, as well as to products prepared from the barley plants of the invention.

[0004] Background

[0005] In commercial malting processes, barley grains are germinated, or malted, under controlled conditions that allow partial mobilization of the starch and protein reserves of the starchy endosperm over a period of 4-6 days. The malting process is typically initiated by immersing the dry barley grain in water. This process is known as steeping and the objective is not only to clean the grain, but also to raise its moisture content to about 40% (w / w) so that the endosperm mobilization step that follows will occur more quickly. During steeping, the water is typically drained once to allow re-aeration of the grain. This step is known as the 'air rest' and is considered necessary, primarily because the submerged grain becomes starved of oxygen after about 16 h. After an 'air rest' of about 8 h, the grain is typically re-immersed in water to complete the steeping treatment over another 8-h period - or in a series of re-steeping steps. The two-step steeping process to increase the moisture content of the dry grain to 40%, or higher, takes about 32 h overall.

[0006] The steeped grain is spread for germination, during which enzymes secreted from aleurone and scutellar epithelial cells - together with some that pre-exist in the starchy endosperm cells - degrade cell walls, starch and protein. Under normal conditions of germination, the phytohormone gibberellic acid (GA) is believed to be synthesized in the nodal region, or elsewhere in the embryo, from where it diffuses along the water gradient.

[0007] The maltster usually aims to rapidly induce synthesis of as many of the starchdegrading enzymes in the grains as possible. In many commercial malting programs, GA may be added to speed up the process of enzyme secretion from the aleurone layer. The starch-degrading enzymes - which include a- and p-amylases, starch debranching enzymes (e.g. limit dextrinase) and a-glucosidases - partially depolymerize the starch reserves of the grain to monosaccharides, disaccharides, oligosaccharides, and glucose. The depolymerization products of starch are subsequently used by yeast cells as a carbon source and are fermented into beer ethanol. a-Amylases have a primary role in degradation of starch in endosperm. The expression of a-amylases is tightly regulated in cereal plants. In wild-type barley, there is very little expression of a-amylase genes during endosperm growth and maturation consistent with the extensive accumulation of starch during this period. During germination a- amylase activity is increased. The tight regulation of a-amylase activity is important, because aberrant a-amylase activity may have severe consequences on plant health. For example, in certain barley varieties premature germination may occur. This may be associated with shoot and root growth, high a-amylase production, and shriveling of the grain at maturity (Green et al., 1997). Also, it has been found that high a-amylase activity frequently is increased in shrivelled grains compared to normal grains (Green et al., 1997). Cv. Himalaya barley carrying the sln1 mutation has also consistently been demonstrated to have both premature sprouting and high a-amylase production (Green et al., 1997). Over-expression of a-amylase genes in developing endosperm of rice produced various degrees of “chalky” grains, i.e. grains comprising immature, loosely packed starch granules (Nakata et al. 2017).

[0008] Maltsters also aim at decreasing the levels of cell wall polysaccharides in the barley grain, in particular the (1,3;1 ,4)-p-glucans and arabinoxylans. (1,3;1 ,4)-p-glucans can be especially troublesome for brewers, because these can be extracted from the malt in soluble forms that form highly viscous aqueous solutions that slow filtration processes in the brewery and contribute to undesirable haze in the final beer. Thus, low levels of soluble (1,3;1 ,4)-p-glucan represent an important malting quality parameter. (1 ,3;1 ,4)-p-glucan may be degraded by glucanases, and thus high levels of (1 ,3; 1 ,4)-p-glucanase enzymes remain important measures of malt quality.

[0009] As noted above, the germination process typically takes about 4-to-5 days. Following the controlled germination steps, the wet malt is dried from about a moisture content of 40% to 4-to-5%. This drying process, termed kilning, is very energy consuming and represents a major cost for the industry. The entire process including kiln drying is typically 6-7 days.

[0010] In the brewery, malt is milled to break open the grain, and the resulting content is extracted with hot water in a process known as mashing. The extracted material includes partially degraded starch, protein and cell wall molecules as described above, and these are further degraded by endogenous grain enzymes that were extracted from the malt. At this stage, some brewers add additional - and generally cheaper carbon sources (adjuncts) - to support the subsequent yeast fermentation process and to offset the higher costs of malt. Said adjuncts can be barley, rice, wheat or other cereal flours from un-germinated grain, but their addition may necessitate the concomitant addition of hydrolytic enzymes, because there are insufficient endogenous enzymes in the malt to degrade the components of the adjunct. The added enzymes are usually from unpurified and relatively cheap extracts of fungal and / or bacterial cultures. The addition of exogenous enzymes is not legal in some countries, particularly where beer must be produced under tightly regulated settings.

[0011] Further degradation of the starch, and other endosperm components extracted in hot water, proceed in a process known as saccharification. Following mashing, the extracts are filtered, often in a lauter tun, and cooled. The extract may be boiled in the presence of hops or hop extracts, and upon cooling yeast cultures are added for the fermentation of released sugars to ethanol. The beer so produced is usually matured and filtered before bottling. The beer may also be carbonated prior to bottling.

[0012] As outlined above, one of the time and energy consuming steps of beer production is malting. Accordingly, there is a need for the provision of materials and methods, which can reduce the time required for malting. In particular, there is a need for methods allowing high activity of hydrolytic enzymes and fast degradation of p-glucan during malting.

[0013] However, as noted above high a-amylase activity is associated with unwanted effects on plant fitness. In particular, high a-amylase activity may be associated with reduced yield, reduced grain starch content and / or pre-harvest sprouting. There is thus a need for barley plants having a high level of hydrolytic enzyme activity in the grains rapidly after initiation of germination, but which never-the-less have optimal agronomical properties, such as high yield and preferably low occurrence of pre-harvest sprouting. In particular, there is a need for barley plants having a high level of a-amylase activity and / or a high level of p-glucanase activity in the grains rapidly after initiation of germination and having optimal agronomical properties.

[0014] Summary

[0015] The inventors have surprisingly discovered that barley plants and parts thereof comprising a mutation in the gene encoding CXE2L1, preferably a gain of function mutation in CXE2L1 are particularly useful for producing barley-based beverages, such as beer. In particular, the inventors have found that barley plants carrying a mutation in the gene encoding CXE2L1, wherein said mutation results in a substitution of an amino acid in proximity to the putative ligand binding site in the CXE2L1 polypeptide are advantageous. Such barley plants are particularly useful for methods of production of cereal based beverages with reduced malting time.

[0016] Barley plants encoding a gain of function mutant CXE2L1 polypeptide, such as barley plants that have a CXE2L1 gain of function mutation, can be identified by measuring a- amylase activity in the endosperm half-grain lacking the embryo of said barley plant after imbibition in water and / or germination, as described in the Examples herein. In other words, gain of function may be indirectly determined by determining a-amylase activity in endosperm half-grain lacking the embryo. Under normal conditions of germination, signalling molecules are produced in the embryo and diffuse along the water gradient. Said signalling molecules induce expression of hydrolytic enzymes in the germinating grain. Thus, normally, signalling molecules from the embryo are required in order to induce expression of hydrolytic enzymes such as a-amylase during germination. The inventors have however surprisingly discovered that in a barley plant encoding a CXE2L1 polypeptide comprising a mutation as described herein, hydrolytic enzyme activity, hereunder a-amylase activity, is also induced in germinating halfgrains lacking the embryo. Thus, the inventors have discovered that certain point mutations in the CXE2L1 gene result in a gain of function CXE2L1 mutant polypeptide and that grains of such barley generally have high hydrolytic activity during germination independently of signaling molecules produced by the embryo. Thus, when describing and referring herein to a gain of function mutation in CXE2L1, this refers to a mutation, wherein barley plants carrying said mutation have a-amylase activity in the endosperm half-grain lacking the embryo of said barley plant after imbibition in water and / or germination, when determined as described in the Examples herein. A gain of function mutant CXE2L1 polypeptide is a mutant CXE2L1 polypeptide encoded by a CXE2L1 gene carrying such a gain of function mutation. The gain of function may potentially come across by different mechanisms. Without being bound by theory, it is believed that the gain of function mutation in CXE2L1 may encode a gain of function mutant CXE2L1 polypeptide having increased CXE2L1 activity. However, the gain of function mutation in CXE2L1 and a gain of function CXE2L1 polypeptide may also gain a-amylase activity in the endosperm half-grain lacking the embryo of said barley plant after imbibition in water and / or germination by other mechanisms.

[0017] As indicated above, barley plants encoding such mutant CXE2L1 polypeptide have a number of superior properties in comparison with similar barley plants not comprising said gain of function mutant. In particular, such barley plants have high hydrolase activity in germinating barley grains. For example, the plants have increased a- amylase, p-amylase, p-glucanase and limit dextrinase activity in the grains of the barley, in particular after germination of said grains. Interestingly, they have increased activity already after 72 h, preferably already after 48 h, more preferably already after 24 h germination. The grains of such barley plants further have increased p-glucan degradation both during germination and malting and during mashing, and a reduced total content of p-glucan in mash, malt and wort. Interestingly, the decrease in p-glucan content can be observed already after 120 h, preferably already after 96 h. Thus, the herein described barley plants and parts thereof encoding the mutant CXE2L1 polypeptide are particularly useful for producing barley-based beverages, such as beer.

[0018] Even more surprisingly, the inventors have discovered that the barley plants encoding such mutant CXE2L1 polypeptide have highly similar, in principle identical, agronomical properties as compared to similar barley plants not expressing such mutant CXE2L1 polypeptide. For example, the barley plant encoding a gain of function mutant CXE2L1 polypeptide have a similar, if not identical, plant height, thousand grain weight (TGW) and average grain size as a similar barley plant not encoding a gain of function mutant CXE2L1 polypeptide. In addition, the inventors have very surprisingly found that barley plants encoding such mutant CXE2L1 , which in addition also carry a mutation in a gene encoding a p-glucan synthase have even significantly higher increase in hydrolase activity in germinating barley grains, as well as significantly decreased p-glucan levels, while retaining normal agronomical properties.

[0019] The barley plants of the invention have high hydrolytic enzyme activity early during germination and preferably also low levels of p-glucan rendering the barley plants particularly useful for reducing malting time. Thus, the barley plants of the invention are useful for preparing malt based beverages, wherein said malt is germinated for less than 96 h, such as less than 72 h, for example less than 48 h, such as for in the range of 24 to 96 h, such as in the range of 24 to 72 h, for example in the range of 24 to 48 h.

[0020] Thus, the invention provides barley plants, products thereof, methods of preparing such barley plants, methods of producing malt, aqueous extracts as well as methods of producing beverages from such barley plants according the claims attached hereto.

[0021] Description of Drawings

[0022] Figure 1. Megazyme a-amylase activity coloration assay. Few individual endosperm half-grains (exemplified here by sample E11) showed high a-amylase activity, comparable in activity to positive controls (three individual positive controls H9-H11, here denoted as Ref).

[0023] Figure 2. Megazyme a-amylase activity coloration assay. Verification of isolated and propagated mutants. Individual endosperm half-grains (eight grains per mutant) of mutants plate 138 samples E11_grain1 and E11_grain2; plate 139 samples H5_grain1 and H5_grain2 showed high a-amylase activity, comparable in activity to reference cultivar Quench (endosperm half-grains treated with hormone GA).

[0024] Figure 3. Megazyme a-amylase activity coloration assay. Verification of isolated and propagated mutants. Average absorbance of eight tested endosperm half-grains shown in Figure 2. Figure 4. a-amylase activity (II g DW-1) after 72 h of germination of a whole grain measured using the Ceralpha method (Ceralpha Method according to manufacturer’s protocol, Megazyme) modified for Gallery Plus Beermaster. Black bar denotes grain germination where grain is submerged in shaking flask, grey bar denotes grain germination on petri dishes. Error bars indicate standard deviations (n=2).

[0025] Figure 5. a-amylase activity (II g DW-1) after 72 h of endosperm half-grain germination measured using the Ceralpha method (Ceralpha Method according to manufacturer’s protocol, Megazyme) modified for Gallery Plus Beermaster. Black bar denotes grain germination where grain is submerged in shaking flask, grey bar denotes grain germination on petri dishes. Error bars show standard deviations (n=2).

[0026] Figure 6. Endosperm half-grain a-amylase activity phenotype measured with Megazyme a-amylase activity coloration assay. HENZ-a1 and HENZ-a2 endopermhalfgrains, grown in New Zealand (2016 / 17) or Denmark (Fyn 2017), show high a- amylase activity compared to wild-type grain Quench, Planet or Paustian.

[0027] Figure 7 shows higher a-amylase activity in mutants HENZ-a1 and HENZ-a2 compared to reference cultivar Quench (wt) after incubation for 24 h and 48 h at 25°C in water with aeration (90l / h / kg).

[0028] Figure 8 shows hydrolytic enzyme transcript accumulation. A. a-amylase (AMY1-2) transcript accumulation determined by ddPCR after 48 h steeping. Error bars indicate standard deviation calculated from three technical replicates. B. Limit dextrinase transcript accumulation determined by ddPCR after 48 h steeping. Error bars indicate standard deviation calculated from three technical replicates. C. p-glucanase (BGL2A) transcript accumulation determined by ddPCR after 48 h steeping. Error bars indicate standard deviation calculated from three technical replicates.

[0029] Figure 9 shows higher a-amylase activity in mutant HENZ-a1 and HENZ-a2 compared to reference cultivar Quench (wt), after 24 h incubation at 25°C in water with aeration (90l / h / kg)(WA) followed by 24 h incubation at 25°C in air with aeration (90 l / h / kg)(A).

[0030] Figure 10 shows germination energy at 4 ml after 24 h, 48 h and 72 h. Data shows high grain quality with no indication for pre-harvest sprouting. Figure 11 shows germination energy at 4 ml and 8 ml after 72 h germination. Barley mutants HENZ-a1, HENZ-a2 have lower water sensitivity compared to reference cultivar Quench (wt).

[0031] Figure 12. General description of micromalting.

[0032] Figure 13. Megazyme a-amylase activity coloration assay of endosperm half-grain of HENZ-a1 and of F1 progenies of crosses HENZ-a1 with Bowman, Paustian and Quench.

[0033] Figure 14. Megazyme a-amylase activity coloration assay of endosperm half-grain of HENZ-a1 and HENZ-a2 F2 populations from reciprocal crosses (upper panel shows crosses between Paustian and HENZ-a1, lower panel shows crosses between Quench and HENZ-O2).

[0034] Figure 15. Genetic mapping of HENZ-a2 in Planet x HENZ-a2 F2 population. Left is the physical genome map of chromosome 3H, the mapping interval is defined by two flanking markers and their physical positions in mega base (Mb). Right is the genetic map of HENZ-a2 on 3HS, marker position is shown in genetic distance (cM). Logarithm of odds for each marker was plotted alongside, which indicates the confidence.

[0035] Figure 16. Sanger sequencing candidate region harboring both S113P (T>C) and A127V (C>T) mutations. Horvu_PLANET_3H01G160900 is Planet reference for CXE2L1, nucleotides identical to reference were darkshaded.

[0036] Figure 17. HENZ-a and FMT-3H candidate structural model. A) Protein model surface in dark grey with the substrate / ligand binding pocket in white. Transplanted GA^substrate in black spheres is situated in the substrate / ligand binding pocket. B) HENZ-a (A127V, dark grey sphere) and FMT-3H (S113P, white sphere) amino acid locations highlighted relative to the substrate / ligand binding pocket (in white surface) with the putative substrate GA4 as black spheres. C) As B) with the residues <5 angstrom from the substrate interacting residues highlighted in black sticks (1stlayer of residues) and the residues <5 angstrom from the 1stlayer of residues highlighted in white sticks (2ndlayer of residues). Figure 18. Phylogenetic tree of barley and rice CXE family that contains the HENZ-a and FMT-3H candidate gene CXE2L1 (HORVU.MOREX.r3.3HG0242030, Morex_V3 (Mascher et al. 2021)).

[0037] Figure 19 shows hydrolytic enzyme activity and p-glucan content after malting of FMT- 3H + Mut2. A) a-amylase activity, B) p-amylase activity and C) limit dextrinase activity. D) p-glucan content.

[0038] Figure 20 shows a-amylase activity measured in micromalted grain of malting barley varieties. The two bars for each variety are replicates. The results are further described in Example 17.

[0039] Figure 21 shows a-amylase activity in the endosperm half-grain HENZ-78, HENZ-a1 , HENZ-a2, Planet and Quench. Error bars indicate standard deviations.

[0040] Detailed description

[0041] Definitions

[0042] As used herein, "a" can mean one or more, depending on the context in which it is used.

[0043] The term “a-amylase” refers herein to an enzyme having a-amylase activity. In particular, an a-amylase according to the invention is an enzyme capable of catalyzing endohydrolysis of (1^4)-a-D-glucosidic linkages in polysaccharides containing three or more (1^4)-a-linked D-glucose units, a-amylase activity may be determined by K- CERA 01 / 12 (protocol and kit available from Megazyme, Ireland). Barley plants contain multiple genes encoding a-amylase, which are organised into clusters. Typically, barley plants may comprise an amy1_1 cluster, an amy1_2 cluster and an amy2 cluster. The amy1_2 cluster frequently only comprises one gene, however for the sake of simplicity it is never-the-less referred to as the amy1_2 cluster herein. In addition to the aforementioned clusters, the barley plant may contain additional a-amylase genes / clusters (e.g. the amy3, amy4_1 and amy4_2 genes). Each of these clusters may comprise one or more a-amylase genes. Examples of sequences of a-amylase genes are available from the barley genome project published by Mascher et al., 2017 (Morex_V1):

[0044] The term "adjunct" as used herein refers to carbon-rich raw material sources added during preparation of beer, typically during mashing. The adjunct may be an ungerminated cereal grain, which may be milled together with the germinated grains prepared according to the invention. The adjunct may also be a syrup, sugar or the like.

[0045] The term “amino acid” as used herein refers to a proteinogenic amino acid. Preferably, the proteinogenic amino acids is one of the 20 amino acids encoded by the standard genetic code. The IIIPAC one and three letter codes are used to name amino acids.

[0046] The term “amino acid corresponding to X” is used herein to describe amino acids of a given polypeptide (e.g. a mutant CXE2L1 polypeptide) in relation to amino acids of a reference polypeptide (e.g. CXE2L1 of SEQ ID NO: 1). Following alignment between said polypeptide and the reference polypeptide, an amino acid is corresponding to X if it is in the same position as X in said alignment. The term “amylose” refers to homopolymers of a-D-glucose. Amylose has a linear molecular structure, as its glucose units are almost exclusively linked by a-1-4- glycosidic bonds.

[0047] The term “amylopectin” refers to homopolymers of a-D-glucose. Amylopectin molecules contain frequent a-1-6-glycosidic linkages. These introduce branch points into the otherwise a-1-4-linked glucose chains resulting in clusters of parallel chains appearing in regular intervals along the molecule’s axis.

[0048] The term "approximately" when used herein in relation to numerical values preferably means ±10%, more preferably ±5%, yet more preferably ±1%.

[0049] The term "barley" in reference to the process of making barley based beverages, such as beer, particularly when used to describe the malting process, means barley kernels or grains. In all other cases, unless otherwise specified, "barley" means the barley plant (Hordeum vulgare, L.), including any breeding line or cultivar or variety, whereas part of a barley plant may be any part of a barley plant, for example any tissue or cells.

[0050] The term “barley flour” as used herein refers to milled barley kernels.

[0051] The term “P-amylase” refers to an enzyme catalysing hydrolysis of (1->4)-alpha-D- glucosidic linkages in polysaccharides so as to remove successive maltose units from the non-reducing ends of the chains, p-amylase activity may be determined by the K- BETA3 (protocol and kit available from Megazyme, Ireland).

[0052] The term "P-glucanase" as used herein refers to enzymes with the potential to depolymerize cereal p-glucan. Accordingly, unless otherwise specified, the term "P-glucanase" refers to an endo- or exo-enzyme or mixture thereof characterized by (1 ,3; 1 ,4)-p- and / or (1,4)-p-glucanase activity. Barley plants may comprise one or more genes encoding p-glucanase, for example the BGL2A and / or BGL2B genes. The sequence of BGL2A is available under accession number HORVU.MOREX.r3.7 HG0750120.1, Morex_V3.

[0053] The “P-glucan content” as used herein may be determined by any useful method.

[0054] Preferably, the content refers to (1 ,3;1 ,4)-p-glucan content. It is determined as the sum of the content of Glc-|3-(1->4)-Glc-|3-(1->3)-Glc (DP3) and Glc-|3-(1->4)-Glc-|3-(1->4)- Glc-p-(1->3)-Glc (DP4) oligomers. The content of DP3 and DP4 oliogmers may e.g. be determined by lichenase digestion of (1,3;1 ,4)-p-glucans followed by quantification e.g. by High-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD).

[0055] The term "P-glucan synthase" as used herein should be regarded as any protein which catalyses the synthesis of (1,3;1 ,4)-p-glucan and, optionally, catalyses the polymerisation of glucopyranosyl monomers. For example the (1,3;1 ,4)-p-glucan synthase may be a polypeptide encoded by a CsIF gene or a functional homolog thereof.

[0056] The term “charged amino acid” as used herein refers to amino acids with electrically charged side chains. Preferably, the charged amino acid is selected from the group consisting of Arg, His, Lys, Asp and Glu. Negatively charged amino acids are preferably selected from the group consisting of Asp and Glu.

[0057] The term "chit" as used herein refers to the embryonic growing bud that is visible during the germination phase of a cereal grain.

[0058] The term “DP” as used herein refers to the degree of polymerization, and indicates the number of a-1 ,4-linked glucose units in amylopectin side chains. Thus, by way of example DP3 refers to amylopectin side chains consisting of a sequence of 3 a-1, 4- linked glucose units. Similarly, DP4 refers to amylopectin side chains consisting of a sequence of 4 a-1 ,4-linked glucose units. The term “DP3:DP4 ratio” of (1 ,3;1 ,4)-p- glucans as used herein refers to the ratio of amylopectin side chains consisting of a sequence of 3 a-1 ,4-linked glucose units and of amylopectin side chains consisting of a sequence of 4 a-1 ,4-linked glucose units within said (1,3;1 ,4)-p-glucans. The DP3:DP4 ratio may be determined by digesting (1,3;1 ,4)-p-glucans with lichenase followed by quantification of released DP3 and DP4 oligomers e.g. by HPAEC-PAD.

[0059] By "encoding" or "encoded", in the context of a specified nucleic acid, is meant comprising the information for translation into the specified protein. A nucleic acid or polynucleotide encoding a protein may comprise non-translated sequences, e.g. introns, within translated regions of the nucleic acid, or may lack such intervening non- translated sequences, e.g. in cDNA. The information by which a protein is encoded is specified by the use of codons.

[0060] As used herein, "expression" in the context of nucleic acids is to be understood as the transcription and accumulation of mRNA. "Expression" used in the context of proteins refers to translation of mRNA into a polypeptide.

[0061] The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (promoter and terminator). Furthermore, plant genes generally consist of exons interrupted by introns.

[0062] The term "germinated grain" as used herein refers to a grain having developed a visible chit and a visible root and coleoptile.

[0063] The term "green malt" as used herein refers germinated cereal kernels, which have not been subjected to a step of kiln drying. In general, said cereal kernels have been germinated under controlled environmental conditions. In some embodiments the green malt is milled green malt.

[0064] The term “half-grain” as used herein refers to one of the parts of a grain, i.e. a kernel or grain, which has been divided in two, wherein one part comprises the whole embryo. Typically, said parts are of similar size. The term “endosperm half-grain lacking the embryo” as used herein refers to the one half of the halfgrain that does not comprise the embryo.

[0065] The term “initiation of germination” as used herein refers to the time point at which barley grains with a water content of less than 15% is contacted with sufficient water to initiate germination. Accordingly, “germination” as used herein also covers steeping in addition to any germination after steeping.

[0066] The term "kernel" is defined to comprise the cereal caryopsis, also denoted internal seed. In addition, the kernel may comprise the lemma and palea. In most barley varieties, the lemma and palea adhere to the caryopsis and are a part of the kernel following threshing. However, naked barley varieties also occur. In these, the caryopsis is free of the lemma and palea after threshing and threshes out free as in wheat. The terms "kernel" and "grain" are used interchangeably herein.

[0067] The term "kiln dried malt" as used herein refers germinated cereal kernels, which have been dried by kiln drying. In general, said cereal kernels have been germinated under controlled environmental conditions. In some embodiments the kiln dried malt is milled kiln dried malt.

[0068] The term “limit dextrinase” as used herein refers to an enzyme capable of catalysing the hydrolysis of (1->6)-alpha-D-glucosidic linkages in amylopectin and pullulan and in alpha- and beta-limit dextrins of amylopectin and glycogen. In particular, a limit dextrinase may be an enzyme classified under EC 3.2.1.142. Limit-dextrinase activity is determined by the Pullanase Limit Dextrinase Assay Kit (PullG6 method; protocol and kit available from Megazyme, Ireland).

[0069] The term "malting" as used herein refers to a controlled germination of cereal kernels (in particular barley kernels) taking place under controlled environmental conditions. In some embodiments “malting” may further comprise a step of drying said germinated cereal kernels, e.g. by kiln drying.

[0070] "Mashing" is the incubation of milled malt (e.g. green malt or kiln dried malt), and / or ungerminated cereal kernels in water. Mashing is preferably performed at specific temperature(s), and in a specific volume of water.

[0071] The term “milled” refers to material (e.g. barley kernels or malt), which has been finely divided, e.g. by cutting, milling, grinding or crushing. The barley kernels can be milled while moist using e.g. a grinder or a wet mill. Milled barley kernels or milled malt is sufficiently finely divided to render the material useful for aqueous extracts. Milled barley kernels or milled malt cannot be regenerated into an intact plant by essentially biological methods.

[0072] "Mutations" include deletions, insertions, substitutions, transversions, and point mutations in the coding and noncoding regions of a gene. Deletions may be of the entire gene, or of only a portion of the gene. Point mutations may concern changes of one base pair, and may for example result in premature stop codons, frameshift mutations, mutation of a splice site or amino acid substitutions. Mutations according to the present invention are preferably point mutations. A gene comprising a mutation may be referred to as a “mutant gene”. If said mutant gene encodes a polypeptide with a sequence different to the wild-type, said polypeptide may be referred to as a “mutant polypeptide”.

[0073] The term “non-polar amino acid” as used herein refers to amino acids with a hydrophobic side chains. Preferably, the non-polar amino acid is selected from the group consisting of Ala, Vai, lie, Leu, Met, Phe, Tyr, Trp and Gly, more preferably from the group consisting of Ala, Vai, lie, Leu, Met, Phe, Trp and Gly.

[0074] By the term "plant product" is meant a product resulting from the processing of a plant or plant material. Said plant product may thus, for example, be green malt, kiln dried malt, wort, a fermented or non-fermented beverage, a food, or a feed product.

[0075] The term “polar amino acid” as used herein refers to amino acids with polar, uncharged side chains. Preferably, the polar amino acid is selected from the group consisting of Ser, Thr, Asn and Gin.

[0076] By the term “progeny” as used herein is meant a plant, which directly or indirectly is offspring of a given plant. Thus, progeny is not confined to direct off-spring but also includes off-spring after numerous generations. In general, progeny of a barley plant carrying a specific mutation also carries that specific mutation. Thus, progeny of a barley plant carrying a specific mutation in the CXE2L1 gene also carry that specific mutation.

[0077] The term “sequence identity” as used herein refers to the % of identical amino acids or nucleotides between a candidate sequence and a reference sequence following alignment. Thus, a candidate sequence sharing 80% amino acid identity with a reference sequence requires that, following alignment, 80% of the amino acids in the candidate sequence are identical to the corresponding amino acids in the reference sequence. Identity according to the present invention is determined by aid of computer analysis, such as, without limitations, the Clustal Omega computer alignment program for alignment of polypeptide sequences (Sievers et al. (2011 October 11) Molecular Systems Biology 7 :539, PMID: 21988835; Li et al. (2015 April 06) Nucleic Acids Research 43 (W1) :W580-4 PMID: 25845596; McWilliam et al., (2013 May 13) Nucleic Acids Research 41 (Web Server issue) :W597-600 PMID: 23671338, and the default parameters suggested therein. The Clustal Omega software is available from EMBL- EBI at https: / / www.ebi.ac.uk / Tools / msa / clustalo / . Using this program with its default settings, the mature (bioactive) part of a query and a reference polypeptide are aligned. The number of fully conserved residues are counted and divided by the length of the reference polypeptide. The MUSCLE or MAFFT algorithms may be used for alignment of nucleotide sequences. Sequence identities may be calculated in a similar way as indicated for amino acid sequences. Sequence identity as provided herein is thus calculated over the entire length of the reference sequence.

[0078] The term “similar genotype” as used herein e.g. in the context of “a barley plant carrying a mutation in the CXE2L1 gene but otherwise of similar genotype” refers to said barley plants having essentially the same genotype except for a limited number of random and / or spontaneous mutations. For example, a parent barley plant is considered to be of similar genotype as barley plants obtained after random mutagenesis of said parent plant, except that the barley plants may carry a mutation in the CXE2L1 gene after mutagenesis.

[0079] The term “starch” as used herein refers to a composition of one or both of the discrete macromolecules: amylose and amylopectin.

[0080] The term "steeping" as used herein refers to the process of increasing the water content of a cereal kernel.

[0081] The term “stop codon” as used herein refers to a nucleotide triplet in the genetic code, which within mRNA results in termination of translation. The term “stop codon” as used herein also refers to a nucleotide triplet within a gene encoding the stop codon in mRNA. The stop codon in DNA typically has one of the following sequences: TAG, TAA or TGA.

[0082] The term "water content" of a grain as used herein refers to the % of H2O w / w in said grain.

[0083] The term “wild-type CslF6” as used herein refers to the polypeptide of SEQ ID NO: 7 or SEQ ID NO: 8. The term “wild-type CXE2L1” as used herein refers to the polypeptide of SEQ ID NO: 1.

[0084] By the term "wort" is meant a liquid extract of malt and / or cereal kernels, such as milled malt and / or milled cereal kernels and optionally additional adjuncts. Wort is in general obtained by mashing, optionally followed by "sparging", which is a process of extracting residual sugars and other compounds from spent grains after mashing with hot water. Sparging is typically conducted in a lauter tun, a mash filter, or another apparatus to allow separation of the extracted water from spent grains, also known as mash filtration. The wort obtained after mashing is generally referred to as "first wort", while the wort obtained after sparging is generally referred to as the "second wort". If not specified, the term wort may be first wort, second wort, or a combination of both. During conventional beer production, wort is boiled together with hops. Wort without hops, may also be referred to as "sweet wort", whereas wort boiled with hops may be referred to as "boiled wort" or simply as wort.

[0085] Enzyme activities of cereal grains as used herein refer to the activities measured in flour prepared from the specified grain type. For example, 10 ll / g of a-amylase activity per gram cereal grain refers to said a-amylase activity (10 II) measured in an aqueous extract derived from 1 g of flour (dry matter) from said cereal. a-Amylase activity is determined by K-CERA 01 / 12 (protocol and kit available from Megazyme, Ireland), - Amylase activity is determined by the K-BETA3 (protocol and kit available from Megazyme, Ireland). Limit-dextrinase activity is determined by the PullG6 Method (protocol and kit available from Megazyme, Ireland).

[0086] The volume of a gas as indicated herein refers to the volume of said gas at 1 atm and 20°C.

[0087] The volume of O2 as indicated herein refers to the volume of O2at 1 atm and 20°C. In embodiments of the invention where O2 is comprised in a mixture of gasses, then the total volume of the gas mixture may be determined, and the volume of O2may be calculated as the percentage of the total volume constituted by O2. By way of example then atmospheric air comprises 21% O2. Thus the volume of O2 within atmospheric air as used herein is 21% of the total volume of atmospheric air. Barley plant carrying a mutation in the CXE2L1 gene

[0088] The present invention relates to a barley plant or part thereof, wherein said barley plant has high a-amylase activity in an endosperm half-grain lacking the embryo, and wherein said barley plant carries a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a gain of function mutant CXE2L1 polypeptide. Wildtype CXE2L1 is preferably CXE2L1 of SEQ ID NO: 1 , but may also be a functional variant thereof having at least 95% sequence identity thereto.

[0089] In some aspects, the invention relates to a barley plant or part thereof, wherein said barley plant has high a-amylase activity in an endosperm half-grain lacking the embryo, wherein said barley plant carries: a. a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a gain of function mutant CXE2L1 polypeptide, and b. a mutation in a gene encoding a p-glucan synthase.

[0090] Wild-type CXE2L1 is preferably CXE2L1 of SEQ ID NO: 1 , but may also be a functional variant thereof having at least 95% sequence identity thereto. In some embodiments, the gain of function mutant CXE2L1 comprises a substitution as described herein below.

[0091] In some aspects, the invention relates to a barley plant or part thereof, wherein said barley plant carries a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a mutant CXE2L1 polypeptide, wherein said mutant CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto, except that mutant CXE2L1 comprises a substitution at: a. the amino acid corresponding to amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or b. the amino acid corresponding to amino acid 113 of SEQ I D NO: 1 , wherein said substitution is a substitution of a serine (S) to a proline (P), with the proviso that the plant does not contain SEQ ID NO: 5.

[0092] In some aspects, the invention relates to a barley plant or part thereof, wherein said barley plant carries a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a mutant CXE2L1 polypeptide, wherein said mutant CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto, except that mutant CXE2L1 comprises a substitution at: a. the amino acid corresponding to amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or b. the amino acid corresponding to amino acid 113 of SEQ I D NO: 1 , wherein said substitution is a substitution of a serine (S) to a proline (P), with the proviso that the plant does not contain SEQ ID NO: 5; and / or c. the amino acid corresponding to amino acid 125 of SEQ ID NO: 1 , wherein said substitution is a substitution of a proline (P) to a serine (S); and / or d. the amino acid corresponding to amino acid 126 of SEQ ID NO: 1 , wherein said substitution is a substitution of an alanine (A) to a threonine (T); and / or e. the amino acid corresponding to amino acid 127 of SEQ ID NO: 1, wherein said substitution is a substitution of an alanine (A) to a threonine (T); and / or f. the amino acid corresponding to amino acid 212 of SEQ ID NO: 1 , wherein said substitution is a substitution of an alanine (A) to a threonine (T); and / or g. the amino acid corresponding to amino acid 212 of SEQ ID NO: 1 , wherein said substitution is a substitution of an alanine (A) to a valine (V).

[0093] In some aspects, the invention relates to a barley plant or part thereof, wherein said barley plant carries: a. a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a mutant CXE2L1 polypeptide, wherein said mutant CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto, except that mutant CXE2L1 comprises a substitution at: i. the amino acid corresponding to amino acid 127 of SEQ ID NO: 1, wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or ii. the amino acid corresponding to amino acid 113 of SEQ ID NO: 1, wherein said substitution is a substitution of a serine (S) to a proline (P); and further b. a mutation in a gene encoding a p-glucan synthase. In some aspects, the invention relates to a barley plant or part thereof, wherein said barley plant carries: a. a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a mutant CXE2L1 polypeptide, wherein said mutant CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto, except that mutant CXE2L1 comprises a substitution at: i. the amino acid corresponding to amino acid 127 of SEQ ID NO: 1, wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or ii. the amino acid corresponding to amino acid 113 of SEQ ID NO: 1, wherein said substitution is a substitution of a serine (S) to a proline (P); and / or iii. the amino acid corresponding to amino acid 125 of SEQ ID NO: 1, wherein said substitution is a substitution of a proline (P) to a serine (S); and / or iv. the amino acid corresponding to amino acid 126 of SEQ ID NO: 1, wherein said substitution is a substitution of an alanine (A) to a threonine (T); and / or v. the amino acid corresponding to amino acid 127 of SEQ ID NO: 1, wherein said substitution is a substitution of an alanine (A) to a threonine (T); and / or vi. the amino acid corresponding to amino acid 212 of SEQ ID NO: 1, wherein said substitution is a substitution of an alanine (A) to a threonine (T); and / or vii. the amino acid corresponding to amino acid 212 of SEQ ID NO: 1, wherein said substitution is a substitution of alanine (A) to a valine (V); and further b. a mutation in a gene encoding a p-glucan synthase.

[0094] In some embodiments, said barley plant or part thereof has high a-amylase activity in an endosperm half-grain lacking the embryo. “High a-amylase activity” is preferably an activity of at least 20 ll / g dry weight 24 h after imbibing a dry half-grain with water. In some embodiments, the kernels of the barley plant of the invention have a reduced P-glucan content compared to a barley not carrying the mutation(s) but otherwise of similar phenotype. In particular, germinating kernels of the barley plant of the invention have a reduced p-glucan content 4 to 6 days after initiation of germination compared to a wild-type barley compared to a barley not carrying the mutation(s) but otherwise of similar phenotype.

[0095] In some embodiments, the wild-type CXE2L1 polypeptide is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 90% sequence identity thereto, such as at least 91% sequence identity thereto, such as at least 92% sequence identity thereto, such as at least 93% sequence identity thereto, such as at least 94% sequence identity thereto, 95% sequence identity thereto, such as at least 96% sequence identity thereto, such as at least 97% sequence identity thereto, such as at least 98% sequence identity thereto, such as at least 99% sequence identity thereto, such as 100% sequence identity thereto. The CXE2L1 gene may be any gene encoding aforementioned CXE2L1.

[0096] In principle, the barley plant of the present invention may comprise any type of mutation in the CXE2L1 gene that results in a gain of function mutant CXE2L1 polypeptide. In particular, the mutation in the CXE2L1 gene may result in substitution of an amino acid in close proximity to the ligand (i.e. substrate) binding site of the CXE2L1 polypeptide.

[0097] In some embodiments, the gain of function mutant CXE2L1 polypeptide comprises a substitution of a substrate interacting amino acid, such as an amino acid in the active site of CXE2L1.

[0098] In some embodiments, the gain of function mutant CXE2L1 polypeptide comprises a substitution of an amino acid positioned within <5 angstrom from the substrate interacting amino acids of CXE2L1.

[0099] In some embodiments, the gain of function mutant CXE2L1 polypeptide comprises a substitution of an amino acid positioned within <5 angstrom from the amino acids that are within <5 angstrom from the substrate interacting amino acids of CXE2L1. In some embodiments, the gain of function mutant CXE2L1 polypeptide comprises a substitution of an amino acid selected from the group consisting of: a. the amino acid corresponding to S113 or A127 of SEQ ID NO: 1 ; or b. the amino acid corresponding to P125, A126 or A212 of SEQ ID NO: 1 ; or c. the amino acid corresponding to F13, L14, G83, G84, G85, L88, Q93, F96, H166, S167, A168, F201 , S219, L220, T221 , M224, L228, H300, G301 , F302, I304, or R305 of SEQ ID NO: 1 ; or d. the amino acid corresponding to E11 , D12, G15, V16, V17, Q18, R27, E30, L33, T35, Y63, Y80, F81 , H82, Y86, C87, G89, S90, 191 , A92, P94, N95, H97, S98, L99, C100, Y116, L118, S164, G165, G169, A170, N171 , L172, A173, L198, S199, A200, F202, A203, G217, V218, T222, A223, A225, D226, Q227, W229, R230, M231 , S232, L233, A244, V265, P267, S269, D270, V271 , L272, F295, E298, Q299, P303, Q306, P307, S309, T311 , A312, or L315 of SEQ ID NO: 1 ; or e. the amino acid corresponding to V9, V10, L19, L20, S24, V25, V26, G28, D29, A31 , V32, R34, N36, G37, L39, P40, V42, V45, Q46, W47, D49, Y52, L58, S59, V60, R61 , A62, R64, P65, L78, V79, L101 , R102, A103, A104, A105, A109, V110, V111 , L112, S113, V114, Q115, R117, A119, P120, E121 , H122, R123, L124, A127, 1128, D130, G131 , F134, W151 , F162, L163, H174, H175, V176, T177, V178, 1196, L197, G204, A205, R207, T208, T210, E211 , P214, P215, E216, P234, V235, A237, S238, M239, H241 , P242, L243, N245, P246, L263, V264, A266, L268, R273, D274, R275, V276, Y279, V293, Q294, E296, G297, F308, E310, S313, E314, L316, R317 ,V318, 1319, or R320 of SEQ ID NO: 1 ; f. the amino acid corresponding to Y86, Y116, R117, H122, R123, L124, P125, A126, 1128, D129, D130, G131 or L172 of SEQ ID NO: 1 ; g. the amino acid corresponding to S59, V60, R61 , Y63, Y80, 191 , C100, V111 , L112, V114 or Q115 of SEQ ID NO: 1 ; wherein wild-type CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto.

[0100] The substitutions may be a substitution of any of the above-mentioned amino acids into any other amino acid. In some embodiments, the substitution is a substitution of an alanine for a non-polar amino acid, and / or an aliphatic amino acid, and / or an amino acid with a hydrophobic side chain. In some embodiments, the substitution is a substitution of an alanine for a valine.

[0101] In some embodiments, the substitution is a substitution of a serine for a small amino acid, and / or an aliphatic amino acid. In some embodiments, the substitution is a substitution of a serine for a proline.

[0102] In some embodiments, the substitution in the CXE2L1 polypeptide comprises a substitution at: a. amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or b. amino acid 113 of SEQ ID NO: 1, wherein said substitution is a substitution of a serine (S) to a proline (P).

[0103] In some embodiments, the substitution in the CXE2L1 polypeptide comprises a substitution at: a. amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or b. amino acid 113 of SEQ ID NO: 1, wherein said substitution is a substitution of a serine (S) to a proline (P); and / or c. amino acid 125 of SEQ ID NO: 1 , wherein said substitution is a substitution of proline (P) into serine (S); and / or d. amino acid 126 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or e. amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or f. amino acid 212 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or g. amino acid 212 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into valine (V). In some embodiments, in addition to the substitution in the CXE2L1 polypeptide described above, the CXE2L1 polypeptide may comprise one or more mutations selected from the group consisting of:

[0104] • the amino acid corresponding to A62 of SEQ ID NO: 1 to V (A62V) or to T (A62T),

[0105] • the amino acid corresponding to S67 of SEQ ID NO: 1 to L (S67L),

[0106] • the amino acid corresponding to V153 of SEQ ID NO: 1 to M (V153M),

[0107] • the amino acid corresponding to A212 of SEQ ID NO: 1 to T (A212T) or to V (A212V),

[0108] • the amino acid corresponding to E216 of SEQ ID NO: 1 to K (E216K),

[0109] • the amino acid corresponding to M224 of SEQ ID NO: 1 to I (M224I),

[0110] • the amino acid corresponding to R230 of SEQ ID NO: 1 to C (R230C) or to H (R230H) or

[0111] • the amino acid corresponding to S238 of SEQ ID NO: 1 to N (S238N), wherein wild-type CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto.

[0112] In some embodiments, the substitution is selected from the substitutions listed in table A, table B or table C below. “Ter” denotes stop codon.

[0113] Table A.

[0114]

[0115] Table B

[0116]

[0117] Table C.

[0118] In some embodiments, the CXE2L1 polypeptide comprises at least one substitution, such as at least two substitutions, such as at least three substitutions, such as at least four substitutions, such as at least five substitutions selected from any of the substitutions described herein.

[0119] In particular embodiments, the substitution is S113P, with the proviso that the plant does not contain SEQ ID NO: 5.

[0120] As used herein the terms “substitution of amino acid X for amino acid Y” or “substitution of amino acid X to amino acid Y” refers to amino acid X in a reference sequence (typically the CXE2L1 wild-type sequence of SEQ ID NO: 1) being replaced by amino acid Y. Substitution of amino acid X for amino acid Y may also be described as XnY, where n indicates the position of the amino acid in the sequence. By way of example, S113P refers to a substitution of the Ser at position 113 to a Pro. Characteristics of barley plant carrying a mutation in CXE2L1

[0121] Hydrolytic enzyme activity, such as a-amylase activity, of barley plants is tightly regulated. During germination hydrolytic enzyme activity aids in conversion of starch to sugar. However, at other time points during plant development, e.g. during grain filling, hydrolytic enzyme activity, such as a-amylase activity, is undesired, because it may result in reduced grain filling, reduced starch content, shriveled grains and / or preharvest sprouting.

[0122] The invention provides barley plants carrying a mutation in CXE2L1, said mutation preferably leading to expression of a gain of function mutant CXE2L1 polypeptide. One major advantage of such barley plants is an increase in hydrolytic enzyme activity during germination.

[0123] The inventors have discovered that, very surprisingly, the barley plant or part thereof carrying a point mutation in CXE2L1 have highly similar, in principle identical, agronomical properties as compared to barley plants or parts thereof of a similar genotype not carrying such point mutation in the CXE2L1, and thus, not comprising the mutant CXE2L1 polypeptide. This finding is rather surprising because aberrant a- amylase activity may have severe consequences on plant health. The barley plants of the invention are thus preferably further characterized by having highly similar and / or identical agronomical properties as compared to the agronomical properties of a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0124] In some embodiments, said agronomical properties are selected from the group consisting of flowering time, plant height, thousand grain weight (TGW), average grain size, content of starch in the grains, content of protein in the grains, content of water in the grains, tiller number, maturation time, germination speed, time to bushing and plant yield.

[0125] In some embodiments, the grains of said barley plant do not sprout on the plant prior to harvesting. In other words, the barley plant has no pre-harvest sprouting. Pre-harvest sprouting is highly undesirable. Furthermore, as stated herein above, barley plants carrying a point mutation in the CXE2L1 according to the invention has high activity of one or more hydrolytic enzyme. In particular, barley plants carrying a point mutation in CXE2L1 according to the invention has high activity of one or more hydrolytic enzyme in grains during germination.

[0126] In some embodiments, the one or more hydrolytic enzyme is selected from the group consisting of a-amylase, p-amylase, limit dextrinase, pullulanase, p-glucanase, xylanase, glucoamylase and protease.

[0127] In some embodiments, the one or more hydrolytic enzyme is selected from the group consisting of a-amylase, p-amylase and limit dextrinase.

[0128] In some embodiments, the level, such as the amount, of mRNA transcribed from one or more genes encoding hydrolytic enzymes in the barley plant or part thereof is increased as compared to a similar barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype, wherein the level, such as the amount, of mRNA is measured in whole grains, wherein said grains have been germinated for at least 12 h, such as at least 24 h, such as at least 36 h, such as at least 48 h.

[0129] In some embodiments, the level, such as the amount, of mRNA is increased by at least 5%, such as by at least 10%, such as by at least 15%, such as by at least 20%, such as by at least 30%, such as by at least 40% such as by at least 50%, such as by at least 60%, such as by at least 70%, such as by at least 80%, such as by at least 90%, such as by at least 100%, such as by at least 200% as compared to a similar barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype, wherein the level, such as the amount, of mRNA is measured in whole grains, wherein said grains have been germinated for at least 12 h, such as at least 24 h, such as at least 36 h, such as at least 48 h.

[0130] In some embodiments, the level, such as the amount, of mRNA is increased by between 5% and 200%, such as by between 10% and 150%, such as by between 25% and 100%, such as by between 15% and 80%, such as by between 50% and 150% as compared to a similar barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype, wherein the level, such as the amount, of mRNA is measured in whole grains, wherein said grains have been germinated for at least 12 h, such as at least 24 h, such as at least 36 h, such as at least 48 h.

[0131] The level, such as the amount, of mRNA can be measured using any method known to the person skilled in the art. For example, the level of mRNA can be measured using real-time reverse transcription polymerase chain reaction (RT-qPCR).

[0132] In particular, plants carrying a point mutation in CXE2L1 has high activity of a-amylase in the endosperm half-grain lacking the embryo. On the contrary, the activity of a- amylase in the endosperm half-grain lacking the embryo of a plant not comprising a mutant CXE2L1 polypeptide according to the invention, but otherwise of similar genotype, is very low. In principle, no a-amylase activity can be detected in the endosperm half-grain lacking the embryo of a plant not expressing such gain of function mutant CXE2L1 polypeptide, but otherwise of similar genotype.

[0133] In some embodiments, the high a-amylase activity in an endosperm half-grain lacking the embryo is at least 5 ll / g, preferably at least 10 ll / g, such as at least 15 ll / g, such as at least 20 ll / g, such as at least 25 ll / g, such as at least 30 ll / g, such as at least 35 ll / g, such as at least 40 ll / g, such as at least 45 ll / g, such as at least 50 ll / g on a dry weight basis.

[0134] In some embodiments, the high a-amylase activity in an endosperm half-grain lacking the embryo is at least 30 ll / g on a dry weight basis.

[0135] In some embodiments, the high a-amylase activity in an endosperm half-grain lacking the embryo is between 20 ll / g and 60 ll / g, such as between 30 ll / g and 50 ll / g, such as between 30 ll / g and 45 ll / g, such as between 35 ll / g and 45 ll / g, such as between 30 ll / g and 40 ll / g, such as between 35 ll / g and 40 ll / g, such as between 40 ll / g and 50 U / g.

[0136] Preferably aforementioned high a-amylase activity is determined 12 h to 48 h after imbibing dry half-grains with water. More preferably said high a-amylase activity is determined as described in Example 3 below. In some embodiments, the a-amylase activity in the endosperm half-grains lacking the embryo of said barley plant is increased by at least 2-fold as compared to a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype, such as by at least 3-fold, such as by at least 4-fold, such as by at least 5- fold, such as by at least 6-fold, such as by at least 7-fold, such as by at least 8-fold, such as by at least 9-fold, such as by at least 10-fold, such as by at least 20-fold, such as by at least 30-fold, such as by at least 50-fold, such as by at least 100-fold, such as by at least 1000-fold, such as by at least 10,000-fold as compared to a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0137] In some embodiments, the a-amylase activity in the endosperm half-grains lacking the embryo of said barley plant is increased by between 2-fold and 10,000-fold as compared to a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype, such as by between 5-fold and 100-fold, such as by between 20-fold and 100-fold, such as by between 3-fold and 50-fold, such as by between 5-fold and 25-fold, such as by between 10-fold and 75-fold, such as by between 30-fold and 60-fold, such as by between 300-fold to 500-fold, such as between 100-fold and 10,000-fold, such as between 50-fold and 1000-fold, such as between 500-fold and 5,000-fold fold as compared to a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0138] In some embodiments, a-amylase activity in the whole grains of barley plants carrying a point mutation in the CXE2L1 is increased as compared to the a-amylase activity in the whole grains of a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0139] In some embodiments, a-amylase activity in the whole grains of barley plants carrying a point mutation in the CXE2L1 is increased by at least 5%, such as by at least 10%, such as by at least 15%, such as by at least 20%, such as by at least 50%, such as by at least 100%, such as by at least 200% as compared to a similar barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0140] In some embodiments, a-amylase activity in the whole grains of barley plants carrying a point mutation in the CXE2L1 is increased by between 5% and 200%, such as by between 5% and 150%, such as by between 5% and 100%, such as by between 50% and 100% as compared to a similar barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0141] Preferably, aforementioned increase in a-amylase activity is obtained 12 to 110 h, such as 12 to 96 h, for example 24 to 48 h after initiation of germination.

[0142] In some embodiments, the activity of p-amylase in the grains of a barley plant carrying a point mutation in CXE2L1 is increased as compared to a similar barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0143] In some embodiments, the activity of limit dextrinase in the grains of a barley plant carrying a point mutation in CXE2L1 is increased as compared to a similar barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0144] Very preferably, the hydrolytic enzyme activity, such as for example a-amylase activity, a-amylase activity and / or limit dextrinase activity, is measured after imbibing dry halfgrains in water and / or after initiation of germination of the whole or half-grain, whichever applicable. Thus, preferably, hydrolytic enzyme activity is measured after imbibition in water and / or germination for at least 12 h, such as at least 24 h, such as at least 48 h, such as at least 72 h.

[0145] Thus, in some embodiments, hydrolytic enzyme activity is high and / or increased after imbibition in water and / or germination for at least 12 h, such as at least 24 h, such as at least 48 h, such as at least 72 h.

[0146] In some embodiments hydrolytic enzyme activity is high and / or increased after imbibition in water and / or germination for between 12 h and 72 h, such as between 24 h and 72 h, such as between 24 h and 48 h, such as between 48 h and 72 h. a-Amylase activity can be measured using methods well known to the person skilled in the art. a-Amylase activity can for example be measured using a standardized kit, such as by using the Ceralpha kit from Megazyme according to the manufacturer’s protocol (K-CERA 01 / 12). P-Amylase activity can be measured using methods well known to the person skilled in the art. p-Amylase activity can for example be measured using a standardized kit, such as by using the p-amylase Assay Kit (Betamyl-3) from Megazyme according to the manufacturer’s protocol (K-BETA3).

[0147] P-glucanase activity can be measured using methods well known to the person skilled in the art. p-glucanase activity can for example be measured using a standardized kit, such as by using the malt p-glucanase / lichanase kit from LI BIOS according to the manufacturer’s protocol (MBG4 Method).

[0148] Limit dextrinase activity can be measured using methods well known to the person skilled in the art. Limit dextrinase activity can for example be measured using a standardized kit, such as by using the Pullanase Limit Dextrinase Assay Kit from Megazyme according to the manufacturer’s protocol (PullG6 Method).

[0149] Barley plant

[0150] The barley plant according to the invention may be any plant of the species Hordeum vulgare, including any breeding line or cultivar or variety.

[0151] “Wild barley”, Hordeum vulgare ssp. Spontaneum, is considered the progenitor of today’s cultivated forms of barley. Domesticated, but heterogeneous mixtures of barley are referred to as barley landraces. Today, most of the landraces have been displaced in advanced agricultures by pure line cultivars. Compared with landraces, modern barley cultivars have numerous improved properties (Nevo, 1992; Pelger et al., 1992).

[0152] Within the present invention, the term “barley plant” comprises any barley plant, such as wild barley, barley landraces or modern barley cultivars. Thus, the invention relates to any barley plant comprising a mutation in the CXE2L1 gene as described herein.

[0153] However, preferred barley plants for use with the present invention are modern barley cultivars or pure lines. The barley cultivar to be used with the present invention may, for example, be selected from the group consisting of RGT Planet (Planet), Paustian, Sebastian, Quench, Celeste, Lux, Prestige, Saloon, Neruda, Harrington, Klages, Manley, Schooner, Stirling, Clipper, Franklin, Alexis, Blenheim, Ariel, Lenka, Maresi, Steffi, Gimpel, Cheri, Krona, Camargue, Chariot, Derkado, Prisma, Union, Beka, Kym, Asahi 5, KOU A, Swan Hals, Kanto Nakate Gold, Hakata No. 2, Kirin - choku No. 1 , Kanto late Variety Gold, Fuji Nijo, New Golden, Satukio Nijo, Seijo No. 17, Akagi Nijo, Azuma Golden, Amagi Nijpo, Nishino Gold, Misato golden, Haruna Nijo, Scarlett, Rosalina and Jersey preferably from the group consisting of Haruna Nijo, Sebastian, Quench, Celeste, Lux, Prestige, Saloon, Neruda and Power, preferably from the group consisting of Paustian, Harrington, Klages, Manley, Schooner, Stirling, Clipper, Franklin, Alexis, Blenheim, Ariel, Lenka, Maresi, Steffi, Gimpel, Cheri, Krona, Camargue, Chariot, Derkado, Prisma, Union, Beka, Kym, Asahi 5, KOU A, Swan Hals, Kanto Nakate Gold, Hakata No. 2, Kirin - choku No. 1 , Kanto late Variety Gold, Fuji Nijo, New Golden, Satukio Nijo, Seijo No. 17, Akagi Nijo, Azuma Golden, Amagi Nijpo, Nishino Gold, Misato golden, Haruna Nijo, Scarlett and Jersey preferably from the group consisting of Paustian, Haruna Nijo, Sebastian, Tangent, Lux, Prestige, Saloon, Neruda, Power, Quench, NFC Tipple, Barke, Class, Vintage, Applaus, Bowie, Broadway, Champ, Chanson, Charles, Chimbon, Cosmopolitan, Crossway, Dragoon, Ellinor, Embrace, Etoile, Evergreen, Flair, Highway, KWS Beckie, KWS Cantton, KWS Coralie, KWS Fantex, KWS Irina, KWS Josie, KWS Kellie, LG Diablo, LG Figaro, LG Nabuco, LG Tomahawk, Laureate, Laurikka, Lauxana, Luther, Odyssey, Ovation, Prospect, RGT Elysium, RGT Observer, RGT Planet, Rotator, Sarbi, Scholar, Subway and Golden Promise.

[0154] The terms “RGT Planet” and “Planet” are used interchangeably herein.

[0155] The barley plant may be in any suitable form. For example, the barley plant according to the invention may be a viable barley plant, a dried plant, a homogenized plant, a kernel or a milled barley kernel. The plant may be a mature plant, an embryo, a kernel, a germinated kernel, a malted kernel (e.g. in the form of green malt or kiln dried malt), a milled malted kernel, a milled kernel or the like.

[0156] Parts of barley plants may be any suitable part of the plant, such as kernels, embryos, leaves, stems, roots, flowers, or fractions thereof. A fraction may, for example, be a section of a kernel, embryo, leaf, stem, root, or flower. Parts of barley plants may also be a fraction of a homogenate or a fraction of a milled barley plant or kernel.

[0157] In one embodiment of the invention, parts of barley plants may be cells of said barley plant, such as viable cells that may be propagated in vitro in tissue cultures. In other embodiments, however, the parts of barley plants may be viable cells that are not capable of maturing into an entire barley plant, i.e. cells that are not a reproductive material. Thus, one embodiment, the plant part is not a reproductive material.

[0158] In some embodiments, the plant or part thereof has not been obtained by means of an essentially biological process. In some embodiments, the progeny of the plant or part thereof has not been obtained by means of an essentially biological process. In other words, in one embodiment the barley plant of the invention has not exclusively been obtained by means of an essentially biological process. Progeny of a barley plant obtained by a technical process is herein considered as not being exclusively obtained by means of an essentially biological process, because the parent plant is obtained by a technical process.

[0159] The barley plant or part thereof not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype may for example be a parent plant. Thus, if the mutant is obtained by mutagenesis of a given barley cultivar, the barley plant not carrying the point mutation in the CXE2L1 gene but otherwise of similar genotype may preferably be a plant of said cultivar.

[0160] Barley plants comprising more than one mutation

[0161] In addition to the mutations described herein the barley plants may also comprise one or more further mutations. Accordingly, the barley plant may comprise one or more of following mutations.

[0162] In addition to the one or more mutations described above, the barley plant may also comprise a mutation in a gene encoding a p-glucan synthase. One major advantage of such barley plants is that the kernels of said barley plant have a reduced p-glucan content. Preferably, said p-glucan is (1 ,3; 1 ,4)- p-glucan.

[0163] In some embodiments, the barley plant carrying a mutation in a gene encoding a p- glucan synthase has a (1 ,3;1 ,4)-p-glucan content: a. less than 5% dry weight of total kernels, for example less than 3% dry weight of total kernels, preferably less than 2 % dry weight of total kernels; and / or b. at most 60%of the (1,3;1 ,4)-p-glucan content of a barley plant carrying a wildtype CslF6 gene, but otherwise of similar genotype. In some embodiments, the barley plant carrying a mutation in a gene encoding a p- glucan synthase has a (1 ,3;1 ,4)-p-glucan content: a. in the range of 1 to 5% dry weight of total kernels, for example 1 to 3% dry weight of total kernels, for example 1.3 to 3% dry weight of total kernels, preferably 1.3 to 2 % dry weight of total kernels; and / or b. of at least 30% and at most 60%, preferably at least 40% and at most 60% of the (1 ,3;1 ,4)- -glucan content of a barley plant carrying a wild type CslF6 gene, but otherwise of similar genotype.

[0164] In principle, the barley plant may comprise any type of mutation in a gene encoding a P-glucan synthase that results in a loss of function mutant p-glucan synthase polypeptide. In some embodiments, the mutation is a deletion.

[0165] In some embodiments, the gene encoding a p-glucan synthase is CslF6. Thus, in some embodiments, the barley plant carries a mutation in the gene encoding CslF6. Said mutation may for example be any of the mutations described in international patent application WO 2019 / 129736.

[0166] Thus, in some embodiments, the gene encoding a p-glucan synthase is CslF6, wherein said mutated CslF6 gene encodes a mutant CslF6 polypeptide, wherein wild-type CslF6 is CslF6 of SEQ ID NO: 7 or a functional variant thereof having at least 95% sequence identity thereto.

[0167] In some embodiments, the mutated CslF6 gene encodes a loss of function mutant CslF6 polypeptide, wherein wild-type CslF6 is CslF6 of SEQ ID NO: 7 or a functional variant thereof having at least 95% sequence identity thereto. In particular, the mutation may introduce a premature stop codon, a frame shift and or a splice site mutation.

[0168] In some embodiments, the mutant CslF6 polypeptide comprises a substitution of one amino acid in a membrane localized domain of CslF6. The membrane localised amino acids in CslF6 are indicated in table D below. Table D. Localization of membrane localized amino acid sequences in the CslF6 protein. (AA = amino acid)

[0169] In some embodiments, the mutant CslF6 polypeptide comprises a substitution of one amino acid in a membrane localized domain of CslF6, wherein said substitution is a substitution of a non-polar amino acid to a charged amino acid or a substitution of a polar amino acid to a non-polar amino acid, wherein the membrane localised domain is selected from the group consisting of the membrane localised domains of CslF6 consisting of: a. amino acids 835 to 857 (SEQ ID NO: 9), or b. amino acids 700 to 731 (SEQ ID NO: 10), or c. amino acids 741 to 758 (SEQ ID NO: 11). In some embodiments, the mutant CslF6 polypeptide comprises a substitution of one amino acid in a membrane localized domain of CslF6, wherein said mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of one amino acid in the transmembrane domain consisting of amino acids 835 to 857 (SEQ ID NO: 9) of CslF6, wherein said substitution is substitution of a non-polar amino acid to a charged amino acid.

[0170] In some embodiments, the mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of amino acid 847, wherein said substitution is substitution of a glycine (G) to a glutamic acid (E).

[0171] In some embodiments, the mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of one amino acid in the transmembrane domain consisting of amino acids 741 to 758 (SEQ ID NO: 10) of CslF6, wherein said substitution is substitution of a non-polar amino acid to a charged amino acid.

[0172] In some embodiments, the mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of amino acid 748, wherein said substitution is substitution of a glycine (G) to an aspartic acid (D).

[0173] In some embodiments, the mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of one amino acid in the transmembrane domain consisting of amino acids 700 to 731 of CslF6 (SEQ ID NO: 11), wherein said substitution is substitution of a polar amino acid to a non-polar amino acid.

[0174] In some embodiments, the mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of amino acid 709, wherein said substitution is substitution of a threonine (T) to an isoleucine (I).

[0175] In addition to the one or more of the mutations described above, the barley plant may also comprise a mutation in the gene encoding LOX-1 resulting in a total loss of functional LOX-1. Said mutation may for example be any of the mutations described in international patent application WO 2005 / 087934. For example the barley plant may comprise a gene encoding LOX-1 comprising a premature stop codon, said codon corresponding to base nos. 3572-3574 of SEQ ID NO:2 of WO 2005 / 087934 or a splice site mutation, said mutation corresponding to base no. 2311 of SEQ ID NO: 6 of SEQ ID NO: 2 of WO 2005 / 087934.

[0176] In addition to one or more of the mutations described above, the barley plant may also comprise a mutation in the gene encoding LOX-2 resulting in a total loss of functional LOX-2. Said mutation may for example be any of the mutations described in international patent application WO 2010 / 075860. For example, the barley plant may comprise a gene encoding LOX-2 comprising a mutation at nucleotide position 2689 of SEQ ID NO: 1 of WO 2010 / 075860, leading to formation of a premature stop codon.

[0177] In addition to one or more of the mutations described above, the barley plant may also comprise a mutation in the gene encoding MMT resulting in a total loss of functional MMT. Said mutation may for example be any of the mutations described in international patent application WO 2010 / 063288. For example, the barley plant may comprise a gene encoding MMT comprising a G^A mutation of base no. 3076 of SEQ ID NO: 3 of WO 2010 / 063288 or a gene encoding MMT comprising a G^A mutation of base no. 1462 of SEQ ID NO: 16 WO 2010 / 063288.

[0178] In addition to one or more of the mutations described above, the barley plant may also comprise a mutation in a gene encoding a protein involved in biosynthesis of anthocyanin and / or proanthocyanidin, for example in one or more of the genes described by Jende-Strid (Genetic control of flavonoid biosynthesis in barley, Hereditas 119: 187-204, 1993). The barley plant may for example be an anthocyanogen-free mutant as described in US 4,165,387. In some embodiments, the barley plant may comprise a mutation in the gene encoding ANT-28 resulting in a total loss of functional ANT-28. ANT-28 encodes a domain protein involved in proanthocyanidin accumulation in developing grains (Himi et al., Ant28 gene for proanthocyadinin synthesis encoding the R2R3 MYB domain protein highly affects grain dormancy in barley, Euphytica, 188:141-151 , 2012). The mutation in ANT-28 may for example be any of the mutations described on GrainGenes (https: / / wheat.pw.usda.gov / ggpages / bgn / 42 / BGS685- 757.htm; see section “BGS 608, Proanthocyanidin-free 28, ant28”), such as for example ant28.484. Barley plants comprising such mutation(s) are preferably free from, or have low content of, anthocyanogens. In addition to one or more of the mutations described above, the barley plant may also comprise a mutation in the gene encoding HRT resulting in a total loss of functional HRT. Said mutation may for example be any of the mutations described in international patent application WO 2019 / 129739. The barley plant may for example also carry a mutation in the HRT gene resulting in a mutant HRT gene encoding a mutant HRT protein lacking one or more of the amino acids of SEQ ID NO: 2 of WO 2019 / 129739, or a mutation resulting in deletion of at least the coding region of the HRT gene, wherein the coding region of the HRT gene encodes a polypeptide of SEQ ID NO: 2 of WO 2019 / 129739. Preferably, the mutation is a mutation resulting in a mutant HRT gene encoding a mutant HRT protein, wherein said mutant HvHRT protein carries a W170stop mutation of SEQ ID NO: 2 of WO 2019 / 129739, or the barley plant carries a mutant HvHRT gene comprising a G^A mutation of the nucleotide 510 of the HvHRT coding sequence of SEQ ID NO: 1 of WO 2019 / 129739.

[0179] In addition to one or more of the mutations described above, the barley plant may also comprise a mutation in the gene encoding LDI resulting in a total loss of functional LDI. The mutation may be any type of mutation resulting in a loss of function of LDI. Said mutation may for example be any of the mutations described in international patent application WO 2021 / 175786. For example, the barley plant may carry a mutation in the LDI gene resulting in a mutant LDI gene encoding a mutant LDI protein lacking one or more of the amino acids of SEQ ID NO: 1 of WO 2021 / 175786, or a mutation resulting in deletion of at least the coding region of the LDI gene, wherein the coding region of the LDI gene encodes a polypeptide of SEQ ID NO: 1 of WO 2021 / 175786. For example, the mutation may be selected from: a. a missense mutation resulting in a change from a proline to a different amino acid in one or more loop regions of LDI, and b. a missense mutation resulting in a change from a negatively charged amino acid to a non-negatively charged amino acid in one or more alpha helix regions of LDI.

[0180] Preferably, the loop regions are selected from the group consisting of amino acids corresponding to position 25 to 44 and amino acids corresponding to position 56 to 62 and amino acids corresponding to position 77 to 78 and amino acids corresponding to position 91 to 111 and amino acids corresponding to position 124 to 147 of SEQ ID NO: 1 of WO 2021 / 175786. Further preferably, the alpha helix regions are selected from the group consisting of amino acids corresponding to position 45 to 55 and amino acids corresponding to position 63 to 76 and amino acids corresponding to position 79 to 90 and amino acids corresponding to position 112 to 123 of SEQ ID NO: 1 of WO 2021 / 175786.

[0181] In addition to the one or more of the mutations described above, the barley plant may also have an amy1_1 haplotype characterised by said barley plants comprising an amy1_1 cluster comprising at least 5 copies of genes encoding functional a-amylases. In other words, said barley plant may have an amy1_1 haplotype characterised by said barley plants comprising an amy1_1 cluster comprising at least 5 functional genes, each gene encoding an a-amylase.

[0182] Said 5 functional genes may each encode the same a-amylase or they may encode different a-amylases, such as different a-amylase variants. In some cases, two or more of said 5 functional genes may each encode the same a-amylase, while the remaining functional genes each encode different a-amylases, such as different a-amylase variants.

[0183] In preferred embodiments, the amy1_1 cluster comprises at least five functional genes each encoding an a-amylase independently selected from the group consisting of:

[0184] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 37;

[0185] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 38;

[0186] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 39;

[0187] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 40;

[0188] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 41 ;

[0189] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 42;

[0190] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 43;

[0191] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 44;

[0192] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 45;

[0193] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 46;

[0194] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 47; and

[0195] • functional homologs of any of the aforementioned having at least 80% sequence identity thereto, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, or such as at least 99% sequence identity thereto.

[0196] In very preferred embodiments the barley plant comprises at least five functional genes each encoding an a-amylase independently selected from the group consisting of:

[0197] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 42 or a functional homolog thereof with at least 80% sequence identity thereto, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, or such as at least 99% sequence identity thereto;

[0198] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 43 or a functional homolog thereof with at least 80% sequence identity thereto, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, or such as at least 99% sequence identity thereto; and

[0199] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 44 or a functional homolog thereof with at least 80% sequence identity thereto, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, or such as at least 99% sequence identity thereto.

[0200] In some embodiments, the barley plant or part thereof according to the present disclosure carries: a. an amy1_1 cluster comprising at least 5 functional genes each encoding an a-amylase, wherein said amy1_1 cluster is as described elsewhere herein; b. a mutation in the gene encoding LOX-1 resulting in a total loss of functional LOX-1 as described elsewhere herein; c. optionally, a mutation in the gene encoding LOX-2 resulting in a total loss of functional LOX-2 as described elsewhere herein; d. a mutation in the gene encoding MMT resulting in a total loss of functional MMT as described elsewhere herein; and e. a mutation in CXE2L1 as described elsewhere herein.

[0201] In some embodiments, the barley plant or part thereof according to the present disclosure carries: a. an amy1_1 cluster comprising at least 5 functional genes each encoding an a-amylase, wherein said amy1_1 cluster is as described elsewhere herein; b. a mutation in the gene encoding LOX-1 resulting in a total loss of functional LOX-1 ; c. optionally, a mutation in the gene encoding LOX-2 resulting in a total loss of functional LOX-2 as described elsewhere herein; d. a mutation in the gene encoding MMT resulting in a total loss of functional MMT as described elsewhere herein; e. a mutation in the gene encoding ANT-28 resulting in a total loss of functional ANT-28 as described elsewhere herein; and f. a mutation in CXE2L1 as described elsewhere herein.

[0202] Said barley plant or part thereof comprising an amy1_1 cluster comprising at least 5 functional genes each encoding an a-amylase combined with one or more additional mutations as described elsewhere herein, such as comprising a mutation in CXE2L1 as described elsewhere herein, may have increased a-amylase activity, increased p- amylase activity, increased free limit dextrinase activity and / or decreased p-glucan content compared to a barley plant or part thereof of similar genotype but not comprising said minimum amy1_1 cluster functional a-amylase gene copy number and optionally not comprising said one or more additional mutations.

[0203] The a-amylase activity is preferably measured as described in Example 4.

[0204] The -amylase activity is preferably measured as described in the K-BETA3 protocol (protocol and kit available from Megazyme, Ireland).

[0205] The free limit dextrinase activity is preferably measured as described in Example 15. The p-glucan content is preferably measured as described in Example 10.

[0206] In some embodiments, the barley plant or part thereof has an a-amylase activity of at least 230 U / g, such as at least 240 U / g, such as at least 250 U / g, such as at least 260 U / g, such as at least 270 U / g, such as at least 280 U / g, such as at least 290 U / g, such as at least 300 U / g, such as at least 310 U / g after 6 days of germination. In some embodiments, the barley plant or part thereof has an a-amylase activity of from 230 to 350 U / g, such as from 240 to 330 U / g, such as from 250 to 320 U / g after 6 days of germination.

[0207] In some embodiments, the barley plant or part thereof has a p-amylase activity of at least 15 ll / g, such as at least 16 ll / g, such as at least 17 ll / g, such as at least 18 ll / g after 6 days of germination. In some embodiments, the barley plant or part thereof has a p-amylase activity of from 15 to 20 ll / g, such as from 15 to 19 ll / g, such as from 15 to 18 ll / g after 6 days of germination.

[0208] In some embodiments, the barley plant or part thereof has a free limit dextrinase activity of at least 60 mll / g, such as at least 65 mll / g, such as at least 70 mll / g, such as at least 75 mll / g, such as at least 80 mU / g after 6 days of germination. In some embodiments, the barley plant or part thereof has a free limit dextrinase activity of from 60 to 90 mU / g, such as from 65 to 85 mU / g, such as from 70 to 80 mU / g after 6 days of germination.

[0209] In some embodiments, the barley plant or part thereof has a p-glucan content of at the most 200 mg / L, such as at the most 175 mg / L, such as at the most 150 mg / L, such as at the most 125 mg / L, such as at the most 100 mg / L, such as at the most 75 mg / L, such as at the most 50 mg / L, such as at the most 25 mg / L, such as at the most 10 mg / L after 6 days of germination. In some embodiments, the barley plant or part thereof has a p-glucan content of from 0 to 200 mg / L, such as from 0 to 150 mg / L, such as from 0 to 100 mg / L, such as from 0 to 75 mg / L, such as from 0 to 50 mg / L, such as from 0 to 25 mg / L after 6 days of germination.

[0210] Plant products

[0211] The invention also provides plant products prepared from a barley plant or part thereof carrying a mutation in CXE2L1, wherein said CXE2L1 encodes a gain of function mutant CXE2L1 polypeptide, e.g. any of the barley plants and parts thereof as described herein.

[0212] The plant product may be any product prepared from a barley plant, for example a food, a feed or a beverage. Thus, the plant product may be any of the beverages described herein below in the section “Beverage and method of production thereof”. The plant product may also be an aqueous extract of the barley plant and / or malt prepared from kernels of said barley plant. For example, the plant product may be wort. Said aqueous extract may for example be prepared as described herein below in the section “Aqueous extract and methods of production thereof”.

[0213] In one embodiment, the plant product is malt, e.g. a milled malt, a green malt, a milled green malt, a kiln dried malt or a milled kiln dried malt, such as any of the malts described herein below in the section “Malt and method of production thereof”. In some embodiments, the plant product is a malt based product, such as malt based beverages. Although the primary use of malt is for beverage production, it can also be utilized in other industrial processes, for example as an enzyme source in the baking industry, or in the food industry as a flavouring and colouring agent, e.g. in the form of malt or malt flour or indirectly as a malt syrup, etc. Thus, the plant product according to the invention may be any of the aforementioned products.

[0214] In one embodiment of the invention, the plant product is barley flour, i.e. barley flour prepared from grains of a barley plant according to the invention.

[0215] In another aspect, the plant products according to the invention comprise, or even consist of syrup, such as a barley syrup, or a barley malt syrup. The plant product may also be an extract of barley or malt. Thus, the plant product may be wort.

[0216] Malt and method of production thereof

[0217] The barley plant of the present invention is particularly useful for producing barleybased beverages, such as beer. Such barley-based beverages are commonly prepared from malt.

[0218] Thus, the invention also provides malt prepared from a barley plant carrying a mutation in the CXE2L1 gene, an optionally one or more additional mutations as described in the section “Barley plants comprising more mutations”. Said malt may be milled malt, green malt, milled green malt, kiln dried malt or milled kiln dried malt prepared from barley grains from a barley plant carrying a mutation in the CXE2L1 gene, or progeny thereof. Said mutation may be any of the mutations in the CXE2L1 gene resulting in a gain of function mutant CXE2L1 as described herein in the section “Barley plants carrying a mutation in CXE2L1”. Green malt may be prepared by malting, i.e. by germination of grains under controlled environmental conditions. Typically, said germination may comprise a step of steeping barley kernels followed by a step of germination. Steeping and germination may also be performed simultaneously or partly simultaneously. In some embodiments, the production of malt may comprise a step of drying the germinated grains. Said drying step may preferably be kiln drying of the germinated kernels at elevated temperatures. Thus, kiln dried malt may be prepared by subjecting green malt to a step of kiln drying.

[0219] Thus, in one embodiment a method of malting may comprise the steps of:

[0220] (a) providing kernels of a barley plant, notably a barley plant, carrying a mutation in the CXE2L1 gene;

[0221] (b) steeping said barley kernels;

[0222] (b) germinating said barley kernels under predetermined conditions; and

[0223] (c) drying said germinated barley kernels, preferably by kiln drying.

[0224] Germinated barley grains may be prepared by a method comprising the steps of

[0225] (a) providing kernels of a barley plant, notably a barley plant, carrying a mutation in the CXE2L1 gene;

[0226] (b) steeping said barley kernels;

[0227] (b) germinating said barley kernel.

[0228] The steps of steeping and germinating may be performed at sequentially, simultaneously or partly simultaneously.

[0229] The barley plants of the invention are particularly useful for preparing malt based beverages, wherein said malt is germinated for less than 96 h, such as less than 72 h, for example less than 48 h, such as for in the range of 24 to 96 h, such as in the range of 24 to 72 h, for example in the range of 24 to 48 h. Aforementioned germination times refers to the total time for steeping and germination.

[0230] In one preferred embodiment steeping and germination is performed simultaneously in a germination process, which comprises incubating barley grains in an aqueous solution typically under aeration for at the most 72 h. Steeping may be performed by any conventional method known to the skilled person. One non-limiting example involves steeping at a temperature in the range of 10 to 25°C with alternating dry and wet conditions. During steeping, for example, the barley kernels may be incubated wet for in the range of 30 min to 3 h followed by incubation dry for in the range of 30 min to 3 h and optionally repeating said incubation scheme in the range of 2 to 5 times. The final water content after steeping may, for example, be in the range of 40 to 50%, for example in the range of 40-45%.

[0231] Germination may comprise a step of incubating grains of a barley plant carrying a mutation in the CXE2L1 gene in an aqueous solution under aeration. For example, the green malt may be produced by any of the methods described in international patent applications WO 2018 / 001882, WO 2019 / 129724 or WO 2019 / 129731.

[0232] In some embodiments the step of germination comprises a. at least one step of incubating said kernels in an aqueous solution at least partly under aeration; and b. at least one step of incubating said barley kernels in air.

[0233] The germinated barley kernels, which have not been dried are also referred to as green malt herein.

[0234] The water content of barley grains may be determined by determining the weight of the barley grains, followed by drying said barley grains and determining the weight of the dried barley grains. The difference in weight of the wet and dry barley grains is considered to be water, and the water content is provided as the weight of the water divided by the total weight of the barley grains (wet barley grains). The water content provided in % is thus a w / w %.

[0235] Germination of grains may be performed by any conventional method known to the skilled person. One non-limiting example involves germination at a temperature in the range of 10 to 25°C, optionally with changing temperature in the range of 1 to 4 days.

[0236] As mentioned above in some embodiments of the invention, the germinated barley grains (i.e. the green malt) may be kiln dried. In some embodiments it is preferred that the green malt is not kiln dried. In particular, it is preferred, that when green malt is prepared by a germination comprising a step of incubating said barley grains in an aqueous solution under aeration, then the green malt is not kiln dried.

[0237] If the green malt is kiln dried, this may be done at conventional temperatures, such as at least 75°C, for example in the range of 80 to 90°C, such as in the range of 80 to 85°C. Thus, the malt may, for example be produced by any of the methods described by Hough et al. (1982). However, any other suitable method for producing malt may also be used with the present invention, such as methods for production of specialty malts, including, but not limited to, methods of roasting the malt.

[0238] Kiln dried malt and green malt may be further processed, for example by milling. In preferred embodiments, the green malt is not kiln dried in which case, the green malt preferably is finely divided (e.g. by milling or shreading) while the green malt has a water content of at least 20%.

[0239] Thus, the plant product according to the invention may be any kind of malt, such as unprocessed malt or milled malt, such as flour. Thus, the plant product may for example be milled, kiln dried malt or milled green malt. Milled malt and flour thereof comprise chemical components of the malt and dead cells that lack the capacity to regerminate.

[0240] The barley plants provided by the invention are characterized by carrying a mutation in the CXE2L1 gene and preferably encode a gain of function mutant CXE2L1 polypeptide. One major advantage of such barley plants is that the kernels have increased hydrolytic enzyme activity and increased p-glucan degradation, such as (1 ,3;1 ,4)-p-glucan degradation, during malting.

[0241] In some embodiments, the activity of one or more hydrolytic enzymes as described in the section “Characteristics of barley plant carrying a mutation in CXE2L1” is increased during and / or after malting.

[0242] In some embodiments, a-amylase activity during malting of kernels from a barley plant carrying a point mutation in the CXE2L1 gene is increased as compared to a-amylase activity during malting of kernels from a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0243] In one embodiment, malt prepared from kernels of said barley plant has a high a- amylase activity, such as for example an a-amylase activity of at least 200 ll / g, such as at least 210 ll / g, such as at least 220 ll / g, such as at least 230 ll / g, such as at least 240 ll / g, such as at least 250 ll / g.

[0244] In one embodiment, malt prepared from kernels of said barley plant has a high a- amylase activity, such as for example an a-amylase activity of between 200 ll / g and 280 ll / g, such as between 210 ll / g and 260 ll / g, such as between 220 ll / g and 240 U / g.

[0245] In some embodiments, p-amylase activity during malting of kernels from a barley plant carrying a point mutation in the CXE2L1 gene is increased as compared to p-amylase activity during malting of kernels from a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0246] In one embodiment, malt prepared from kernels of said barley plant has a high p- amylase activity, such as for example a p-amylase activity of at least 10 U / g, such as at least 11 U / g, such as at least 12 U / g, such as at least 13 U / g, such as at least 14 U / g, such as at least 15 U / g.

[0247] In one embodiment, malt prepared from kernels of said barley plant has a high p- amylase activity, such as for example a p-amylase activity of between 10 U / g and 15 U / g, such as between 10 U / g and 14 U / g, such as between 10 U / g and 13 U / g.

[0248] In some embodiments, limit dextrinase activity during malting of kernels from a barley plant carrying a point mutation in the CXE2L1 gene is increased as compared to limit dextrinase activity during malting of kernels from a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0249] In one embodiment, malt prepared from kernels of said barley plant has a high limit dextrinase activity, such as for example a limit dextrinase activity of at least 45 U / g, such as at least 50 ll / g, such as at least 55 ll / g, such as at least 60 ll / g, such as at least 65 ll / g.

[0250] In one embodiment, malt prepared from kernels of said barley plant has a high limit dextrinase activity, such as for example a limit dextrinase activity of between 45 ll / g and 65 ll / g, such as between 45 ll / g and 55 ll / g, such as between 50 ll / g and 60 ll / g.

[0251] In some embodiments, p-glucan degradation during malting of kernels from a barley plant carrying a point mutation in the CXE2L1 gene is increased as compared to the degradation of p-glucan during malting of kernels from a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0252] In some embodiments, wort prepared from kernels of said barley plant has a decreased content of p-glucan as compared to the content of p-glucan in wort prepared from kernels of a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0253] In some embodiments, the content of p-glucan in wort prepared from kernels of the barley plant of the invention is decreased by at least 10%, such as by at least 20%, such as by at least 30% such as by at least 40%, such as by at least 50%, such as by at least 60%, such as by at least 70%, such as by at least 80% such as by at least 90%, such as by 100% as compared to the content of p-glucan in wort prepared from kernels of a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0254] In some embodiments, the content of p-glucan in wort prepared from said barley plant or part thereof is decreased by between 10% and 100%, such as by between 10% and 50%, such as by between 50% and 75%, such as by between 25% and 100% as compared to the content of p-glucan in wort prepared from kernels of a barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype.

[0255] In one embodiment, p-glucan content of wort prepared from said barley plant or part thereof is at most 400 mg / L, such as at most 350 mg / L, such as at most 300 mg / L, such as at most 250 mg / L, such as at most 200 mg / L, such as at most 150 mg / L. In one embodiment, p-glucan content of wort prepared from said barley plant or part thereof is between 0 and 500 mg / L, such as between 0 and 250 mg / L, such as between 50 and 250 mg / L, such as between 100 and 200 mg / L, such as between 200 and 400 mg / L, such as between 50 and 200 mg / L.

[0256] Wort can for example be prepared as described herein in the section “Aqueous extract and method of production thereof”.

[0257] Aqueous extract and method of production thereof

[0258] The invention provides barley based beverages as well as methods of preparing the same, wherein the barley plant carries a mutation in the CXE2L1 gene, or progeny thereof. The invention also provides aqueous extracts of kernels of barley plants carrying a mutation in the CXE2L1 gene. Said aqueous extract may for example be prepared from green malt or kiln dried malt. The aqueous extract may in particular be wort.

[0259] Frequently, methods for preparing a beverage comprise a step of preparing an aqueous extract of kernels of the barley plants of the invention and / or of malts prepared from barley plants of the invention.

[0260] The aqueous extract may, in general, be prepared by incubating barley flour, flour of green malt and / or flour of kiln dried malt in water or in an aqueous solution. Said aqueous solution is also referred to as “mashing solution” herein. In particular, the aqueous extract may be prepared by mashing.

[0261] The present invention also provides a method of producing an aqueous extract, said method comprising the steps of: a. providing kernels of a barley plant according to the present invention; b. subjecting the barley kernels to a step of germination thereby obtaining germinated kernels; c. finely dividing said germinated kernels; d. optionally, drying said finely divided germinated kernels; e. preparing an aqueous extract of said (dried) finely divided germinated kernels, f. thereby producing an aqueous extract of the barley. In some embodiments, step c) is carried out while said germinated kernels have a water content of at least 20%, with the proviso that said barley kernels do not have a water content below 20% at any time between steps b) and c).

[0262] In some embodiments, step d) is not carried out.

[0263] The germination step is described in detail in the section “Malt and method of production thereof”. In some embodiments, the step of germination (a) is carried out for at the most 96 h, such as for at the most 72 h, such as for at the most 48 h.

[0264] In general said mashing solution may be water, such as tap water to which one or more additional agents may be added. The additional agents may be present in the aqueous solution from the onset or they may be added during the process of preparing an aqueous extract. Said additional agents may be enzymes. Thus, the mashing solution may comprise one or more enzymes. Said enzymes may be added to the aqueous solution from the onset, or subsequently, during the process.

[0265] Said enzymes may, for example, be one or more hydrolytic enzymes. Suitable enzymes include lipases, starch degrading enzymes (e.g. amylases), glucanases [preferably (1-4)- and / or (1 ,3;1 ,4)-p-glucanases], and / or xylanases (such as arabinoxylanases), and / or proteases, or enzyme mixtures comprising one or more of the aforementioned enzymes, e.g. Cereflo, Ultraflo, or Ondea Pro (Novozymes). For example, the aqueous solution may comprise one or more hydrolytic enzymes selected from the group consisting of a-amylase, p-amylase, limit dextrinase, pullulanase, P-glucanase (e.g. endo-(1 ,3;1 ,4)-p-glucanase or endo-1,4-p-glucanase), xylanase (e.g. endo- or exo-1,4-xylanase, an arabinofuranosidase or a ferulic acid esterase), glucoamylase and protease.

[0266] In one embodiment no or only limited amounts of a-amylase is added to said mashing solution.

[0267] In one embodiment no or only limited amounts of limit dextrinase and pullulanase is added to said mashing solution. Said additional agents, preferably of food grade quality, may also be a salt, for example CaCh, or an acid, for example H3PO4.

[0268] The aqueous extract is generally prepared by incubation of the barley flour, flour of green malt and / or flour of kiln dried malt in the mashing solution at one or more predetermined temperature(s). Said predetermined temperature may also be referred to as "mashing temperature" herein. Said mashing temperatures may for example be conventional temperatures used for mashing. The mashing temperature is in general either kept constant (isothermal mashing), or gradually increased, for example increased in a sequential manner. In either case, soluble substances in the barley grains and / or malt are liberated into said mashing solution thereby forming an aqueous extract.

[0269] The mashing temperature(s) are typically temperature(s) in the range of 30 to 90°C, such as in the range of 40 to 85°C, for example in the range of 50 to 85°C. Frequently, incubation with the mashing solution includes first step(s) at lower temperature(s), e.g. at temperatures in the range of 50 to 70°C, and a final step of heating to a higher temperature, e.g. to a temperature in the range of 75 to 80°C.

[0270] Subsequent to incubation in the aqueous solution in e.g. a mashing vessel, the aqueous solution may be transferred to another container, e.g. a lauter tun and incubated for additional time at elevated temperature.

[0271] Non-limiting examples of useful mashing protocols can be found in the literature of brewing, e.g. in Hough et al. (supra).

[0272] Mashing (i.e. incubation of the barley flour, flour of green malt and / or flour of kiln dried malt in mashing solution) can occur in the presence of adjuncts, which is understood to comprise any carbohydrate source other than malt or germinated barley grains, such as, but not limited to, barley, barley syrups, or maize, or rice - either as whole kernels or processed products like grits, syrups or starch. All of the aforementioned adjuncts may be used principally as an additional source of extract (syrups are typically dosed during wort heating). The requirements for processing of the adjunct in the brewery depend on the state and type of adjunct used. After incubation in the mashing solution, the aqueous extract may typically be separated, e.g. through filtration into the aqueous extract and residual non-dissolved solid particles, the latter also denoted "spent grain". Filtering may for example be performed in a lauter tun. Alternatively, the filtering may be filtering through a mash filter. The aqueous extract thus obtained may also be denoted "first wort". Additional liquid, such as water may be added to the spent grains during a process also denoted sparging. After sparging and filtration, a "second wort" may be obtained. Further worts may be prepared by repeating the procedure. Thus, the aqueous extract may be wort, e.g. a first wort, a second wort, a further wort or a combination thereof.

[0273] The method of preparing an aqueous extract may in one embodiment be performed using any of the apparatuses described in international patent application

[0274] PCT / EP2017 / 065498, for example any of the apparatuses described on p. 20-22 therein.

[0275] Additional compounds

[0276] The methods of the invention may comprise the step of adding one or more additional compounds. Said additional compounds may for example be a flavour compound, a preservative, a functional ingredient, a color, a sweetener, a pH regulating agent or a salt. The pH regulating agent may for example be a buffer or an acid, such as phosphoric acid.

[0277] Functional ingredients may be any ingredient added to obtain a given function. Preferably a functional ingredient renders the beverage healthier. Non-limiting examples of functional ingredients includes vitamins or minerals.

[0278] The preservative may be any food grade preservative, for example it may be benzoic acid, sorbic acid, sorbates (e.g. potassium sorbate), sulphites and / or salts thereof.

[0279] The additional compound may also be CO2. In particular, CO2 may be added to obtain a carbonated beverage.

[0280] The flavour compound to be used with the present invention may be any useful flavour compound. The flavour compound may for example be selected from the group consisting of aromas, plant extracts, plant concentrates, plant parts and herbal infusions. In particular the flavour compounds may be hops.

[0281] Beverage and method of production thereof

[0282] The present invention also provides barley based beverages and methods of producing such beverages, wherein the beverages are prepared from the barley plant according to the invention, i.e. a barley plant carrying a mutation in the CXE2L1 gene, and optionally one or more additional mutations as described in the section “Barley plants comprising more mutations”.

[0283] The beverage may be an alcoholic barley based beverages or non-alcoholic barley based beverages. Alcoholic barley based beverages may for example be beer or a distilled alcohol.

[0284] Said beer may be any kind of beer. It may be a light colored beer, for example selected from the group consisting of lager beer, pale ale and wheat beer. Thus, the beer may for example be selected from the group consisting of Altbier, Amber ale, Barley wine, Berliner Weisse, Biere de Garde, Bitter, Blonde Ale, Bock, Brown ale, California Common, Cream Ale, Dortmunder Export, Doppelbock, Dunkel, Dunkelweizen, Eisbock, Fruit lambic, Golden Ale, Gose, Gueuze, Hefeweizen, Helles, India pale ale, Kdlsch, Lambic, Light ale, Maibock, Malt liquor, Mild, Marzenbier, Old ale, Oud bruin, Pale ale, Pilsener, Porter, Red ale, Roggenbier, Saison, Scotch ale, Steam beer, Stout, Schwarzbier, Lager, Witbier, Weissbier, Weizenbier and Weizenbock.

[0285] Said distilled alcohol may be any kind of distilled alcohol. In particular the distilled alcohol may be based on a barley, e.g. a barley malt. Non-limiting examples of such distilled alcohol include whiskey and vodka.

[0286] The beverage may be a non-alcoholic beverage, such as a non-alcoholic barley based beverage, e.g. non-alcoholic beer or non-alcoholic malt beverages, such as maltina.

[0287] The beverage may for example be prepared by a method comprising the steps of: a. preparing an aqueous extract by the method described in the section “Aqueous extract and method of production thereof”; b. processing said extract into a beverage. In some embodiments, the beverage is prepared by a method comprising the steps of: a. providing kernels of a barley plant according to the invention, and / or malt prepared according to the method described in the section “Malt and method of production thereof”; b. preparing an aqueous extract of said kernels and / or said malt; c. processing said aqueous extract into a beverage.

[0288] The aqueous extract may be boiled with or without hops where after it may be referred to as boiled wort. First, second and further worts may be combined, and thereafter subjected to boiling. The aqueous extract may be boiled for any suitable amount of time, e.g. in the range of 60 min to 120 min.

[0289] The step of processing the aqueous extract into a beverage may comprise: a. heating said aqueous extract optionally in the presence of hops or hops extract; b. cooling the aqueous extract; c. fermenting said aqueous extract with yeast, thereby producing a fermented beverage.

[0290] The step of processing the aqueous extract into a beverage may in particular comprise fermentation of said aqueous extract, e.g. by fermentation of wort. Thus, the beverage may be prepared by fermentation of the aqueous extract with a microorganism, such as a yeast, such as for example Saccharomyces cerevisiae and / or Saccharomyces pastorianus.

[0291] Once the aqueous extract has been prepared it may be processed into beer by any method including conventional brewing methods. Non-limited descriptions of examples of suitable methods for brewing can be found, for example, in publications by Hough et al. (1982). Numerous, regularly updated methods for analyses of barley and beer products are available, for example, but not limited to, American Association of Cereal Chemists (1995), American Society of Brewing Chemists (1992), European Brewery Convention (1998), and Institute of Brewing (1997). It is recognized that many specific procedures are employed for a given brewery, with the most significant variations relating to local consumer preferences. Any such method of producing beer may be used with the present invention.

[0292] The first step of producing beer from the aqueous extract preferably involves boiling said aqueous extract as described herein above, followed by a subsequent phase of cooling and optionally whirlpool rest. One or more additional compounds may be added to the aqueous extract, e.g. one or more of the additional compounds described below in the section “Additional compounds”. After being cooled, the aqueous extract may be transferred to fermentation tanks containing yeast, e.g. brewing yeast, such as S. pastorianus or S. cerevisiae. The aqueous extract may be fermented for any suitable time period, in general in the range of 1 to 20 days, such as 1 to 10 days. The fermentation is performed at any useful temperature e.g. at a temperature in the range of 10 to 20°C. The methods may also comprise addition of one or more enzymes, e.g. one or more enzymes may be added to the wort prior to or during fermentation. In particular, said enzyme may be a proline-specific endoprotease. A non-limiting examples of a proline-specific endoprotease is “Brewer’s Clarex” available from DSM. In other embodiments, no exogenous enzymes are added during the methods.

[0293] During the several-day-long fermentation process, sugar is converted to alcohol and CO2 concomitantly with the development of some flavour substances. The fermentation may be terminated at any desirable time, e.g. once no further drop in %P is observed.

[0294] Subsequently, the beer may be further processed, for example chilled. It may also be filtered and / or lagered - a process that develops a pleasant aroma and a less yeastlike flavour. Additives may also be added. Furthermore, CO2 may be added. Finally, the beer may be pasteurized and / or filtered, before it is packaged (e.g. transferred to containers or kegs, bottled or canned). The beer may also be pasteurized by standard methods.

[0295] Method of preparing a barley plant comprising a mutation in CXE2L 1 Barley plants carrying a mutation in CXE2L1, e.g. any of the specific mutations described herein may be prepared in any useful manner.

[0296] For example, such barley plants can be prepared by a method comprising the steps of: a. subjecting a plurality of barley plants or barley kernels to random mutagenesis, e.g. by irradiation or chemical treatment, e.g. treatment with sodium azide; b. identifying barley plants or barley kernels carrying a mutation in CXE2L1. Such methods may also include one or more steps of reproducing said barley plants / barley kernels in order to obtain multiple barley plants / kernels each carrying random mutations.

[0297] In particular, barley plants carrying a particular mutation in the CXE2L1 gene may be prepared and identified using the FIND-IT method, which for example is described by Knudsen et al., 2022 and in patent application WO 2018 / 001884. The FIND-IT method allows identification of any specific single-nucleotide substitution caused by a mutagen from a library generated by random mutagenesis. Thus, even though the library is prepared by random mutagenesis, the identification of a given specific mutation is reproducible as long as a sufficiently large library is created.

[0298] Thus, in some embodiments barley plants carrying a particular mutation in the CXE2L1 gene are prepared essentially as described in international patent application WO 2018 / 001884 or as described in Knudsen et al., 2022 using primers and probes designed to identify a particular mutation in the gene. The primers are preferably designed so that they are capable of amplifying a fragment of the CXE2L1 comprising the site of the desirable mutation, and the probes are preferably designed to distinguish between wild-type and mutant at the site of the desirable mutation. Suitable primers and probes for identification of a CXE2L1 gene containing a C380T mutation in the CXE2L1 gene, said gene encoding mutant CXE2L1 comprising a A127V mutation are described in Example 16.

[0299] Any type of mutagenizing agent may be used. In some embodiments, the mutagenizing agent is a chemical mutagenizing agent, such as an alkylating agent, such as a nitroso compound. In some embodiments, the chemical mutagenizing agent is selected from the group consisting of methyl methanesulphonate (MMS), ethyl methanesulphonate (EMS), dimethyla sulfate, N,N-diethylnitrous amide (NDEA) and 5-bromo-2’- deoxyuridine (BLIdR), or is a combination thereof. In some embodiments, the chemical mutagenizing agent is selected from ethyl methanesulfonate (EMS), dimethyl sulfate and NaNs, or is a combination thereof. In some embodiments, the mutagenizing agent is radiation. In some embodiments, the radiation is selected from X-ray, gamma ray and ultraviolet radiation, or is a combination thereof.

[0300] Barley plants carrying a mutation in the CXE2L1 gene may also be prepared using various site directed mutagenesis methods, which for example can be designed based on the sequence of the CXE2L1 gene provided herein (SEQ ID NO: 2). In one embodiment, the barley plant is prepared using any one of CRISPR, a TALEN, a zinc finger, meganuclease, and a DNA-cutting antibiotic as described in WO 2017 / 138986.

[0301] In one embodiment, the barley plant is prepared using CRISPR / Cas9 technique, e.g. using RNA-guided Cas9 nuclease. This may be done as described in Lawrenson et al., Genome Biology (2015) 16:258; DOI 10.1186 / s13059-015-0826-7 except that the single guide RNA sequence is designed based on the gene sequences provided herein. In one embodiment, the barley plant is prepared using a combination of both TALEN and CRISPR / Cas9 techniques, e.g. using RNA-guided Cas9 nuclease. This may be done as described in Holme et al., Plant Mol Biol (2017) 95:111-121 ; DOI: 10.1007 / s11103-017-0640-6 except that the TALEN and single guide RNA sequence are designed based on the genes sequences provided herein.

[0302] In one embodiment, the barley plant is prepared using the CRISPR / Cas9-based technique base editing. This may be done as described in Komor et al. (2016), except that the guide RNA is designed based on the gene sequences provided herein.

[0303] In one embodiment, the barley plant is prepared using the CRISPR / Cas9-based technique prime editing. This may be done as described in in Anzalone et al. (2019), except that the prime editing guide RNA is designed based on the gene sequences provided herein.

[0304] In one embodiment, the cereal plant is prepared using homology directed repair, a combination of a DNA cutting nuclease and a donor DNA fragment. This may be done as described in Sun et al., Molecular Plant (2016) 9:628-631 ;

[0305] DOI: https: / / doi.Org / 10.1016 / j.molp.2016.01.001 except that the DNA cutting nuclease is designed based on the genes sequences provided herein and the donor DNA fragment is designed based on the coding sequence of the mutated cereal variant provided herein. The invention also provide barley plants carrying further mutations in addition to the mutation in the CXE2L1 gene. Such plants may be prepared by introducing further mutations into barley plants already carrying a mutation in the CXE2L1 gene or by generating a separate barley plant carrying the other mutation, followed by crossing the barley plants to obtain a barley plant carrying both mutations.

[0306] In any event, the second mutation can be prepared and identified using the same methods as described above for barley plants carrying a mutation in the CXE2L1 gene.

[0307] In some embodiments, the method further comprises selecting barley kernel or progeny thereof carrying a mutated p-glucan synthase gene. In some embodiments, the mutated p-glucan is CslF6, optionally wherein said mutated CslF6 gene encodes a loss of function mutant CslF6 polypeptide, wherein wild-type CslF6 is CslF6 of SEQ ID NO: 7, further optionally wherein the mutation in the gene encoding CslF6 is a deletion.

[0308] In particular, barley plants carrying a mutation in a gene encoding a p-glucan synthase may be prepared as described above, such as by using one or more of the mutagenizing agents as described above. Preferably, barley plants carrying a mutation in a gene encoding a p-glucan synthase are prepared and identified using the FIND-IT method. Suitable primers and probes for identification of barley plants comprising the mutations indicated in Table E below in the CslF6 gene are described in Example 1 and 2 of international patent application WO 2019 / 129736.

[0309] Table E. Alternatively, barley plants carrying a mutation in the CXE2L1 gene as well as a mutation in a gene encoding a p-glucan synthase may be generated by crossing a barley plant carrying a mutation in the CXE2L1 gene with the barley plant designated “Mutant 2” deposited with NCIMB Ltd. Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA Scotland on 12 November 2018 under the accession number NCIMB 43273. Said barley plant is described in international patent application WO 2019 / 129736.

[0310] Barley plants carrying a mutation in the CXE2L1 gene and in other genes may be generated in similar manners, i.e. either as described above or by crossing with barley plants comprising said mutations.

[0311] In one embodiment of the invention, the objective is to provide agronomical useful barley plants carrying a mutation in the CXE2L1 gene and optionally in a gene encoding a p-glucan synthase. In addition to the mutation in the CXE2L1 gene and optionally the mutation in a gene encoding a p-glucan synthase, there are additional factors which also may be considered in the art of generating a commercial barley variety useful for malting and / or brewing and / or as base for beverages, for example kernel yield and size, and other parameters that relate to malting performance or brewing performance. Since many - if not all - relevant traits have been shown to be under genetic control, the present invention also provides modern, homozygous, high- yielding malting cultivars, which may be prepared from crosses with the barley plants that are disclosed in the present publication. The skilled barley breeder will be able to select and develop barley plants, which - following crossings with other barley plants - will result in superior cultivars. Alternatively, the breeder may utilize plants of the present invention for further mutagenesis to generate new cultivars carrying additional mutations in addition to the mutation of the CXE2L1 gene.

[0312] The invention also comprise barley plants carrying a mutation in the CXE2L1 gene and optionally in a gene encoding a p-glucan synthase prepared from plant breeding method, including methods of selfing, backcrossing, crossing to populations, and the like. Backcrossing methods can be used with the present invention to introduce into another cultivar the mutation of the CXE2L1 gene. A way to accelerate the process of plant breeding comprises the initial multiplication of generated mutants by application of tissue culture and regeneration techniques. Thus, another aspect of the present invention is to provide cells, which upon growth and differentiation produce barley plants carrying the mutation of the CXE2L1 gene and optionally in a gene encoding a p-glucan synthase. For example, breeding may involve traditional crossings, preparing fertile anther-derived plants or using microspore culture.

[0313] In one embodiment the barley plant of the invention has not exclusively been obtained by means of an essentially biological process. Progeny of a barley plant obtained by a technical process is herein considered as not being exclusively obtained by means of an essentially biological process, because the parent plant is obtained by a technical process.

[0314] In one embodiment the barley plant carries a mutation in the CXE2L1 gene, wherein said mutation has been induced by chemical and / or physical agents. In one embodiment, the barley plant furthermore carries a mutation in a gene encoding a p- glucan synthase, wherein said mutation has been induced by chemical and / or physical agents.

[0315] In one embodiment the barley plant has been prepared by a method involving a step of induced mutagenesis or said plant is progeny of a plant prepared by a method involving a step of induced mutagenesis. Thus, the barley plant may be a barley plant prepared by a method comprising the following steps or progeny of a plant prepared by a method comprising the following steps: a. providing barley kernels; and b. randomly mutagenizing said barley kernels; and c. selecting barley kernels or progeny thereof carrying a mutated CXE2L1 gene; wherein said mutated CXE2L1 gene encodes a gain of function mutant CXE2L1 polypeptide, wherein wild-type CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto.

[0316] In one embodiment, the barley plant may be a barley plant prepared by a method comprising the following steps or progeny of a plant prepared by a method comprising the following steps: a. providing barley kernels; and b. randomly mutagenizing said barley kernels, thereby introducing a mutation in the CXE2L1 gene; and c. selecting barley kernels or progeny thereof carrying a mutated CXE2L1 gene; wherein said mutated CXE2L1 gene encodes a gain of function mutant CXE2L1 polypeptide, wherein said mutant CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto, except that mutant CXE2L1 comprises a substitution at: i. amino acid 127, wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or ii. amino acid 113, wherein said substitution is a substitution of a serine (S) to a proline (P) with the proviso that the plant does not contain SEQ ID NO: 5.

[0317] In one embodiment, the barley plant may be a barley plant prepared by a method comprising the following steps or progeny of a plant prepared by a method comprising the following steps: a. providing barley kernels; and b. randomly mutagenizing said barley kernels, thereby introducing a mutation in the CXE2L1 gene; and c. selecting barley kernels or progeny thereof carrying a mutated CXE2L1 gene; wherein said mutated CXE2L1 gene encodes a gain of function mutant CXE2L1 polypeptide, wherein said mutant CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto, except that mutant CXE2L1 comprises a substitution at: i. amino acid 127, wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or ii. amino acid 113, wherein said substitution is a substitution of a serine (S) to a proline (P) with the proviso that the plant does not contain SEQ ID NO: 5; and / or iii. amino acid 125 of SEQ ID NO: 1 , wherein said substitution is a substitution of proline (P) into serine (S); and / or iv. amino acid 126 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or v. amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or vi. amino acid 212 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or vii. amino acid 212 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into valine (V).

[0318] The mutation and / or substitution in CXE2L1 may be any mutation as defined herein.

[0319] Examples

[0320] Example 1 - Isolation of HENZ-a mutants from a CRL Quench mutant population We here describe a high-throughput screen of single barley grain derived from a Quench mutant population. The trait screened for was high hydrolase activity, exemplified by a-amylase activity, in germinated barley grain. Objective of this forward genetic screen was to identify barley variants beneficial for short malting times.

[0321] Results

[0322] First, a cultivar (cv.) Quench mutant population was designed. Cv. Quench was NaNs- mutagenized as described elsewhere (Knudsen et al., 2022) and field-propagated in Fyn (Denmark) for consecutive years. The respective M3 cv. Quench mutant population was grown in Fyn in 2014, and single spikes, bearing M4 mutant seeds, were harvested by hand.

[0323] Next, two grains from the centre of an individual spike were harvested, each bisected into an “endosperm half-grain” (without embryo) and an “embryo-halfgrain” (with embryo) and stored in two individual 96-well plates at corresponding positions.

[0324] Next, endosperm half-grains were transferred into 2 ml 96-deep-well plates, imbibed in water. After 24 hours, water was removed and the halfgrain was further incubated for 72 hours. Subsequently the halfgrains were crushed and tested for their ability to express and synthesize hydrolytic enzymes, here exemplified by a-amylase enzyme activity, using a Megazyme a-amylase enzyme assay (Ceralpha Method according to manufacturer’s protocol (https: / / www.megazyme.com / alpha-amylase-assay-kit). Altogether, 8.280 mutant grains, derived from 4.140 individual spikes were tested. Of all tested endosperm half-grains, 19 individual endosperm half-grains showed significant a-amylase activity (figure 1: see representative sample E11 compared to positive references H9-11). It should be pointed out that in several cases, two individual endosperm half-grains derived from the same spike had the same high a-amylase activity (as described below for HENZ-a1 and HENZ-a2).

[0325] Next, the corresponding “embryo-halfgrains” of the 19 identified high a-amylase ’’endosperm half-grains” were germinated, plants were grown to maturity and several spikes per individual plant were harvested. To verify enhanced hydrolytic power in these mutants, eight endosperm half-grains of each propagated plant were re-tested for a-amylase activity (identical experimental set-up as described above). Four mutants, originally derived from two individual mutant spikes (plate 138 samples E11_grain1 and E11_grain2; plate 139 samples H5_grain1 and H5_grain2), showed strong a-amylase activity (figure 2, 8 individual endosperm half-grain; figure 3, average of eight endosperm half-grains). Grains derived from spike “plate 138 samples E11_grain1 and E11_grain2” were renamed HENZ-a1_1 and HENZ-a1_2, respectively, and grains derived from spike “plate 139 samples H5_grain1 and H5_grain2” were renamed HENZ-a2_1 and HENZ-a2_2. The corresponding embryohalfgrains of the tested HENZ-a1_1 and HENZ-a1_2, and of HENZ-a_1 and HENZ- a2_2, were germinated in a petri-dish and grown to maturity and harvested seeds were kept in the Carlsberg Research Laboratory barley seed bank. Early harvested grain of HENZ-a1_1 and HENZ-a2_1 (greenish grain derived from the first greenhouse propagation) were sent to Norre Aaby, Fyn, Denmark in 2016, for propagation in rows. The offspring of these propagated HENZ-a1_1 and HENZ-a2_1 plants was simply called “HENZ-a1” and “HENZ-a2”, respectively. “HENZ-a1” and “HENZ-a2” were further propagated in Fyn (DK) and Christchurch (NZ) for downstream characterization.

[0326] Material and methods

[0327] Cultivar Quench was mutagenized using NaN3 as described in Kudsen et al., 2022. M1 , M2, and M3 plants were grown in Fyn Denmark 2013, New Zealand 2013 / 2014, Fyn Denmark 2014, respectively. M4 seeds from M3 plants (Fyn Denmark 2014) were hand harvested and not threshed to keep spikes intact. 2 grains from individual spikes were picked for the experiment as described in Results. The experimental protocol was as follows:

[0328] • Transfer half-grains from original Nunc-plate o To new Nunc-plate (reverse orientation) o Then to 2 ml-deep well plate (forward orientation)

[0329] • Use new, mechanically stable deep-well (2 ml) 96-well plates

[0330] • Place endosperm half-grains in 96-well plates

[0331] • Add 500 pl H2O o Store endosperm half-grains in H2O for 24 h in a dark box, humid environment (permeable lid on 96-well plate, wet cloth in box, boxed closed) at 15°C in cold room o Remove H2O after 24 h, germinate for 72 h in a dark box, humid environment (permeable lid on 96-well plate, wet cloth in box, boxed closed) at 15°C in cold room

[0332] Add steel balls (5 mm diameter)

[0333] Add 400 pl 1x extraction buffer per half-grain > pre-heat buffer to 40°C

[0334] Close 96-well plate using silicon lid

[0335] Grind samples: GenoGinder, 6 min at 1500 rpm

[0336] Spin plates for 2 min at 2000 rpm

[0337] Add 600 pl 1x extraction buffer per half-grain > pre-heat buffer to 40°C

[0338] Vortex 30 s at 1250rpm (mixmate) and shake samples manually incubate for 5 min at 40°C

[0339] Vortex 30 s at 1250 rpm (mixmate) and shake samples manually incubate for 5 min at 40°C

[0340] Spin plates 3 min at 3000 rpm

[0341] Take 50 pl extract and dilute 1:10 with 1x extraction buffer (450 pl)

[0342] Vortex 30 s at 1250 rpm (mixmate)

[0343] Mix 20 pl diluted extract with 20 pl Ceralpha mix in Nunc microtiter plates at RT

[0344] Vortex 30 s at 1250 rpm (mixmate)

[0345] Incubation times at RT for 30 min

[0346] Add 200 pl of 1% TRISMA stop solution

[0347] Measure absorbance at 405 nm (microtiter plate reader) Example 2 - Characterization of HENZ-a mutants under different germination conditions

[0348] We here describe the characterization of HENZ-a mutants, specifically a-amylase activity and sugar composition, under different germination setups. The objective was to show that HENZ-a variants modify barley grain germination through increased hydrolase activity, here exemplified by increased a-amylase activity and modified sugar composition in endosperm half-grain.

[0349] Results

[0350] After 72 h germination in petri dish, both HENZ-a1 and HENZ-a2 whole grains showed 10-20% higher a-amylase activity compared to wild-type Quench (figure 4). When submerged in water, HENZ-a1 and HENZ-a2 exhibit 180% higher a-amylase activity than wild-type Quench (figure 4).

[0351] In endosperm half-grain germination, significant a-amylase activity was observed in HENZ-a1 and HENZ-a2, both in petri dish and submerged in water (figure 5). No a- amylase activity was found in wild-type Quench. Interestingly, the a-amylase activity of HENZ-a1 and HENZ-a2 was highest when the grain was submerged in water (compared to petri dish) (figure 5).

[0352] Released sugar composition was analyzed in germinated endosperm half-grain (water- submerged sample). As shown in table 1 , HENZ-a1 and HENZ-a2 endosperm halfgrain germination resulted in a modified sugar composition, indicating altered hydrolase activity in HENZ-a variants.

[0353] Table 1. Released sugar composition in germinated endosperm half-grain (water- submerged samples) (ppm).

[0354] Material and methods

[0355] Grains of HENZ- a1 , HENZ- a2 and their respective wild-type Quench were propagated and harvested in New Zealand 2017 / 2018.

[0356] Germination was conducted in petri dishes or submerged in water in glass flasks using either whole grains or endosperm half-grains. Endosperm half-grains were manually dissected as described elsewhere (mutant identification experiment).

[0357] Petri dish germination

[0358] Two sheets of Whatman filter paper #1 were placed in a petri dish. 100 grains per sample were germinated adding 4 ml water. Petri dishes were stored in a dark box at 20°C for 72 h.

[0359] Flask germination

[0360] 100 grains per sample were submerged in 100 ml ddwater in a 250 ml Erlenmeyer flask with air flow at 20°C for 72 h. The flasks were agitated at 250 rpm during the incubation. Two replicates were made per sample.

[0361] After 72 h incubation, the grains from Petri dish germination or flask germination were harvested in a 50 ml tube and freeze-dried for 24 h. The dried grains were milled using the Retsch grinder (30 Hz, 30 sec x 2). a-Amylase activity assay was measured using the Ceralpha method (Ceralpha Method according to manufacturer’s protocol, Megazyme) modified for with Gallery Plus Beermaster. a-Amylase activity was calculated as units per gram of initial dry weight (II g DW1).

[0362] For the sugar analysis, endosperm half-grains were incubated and germinated in flask as described elsewhere (submerged condition). 0.9 ml of the liquid in the flasks were taken and weighed. 10 % of the sample weight of 1 M KOH was added and the samples were centrifuged. The supernatant was diluted 20 times and filtered by 0.2 pm filter.

[0363] The analysis was performed by ICS-3000 Ion Chromatography System. The separation was carried out in Dionex™ CarboPac™ PA100 guard (4 mm x 50 mm, 8.5 pm) and analytical columns (4 mm x 250 mm, 8.5 pm). The injection volume was 10 pl. The analytes were detected by Pulsed Electrochemical Detector with permanent gold ED electrode for Pulsed Amperometric Detection.

[0364] Example 3 - a-Amylase activity in endosperm half-grain of HENZ- a1 and HENZ- a2 We here describe the phenotype assessment of a-amylase activity in endosperm halfgrain after germination. a-Amylase activity is dependent on GA-induced de novo expression of a-amylase enzymes, initiated by the hormone GA derived from the embryo and scutellum tissues (Betts et al., 2019). Thus, without embryo, as in endosperm half-grain where the embryo was removed, no a-amylase activity is detectable in wild-type grain. However, even without embryo, HENZ- a1 and HENZ- a2 endosperm half-grains exhibit a-amylase activity. This trait is stable across years and locations.

[0365] Results

[0366] Eight non-dormant grains of each accessions were dissected into half, i.e. endospermhalf and embryo-half. Embryo half-grains were placed in a 96-well Nunc-plate, while the corresponding endosperm half-grains were placed in a 96-deep well plate with the same order. Both endosperm half-grains and embryo half-grains were incubated in water for 24 h (dark, at 15°C). Subsequently water was removed, and incubation continued for another 72 h. a-Amylase activity was measured in endosperm half-grains using a Megazyme a-amylase activity assay. Absorbance was measured at OD 405nm.

[0367] As shown figure 6 and table 2, HENZ-a1 and HENZ-a2 endosperm half-grains from both Fyn, Denmark 2017 and New Zealand 2016 / 2017 had high a-amylase activity, similar to the positive control (Quench endosperm half-grain with 100 nM GA). Wildtypes Quench, Planet and Paustian showed no a-amylase activity. The trait was stable over years and environments; however the strength of the trait showed some variation and was stronger in the grain grown in New Zealand 17.

[0368] Table 2.

[0369] Material and methods

[0370] HENZ-a1, HENZ-a2, wild-type Quench and other wild-type accessions (Planet and Paustian) were grown in New Zealand 2016 / 2017 and Fyn, Denmark 2017.

[0371] Germination and a-amylase activity assay (Ceralpha kit from Megazyme according to manufacturer's protocol (K-CERA 01 / 12)) were done as described earlier (mutant isolation assays) with Quench endosperm half-grain incubated in 100 nM GA as positive control.

[0372] The experimental protocol was as follows:

[0373] Each healthy grain was dissected into half. Embryo half-grain was placed into a Nunc- plate. The responding endosperm half-grain was placed in the corresponding well in 2 ml-deep well plate. Both embryo half-grains and endosperm half-grains were germinated in the same way, one for seed variability check and the latter for a-amylase assay. Details are described as following.

[0374] • The embryo half-grain was stored in a standard Nunc 96-well plate, stored cold, dark and dry, and kept for potential germination and growth later. • The respective endosperm half-grain was put into a 2 ml deep-well plate and then treated as follows:

[0375] • Add 500 pl H2O the deep well plate for a-amylase assay o Store endosperm half-grains in H2O for 24 h in a dark box, humid environment (permeable lid and wet cloth) at 15°C in cold room (malt lab) o Remove H2O after 24 h, germinate for 72 h in a dark box, humid environment (permeable lid and wet cloth) at 15°C in cold room (malt lab)

[0376] • Add steel balls (5 mm diameter)

[0377] • Add 400 pl 1x extraction buffer (pre-heated to 40°C) per half-grain

[0378] • Close 96-well plate using silicon lid

[0379] • Grind samples: GenoGinder, 6 min at 1500 rpm

[0380] • Spin plates for 2 min at 2000 rpm

[0381] • Add 600 pl 1x extraction buffer (pre-heated to 40°C) per half-grain

[0382] • Vortex 30 s at 1250 rpm (mixmate) and shake samples manually

[0383] • incubate for 5 min at 40°C

[0384] • Vortex 30 s at 1250 rpm (mixmate) and shake samples manually

[0385] • incubate for 5 min at 40°C

[0386] • Spin plates 3 min at 3000 rpm

[0387] • Take 50pl extract and dilute 1 :10 with 1x extraction buffer (450 pl)

[0388] • Vortex 30 s at 1250 rpm (mixmate)

[0389] • Add 20 pl Ceralpha in Nunc microtiter plates, then 20 pl diluted extract at RT

[0390] • Vortex 30 s at 1250 rpm (mixmate)

[0391] • Incubation times at RT for 30 min

[0392] • Add 200 pl of 1 % TRISMA stop solution

[0393] • Measure absorbance at 405 nm (microtiter plate reader)

[0394] Example 4 - a-Amylase activity of germinated grains

[0395] Materials and methods

[0396] Field-grown grain material of wild-type Quench, HENZ-a1 and HENZ-a2 was germinated in a tank with water essentially as described in Example 1 of international patent application PCT / EP2017 / 065498 with the following specifics: 200 g barley grains (dry weight) were incubated for 48 h in a tank and covered with water containing 1 mM GA, while subjected to an air flow of 90 L / h per kg dry weight of barley grains, a- Amylase activity of in the same material after 24 h and after 48 h was measured using standard Megazyme assays as described below.

[0397] Sample preparation

[0398] Prior to enzyme activity analysis the germinated grain samples were milled using a standard Foss Cyclotech mill (Foss, Denmark), equipped with a tungsten carbide grinding ring (Foss 10004463), nickel plated impeller (Foss 1000 2666) and a 1 mm outlet screen (Foss 10001989). All measurements of enzyme activity in germinated barley grains were made within 48 h after milling of the sample. a-Amylase activity a-Amylase activity of germinated grains was based on flour prepared as described above in the section "Sample preparation". Assays for determination of a-amylase activity utilized a Ceralpha kit from Megazyme using standard laboratory equipment. The assays were made according to manufacturer's protocol (K-CERA 01 / 12), including calculation of a-amylase activity.

[0399] Results

[0400] The a-amylase activity of the germinated grains can be seen in figure 7 and table 3.

[0401] Table 3.

[0402] Example 5 - Transcript levels of hydrolytic enzymes after germination

[0403] Material and methods

[0404] 200 g field-grown grain material from New Zealand 2016 / 2017 of wild type Quench, HENZ-a1 and HENZ-a2 was germinated in a tank with 500 ml water and 1 mM GA for

[0405] 48 h with a continuous flow of air (90 l / h). Subsets of germinated grains were snap frozen in liquid N2, freeze-dried for 48 h, and milled (30 / s for 30 sec) using a Retsch MM300 ball mill equipped with one 20 mm stainless steel ball per chamber (Retsch, Germany).

[0406] Transcript quantification

[0407] Transcript analysis of germinated grains was based on flour prepared as described above in the section "Material and methods". The preparation of samples for RNA extraction was conducted according to the following procedure. For each sample, approximately 100 mg of flour was weighed out in 2 mL Eppendorf tubes with two 3 mm metal balls and 1 mL of Tri-Reagent was added (Sigma #93289). The resulting mixture was vigorously shaken. Following homogenization, the sample was centrifuged at 12,000 x g for 10 minutes at 4°C to precipitate polysaccharides and high molecular weight DNA. The supernatant (-700 pl) was then pipetted into a new 2 mL PhaseLock tube (Qiagen #129056), and 0.2 mL of chloroform was added. The tube was vigorously shaken by hand for 10-15 seconds to mix chloroform and Tri-Reagent. The sample was then incubated at room temperature for 5-15 minutes and centrifuged at 12,000 x g for 5 minutes at 4°C. The mixture separates into a lower red phenol-chloroform phase, a solid gel interphase, and a colorless upper aqueous phase, with RNA remaining exclusively in the aqueous phase. The aqueous phase of the sample (-400 pl) was decanted into a new Eppendorf tube and 500 pl of 2-propanol was added. The sample was incubated in a freezer for 1 hour. Next, samples were centrifuged at 12,000 x g for 10 minutes at 4°C, and the supernatant was removed. The RNA pellet was resuspended in 100 pl RNase-free water, and RNA cleanup was continued according to the manufacturer's instructions (Qiagen#74181). RNA was then quantified on the NanoDrop (ThermoFisher Scientific).

[0408] To synthesize complementary DNA (cDNA), the RNA sample was first normalized to a 50 ng / pl concentration. A 200 ng (4 pl) aliquot of the RNA sample was then used for cDNA synthesis with the iScript Select cDNA Synthesis Kit, following the manufacturer's instructions (Bio-Rad #1708896). The resulting cDNA was further diluted, specifically, 180 pl water was added to the 20 pl cDNA reaction volume, resulting in a 10-fold dilution. This was followed by an additional round of 10-fold dilution, resulting in a 100-fold dilution solution that was appropriate for droplet digital PCR (ddPCR). We utilized ddPCR for the quantification of AMY1-2, LD, and BGL2A transcripts. For analytical purposes, 5 pL of cDNA was added to a 17-pL PCR mixture containing 11 pL of 2x ddPCR Supermix for probes (No. dUTP; Bio-Rad), 900 nM of target-specific PCR primers, 250 nM of target-specific probe (6-carboxy-fluorescein — FAM), 900 nM of reference-specific PCR primers, and 250 nM of reference-specific probes (hexachlorofluorescein — HEX). Droplet generation was carried out by loading the reaction mixture onto the AutoDG Droplet Generator (Bio-Rad), as per the manufacturer's instructions. The droplet emulsion was thermally cycled using standard PCR conditions, which included denaturing at 95°C for 10 min, 40 cycles of PCR at 94°C for 30 sec and 55°C for 1 min, and a final extension at 98°C for 10 min before storage of the microtiter plate at 8°C. The PCR amplification was analyzed using the QX200 Droplet Reader (Bio-Rad), and the threshold was determined by comparing the samples and no-template ddPCR controls. The data were analyzed using the QuantaSoft software (version v1.7, Bio-Rad). Data was normalized to the internal Actin transcript levels of each sample, and the resulting data is presented as a bar chart, depicting the absolute number of transcripts detected per pl of cDNA.

[0409] AMY1-2 forward primer (SEQ ID NO: 15): 5'- TGAAGGAGGAGATCGATC-3'; AMY1-2 reverse primer (SEQ -ID NO: 16): 5'- TTGCCGTCGATCTCG-3';

[0410] AMY1-2 -specific detection probe (SEQ ID NO: 17): 5'- AAGCTGCAGATCATGGAGGC-3'-labelled with 6-carboxyfluorescein (FAM) LD forward primer (SEQ ID NO: 18): 5'- CTTCGATGGGGTTTGAAC-3'; LD reverse primer (SEQ -ID NO: 19): 5'- CAGATTTCCTCACCAAAG -3';

[0411] LD -specific detection probe (SEQ ID NO: 20): 5'- CCTGTGCAGGTGAATTCATCA-3'- labelled with 6-carboxyfluorescein (FAM)

[0412] BGL2A forward primer (SEQ ID NO: 21): 5'- AACTGGGGACTCTTCTAC-3'; BGL2A reverse primer (SEQ -ID NO: 22): 5'- TCAGAAGTTGATGGGGTAG-3'; BGL2A-specific detection probe (SEQ ID NO: 23): 5'- CCCAACATGCAGCACGT-3'- labelled with 6-carboxyfluorescein (FAM)

[0413] Reference Actin forward primer (SEQ ID NO: 24): 5'- TACAACTCCATCATGAAGTG- 3';

[0414] Reference Actin reverse primer (SEQ -ID NO: 25): 5'- GATACCTGGGAACATAGTTG- 3';

[0415] Reference Actin-specific detection probe (SEQ ID NO: 26): 5'- AAACATCGTGCTCAGTGGTG -3'-labelled with hexachlorofluorescein (HEX). Results

[0416] Germinating HENZ-a1 and HENZ-a2 were tested for transcript accumulation of the genes encoding a-amylase (AMY1-2; HORVU.MOREX.r3.6HG0619750.1, Morex_V3), limit dextrinase (LD; HORVU.MOREX.r3.7HG0656620.1 , Morex_V3) and p-amylase (BGL2A; HORVU.MOREX.r3.7HG0750120.1, Morex_V3) in samples from 48 h steeping. Samples were compared to their parental control, cv. Quench. Figures 8A-C show a clear increase of accumulated transcript of all three genes after 48 h of continuous steeping in HENZ-a1 and HENZ-a2 as compared to their control.

[0417] Example 6 - a-Amylase activity of germinated grains Material and methods

[0418] Field-grown grain material of wild type Quench, HENZ-a1 and HENZ-a2 was germinated in a tank with water essentially as described in Example 1 of international patent application PCT / EP2017 / 065498 with the following specifics: 200 g barley grains (dry weight) were incubated for 24 h (WA) in a tank and covered with water while subjected to an air flow of 90 L / h per kg dry weight of barley grains), followed by 24 h incubation at 25°C in air with aeration (90 l / h / kg)(A).

[0419] Sample preparation

[0420] Prior to enzyme activity analysis the germinated grain samples were milled using a standard Foss Cyclotech mill (Foss, Denmark), equipped with a tungsten carbide grinding ring (Foss 10004463), nickel plated impeller (Foss 1000 2666) and a 1 mm outlet screen (Foss 10001989). All measurements of enzyme activity in germinated barley grains were made within 48 h after milling of the sample. a-amylase activity a-amylase activity of germinated grains was based on flour prepared as described above in the section "Sample preparation". Assays for determination of a-amylase activity utilized a Ceralpha kit from Megazyme using standard laboratory equipment. The assays were made according to manufacturer's protocol (K-CERA 01 / 12), including calculation of a-amylase activity.

[0421] Results

[0422] The a-amylase activity of the germinated grains can be seen in figure 9 and table 4. Table 4.

[0423] Example 7 - Grain quality and germination index

[0424] Material and methods

[0425] Protein, water and starch contents of barley samples were determined using a Foss 1241 NIT instrument, using barley calibration (FOSS; provided by Foss, DK).

[0426] Germination test

[0427] All barley samples used in the examples were evaluated for the parameters germination index, germination energy and water sensitivity. Data was based on a sample size of 100 barley grains for a 4-mL germination test and a sample size of 100 barley grains for an 8-mL germination test according to Analytica-EBC Method 3.6.2 Germinative Energy of Barley (BRF Method).

[0428] Grain material from HENZ-a1, HENZ-a2 and reference cultivar Quench (wt) grown in the field under similar conditions were germinated in a standard germination test: Grains were sorted according to size using Pfeuffer grain sorter > grains with sizes 2.5 and 2.8 mm were used.

[0429] - 100 full grains were placed on 2 pieces Whatman (Grade 1, 85 mm, Cat-No. 1001- 085) in 90 mm petri dishes and 4 ml of aqua dest was added

[0430] - Another 100 full grains were placed on 2 pieces Whatman (Grade 1,85 mm, Cat-No. 1001-085) in 90 mm petri dishes and 8 ml of aqua dest was added (high water conditions)

[0431] - Petri dishes were closed and stored in a dark box covered with a wet cloth at 20°C - 4 ml petri dishes were checked after 24 h, 48 h and 72 h, germinating grains (radicula emergence) were removed from petri dish and number of germinated grain noted

[0432] - 8 ml petri dishes were checked after 72 h, germinating grains (radicula emergence) were removed from petri dish and number of germinated grains noted.

[0433] Results

[0434] The water, protein and starch content (%) can be seen in table 5.

[0435] Table 5.

[0436] The results of the germination test can be seen table 6 and in figures 10 and 11. In particular, note that HENZ-a1 and HENZ-a2 have high grain quality with no indication of pre-harvest sprouting. Further, HENZ-a1 and HENZ-a2 have lower water sensitivity as compared to control, displaying better germination in excess water.

[0437] Table 6. Example 8 - Agronomic traits

[0438] Material and methods

[0439] Plant material and growth conditions

[0440] Barley plants were grown in field trial plots for agronomic evaluation (7.5 m2 plots) in Fyn, Denmark, in 2017 and 2019. Grain from field plots was harvested and threshed using a Wintersteiger Elite plot combiner (Wintersteiger AG, Germany), and grains were sorted by size (threshold 2.5 mm) using a Pfeuffer SLN3 sample cleaner (Pfeuffer GmbH, Germany).

[0441] Yield performance evaluation and grain properties measurements

[0442] Thousand grain weight (TGW), water, starch and protein content of mature dry grains (sample size approximately 500 grains per measurement) from field grown plants were determined using the digital seed analyzer MARVIN (GTA Sensorik GmbH, Neubrandenburg, Germany) as described by Knudsen et al., 2022.

[0443] Plant height and heading date

[0444] Plant height of two individuals per plot repetition per line were measured manually, from the start of the lowest internode to the end of the spike. Heading date, as defined by Alqudah and Schurbusch, 2017 (https: / / www.frontiersin.org / articles / 10.3389 / fpls.2017.00896 / full), was recorded manually in June 2017 and 2019.

[0445] Results

[0446] Agronomic traits of HENZ-a1 and HENZ- a2 are not significantly changed and similar to wild-type (wt) Quench. Grain parameters water / starch / protein content, TGW and total yield are wt. Plant height and heading date are wt. Barley variants with modification in GA metabolism were shown by others (Stockinger, 2021 ; Kandemir et al., 2021) to have changes in TGW, yield, heading date and plant height.

[0447] Agronomic traits of HENZ-a1 as compared to Quench can be seen in table 7. Harvest from Fyn in 2017.

[0448] Table 7.

[0449] Agronomic traits of HENZ-a2 as compared to Quench can be seen in table 8. Harvest from Fyn in 2017.

[0450] Table 8.

[0451] Agronomic traits of HENZ-a1 as compared to Quench can be seen in table 9. Harvest from Fyn in 2019.

[0452] Table 9.

[0453] Agronomic traits of HENZ-a2 as compared to Quench can be seen in table 10. Harvest from Fyn in 2019.

[0454] Table 10. Example 9 - Micromalting set-up and procedure

[0455] Material and methods

[0456] The micromalting workflow can be seen in figure 12. Micromalting procedure was performed in controlled environment with a temperature of 16°C and humidity at around 70%.

[0457] Steeping

[0458] The barley samples were placed in individual containers, each holding 100 g of seeds, and submitted into 16°C fresh water to reach 35% moisture content on day 1 , and 41% moisture content on day 2.

[0459] The actual water uptake of individual samples was determined as the weight difference between initial water content, measured with Foss 1241 NIT instrument (Foss A / S, Denmark), and the sample weight after surface water removal.

[0460] Germination

[0461] Following the last steep, the barley samples were maintained at a degree of steeping of 41%. After each 24 hours, samples were checked for moisture content, and sprayed with additional water to overcome possible respiration loss.

[0462] Kiln

[0463] After the germination process the barley samples were kiln dried in Curio kiln using a two-step ramping profile. First ramping step started at a set point of 27°C and a linear ramping at 2°C / h to the breakpoint at 55°C using 100% fresh air. Second linear ramping was at 4°C I h reaching a maximum at 85°C. This temperature was kept constant for 90 minutes using 50% fresh air.

[0464] Deculming

[0465] The kiln samples were cured using a manual root removal system from Wissenschaftliche Station fur Brauerei, Munich, Germany.

[0466] Example 10 - Hydrolytic enzyme activity and / 3-glucan content during micromalting Materials and methods

[0467] The experiment was carried out as described in Example 9. Two independent micromalting experiments were carried out per genotype. Sample preparation

[0468] Enzyme activity

[0469] Prior to enzyme activity and p-glucan content analysis the germinated grain samples were milled using a standard Foss Cyclotech mill (Foss, Denmark), equipped with a tungsten carbide grinding ring (Foss 10004463), nickel plated impeller (Foss 1000 2666) and a 1 mm outlet screen (Foss 10001989). All measurements of enzyme activity in germinated barley grains were made within 48 h after milling of the sample.

[0470] P-glucan content

[0471] Two methods were used for measurement of p-glucan content. The data in table 11A was produced using the standard EBC method for detecting HMW p-glucan in wort (Analytica EBC - 8.13.3 - p-Glucan in wort by Automated Discrete Analysis - 2021). The data shown in table 11B was produced by extracting soluble HMW p-glucan from malt flour during malting as described in the section “Sample preparation”.

[0472] Malt flour was extracted in distilled water at 65°C for 2 h in a grist:water ratio of 1 :4. After extraction, samples were centrifuged at 10,000g for 10 minutes and the supernatant was analysed for soluble HMW p-glucan, by ThermoFisher Scientific Beta- Glucan (High MW) kit method in a GalleryPlus Beer Master (ThermoFisher Scientific).

[0473] Results

[0474] HENZa-1 and HENZa-2

[0475] Hydrolytic enzyme activity and / 3-glucan content

[0476] Hydrolytic enzyme activity after malting was tested in HENZa-1 and HENZa-2 as described in “Materials and methods”. p-Glucan content after was measured using the standard EBC method for detecting HMW p-glucan in wort (Analytica EBC - 8.13.3 - p- Glucan in wort by Automated Discrete Analysis - 2021).

[0477] The results can be seen in table 11A.

[0478] Table 11A.

[0479]

[0480] Table 11A, continued.

[0481] Table 11A, continued.

[0482] [3-Glucan degradation

[0483] For time course measurement of p-glucan degradation, flour was extracted and soluble HMW p-glucan was analysed during malting as described in the section “Sample preparation”.

[0484] The p-glucan content during malting can be seen in table 11 B.

[0485] Table 11 B.

[0486] Example 11 - Genetic analyses of HE NZ-a1 and HENZ-a2

[0487] We here describe genetic analyses of HENZ-a1 and HENZ-a2, specifically the genetic inheritance of the HENZ-a trait and the genetic mapping of the HENZ-a trait, including the identification of closely linked markers for marker-assisted breeding.

[0488] Results

[0489] Genetic inheritance

[0490] Several HENZ-a1 reciprocal crosses were performed for genetic inheritance analyses (table 12). As shown in table 13 and figure 13, when HENZ-a1 was used as mother in the crossings, F1 progenies showed increased a-amylase activity after 72 h in endosperm half-grain germination tests. When HENZ-a1 was used as father in the crossings, F1 progenies showed low a-amylase activity after 72 h in endosperm halfgrain germination tests. This was further confirmed by an endosperm half-grain assay in F2 individual seeds from Paustian x HENZ-a1 reciprocal crosses, where 40 individuals with HENZ-a1 as mother and 48 individuals with HENZ-a1 as father were tested. Despite of the large variation observed, the average a-amylase activity was higher when HENZ-a1 was the mother in crosses (figure 14, table 14). In contrast, the respective F2 from all reciprocal crosses had the endosperm half-grain a-amylase activity indicating that the HENZ-a trait is control by nuclear DNA (figure 14, table 14).

[0491] For HENZ-a2, endosperm half-grain a-amylase activity assays were done on F2 individual seeds from the cross HENZ-a2 x Quench (40 individuals with HENZ-a2 as mother and 48 individuals with HENZ-a2 as father). Here, a similar result was observed as described for HENZ-a1, again indicating that the HENZ-a trait is controlled by nuclear DNA (figure 14, table 14). Taken together, our results suggest that both HENZ-a1 and HENZ-a2 traits are nucleo- inherited, incomplete dominant (common for gene gain-of-function mutations), and that the trait(s) has(have) a dose effect in germinating barley grain. Table 12. Reciprocal crosses.

[0492] Table 13. a-amylase activity in F1 endosperm half-grain of HENZ-a1 reciprocal crosses

[0493] Table 14. Megazyme a-amylase activity of endosperm half-grain in HENZ-a1 and HENZ-a2 F2 populations from reciprocal crosses. Genetic mapping

[0494] F2 individuals from two independent crosses were genotyped using a 50K SNP array. Among the 50K SNPs detectable in this array, 6722 markers were polymorphic between Paustian and HENZ-a1, and thus useful for the HENZ-a1 mapping study. After quality filtering and redundancy check, 930 polymorphic markers were used for genetic map construction and trait association analyses. Here, HENZ-a1 was mapped to the short arm of chromosome 3H (markers JHI-Hv50k-2016-160542 and BOPA2_12_30571), however due to the general lack of sufficient polymorphic markers on the 3H short arm, an exact interval (with flanking markers) could not be defined. We thus conclude that HENZ-a1 is located on the short arm of chromosome 3H (figure 15). In the second F2 population, derived from the cross of Planet x HENZ- a2, 4734 polymorphic markers were identified. After quality filtering and redundancy check, 738 polymorphic markers were used for genetic map construction and trait association analyses. Here, HENZ-a2 was, like HENZ-a1 , mapped on the short arm of chromosome 3H, but in a more defined interval between flanking markers JHI-Hv50k- 2016-164728 and SCRI_RS_209249 (figure 15).

[0495] Material and methods

[0496] Genetic inheritance

[0497] To study the genetic inheritance, we designed several reciprocal crosses as shown in table 12. Paustian, Planet and Quench were used as crossing parents as they do not have the endosperm half-grain a-amylase phenotype. HENZ-a1, HENZ-a2, Quench, Paustian and Planet were sown in the greenhouse in 2018. For each cross, two spikes were made. Crossing spikes (F1 seeds - develop into F1 plants) were harvested. Some seeds were kept for genetic inheritance analyses, leftover seeds were sown again in the greenhouse. F2 from reciprocal crosses of Paustian and HENZ-a1, Quench and HENZ-a2 were also used for genetic inheritance analyses. Several spikes per cross were harvested before emergence for double haploid (DH) production as described elsewhere (Olsen 1987). The remaining spikes (F2 seeds - develop into F2 plants) were grown to maturity and harvested.

[0498] Genetic mapping

[0499] After genetic inheritance analyses, two F2 populations of Paustian x HENZ-a1 and Planet x HENZ-a2 were chosen for genetic mapping. For each population, 94 single grain together with two parents were sown in a 96-tray. Leaf samples were harvested at seedling stage and genotyped using a 50K SNP array (Knudsen et al., 2022). The two populations were grown to maturity in the greenhouse and F3 seeds were harvested from individual F2 spikes (here denoted as F2:3 grain).

[0500] Next, the endosperm half-grain phenotype was evaluated of the F2:3 grain. As shown earlier, the HENZ-a grain phenotype depends on allele dose in crossing experiments, and thus, the trait can be segregating in individual F2:3 grains derived from a F2 spike. Therefore, F2:3 grains derived from one F2 spike were tested as a pool: 40 individual F2:3 grain from a F2 single plant were tested in endosperm half-grain germination assays and pooled before the a-amylase activity assay.

[0501] For each population individual, 40 healthy grains were dissected and germinated on petri dish in 2.5 ml milliQ water for 96 hours in 15°C. Subsequently all samples were freeze dried and milled. From each milled sample, three technical reps of 100 mg each were used for a-amylase activity assay. The assay protocol is as follows:

[0502] • Add 1000 pl 1x Extraction Buffer to 100 mg flour in 2 ml tube

[0503] • Pre-warm fridge-cold buffer to RT

[0504] • Vortex 20 s vigorously

[0505] • Incubate for 5 min at RT

[0506] • Vortex 20 s vigorously

[0507] • Incubate for 5 min at RT

[0508] • Vortex 20 s vigorously

[0509] • Incubate for 5 min at RT

[0510] • Spin tube at 1000g for 10 min

[0511] • Take 50 pl extract and dilute 1:10 with 1x extraction buffer (450 pl)

[0512] • Vortex

[0513] • Run assay within 2 hours

[0514] • Diluted extract and fresh Ceralpha solution both are at room temperature before assay.

[0515] • Add 20 pl diluted extract to plate, add 20 pl Ceralpha.

[0516] • Mix

[0517] • Incubation times at 40°C 20 min

[0518] • Add 200 pl of 1 % TRISMA stop solution

[0519] • Mix • Measure absorbance at 400 nm (microtiter plate reader)

[0520] Example 12 - Identification of HENZ-a via genomic and transcriptomic approach

[0521] We here describe the identification of candidate mutation(s) in HENZ-a1 and HENZ-a2 via RNA-seq of germinating endosperm half-grain HENZ-a1, HENZ-a2 and Quench, and by whole genome sequencing (WGS) of HENZ-a1, HENZ-a2 and Quench mutant siblings.

[0522] Table 15. Material used in whole genome sequencing.

[0523] Table 16. List of candidate mutations identified by WGS, possibly causative for the HENZ-a trait.

[0524] Results

[0525] Whole genome sequencing (WGS)

[0526] After initial filtering for biallelic SNPs in extended gene coding regions (genes including regions 500bp upstream and downstream), WGS identified 56,469 SNPs on chromosome 3H. We further only considered SNPs that were different between all wt samples and HENZ-a1 or HENZ-a2 mutant samples. SNPs unique to any of mutant lines were kept for further analyses.

[0527] For all the remaining SNPs, RNA-seq quantification (TPM) from germinated endosperm half-grain was used as additional filtering criteria. Here, only genes were considered that showed expression in germinated endosperm half-grains.

[0528] Finally, all SNPs outside of the individual mapping intervals for HENZ-a1 and HENZ-a2 were excluded. We subsequently shorten the number of candidate SNPs as shown in table 16. One of the candidate SNPs is in gene “Horvu_PLANET_3H01G160900” (Planet_V1) or ID HORVU.MOREX.r3.3HG0242030 (Morex_V3), annotated to be encoding an Alpha / beta-Hydrolases superfamily protein, or more specifically a Carboxylesterase (CXE) CXE2L1. Both HENZ-a1 and HENZ-a2 mutants (in both cases original mutant and DH) carry the same C->T nucleotide transition in the CXE2L1 gene, likely to have been induced by NaNs (Knudsen et al., 2022). The mutant CXE2L1 gene encodes a mutant CXE2L1 protein comprising an amino acid exchange of Alanine 127 to Valine 127 (A127>V). From our results, HENZ-a1 and HENZ-a2 are most likely derived from the same induced mutation event after NaNs mutagen treatment.

[0529] We then tested barley cultivars that are reported to have fast beta-glucan degradation in malting via Sanger sequencing for the A127V mutation (C>T) in the CXE2L1 gene. As shown in figure 16, none of these lines had the A127V mutation (C>T). However, surprisingly several FMT-3H-type lines had another CXE2L1 mutation in this Sanger sequencing fragment, namely S113P (T>C).

[0530] Material and methods

[0531] Whole genome sequencing (WGS)

[0532] HENZ-a1 and HENZ-a2 seeds harvested from F2 mapping populations were selected for WGS. Their identities were verified by 50K genotyping and by endosperm half-grain phenotyping. Beside original mutant plants, two DH lines from crosses with Planet were included. For the wild type controls, 12 spikes were chosen based on original endosperm half-grain screening data (original experiment for isolation of the HENZ-a; chosen lines had no a-amylase activity in endosperm half-grain germination tests). Four grains were collected from each of these 12 spikes and endosperm half-grain germination tests were repeated as described previously. All four grains of each of the 12 mutant siblings were negative for endosperm half-grain phenotype, and thus the 12 mutant siblings were chosen as wild type controls for the WGS. In total 16 accessions were grown in the greenhouse and leaf samples were harvested at seedling stage. Subsequently leaves were freeze dried and sent to LGC for Illumina PE250 sequencing.

[0533] Sequencing reads were trimmed to remove low quality bases and adapters using cutadapt (v4.2; python3.9). The remaining high-quality reads were mapped to the barley reference genome assembly of RGT Planet_V1 using minimap (v2.24), sorted using novosort and converted to cram format using samtools (v1.15). Variant calling was performed using mpileup and call functions from bcftools. Variants were annotated with SnpEff (v5.1). Gene names were extracted using SnpSift (v5.1) and genotypes were extracted with bcftools (v1.15). Only biallelic SNPs in regions 500bp upstream to 500bp downstream of genes were further considered. SNPs, associated genes and their RNA-seq quantification from endosperm half-grain germination were all further analysed in R (v4.0.2).

[0534] RNA-seq

[0535] HENZ-a1, HENZ-a2 and Quench were propagated in New Zealand 2016 / 2017. We dissected 200 grains from each sample, 100 endosperm half-grains were germinated as described elsewhere (REF to other experiments). As positive control, Quench endosperm half-grain was germinated with 4 ml water containing 100nM GA3.

[0536] Halfgrain were sampled 24 h, 48 h and 72 h after imbibition (three biological replicates each) and freeze-dried. Halfgrains (30-200 mg) were ground in liquid nitrogen before isolating RNA using the SpectrumTM Plant Total RNA kit (Sigma- Aldrich) according to the manufacturer’s instructions. Total RNA of samples was RNA-sequenced at La Trobe University, Australia. Transcript abundances were estimated as transcript per million (TPM) using kallisto (v0.48.0) with default 31-mer and 100 bootstraps.

[0537] Sanger sequencing

[0538] Several commercial barley varieties (table 17 - herein collectively referred to as “FMT- 3H-type lines”) known for fast degradation of beta-glucan in malting were selected together with HENZ-a1 , HENZ-a2, Quench and Planet for sanger sequencing. Leaf material was harvested at seedling stage and DNA was extracted using EchoLUTION Plant DNA Kit (BioEcho Life Sciences GmbH). Based on Horvu_PLANET_3H01G160900 (Planet_V1), two primers were designed to amplify a gene region of 429bp (LU88F CTTAGTGTCCGCGCATACAG, LU88R CGCGGAGAGGAGGATGTAC).

[0539] PCR Mix was prepared in 25 pl volume of 12.5 pl Red Extraction PCR Mix, 1.25pl Primerl , 1.25pl Primer2, 5pl water and 5 pl of template DNA. Adapted PCR program was used: 3 min of denaturing at 94°C, followed by 35 cycles of 94°C denaturing for 45 s, 62°C annealing for 1 min and 72°C extension for 1 min, finally extension for 10 min, then stored at 8°C. The PCR products were sent to Eurofins genomics for purification and Sanger sequencing. The sequencing results were analyzed in CLC workbench 21 (QIAGEN). Alignment was shaded at https: / / www.bioinformatics.org / sms2 / color_align_cons.html

[0540] Table 17. Sanger sequenced material.

[0541] Example 13 - Visualization of identified HENZ-a and FMT-3H mutations in a structural CXE2L1 protein model

[0542] Results

[0543] A structural model was done of the mutant CXE2L1 proteins of HENZ-a and of FMT- 3H. In figure 17A the protein model surface is shown in dark grey with the substrate / ligand binding pocket in white. Transplanted substrate I GA4 (representative substrate) in black spheres is situated in the substrate / ligand binding pocket. From the structural model we predict that the Alanine at position 127 adopts an alpha-helical conformation away from the substrate / ligand binding pocket marked in black (figure 17B). The C-beta branched VAL residue generally shows decreased propensity for forming alpha-helical conformations compared to Alanine. Thus, the HENZ-a mutation A127V is likely to cause structural rearrangements in the protein core that alters the binding properties of the substrate / ligand binding pocket.

[0544] From the structural model it is further possible to identify additional residues which may affect interaction with the ligand. Mutation of such residues may potentially result in similar effects on the protein core and binding properties of the substrate / ligand binding pocket as S113P (FMT-3H) and A127V (HENZ-a). The potentially relevant residues are grouped after: i) distance to the ligand / substrate pocket, and ii) distance to A127 and S113, respectively.

[0545] The relevant residues are listed below. Distance to the ligand / substrate pocket

[0546] Using the model, the following ligand-interacting (i.e. substrate-interacting) or functional residues were identified:

[0547] (‘amino acid number’, ‘amino acid’)

[0548] ('13', 'PHE'), ('14', 'LEU'), ('83', 'GLY'), ('84', 'GLY'), ('85', 'GLY'), ('88', 'LEU'), ('93' 'GLN'), ('96', 'PHE'), ('166', 'HIS'), ('167', 'SER'), ('168', 'ALA'), ('201', 'PHE'), ('219', 'SER'), ('220', 'LEU'), ('22T, 'THR'), ('224', 'MET'), ('228', 'LEU'), ('300', 'HIS'), ('301', 'GLY'), ('302', 'PHE'), ('304', 'ILE'), ('305', 'ARG')

[0549] Furthermore, the residues <5 angstrom from the ligand / substrate interacting residues were identified (highlighted in black sticks in figure 17C; 1stlayer of residues):

[0550] (‘amino acid number’, ‘amino acid’)

[0551] ('11', 'GLU'), ('12', 'ASP'), ('15', 'GLY'), ('16', 'VAL'), ('17', 'VAL'), ('18', 'GLN'), ('27', 'ARG'), ('30', 'GLU'), ('33', 'LEU'), ('35', 'THR'), ('63', 'TYR'), ('80', 'TYR'), ('81', 'PHE'), ('82', 'HIS'), ('86', 'TYR'), ('87', 'CYS'), ('89', 'GLY'), ('90', 'SER'), ('91', 'ILE'), ('92', 'ALA'), ('94', 'PRO'), ('95', 'ASN'), ('97', 'HIS'), ('98', 'SER'), ('99', 'LEU'), ('100', 'CYS'), ('116', 'TYR'), ('118', 'LEU'), ('164', 'SER'), ('165', 'GLY'), ('169', 'GLY'), ('170', 'ALA'), ('171',

[0552] 'ASN'), ('172', 'LEU'), ('173', 'ALA'), ('198', 'LEU'), ('199', 'SER'), ('200', 'ALA'), ('202',

[0553] 'PHE'), ('203', 'ALA'), ('217', 'GLY'), ('218', 'VAL'), ('222', 'THR'), ('223', 'ALA'), ('225',

[0554] 'ALA'), ('226', 'ASP'), ('227', 'GLN'), ('229', 'TRP'), ('230', 'ARG'), ('23T, 'MET'), ('232',

[0555] 'SER'), ('233', 'LEU'), ('244', 'ALA'), ('265', 'VAL'), ('267', 'PRO'), ('269', 'SER'), ('270',

[0556] 'ASP'), ('271', 'VAL'), ('272', 'LEU'), ('295', 'PHE'), ('298', 'GLU'), ('299', 'GLN'), ('303',

[0557] 'PRO'), ('306', 'GLN'), ('307', 'PRO'), ('309', 'SER'), ('31 T, 'THR'), ('312', 'ALA'), ('315', 'LEU')

[0558] Furthermore, the residues <5 angstrom from the 1stlayer of residues were identified (highlighted in white sticks in figure 17C; 2ndlayer of residues);

[0559] Note that the 2ndlayer of residues includes A127 and S113.

[0560] (‘amino acid number’, ‘amino acid’)

[0561] ('9', 'VAL'), ('10', 'VAL'), ('19', 'LEU'), ('20', 'LEU'), ('24', 'SER'), ('25', 'VAL'), ('26', 'VAL') ('28', 'GLY'), ('29', 'ASP'), ('31', 'ALA'), ('32', 'VAL'), ('34', 'ARG'), ('36', 'ASN'), ('37', 'GLU'), ('39', 'LEU'), ('40', 'PRO'), ('42', 'VAL'), ('45', 'VAL'), ('46', 'GLN'), ('47', 'TRP'), ('49', 'ASP'), ('52', 'TYR'), ('58', 'LEU'), ('59', 'SER'), ('60', 'VAL'), ('61', 'ARG'), ('62', 'ALA'), ('64', 'ARG'), ('65', 'PRO'), ('78', 'LEU'), ('79', 'VAL'), ('101', 'LEU'), ('102', 'ARG') ('103', 'ALA'), ('104', 'ALA'), ('105', 'ALA'), ('109', 'ALA'), ('110', 'VAL'), ('111', 'VAL'), ('112', 'LEU'), ('113', 'SER'), ('114', 'VAL'), ('115', 'GLN'), ('117', 'ARG'), ('119', 'ALA') ('120', 'PRO'), ('121', 'GLU'), ('122', 'HIS'), ('123', 'ARG'), ('124', 'LEU'), ('127', 'ALA') ('128', 'ILE'), ('130', 'ASP'), ('131', 'GLY'), ('134', 'PHE'), ('151', 'TRP'), ('162', 'PHE') ('163', 'LEU'), ('174', 'HIS'), ('175', 'HIS'), ('176', 'VAL'), ('177', 'THR'), ('178', 'VAL') ('196', 'ILE'), ('197', 'LEU'), ('204', 'GLY'), ('205', 'ALA'), ('207', 'ARG'), ('208', 'THR') ('210', 'THR'), ('21 T, 'GLU'), ('214', 'PRO'), ('215', 'PRO'), ('216', 'GLU'), ('234', 'PRO') ('235', 'VAL'), ('237', 'ALA'), ('238', 'SER'), ('239', 'MET'), ('241', 'HIS'), ('242', 'PRO') ('243', 'LEU'), ('245', 'ASN'), ('246', 'PRO'), ('263', 'LEU'), ('264', 'VAL'), ('266', 'ALA') ('268', 'LEU'), ('273', 'ARG'), ('274', 'ASP'), ('275', 'ARG'), ('276', 'VAL'), ('279', 'TYR') ('293', 'VAL'), ('294', 'GLN'), ('296', 'GLU'), ('297', 'GLY'), ('308', 'PHE'), ('310', 'GLU'), ('313', 'SER'), ('314', 'GLU'), ('316', 'LEU'), ('317', 'ARG'), ('318', 'VAL'), ('319', 'ILE'), ('320', 'ARG')

[0562] Distance to A 127 and S113

[0563] Using the model, the following residues were identified as being in proximity, i.e. <5 angstrom within, A127:

[0564] (‘amino acid number’, ‘amino acid’)

[0565] 86 TYR, 116 TYR, 117 ARG, 122 HIS, 123 ARG, 124 LEU, 125 PRO, 126 ALA, 128 ILE, 129 ASP, 130 ASP, 131 GLY, 172 LEU

[0566] Using the model, the following residues were identified as being in proximity, i.e. <5 angstrom within, S113:

[0567] (‘amino acid number’, ‘amino acid’)

[0568] 59 SER, 60 VAL, 61 ARG, 63 TYR, 80 TYR, 91 ILE, 100 CYS, 111 VAL, 112 LEU, 114

[0569] VAL, 115 GLN Material and methods

[0570] Structural modelling and visualization

[0571] Alphafold2 (Jumper et al., 2021) as implemented in Colabfold v.1.3.0 (Mirdita et al., 2022), with the msa_mode MMseqs2 (UniRef+Environmental) and use_amber=false, was used to generate a structural prediction of CXE2L1 residue 1-327 (SEQ ID NO: 1, HORVU.MOREX.r3.3HG0242030, Morex_V3). AlphaFill (Hekkelman et al., 2023) was used to transplant the representative ligand GA4 from PDB:3ebl.A (-30% identity) into the CXE2L1 alphafold model.

[0572] Pymol (V. 1.5.0.3) was used for protein model visualization.

[0573] Example 14 - Phylogeny of Caboxylesterase (CXE) family in barley and rice of which barley HENZ-a and FMT-3H candidate gene CXE2L1 (HORVU.MOREX.r3.3HG0242030, Morex_V3) is part of Results

[0574] The HENZ-Alpha candidate gene CXE2L1 (HORVU.MOREX.r3.3HG0242030, Morex_V3) is part of the Carboxylesterase (CXE) family where some members hydrolyze short-chain fatty-acid esters and others are involved in GA hormone perception. To place the candidate gene in the CXE family phylogeny we identified CXE genes in barley and rice, aligned them and constructed a maximum-likelihood phylogenetic tree.

[0575] The phylogenetic tree show 5 subclades, where subclade 5 contains the well-known GID1 GA receptor from barley and rice and our HENZ-a candidate gene CXE2L1 (figure 18).

[0576] Example 15 - Generation and testing of double mutants

[0577] The CXE2L1 gene of FMT-3H-type lines was sequenced as described in Example 12, and it was found to comprise a mutant CXE2L1 gene encoding a mutant CXE2L1 polypeptide comprising a S113P substitution.

[0578] An FMT-3H-type line carrying the S113P substitution (herein referred to as “FMT-3H”) was crossed into a barley strain comprising a G^A mutation of nucleotide 2243 of the coding sequence of the HvCslF6 gene (SEQ ID NO: 2 of WO 2019 / 129736) resulting in said HvCslF6 gene encoding a mutant HvCslF6 protein comprising a Gly^Asp mutation of amino acid 748 of SEQ ID NO: 1 of WO 2019 / 129736. Said barley strain was generated as described in Examples 1 and 2 of WO 2019 / 129736, and has also been deposited with NCIMB Ltd. Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA Scotland on 12 November 2018 and has received the accession number NCIMB 43273.

[0579] From these crosses, progeny containing both the S113P substitution in the CXE2L1 polypeptide and the G^A mutation of nucleotide 2243 of the coding sequence of the HvCslF6 gene were selected. The resulting barley plant comprised both mutations and is referred to as FMT-3H + Mut2.

[0580] Hydrolytic enzyme activity and p-glucan degradation after malting was tested as described in “Materials and methods” above in said barley plant.

[0581] Properties of the barley plants are shown in tables 18 and 19 below.

[0582] Table 18.

[0583] Table 19. a-Amylase activity

[0584] When measuring a-amylase activity after malting, flour was made as described above in the section "Sample preparation". a-Amylase activity assays followed the recommendations provided with the Ceralpha kit from Megazyme.

[0585] The a-amylase activity can be seen in figure 19A and table 20A.

[0586] Table 20A.

[0587] / 3-Amylase activity

[0588] When measuring p-amylase activity after malting, flour was made as described above in the section "Sample preparation". p-Amylase activity assays followed the recommendations provided with the Betamyl kit from Megazyme (K-BETA3).

[0589] The p-amylase activity can be seen in figure 19B and table 20B.

[0590] Table 20B.

[0591] Limit dextrinase activity

[0592] For measurement of free limit dextrinase activity after malting, flour was made as described above in the section "Sample preparation". Limit dextrinase activity was determined using a Limit Dextrizyme PullG6 Method from Megazyme. Assays, including activity measurements, were done according to manufacturer's protocol (PullG6 Method).

[0593] The free limit dextrinase activity can be seen in figure 19C and table 20C.

[0594] Table 20C.

[0595] [3-Glucan content

[0596] Measurement of p-glucan content after malting was carried out using the standard EBC method for detecting HMW p-glucan in wort (Analytica EBC - 8.13.3 - p-Glucan in wort by Automated Discrete Analysis - 2021).

[0597] The p-glucan content can be seen in figure 19D and table 20D.

[0598] Table 20D.

[0599] Example 16 - Generation and testing ofFIND-IT mutant HENZ-78

[0600] Material and methods

[0601] A unique ddPCR assay was designed, specifically to distinguish between the barley mutant allele and wild-type allele of CXE2L1 at nucleotide position 380 in the wild-type coding sequence (HORVU.MOREX.r3.3HG0242030, Morex_V3). The mutant detection probe was complementary to the coding sequence, containing a T base at nucleotide position 380. The reference detection probe was complementary to the coding sequence, containing a C base at nucleotide position 380. Two flanking primers were designed to amplify the genomic sequence surrounding nucleotide 380 in the coding sequence.

[0602] The following primers and probes were designed specifically for the CXE2L1 gene and used to screen a NaNs mutagenized RGT Planet library as described elsewhere (Knudsen et al., 2022):

[0603] Target-specific forward primer (SEQ ID NO: 27): 5'- AACTTCCACTCGCTCTG -3';

[0604] Target-specific reverse primer (SEQ ID NO: 28): 5'- CAGGAAAGGAAAGACGC -3';

[0605] Mutant-specific detection probe (SEQ ID NO: 29): 5'- CGATGACCGCGGG -3'-labelled with 6-carboxyfluorescein (FAM);

[0606] Reference-specific detection probe (SEQ ID NO: 30): 5'- CGATGGCCGCGG -3'- labelled with hexachlorofluorescein (HEX).

[0607] The mutant “HENZ-78” in the table below was identified in the dd-PCR assay.

[0608] A half-grain a-amylase activity assay of the HENZ-78 mutant was conducted as described in Example 3. The half-grain a-amylase activities of Planet, HENZ-a1 , HENZ- a2 and Quench were tested in the same assay (Planet as reference for HENZ-78; Quench as reference for HENZ-a1 , HENZ-a2).

[0609] Results

[0610] The endosperm half-grains of HENZ-78, HENZ-a1 and HENZ-a2 all showed high a- amylase activity. The endosperm half-grains of Quench and Planet showed in principle no a-amylase activity. The results can be seen in Figure 21 and in the Table below.

[0611] Table showing a-amylase activity in the endosperm half-grain of the below-indicated barleys.

[0612] Example 17- a-Amylase activity of micromalted grain in malting barley varieties with distinct amy1_ 1 haplotypes and causative copy number determination

[0613] Material and methods

[0614] Based on Morex_V1 genome assembly, a PCR assay targeting a polymorphic region upstream of amy1_1 copies was developed and used to screen a diverse panel of malting barley and breeding lines. A total of 10 diverse haplotypes were found, which indicated potential copy number variation (CNV) in modern varieties. Two of these haplotypes were named the B (amy1_1-B) and Q (amy1_1-Q) haplotypes.

[0615] Non-dormant grain samples of a selected group of malting barley varieties were micromalted as described in Example 9. a-Amylase activity was measured using the Ceralpha method (Ceralpha Method _R-CAAR4, Megazyme) modified for Gallery Plus Beermaster (Thermo Fisher Scientific, USA).

[0616] To quantify the copy number of the amy1_1 gene, droplet digital PCR (ddPCR) was performed on genomic barley DNA. Two ddPCR assays were designed: one for the amy1_1 gene and one for a reference gene with known copy number (HvGW2).

[0617] The primers and probes for the amy1_1 assay were as follows:

[0618] - Forward primer: [5’-CGACCACCTCAACCTG-3’]

[0619] - Reverse primer: [5’-GTAAATCTTGGCGACGT-3’]

[0620] - Probe: [5’- FAM - ATGTCGGCCTTGAGC-3’]

[0621] The primers and probes for the HvGW2 assay were as follows:

[0622] - Forward primer: [5’-AATGGTACGAGAGGAAGG-3’]

[0623] - Reverse primer: [5’-GGCATAGCTTGTCCCA-3’]

[0624] - Probe: [5’-HEX-ATCACTGGTCAGAGGGT-3’]

[0625] Different fluorescent labels were utilized for the probes to enable two assays being conducted simultaneously in the same reaction. For each ddPCR reaction, the following components were prepared: 11 pl of 2x ddPCR Supermix for Probes (BioRad), 900 nM of each primer, 250 nM of probe, 5 pl of genomic DNA template, and nuclease-free water to a final volume of 22pl. Droplets were generated using a QX200 Droplet Generator (Bio-Rad). The PCR plate containing the droplets was heat-sealed at 180°C for 5 seconds with pierceable foil, using a PX1 PCR plate sealer (Bio-Rad, Hercules, CA, USA) followed by PCR amplification (Uno96, VWR, Radnor, PA, USA) as follows: enzyme activation at 95°C for 10 minutes followed by 40 cycles of denaturation at 94°C for 30 seconds followed by annealing / extension at 55°C for 1 minute, ending with enzyme deactivation at 98°C for 10 minutes. All steps had a ramp of 2°C / s. The fluorescence of each droplet was then measured using a QX200 Droplet Reader (Bio-Rad) and the data was analyzed for copy number variation using QuantaSoft software (Bio-Rad).

[0626] Results

[0627] The micromaltings were focused on barley varieties with the amy1_1-B or amy1_1-Q haplotypes. Fig. 20 indicates a tendency for barley cultivars with the amy1_1-B haplotype exhibiting overall higher a-amylase activity than barley cultivars with the amy1_1-Q haplotype.

[0628] Barley cultivars in the amy1_1-Q haplotype group were found by ddPCR sequencing to have a lower amy1_1 gene copy number (4 copies) than barley cultivars in the amy1_1-B haplotype group (5 copies) - see Table 21 , below.

[0629] Table 21. ddPCR copy number analysis a my 1 1 copy amy1_1 haplotype number Barley cultivar

[0630] 4 Quench

[0631] 4 RGT Planet amy1_ 1-Q

[0632] 4 Admiral

[0633] 4 Navigator

[0634] 5 Barke amy1_1-B 5 Paustian

[0635] 5 Rubinesse

[0636] This indicates that a copy number of 5 for amy1_1 increases alpha-amylase activity. Example 18 - Amy1_1-B breeding marker

[0637] In order to develop a breeding marker suitable for high throughput genotyping, amy1_1 copy-specific primers were designed based on the Morex_V1 genome assembly, further improved when the Morex_V2 genome assembly was published.

[0638] An amy 1_ 7-B-specific SNP locus (GGCGCCAGGCATGATCGGGTGGTGGCCAGCCAAGGCGGTGACCTTCGTGGACA ACCACGACACCGGCTCCACGCAGCACATGTGGCCCTTCCCTTCTGACA[A / G]GGT CATGCAGGGATATGCGTACATACTCACGCACCCAGGGACGCCATGCATCGTGAG TTCGTCGTACCAATACATCACATCTCAATTTTCTTTTCTTGTTTCGTTCATAA) was identified and used for KASP marker development (LGC Biosearch Technologies, Hoddesdon, United Kingdom). This unique SNP resides close to the end of the 2ndexon compared to all copies sequenced in modern cultivars. At this position the B-copy has an A nucleotide and while all other B-copies, as well as copies from other haplotypes, have the nucleotide G, resulting in an amino acid exchange B-amy1_1- R327K.

[0639] Amy1_1 copies were amplified in representative lines of 10 haplotypes, barcoded and pooled into one sample as instructed in PacBio amplicon sequencing (Pacific Biosciences, CA, USA). After purification, the sample was sent to BGI Tech Solutions Co. Ltd. (Hong Kong, China) for library construction and sequencing. amy1_1 sequences were analyzed for Morex, Barke, Quench and other haplotypes.

[0640] Example 19 - Development of new high yielding barley varieties with high / early enzyme activities

[0641] Material and methods

[0642] Combinations of several traits as described elsewhere herein were combined in the same barley variety using common breeding techniques for crossing barley. The resulting barley variety was then evaluated for enzyme activity (a-amylase, p-amylase, limit dextrinase) and content of p-glucan. a-amylase activity was measured essentially as described in Example 4.

[0643] P-amylase activity was determined essentially as described in the K-BETA3 (protocol and kit available from Megazyme, Ireland).

[0644] Free limit dextrinase activity was determined essentially as described in Example 15. P-glucan content was determined essentially as described in Example 10.

[0645] Results

[0646] The following barley varieties were generated:

[0647] Variety 1 - Genotype:

[0648] • Null LOX-1

[0649] • Null MMT

[0650] • CXE2L1 gene encoding a mutant CXE2L1 polypeptide comprising a S113P substitution;

[0651] • amy1_ 1-B

[0652] Variety 2 - Genotype:

[0653] • Null LOX-1

[0654] • Null MMT

[0655] • Null HRT

[0656] • Null ANT-28

[0657] • HvCslF6 gene encoding a mutant HvCslF6 protein comprising a Gly^Asp mutation of amino acid 748 of SEQ ID NO: 1 of WO 2019 / 129736

[0658] • CXE2L1 gene encoding a mutant CXE2L1 polypeptide comprising a S113P substitution;

[0659] • amy1_ 1-B

[0660] As shown in Table 22, below, Variety 1 shows improved enzyme activities for a- amylase, p-amylase, and free limit dextrinase compared to reference barley variety RGT Planet. Variety 2 shows improved enzyme activities for a-amylase and limit dextrinase compared to reference barley variety RGT Planet. Additionally, Variety 1 and Variety 2 both have significantly reduced p-glucan content.

[0661] Table 22. Enzyme activities and p-glucan content after 6 days of malting.

[0662] Example 20 - Micromalting

[0663] Material and methods

[0664] The micromalting procedure was performed in a controlled environment with a temperature of 16°C and humidity at around 70%. The micromalting was conducted as shown in Fig. 12, but with a water target of 43%. The kilning was conducted at 27-55°C (2°C increase per hour) followed by 55-85°C (4°C increase per hour) followed by 1 h at 85°C).

[0665] Barley variants

[0666] CW3a + HENZ-a1

[0667] This line is the offspring (double haploid) of a cross between the HENZ-a1 (mother) carrying the A127V substitution and a breeding line (father; CW3a) carrying a G^A mutation of nucleotide 2243 of the coding sequence of the HvCslF6 gene (SEQ ID NO: 2 of WO 2019 / 129736) resulting in said HvCslF6 gene encoding a mutant HvCslF6 protein comprising a Gly^Asp mutation of amino acid 748 of SEQ ID NO: 1 of WO 2019 / 129736.. The CW3a strain was generated as described in Examples 1 and 2 of WO 2019 / 129736, and has also been deposited with NCIMB Ltd. Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA Scotland on 12 November 2018 and has received the accession number NCIMB 43273.

[0668] From these crosses, progeny containing both the A127V substitution in the CXE2L1 polypeptide and the G^A mutation of nucleotide 2243 of the coding sequence of the HvCslF6 gene were selected. The resulting barley plant comprised both mutations and is referred to as CW3a + HENZ-a1.

[0669] HENZ-a1 and HENZ-a2

[0670] The lines HENZ-a1, and HENZ-a2, all carry the A127V mutation and are all individual propagations (four repetitions each) of the same original HENZ-a1 and HENZ-a2 mutant seed batches. The plants were grown, and respective seeds harvested, in individual field plots (8 sqm) within the same field but at different locations. As described in Example 1 , HENZ-a1 and HENZ-a2 are derived from a Quench mutant population. HENZ-a1_DH

[0671] The lines HENZ-a1_DH1 to HENZ-a1_DH 6 are all sister plants (double haploids derived from the same cross) carrying the A127V substitution. The plants were grown, and respective seeds harvested, in individual field plots (8 sqm).

[0672] FMT-3H_DH

[0673] The lines FMT-3H_DH1 to FMT-3H_DH 9 are all sister plants (double haploids derived from the same cross) carrying the S113P substitution. The plants were grown, and respective seeds harvested, in individual field plots (8 sqm).

[0674] Controls

[0675] Planet-1, Planet-127, Quench-131, Quench-141 , Quench-148 and Quench-158 were grown in field plots (8 sqm). Planet-1 and Planet-127 are references for DH lines, Quench-131, Quench-141, Quench-148 and Quench-158 are references for HENZ-a1 and HENZ-a2.

[0676] Steeping

[0677] The barley samples were placed in individual containers, each holding 100 g of seeds, and submitted into 16°C fresh water to reach 33% moisture content on day 1 , and 43% moisture content on day 2.

[0678] The actual water uptake of individual samples was determined as the weight difference between initial water content, measured with Foss 1241 NIT instrument (Foss A / S, Denmark), and the sample weight after surface water removal.

[0679] Germination

[0680] Following the last steep, the barley samples were maintained at a degree of steeping of 43%. After each 24 hours, samples were checked for moisture content, and sprayed with additional water to overcome possible respiration loss.

[0681] Kiln

[0682] After the germination process the barley samples were kiln dried in Curio kiln using a two-step ramping profile. First ramping step started at a set point of 27 °C and a linear ramping at 2 °C / h to the breakpoint at 55 °C using 100% fresh air. Second linear ramping was at 4 °C / h reaching a maximum at 85 °C. This temperature was kept constant for 90 minutes using 50% fresh air.

[0683] Wort

[0684] Analysis of the wort was carried out according to the EBC protocol on Extract of Malt: Congress Mash (4.5.1).

[0685] Enzymatic activity of malt

[0686] The enzymatic activity was measured using the Megazyme methods modified for Gallery Plus Enzyme Master (Thermo Fisher Scientific, USA). a-amylase: a-Amylase Assay Kit (Ceralpha Method)

[0687] P-amylase: p-Amylase Assay Kit (Betamyl-3)

[0688] Free limit dextrinase: Pullulanase / Limit-Dextrinase Assay Kit (PullG6 Method) P-glucanase: Malt p-glucanase / lichanase (MBG4 Method)

[0689] / 3-glucan content of wort

[0690] P-glucan was measured by EBC 8.13.3 using Thermo Fisher reagents of the D14622_H P_ Beta-Glucan (High MW) kit.

[0691] Viscosity of wort

[0692] The viscosity of the wort was measured by EBC 4.8 with the viscosimeter Rheotest LK 2.2.

[0693] Results

[0694] The tables below show the protein content of the barley grain, the activity of the malt hydrolytic enzymes, and the wort analysis values measured according to the EBC congress mash procedure for the various tested barley lines. The standard deviation for each value is shown where more than two samples have been tested.

[0695] The table below presents enzymatic activity in malt after micromalting. In the previous examples, it was shown that a-amylase and p-glucanase activity was higher during germination in plants carrying the mutations described in the present application. Since the enzyme activity is higher during germination, the p-glucan content of the wort of said plants is lower, as can be seen in the tables below.

[0696] Example 21 - Half grain assay of additional mutants

[0697] Material and methods

[0698] Generation of FIN D-IT mutants

[0699] A NaNs mutagenized RGT Planet library was screened for specific mutations in the gene encoding CXE2L1. The mutants in the table below were identified.

[0700] The mutants were identified using FIND-IT, as already described for HENZ-78 in Example 16. Briefly, a ddPCR screening method essentially as described in international patent application PCT / EP2017 / 065516. More specifically, a pool of randomly mutagenized barley grains was prepared, followed by preparation of an ordered library as described in international patent application PCT / EP2017 / 065516 in WS1 and WS2 on p. 66-69 as well as in Examples 1 to 2. The mutants in the table above were identified and selected as described in international patent application PCT / EP2017 / 065516 in WS3 and WS4 on p. 67-72 as well as in Examples 3 to 15 using the primers and probes specified in the table below. In particular, the screening was performed essentially as described in international patent application

[0701] PCT / EP2017 / 065516 in WS3 and in Examples 3 to 7 using the primers and probes specified in the table below. Individual barley grains carrying the gene mutation were identified essentially as described in international patent application

[0702] PCT / EP2017 / 065516 in WS4 (p. 69-72) and in Examples 8 to 15 using the primers and probes specified in the table below. Primers and probes were designed specifically for the identification of each of the specific mutants. Table. Primers and probes for the specific mutants. Propagation of plants

[0703] The barley plants with specific mutations in the CXE2L1 gene are grown in 2L pots in a greenhouse with 16 hours of light and 8 hours of darkness until they are matured.

[0704] Half-grain assay A half-grain assay of the above-mentioned FIND-IT mutants is conducted as described in Example 3. Planet and Quench are used as controls.

[0705] HENZ-79 is expected to show less preferable results. Items

[0706] 1. A barley plant or part thereof, wherein said barley plant has high a-amylase activity in an endosperm half-grain lacking the embryo, and wherein said barley plant carries a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a gain of function mutant CXE2L1 polypeptide.

[0707] 2. The barley plant or part thereof, wherein wild-type CXE2L1 is a polypeptide of SEQ ID NO: 1 or a functional homologue thereof sharing at least 95% sequence identify thereto, preferably, wild-type CXE2L1 is a polypeptide of SEQ ID NO: 1.

[0708] 3. A barley plant or part thereof, wherein said barley plant has high a-amylase activity in an endosperm half-grain lacking the embryo, and wherein said barley plant carries a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a mutant CXE2L1 polypeptide, wherein wild-type CXE2L1 is a polypeptide of SEQ ID NO: 1 or a functional homologue thereof sharing at least 95% sequence identify thereto, preferably, wild-type CXE2L1 is a polypeptide of SEQ ID NO: 1.

[0709] 4. The barley plant or part thereof according to any one of the preceding items, wherein the mutant CXE2L1 polypeptide comprises a substitution of an amino acid selected from the group consisting of: a. the amino acid corresponding to S113 or A127 of SEQ ID NO: 1; or b. the amino acid corresponding to P125, A126 or A212 of SEQ ID NO: 1 ; or c. the amino acid corresponding to F13, L14, G83, G84, G85, L88, Q93, F96, H166, S167, A168, F201 , S219, L220, T221 , M224, L228, H300, G301, F302, I304, or R305 of SEQ ID NO: 1; or d. the amino acid corresponding to E11 , D12, G15, V16, V17, Q18, R27, E30, L33, T35, Y63, Y80, F81 , H82, Y86, C87, G89, S90, 191 , A92, P94, N95, H97, S98, L99, C100, Y116, L118, S164, G165, G169, A170, N171 , L172, A173, L198, S199, A200, F202, A203, G217, V218, T222, A223, A225, D226, Q227, W229, R230, M231 , S232, L233, A244, V265, P267, S269, D270, V271, L272, F295, E298, Q299, P303, Q306, P307, S309, T311, A312, or L315 of SEQ ID NO: 1; or e. the amino acid corresponding to V9, V10, L19, L20, S24, V25, V26, G28, D29, A31, V32, R34, N36, G37, L39, P40, V42, V45, Q46, W47, D49, Y52, L58, S59, V60, R61, A62, R64, P65, L78, V79, L101, R102, A103, A104, A105, A109, V110, V111 , L112, S113, V114, Q115, R117, A119, P120, E121, H122, R123, L124, A127, 1128, D130, G131 , F134, W151, F162, L163, H174, H175, V176, T177, V178, 1196, L197, G204, A205, R207, T208, T210, E211, P214, P215, E216, P234, V235, A237, S238, M239, H241 , P242, L243, N245, P246, L263, V264', A266, L268, R273, D274, R275, V276, Y279, V293, Q294, E296, G297, F308, E310, S313, E314, L316, R317 ,V318, 1319, or R320 of SEQ ID NO: 1; f. the amino acid corresponding to Y86, Y116, R117, H122, R123, L124, P125, A126, 1128, D129, D130, G131 or L172 of SEQ ID NO: 1 ; g. the amino acid corresponding to S59, V60, R61 , Y63, Y80, 191, C100, V111, L112, V114 or Q115 of SEQ ID NO: 1; wherein wild-type CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto.

[0710] 5. A barley plant or part thereof, wherein said barley plant carries a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a mutant CXE2L1 polypeptide, wherein said mutant CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto, except that mutant CXE2L1 comprises a substitution at: a. the amino acid corresponding to amino acid 127 of SEQ ID NO: 1, wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or b. amino acid 113, wherein said substitution is a substitution of a serine (S) to a proline (P); with the proviso that the plant does not contain SEQ ID NO: 5.

[0711] 6. A barley plant or part thereof, wherein said barley plant carries a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a mutant CXE2L1 polypeptide, wherein said mutant CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto, except that mutant CXE2L1 comprises a substitution at: a. the amino acid corresponding to amino acid 127 of SEQ ID NO: 1, wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or b. amino acid 113, wherein said substitution is a substitution of a serine (S) to a proline (P); and / or c. the amino acid corresponding to amino acid 125 of SEQ ID NO: 1, wherein said substitution is a substitution of a proline (P) to a serine (S); and / or d. the amino acid corresponding to amino acid 126 of SEQ ID NO: 1, wherein said substitution is a substitution of an alanine (A) to a threonine (T); and / or e. the amino acid corresponding to amino acid 127 of SEQ ID NO: 1, wherein said substitution is a substitution of an alanine (A) to a threonine (T); and / or f. the amino acid corresponding to amino acid 212 of SEQ ID NO: 1, wherein said substitution is a substitution of an alanine (A) to a threonine (T); and / or g. the amino acid corresponding to amino acid 212 of SEQ ID NO: 1, wherein said substitution is a substitution of alanine (A) to a valine (V); with the proviso that the plant does not contain SEQ ID NO: 5. A barley plant or part thereof, wherein said barley plant has high a-amylase activity in an endosperm half-grain lacking the embryo, wherein said barley plant carries: a. a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a gain of function mutant CXE2L1 polypeptide, wherein wild-type CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto, and b. a mutation in a gene encoding a p-glucan synthase. A barley plant or part thereof, wherein said barley plant carries: a. a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a mutant CXE2L1 polypeptide, wherein said mutant CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto, except that mutant CXE2L1 comprises a substitution at: i. the amino acid corresponding to amino acid 127 of SEQ ID NO:

[0712] 1 , wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or ii. the amino acid corresponding to amino acid 113 of SEQ ID NO: 1 , wherein said substitution is a substitution of a serine (S) to a proline (P); and further b. a mutation in a gene encoding a p-glucan synthase. ey plant or part thereof, wherein said barley plant carries: a. a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a mutant CXE2L1 polypeptide, wherein said mutant CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto, except that mutant CXE2L1 comprises a substitution at: i. the amino acid corresponding to amino acid 127 of SEQ ID NO:

[0713] 1 , wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or ii. the amino acid corresponding to amino acid 113 of SEQ ID NO: 1 , wherein said substitution is a substitution of a serine (S) to a proline (P); and / or iii. the amino acid corresponding to amino acid 125 of SEQ ID NO:

[0714] 1 , wherein said substitution is a substitution of a proline (P) to a serine (S); and / or iv. the amino acid corresponding to amino acid 126 of SEQ ID NO:

[0715] 1 , wherein said substitution is a substitution of an alanine (A) to a threonine (T); and / or v. the amino acid corresponding to amino acid 127 of SEQ ID NO:

[0716] 1 , wherein said substitution is a substitution of an alanine (A) to a threonine (T); and / or vi. the amino acid corresponding to amino acid 212 of SEQ ID NO:

[0717] 1 , wherein said substitution is a substitution of an alanine (A) to a threonine (T); and / or vii. the amino acid corresponding to amino acid 212 of SEQ ID NO:

[0718] 1 , wherein said substitution is a substitution of an alanine (A) to a valine (V); and further b. a mutation in a gene encoding a p-glucan synthase. The barley plant or part thereof according to any one of the preceding items, wherein the barley plant has high a-amylase activity in an endosperm half-grain lacking the embryo. The barley plant or part thereof according to any one of the preceding items, wherein the kernels of said barley plant have a reduced p-glucan content. The barley plant or part thereof according to any one of the preceding items, wherein the gain of function mutant CXE2L1 polypeptide comprises a substitution of an amino acid selected from the group consisting of: a. the amino acid corresponding to S113 or A127 of SEQ ID NO: 1 ; or b. the amino acid corresponding to P125, A126 or A212 of SEQ ID NO: 1 ; or c. the amino acid corresponding to F13, L14, G83, G84, G85, L88, Q93, F96, H166, S167, A168, F201 , S219, L220, T221 , M224, L228, H300, G301 , F302, I304, or R305 of SEQ ID NO: 1 ; or d. the amino acid corresponding to E11 , D12, G15, V16, V17, Q18, R27, E30, L33, T35, Y63, Y80, F81 , H82, Y86, C87, G89, S90, 191 , A92, P94, N95, H97, S98, L99, C100, Y116, L118, S164, G165, G169, A170, N171 , L172, A173, L198, S199, A200, F202, A203, G217, V218, T222, A223, A225, D226, Q227, W229, R230, M231 , S232, L233, A244, V265, P267, S269, D270, V271 , L272, F295, E298, Q299, P303, Q306, P307, S309, T311 , A312, or L315 of SEQ ID NO: 1 ; or e. the amino acid corresponding to V9, V10, L19, L20, S24, V25, V26, G28,

[0719] D29, A31 , V32, R34, N36, G37, L39, P40, V42, V45, Q46, W47, D49, Y52, L58, S59, V60, R61 , A62, R64, P65, L78, V79, L101 , R102, A103, A104, A105, A109, V110, V111 , L112, S113, V114, Q115, R117, A119, P120,

[0720] E121 , H122, R123, L124, A127, 1128, D130, G131 , F134, W151 , F162,

[0721] L163, H174, H175, V176, T177, V178, 1196, L197, G204, A205, R207, T208, T210, E211 , P214, P215, E216, P234, V235, A237, S238, M239, H241 ,

[0722] P242, L243, N245, P246, L263, V264, A266, L268, R273, D274, R275, V276, Y279, V293, Q294, E296, G297, F308, E310, S313, E314, L316, R317 ,V318, 1319, or R320 of SEQ ID NO: 1; f. the amino acid corresponding to Y86. Y116, R117, H122, R123, L124, P125, A126, 1128, D129, D130, G131 or L172 of SEQ ID NO: 1; g. the amino acid corresponding to S59, V60, R61, Y63, Y80, 191, C100, V111 , L112, V114 or Q115 of SEQ ID NO: 1; wherein wild-type CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto. The barley plant of part thereof according to any one of the preceding items, wherein the substitution in CXE2L1 is a substitution of an alanine for a valine or a substitution of a serine for a proline, for example wherein said substitution comprises a substitution at: a. amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or b. amino acid 113 of SEQ ID NO: 1 , wherein said substitution is a substitution of a serine (S) to a proline (P). The barley plant of part thereof according to any one of the preceding items, wherein the substitution in CXE2L1 is a substitution of an alanine for a valine, or a substitution of a proline for a serine, or a substitution of an alanine for a threonine, or a substitution of a serine for a proline, for example wherein said substitution comprises a substitution at: a. amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or b. amino acid 113 of SEQ ID NO: 1 , wherein said substitution is a substitution of a serine (S) to a proline (P); and / or c. amino acid 125 of SEQ ID NO: 1, wherein said substitution is a substitution of proline (P) into serine (S); and / or d. amino acid 126 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or e. amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or f. amino acid 212 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or g. amino acid 212 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into valine (V).

[0723] 15. The barley plant according to any one of the preceding items, wherein said barley plant, in addition to the substitution in the CXE2L1 polypeptide comprises one or more mutations selected from the group consisting of: a. the amino acid corresponding to A62 of SEQ ID NO: 1 to V (A62V) or to T (A62T), b. the amino acid corresponding to S67 of SEQ ID NO: 1 to L (S67L), c. the amino acid corresponding to V153 of SEQ ID NO: 1 to M (V153M), d. the amino acid corresponding to A212 of SEQ ID NO: 1 to T (A212T) or to V (A212V), e. the amino acid corresponding to E216 of SEQ ID NO: 1 to K (E216K), f. the amino acid corresponding to M224 of SEQ ID NO: 1 to I (M224I), g. the amino acid corresponding to R230 of SEQ ID NO: 1 to C (R230C) or to H (R230H) or h. the amino acid corresponding to S238 of SEQ ID NO: 1 to N (S238N), wherein wild-type CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto.

[0724] 16. The barley plant according to any one of the preceding items, wherein the substitution in the CXE2L1 polypeptide is selected from one or more of the mutations listed in Table A, Table B and Table C.

[0725] 17. The barley plant or part thereof, according to any one of the preceding items, with the proviso that the plant does not contain SEQ ID NO: 5.

[0726] 18. The barley plant or part thereof according to any one of the preceding items, wherein one or more agronomical properties of the barley plant are similar or superior as compared to the agronomical properties of a reference barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype, wherein said agronomical properties for example are flowering time, plant height, thousand grain weight (TGW), average grain size, content of starch in the grains, content of protein in the grains, content of water in the grains and plant yield of the barley plant. The barley plant or part thereof according to any one of the preceding items, wherein the high a-amylase activity in an endosperm half-grain lacking the embryo is at least 5 ll / g, preferably at least 10 ll / g, such as at least 15 ll / g, such as at least 20 llg, such as at least 25 ll / g, such as at least 30 ll / g, such as at least 35 ll / g, such as at least 40 ll / g, such as at least 45 ll / g, such as at least 50 ll / g on a dry weight basis. The barley plant of part thereof according to any one of the preceding items, wherein the high a-amylase activity in an endosperm half-grain lacking the embryo is at least 30 ll / g on a dry weight basis. The barley plant or part thereof according to any one of the preceding items, wherein a-amylase activity in the endosperm half-grains lacking the embryo of said barley plant is increased by at least 2-fold, such as by at least 3-fold, such as by at least 4-fold, such as by at least 5-fold, such as by at least 6-fold, such as by at least 7-fold, such as by at least 8-fold, such as by at least 9-fold, such as by at least 10-fold, such as by at least 20-fold, such as by at least 30-fold, such as by at least 50-fold, such as by at least 100-fold, such as by at least 1000-fold, such as by at least 10,000-fold as compared to a reference barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype. The barley plant or part thereof according to any one of the preceding items, wherein a-amylase activity in the endosperm half-grains lacking the embryo of said barley plant is increased by between 2-fold and 10,000-fold, such as by between 5-fold and 100-fold, such as by between 20-fold and 100-fold, such as by between 3-fold and 50-fold, such as by between 5-fold and 25-fold, such as by between 10-fold and 75-fold, such as by between 30-fold and 60-fold, such as by between 300-fold to 500-fold as compared to a reference barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype. The barley plant or part thereof according to any one of the preceding items, wherein a-amylase activity in the whole grain is increased by at least 5%, such as by at least 10%, such as by at least 15%, such as by at least 20%, such as by at least 50%, such as by at least 100%, such as by at least 200% as compared to a reference barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype. The barley plant or part thereof according to any one of the preceding items, wherein a-amylase activity in the whole grain is increased by between 5% and 200%, such as by between 5% and 150%, such as by between 5% and 100%, such as by between 50% and 100% as compared to a reference barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype. The barley plant or part thereof, wherein a-amylase activity is measured after imbibition of the half-grain and whole grain in water for at least 24 h, such as at least 48 h, such as at least 72 h. The barley plant or part thereof according to any one of the preceding items, wherein the level, such as the amount, of mRNA transcribed from one or more genes encoding hydrolytic enzymes in the barley plant or part thereof is increased as compared to a reference barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype, wherein the level, such as the amount, of mRNA is measured in whole grains, wherein said grains have been germinated for at least 12 h, such as at least 24 h, such as at least 36 h, such as at least 48 h. The barley plant or part thereof according to any one of the preceding items, wherein the one or more hydrolytic enzyme is selected from the group consisting of a-amylase, p-amylase, limit dextrinase, pullulanase, p-glucanase, xylanase, glucoamylase and protease, preferably wherein the one or more hydrolytic enzyme is selected from the group consisting of a-amylase, p-glucanase and limit dextrinase. The barley plant or part thereof according to any one of the preceding items, wherein the level, such as the amount, of mRNA is increased by at least 5%, such as by at least 10%, such as by at least 15%, such as by at least 20%, such as by at least 30%, such as by at least 40% such as by at least 50%, such as by at least 60%, such as by at least 70%, such as by at least 80%, such as by at least 90%, such as by at least 100%, such as by at least 200% as compared to a reference barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype, wherein the level, such as the amount, of mRNA is measured in whole grains, wherein said grains have been germinated for at least 12 h, such as at least 24 h, such as at least 36 h, such as at least 48 h.

[0727] 29. The barley plant or part thereof according to any one of the preceding items, wherein the level, such as the amount, of mRNA is increased by between 5% and 200%, such as by between 10% and 150%, such as by between 25% and 100%, such as by between 15% and 80%, such as by between 50% and 150% as compared to a reference barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype, wherein the level, such as the amount, of mRNA is measured in whole grains, wherein said grains have been germinated for at least 12 h, such as at least 24 h, such as at least 36 h, such as at least 48 h.

[0728] 30. The barley plant or part thereof according to any one of the preceding items, wherein a malt prepared from kernels of said barley plant has a high a-amylase activity, such as for example an a-amylase activity of at least 200 ll / g, such as at least 210 ll / g, such as at least 220 ll / g, such as at least 230 ll / g, such as at least 240 ll / g, such as at least 250 ll / g.

[0729] 31 . The barley plant or part thereof according to any one of the preceding items, wherein a malt prepared from kernels of said barley plant has a high a-amylase activity, such as for example an a-amylase activity of between 200 ll / g and 280 ll / g, such as between 210 ll / g and 260 ll / g, such as between 220 ll / g and 240 U / g.

[0730] 32. The barley plant or part thereof according to any one of the preceding items, wherein a malt prepared from kernels of said barley plant has a high p-amylase activity, such as for example a p-amylase activity of at least 10 U / g, such as at least 11 U / g, such as at least 12 U / g, such as at least 13 U / g, such as at least 14 U / g, such as at least 15 U / g.

[0731] 33. The barley plant or part thereof according to any one of the preceding items, wherein a malt prepared from kernels of said barley plant has a high p-amylase activity, such as for example a p-amylase activity of between 10 U / g and 15 U / g, such as between 10 U / g and 14 U / g, such as between 10 U / g and 13 U / g. The barley plant or part thereof according to any one of the preceding items, wherein a malt prepared from kernels of said barley plant has a high limit dextrinase activity, such as for example a limit dextrinase activity of at least 45 ll / g, such as at least 50 ll / g, such as at least 55 ll / g, such as at least 60 ll / g, such as at least 65 ll / g. The barley plant or part thereof according to any one of the preceding items, wherein a malt prepared from kernels of said barley plant has a high limit dextrinase activity, such as for example a limit dextrinase activity of between 45 ll / g and 65 ll / g, such as between 45 ll / g and 55 ll / g, such as between 50 ll / g and 60 ll / g. The barley plant or part thereof according to any one of the preceding items, wherein wort prepared from kernels of said barley plant has a decreased content of p-glucan as compared to the content of p-glucan in wort prepared from kernels of a reference barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype. The barley plant or part thereof according to any one of the preceding items, wherein the content of p-glucan in wort prepared from kernels of said barley plant is decreased by at least 10%, such as by at least 20%, such as by at least 30% such as by at least 40%, such as by at least 50%, such as by at least 60%, such as by at least 70%, such as by at least 80% such as by at least 90%, such as by 100% as compared to the content of p-glucan in wort prepared from kernels of a reference barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype. The barley plant or part thereof according to any one of the preceding items, wherein the content of p-glucan in wort prepared from said barley plant or part thereof is decreased by between 10% and 100%, such as by between 10% and 50%, such as by between 50% and 75%, such as by between 25% and 100% as compared to the content of p-glucan in wort prepared from kernels of a reference barley plant not carrying a point mutation in the CXE2L1 gene but otherwise of similar genotype. 39. The barley plant or part thereof according to any one of the preceding items, wherein the p-glucan content of wort prepared from said barley plant or part thereof is at most 400 mg / L, such as at most 350 mg / L, such as at most 300 mg / L, such as at most 250 mg / L, such as at most 200 mg / L, such as at most 150 mg / L.

[0732] 40. The barley plant or part thereof according to any one of the preceding items, wherein the p-glucan content of wort prepared from said barley plant or part thereof is between 0 and 500 mg / L, such as between 0 and 250 mg / L, such as between 50 and 250 mg / L, such as between 100 and 200 mg / L, such as between 200 and 400 mg / L, such as between 50 and 200 mg / L.

[0733] 41. The barley plant or part thereof according to any one of the preceding items, wherein the reference barley plant of similar genotype is barley cultivar Quench or Planet.

[0734] 42. The barley plant or part thereof according to any one of the preceding items, wherein the p-glucan is (1,3;1 ,4)-p-glucan.

[0735] 43. The barley plant or part thereof according to any one of the preceding items, wherein the barley plant carries a mutation in the gene encoding CslF6.

[0736] 44. The barley plant or part thereof according to any one of the preceding items, wherein said barley plant have a (1,3;1 ,4)-p-glucan content: a. in the range of 1 to 5% dry weight of total kernels, for example 1 to 3% dry weight of total kernels, for example 1.3 to 3% dry weight of total kernels, preferably 1.3 to 2% dry weight of total kernels; and / or b. of at least 30% and at most 60%, preferably at least 40% and at most 60% of the (1 ,3; 1 ,4)-p-glucan content of a barley plant carrying a wildtype CslF6 gene, but otherwise of the same genotype.

[0737] 45. The barley plant or part thereof according to any one of the preceding items, wherein the gene encoding a p-glucan synthase is CslF6, wherein said mutated CslF6 gene encodes a mutant CslF6 polypeptide, wherein wild-type CslF6 is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8, or a functional variant thereof having at least 95% sequence identity thereto. 46. The barley plant or part thereof according to any one of the preceding items, wherein the mutation in the gene encoding CslF6 is a deletion.

[0738] 47. The barley plant or part thereof according to any one of the preceding items, wherein said mutated CslF6 gene encodes a loss of function mutant CslF6 polypeptide, wherein wild-type CslF6 is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8, or a functional variant thereof having at least 95% sequence identity thereto.

[0739] 48. The barley plant or part thereof according to any one of the preceding items, wherein the mutant CslF6 polypeptide comprises a substitution of one amino acid in a membrane localized domain of CslF6, wherein said substitution is a substitution of a non-polar amino acid to a charged amino acid or a substitution of a polar amino acid to a non-polar amino acid, wherein the membrane localised domain is selected from the group consisting of the membrane localised domains of CslF6 consisting of: a. amino acids 835 to 857 (SEQ ID NO: 9), or b. amino acids 700 to 731 (SEQ ID NO: 10), or c. amino acids 741 to 758 (SEQ ID NO: 11).

[0740] 49. The barley plant or part thereof according to any one of the preceding items, wherein the mutant CslF6 polypeptide comprises a substitution of one amino acid in a membrane localized domain of CslF6, wherein said mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of one amino acid in the transmembrane domain consisting of amino acids 835 to 857 (SEQ ID NO: 9) of CslF6, wherein said substitution is substitution of a non-polar amino acid to a charged amino acid.

[0741] 50. The barley plant or part thereof according to any one of the preceding items, wherein said mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of amino acid 847, wherein said substitution is substitution of a glycine (G) to a glutamic acid (E).

[0742] 51. The barley plant or part thereof according to any one of the preceding items, wherein said mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of one amino acid in the transmembrane domain consisting of amino acids 741 to 758 (SEQ ID NO: 10) of CslF6, wherein said substitution is substitution of a non-polar amino acid to a charged amino acid.

[0743] 52. The barley plant or part thereof according to any one of the preceding items, wherein said mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of amino acid 748, wherein said substitution is substitution of a glycine (G) to an aspartic acid (D).

[0744] 53. The barley plant or part thereof according to any one of the preceding items, wherein said mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of one amino acid in the transmembrane domain consisting of amino acids 700 to 731 of CslF6 (SEQ ID NO: 11), wherein said substitution is substitution of a polar amino acid to a nonpolar amino acid.

[0745] 54. The barley plant or part thereof according to any one of the preceding items, wherein said mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of amino acid 709, wherein said substitution is substitution of a threonine (T) to an isoleucine (I).

[0746] 55. The barley plant or part thereof according to any one of the preceding items, wherein the barley plant comprises a mutation in one or more additional genes, for example one or more of the following mutations: a. a mutation in the gene encoding LOX-1 resulting in a total loss of functional LOX-1 ; b. a mutation in the gene encoding LOX-2 resulting in a total loss of functional LOX-2; c. a mutation in the gene encoding MMT resulting in a total loss of functional MMT; d. a mutation in the gene encoding ANT-28, resulting in a total loss of functional ANT-28; e. a mutation in the gene encoding HRT, resulting in total loss of functional HRT; f. a mutation in the gene encoding LDI, resulting in a total loss of function of LDI.

[0747] 56. A barley plant or part thereof, wherein said barley plant carries: a. an amy1_1 cluster comprising at least 5 functional genes each encoding an a-amylase, wherein said a-amylase has an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 31-41 and respective functional homologs thereof with at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, such as at least 99% sequence identity thereto; and b. a mutation in one or more genes selected from the group consisting of CXE2L1, LOX-1, LOX-2, MMT, ANT-28, HRT, LDI and a gene encoding a p-glucan synthase, such as CslF6.

[0748] 57. The barley plant or part thereof according to item 56, wherein said mutation in CXE2L1 is as defined according to any one of items 1 to 42.

[0749] 58. The barley plant or part thereof according to any one of items 56 to 57, wherein said mutation in one or more genes selected from the group consisting of LOX-1, LOX-2, MMT, ANT-28, HRT, and LDI are as defined according to item 55.

[0750] 59. The barley plant or part thereof according to item 56, wherein said mutation in said gene encoding said p-glucan synthase is as defined according to any one of items 43 to 52.

[0751] 60. The barley plant or part thereof according to item 59, wherein said gene encoding said p-glucan synthase is CslF6.

[0752] 61. The barley plant or part thereof according to any one of items 56 to 60, wherein said barley plants carries a. an amy1_1 cluster comprising at least 5 functional genes each encoding an a-amylase, wherein said a-amylase has an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 37-47 and respective functional homologs thereof with at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, such as at least 99% sequence identity thereto; b. a mutation in the gene encoding LOX-1 resulting in a total loss of functional LOX-1 ; c. optionally, a mutation in the gene encoding LOX-2 resulting in a total loss of functional LOX-2; d. a mutation in the gene encoding MMT resulting in a total loss of functional MMT; and e. a mutation in CXE2L1 as defined in any one of items 1 to 42. The barley plant or part thereof according to any one of items 56 to 61, wherein said barley plants carries a. an amy1_1 cluster comprising at least 5 functional genes each encoding an a-amylase, wherein said a-amylase has an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 37-47 and respective functional homologs thereof with at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, such as at least 99% sequence identity thereto; b. a mutation in the gene encoding LOX-1 resulting in a total loss of functional LOX-1 ; c. optionally, a mutation in the gene encoding LOX-2 resulting in a total loss of functional LOX-2; d. a mutation in the gene encoding MMT resulting in a total loss of functional MMT; e. a mutation in the gene encoding ANT-28 resulting in a total loss of functional ANT-28; and f. a mutation in CXE2L1 as defined in any one of items 1 to 42. The barley plant or part thereof according to any one of items 56 to 62, wherein the amy1_1 cluster comprises at least 5 functional genes each encoding an a- amylase, wherein said a-amylase is independently selected from the group consisting of:

[0753] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 42 or a functional homolog thereof with at least 80% sequence identity thereto, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, or such as at least 99% sequence identity thereto;

[0754] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 43 or a functional homolog thereof with at least 80% sequence identity thereto, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, or such as at least 99% sequence identity thereto; and

[0755] • the a-amylase with the amino acid sequence as set forth in SEQ ID NO: 44 or a functional homolog thereof with at least 80% sequence identity thereto, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, or such as at least 99% sequence identity thereto.

[0756] 64. The barley plant or part thereof according to any one of items 56 to 63, wherein the a-amylase activity of said barley plant or part thereof is at least 230 ll / g, such as at least 240 ll / g, such as at least 250 ll / g, such as at least 260 ll / g, such as at least 270 ll / g, such as at least 280 ll / g, such as at least 290 ll / g, such as at least 300 ll / g, such as at least 310 ll / g, such as from 230 to 350 ll / g, such as from 250 to 320 ll / g after 6 days of germination.

[0757] 65. The barley plant or part thereof according to any one of items 56 to 64, wherein the p-amylase activity of said barley plant or part thereof is at least 15 ll / g, such as at least 16 ll / g, such as at least 17 ll / g, such as at least 18 ll / g, such as from 15 to 20 ll / g, such as from 15 to 18 ll / g after 6 days of germination.

[0758] 66. The barley plant or part thereof according to any one of items 56 to 65, wherein the free limit dextrinase activity of said barley plant or part thereof is at least 60 mll / g, such as at least 65 mll / g, such as at least 70 mll / g, such as at least 75 mll / g, such as at least 80 mll / g, such as from 60 to 90 mU / g, such as from 65 to 85 mU / g after 6 days of germination.

[0759] 67. The barley plant or part thereof according to any one of items 56 to 66, wherein the p-glucan content of said barley plant or part thereof is at the most 200 mg / L, such as at the most 150 mg / L, such as at the most 100 mg / L, such as at the most 75 mg / L, such as at the most 50 mg / L, such as at the most 25 mg / L, such as at the most 10 mg / L, such as from 0 to 200 mg / L, such as from 0 to 100 mg / L, such as from 0 to 50 mg / L after 6 days of germination. The barley plant or part thereof according to any one of the preceding items, wherein the plant part is a kernel, a grain, a cell and / or a plant part which is not a reproductive material. The barley plant or part thereof according to any one of the preceding items, wherein the plant or part thereof has not been obtained by means of an essentially biological process and / or wherein progeny of the plant or part thereof has not been obtained by means of an essentially biological process. A plant product comprising or prepared from the barley plant or part thereof according to any one of the preceding items. The plant product according to any one of the preceding items, wherein the plant product is a malt, such as for example a milled malt, a green malt and / or a milled green malt. The plant product according to any one of the preceding items, wherein the plant product is a beverage prepared from said barley plant or part thereof. The plant product according to any one of the preceding items, wherein plant product is an aqueous extract or a beverage prepared from kernels of said barley plant and / or from malt comprising processed kernel(s) of said barley plant. The plant product according to any one of the preceding item, wherein said beverage is beer. A method of preparing a barley plant or part thereof with a-amylase activity in the endosperm half-grain lacking the embryo, the method comprising the steps of: a. providing barley kernels; and b. randomly mutagenizing said barley kernels; and c. selecting barley kernels or progeny thereof carrying a mutated CXE2L1 gene; wherein said mutated CXE2L1 gene encodes a gain of function mutant CXE2L1 polypeptide, wherein wild-type CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto, with the proviso that the plant does not contain SEQ ID NO: 5. A method of preparing a barley plant or part thereof, the method comprising the steps of: a. providing barley kernels; and b. randomly mutagenizing said barley kernels, thereby introducing a mutation in the CXE2L1 gene; and c. selecting barley kernels or progeny thereof carrying a mutated CXE2L1 gene; wherein said mutated CXE2L1 gene encodes a gain of function mutant CXE2L1 polypeptide, wherein said mutant CXE2L1 is CXE2L1 of SEQ ID NO: X or a functional variant thereof having at least 95% sequence identity thereto, except that mutant CXE2L1 comprises a substitution at: i. amino acid 127, wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or ii. amino acid 113, wherein said substitution is a substitution of a serine (S) to a proline (P); with the proviso that the plant does not contain SEQ ID NO: 5. A method of preparing a barley plant or part thereof, the method comprising the steps of: a. providing barley kernels; and b. randomly mutagenizing said barley kernels, thereby introducing a mutation in the CXE2L1 gene; and c. selecting barley kernels or progeny thereof carrying a mutated CXE2L1 gene; wherein said mutated CXE2L1 gene encodes a gain of function mutant CXE2L1 polypeptide, wherein said mutant CXE2L1 is CXE2L1 of SEQ ID NO: X or a functional variant thereof having at least 95% sequence identity thereto, except that mutant CXE2L1 comprises a substitution at: i. amino acid 127, wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or ii. amino acid 113, wherein said substitution is a substitution of a serine (S) to a proline (P); and / or iii. amino acid 125 of SEQ ID NO: 1 , wherein said substitution is a substitution of proline (P) into serine (S); and / or iv. amino acid 126 of SEQ ID NO: 1, wherein said substitution is a substitution of alanine (A) into threonine (T); and / or v. amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or vi. amino acid 212 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or vii. amino acid 212 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into valine (V); with the proviso that the plant does not contain SEQ ID NO: 5.

[0760] 78. The method according to any one of the preceding items, wherein the mutation and / or substitution in CXE2L1 is as defined in any one of the preceding items.

[0761] 79. The method according to any one of the preceding items, wherein the method further comprises selecting barley kernel or progeny thereof carrying a mutated p- glucan synthase gene.

[0762] 80. The method according to any one of the preceding items, wherein said mutated p- glucan is CslF6, optionally wherein said mutated CslF6 gene encodes a loss of function mutant CslF6 polypeptide, wherein wild-type CslF6 is CslF6 of SEQ ID NO: 7, further optionally wherein the mutation in the gene encoding CslF6 is a deletion.

[0763] 81. A method of preparing kiln dried malt, said method comprising the steps of a. providing kernels of a barley plant according to any one of the preceding items; b. steeping said kernels; c. germinating the steeped kernels under predetermined conditions; d. drying said germinated kernels.

[0764] 82. The method according to any one of the preceding items, wherein the barley plant or part thereof is as defined in any one of the preceding items.

[0765] 83. A method of producing an aqueous extract, said method comprising the steps of: a. providing kernels of a barley plant according to any one of the preceding items; b. subjecting the barley kernels to a step of germination thereby obtaining germinated kernels; c. finely dividing said germinated kernels; d. optionally, drying said finely divided germinated kernels; e. preparing an aqueous extract of said (dried) finely divided germinated kernels, f. thereby producing an aqueous extract of the barley. The method according to any one of the preceding items, wherein the step c) is carried out while said germinated kernels have a water content of at least 20%, with the proviso that said barley kernels do not have a water content below 20% at any time between steps b) and c). The method according to any one of the preceding items, wherein step d) is not carried out. The method according to any one of the preceding items, wherein the step of germination is carried out for at the most 96 h, such as for at the most 72 h, such as for at the most 48 h. A method of producing a beverage, said method comprising the steps of: a. providing kernels of a barley plant according to any one of the preceding items and / or malt according to any one of the preceding items; b. preparing an aqueous extract of said kernels and / or said malt; c. processing said aqueous extract into a beverage. A method for producing a beverage, said method comprising the steps of: a. preparing an aqueous extract by the method according to any one of the preceding items; b. processing said extract into a beverage. The method according to any one of the preceding items, wherein the processing step comprises a step of fermentation with a microorganism, such as with a yeast. 90. The method according to any one of the preceding items, wherein the barley plant is as defined in any one of the preceding items.

[0766] 91. The method according to any one of the preceding items, wherein the kernels of the barley plant is as defined in any one of the preceding items.

[0767] 92. The method according to any one of the preceding items, wherein the malt is as defined in any one of the preceding items.

[0768] 93. The method according to any one of the preceding items, wherein the beverage is beer.

[0769] 94. The method according to any one of the preceding items, wherein the beverage is a light colored beer, for example selected from the group consisting of lager beer, pale ale and wheat beer.

[0770] 95. The method according to any one of the preceding items, wherein the beverage is a lager beer.

[0771] 96. The method according to any one of the preceding items, wherein the beer is a non-alcoholic beer.

[0772] Sequence overview

[0773] References

[0774] Anzalone, A.V., Randolph, P.B., Davis, J.R. et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149-157 (2019). https : / / do i . org / 10.1038 / s41586-019-1711-4

[0775] Edgar, R.C. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5, 113 (2004). https: / / doi.Org / 10.1186 / 1471-2105-5-113

[0776] Hekkelman, M.L., de Vries, I., Joosten, R.P. et al. AlphaFill: enriching AlphaFold models with ligands and cofactors. Nat Methods 20, 205-213 (2023). https: / / doi.org / 10.1038 / s41592-022-01685-y

[0777] Kandemir, N., Saygili, L, Sdnmezoglu, O.A. et al. Evaluation of barley semi-dwarf allele sdwl.d in a near isogenic line. Euphytica 218, 31 (2022). https: / / doi.org / 10.1007 / s10681-022-02983-4

[0778] Komor, A., Kim, Y., Packer, M. et al. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533, 420-424 (2016). https: / / d0i.0rg / l 0.1038 / nature17946

[0779] Knudsen, S., Wendt, T., Dockter, C., Thomsen, H. C., Rasmussen, M., Egevang Jorgensen, M., ... & Skadhauge, B. (2022). FIND-IT: Accelerated trait development for a green evolution. Science Advances, 8(34), eabq2266.

[0780] Jumper, J., Evans, R., Pritzel, A., Green, T., Figurnov, M., Ronneberger, O., Tunyasuvunakool, K., Bates, R., Zidek, A., Potapenko, A. and Bridgland, A., 2021. Highly accurate protein structure prediction with AlphaFold. Nature, 596(7873), pp.583-589.

[0781] Mascher, M., Gundlach, H., Himmelbach, A., Beier, S., Twardziok, S. O., Wicker, T., ... & Bayer, M. (2017). A chromosome conformation capture ordered sequence of the barley genome. Nature, 544(7651), 427-433. Mascher et al, Long-read sequence assembly: a technical evaluation in barley, The Plant Cell, Volume 33, Issue 6, June 2021, Pages 1888-

[0782] 1906, https: / / doi.Org / 10.1093 / plcell / koab077

[0783] Mirdita, M., Schutze, K., Moriwaki, Y., Heo, L., Ovchinnikov, S. and Steinegger, M., 2022. ColabFold: making protein folding accessible to all. Nature methods, 19(6), pp.679-682.

[0784] Nakata M, Fukamatsu Y, Miyashita T, Hakata M, Kimura R, Nakata Y, Kuroda M, Yamaguchi T and Yamakawa H (2017) High Temperature-Induced Expression of Rice alphaAmylases in Developing Endosperm Produces Chalky Grains. Front. Plant Sci. 8:2089. doi: 10.3389 / fpls.2017.02089

[0785] Olsen, F. L. 1987. Induction of microspore embryogenesis in cultured anthers of Hordeum vulgare.. The effect of ammonium nitrate, glutamine and asparagine as nitrogen sources - Carlsberg Research Communications 52: 393-404

[0786] Stockinger, E.J. The Breeding of Winter-Hardy Malting Barley. Plants 2021 , 10, 1415. https: / / doi.org / 10.3390 / plants10071415

Claims

Claims1. A barley plant or part thereof, wherein said barley plant has high a-amylase activity in an endosperm half-grain lacking the embryo, and wherein said barley plant carries a point mutation in the CXE2L1 gene, wherein said mutated CXE2L1 gene encodes a mutant CXE2L1 polypeptide, wherein wild-type CXE2L1 is a polypeptide of SEQ ID NO: 1 or a functional homologue thereof sharing at least 95% sequence identify thereto, preferably, wild-type CXE2L1 is a polypeptide of SEQ ID NO: 1.

2. The barley plant or part thereof according to claim 1 , wherein the mutant CXE2L1 polypeptide comprises a substitution of an amino acid selected from the group consisting of: a. the amino acid corresponding to S113 or A127 of SEQ ID NO: 1; or b. the amino acid corresponding to P125, A126 or A212 of SEQ ID NO: 1; or c. the amino acid corresponding to F13, L14, G83, G84, G85, L88, Q93, F96, H166, S167, A168, F201 , S219, L220, T221 , M224, L228, H300, G301, F302, I304, or R305 of SEQ ID NO: 1 ; or d. the amino acid corresponding to E11 , D12, G15, V16, V17, Q18, R27, E30, L33, T35, Y63, Y80, F81 , H82, Y86, C87, G89, S90, 191, A92, P94, N95, H97, S98, L99, C100, Y116, L118, S164, G165, G169, A170, N171, L172, A173, L198, S199, A200, F202, A203, G217, V218, T222, A223, A225, D226, Q227, W229, R230, M231 , S232, L233, A244, V265, P267, S269, D270, V271 , L272, F295, E298, Q299, P303, Q306, P307, S309, T311 , A312, or L315 of SEQ ID NO: 1; or e. the amino acid corresponding to V9, V10, L19, L20, S24, V25, V26, G28, D29, A31, V32, R34, N36, G37, L39, P40, V42, V45, Q46, W47, D49, Y52, L58, S59, V60, R61, A62, R64, P65, L78, V79, L101 , R102, A103, A104, A105, A109, V110, V111, L112, S113, V114, 0115, R117, A119, P120, E121 , H122, R123, L124, A127, 1128, D130, G131, F134, W151, F162, L163, H174, H175, V176, T177, V178, 1196, L197, G204, A205, R207, T208, T210, E211 , P214, P215, E216, P234, V235, A237, S238, M239, H241 , P242, L243, N245, P246, L263, V264', A266, L268, R273, D274, R275, V276, Y279, V293, Q294, E296, G297, F308, E310, S313, E314, L316, R317 ,V318, 1319, or R320 of SEQ ID NO: 1;f. the amino acid corresponding to Y86, Y116, R117, H122, R123, L124, P125, A126, 1128, D129, D130, G131 or L172 of SEQ ID NO: 1 ; g. the amino acid corresponding to S59, V60, R61 , Y63, Y80, 191, C100, V111, L112, V114 or Q115 of SEQ ID NO: 1; wherein wild-type CXE2L1 is CXE2L1 of SEQ ID NO: 1 or a functional variant thereof having at least 95% sequence identity thereto.

3. The barley plant of part thereof according to any one of the preceding claims, wherein the substitution in CXE2L1 is a substitution of an alanine for a valine, a substitution of a proline for a serine, a substitution of an alanine for a threonine, or a substitution of a serine for a proline.

4. The barley plant or part thereof according to any one of the preceding claims, wherein the substitution in CXE2L1 is a substitution at: a. amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of an alanine (A) to a valine (V); and / or b. amino acid 113 of SEQ ID NO: 1 , wherein said substitution is a substitution of a serine (S) to a proline (P); and / or c. amino acid 125 of SEQ ID NO: 1 , wherein said substitution is a substitution of proline (P) into serine (S); and / or d. amino acid 126 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or e. amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); and / or f. amino acid 212 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into threonine (T); g. amino acid 212 of SEQ ID NO: 1 , wherein said substitution is a substitution of alanine (A) into valine (V).

5. The barley plant of part thereof according to any one of the preceding claims, wherein the substitution in CXE2L1 is a substitution of an alanine for a valine or a substitution of a serine for a proline, for example wherein said substitution comprises a substitution at: a. amino acid 127 of SEQ ID NO: 1 , wherein said substitution is a substitution of an alanine (A) to a valine (V); and / orb. amino acid 113 of SEQ ID NO: 1 , wherein said substitution is a substitution of a serine (S) to a proline (P).

6. The barley plant or part thereof according to any one of the preceding claims, wherein said mutated CXE2L1 gene encodes gain of function mutant CXE2L1 polypeptide.

7. The barley plant or part thereof according to any one of the preceding claims, wherein the kernels of said barley plant have a reduced p-glucan content.

8. The barley plant or part thereof according to any one of the preceding items, wherein the p-glucan content of wort prepared from said barley plant or part thereof is at most 300 mg / L, such as at most 250 mg / L, such as at most 200 mg / L, such as at most 150 mg / L.

9. The barley plant or part thereof according to any one of the preceding claims, wherein said barley plant carries a mutation in a gene encoding a p-glucan synthase.

10. The barley plant or part thereof according to claim 8, wherein the gene encoding a P-glucan synthase is CslF6, wherein said mutated CslF6 gene encodes a mutant CslF6 polypeptide, wherein wild-type CslF6 is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8, or a functional variant thereof having at least 95% sequence identity thereto, optionally wherein said mutant CslF6 polypeptide is CslF6 of SEQ ID NO: 7 or SEQ ID NO: 8 except that mutant CslF6 comprises a substitution of: a. amino acid 847, wherein said substitution is substitution of a glycine (G) to a glutamic acid (E); and / or b. amino acid 748, wherein said substitution is substitution of a glycine (G) to an aspartic acid (D); and / or c. a substitution of amino acid 709, wherein said substitution is substitution of a threonine (T) to an isoleucine (I).

11. The barley plant or part according to claim 8, wherein the gene encoding a p- glucan synthase is CslF6, wherein said mutated CslF6 gene encodes a loss of function mutant CslF6 polypeptide, wherein wild-type CslF6 is CslF6 of SEQ IDNO: 7 or SEQ ID NO: 8, or a functional variant thereof having at least 95% sequence identity thereto.

12. The barley plant or part thereof according to any one of the preceding claims, with the proviso that the plant does not contain SEQ ID NO: 5.

13. The barley plant or part thereof according to any one of the preceding claims, wherein high a-amylase activity in an endosperm half-grain lacking the embryo is at least 5 ll / g, preferably at least 10 ll / g on a dry weight basis.

14. The barley plant or part thereof according to any one of the preceding claims, wherein a-amylase activity is measured after imbibition of the half-grain and whole grain in water for at least 24 h, such as at least 48 h, such as at least 72 h.

15. The barley plant or part thereof according to any one of the preceding claims, wherein said barley plant comprises an amy1_1 cluster comprising at least 5 functional genes each encoding an a-amylase, wherein said a-amylase has an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 37-47, or respective functional homologs thereof with at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 98%, such as at least 99% sequence identity thereto.

16. The barley plant or part thereof according to any one of the preceding claims, wherein the barley plant comprises a mutation in one or more additional genes, for example one or more of the following mutations: a. a mutation in the gene encoding LOX-1 resulting in a total loss of functional LOX-1 ; b. a mutation in the gene encoding LOX-2 resulting in a total loss of functional LOX-2; c. a mutation in the gene encoding MMT resulting in a total loss of functional MMT; d. a mutation in the gene encoding ANT-28, resulting in a total loss of functional ANT-28; e. a mutation in the gene encoding HRT, resulting in total loss of functional HRT;f. a mutation in the gene encoding LDI, resulting in a total loss of function of LDI.

17. A plant product comprising the barley plant or part thereof according to any one of the preceding claims.

18. The plant product according to claim 17, wherein the plant product is a malt, such as for example a milled malt, a green malt and / or a milled green malt.

19. A method of producing an aqueous extract, said method comprising the steps of: a. providing kernels of a barley plant according to any one of claims 1 to 16; b. subjecting the barley kernels to a step of germination thereby obtaining germinated kernels; c. finely dividing said germinated kernels; d. optionally, drying said finely divided germinated kernels; e. preparing an aqueous extract of said (dried) finely divided germinated kernels, f. thereby producing an aqueous extract of the barley.

20. A method of producing a beverage, said method comprising the steps of: a. providing kernels of a barley plant according to any one of claims 1 to 16 and / or malt according to claim 18; b. preparing an aqueous extract of said kernels and / or said malt; c. processing said aqueous extract into a beverage, such as a beer.

21. The method according to claim 20, wherein the processing step comprises a step of fermentation with a microorganism, such as with a yeast.

22. The method according to any one of claims 20 to 21 , wherein the aqueous extract is prepared according to claim 19.