Genetically modified porcine cell, genetically modified pig and methods of producing same

Abstract

The present invention relates to a genetically modified porcine cell, a genetically modified porcine organ and a genetically modified pig comprising a genomic insertion of a CD46 expression sequence. The present invention also relates to methods for producing such genetically modified porcine cell, genetically modified porcine organ and genetically modified pig.

Description

[0001] Genetically modified porcine cell, genetically modified pig and methods of producing same

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to the field of genetic engineering, in particular to genetic engineering and genome editing of porcine cells and pigs. Such genetically modified porcine cells and pigs may be used for xenotransplantation such as pig-to-human xenotransplantation.

[0004] BACKGROUND

[0005] Major progress in genetic engineering and genome editing of livestock species has extended their use to biomedical applications, the most notable being: tailored large animal models for translational medicine; porcine cells, tissues and organs for xenotransplantation; and production of pharmaceutical proteins in transgenic large animals.

[0006] The translation of novel discoveries from basic research to clinical application is a long, often inefficient and costly process. Appropriate animal models are critical for the success of translational research. Although rodent models are widely used, they often do not accurately represent the human disease. Thus, additional animal models that more closely mimic aspects of human anatomy and physiology are required. Several genetically engineered pig models have been generated, many of which represent human disease mechanisms and phenotypes more closely than existing rodent models.

[0007] In addition, pigs are the most promising donor species for xenotransplantation into humans. Although organ replacement is still the treatment of choice in terminally ill patients, the need for organs by far surpasses their supply. In particular, the number of potentially life-saving donated human hearts is far fewer than the population who could benefit from a new heart, resulting in increasing numbers of patients awaiting replacement of their failing heart, high waitlist mortality, and frequent reliance on interim mechanical support.

[0008] Xenotransplantation represents an alternative to allogeneic organ donations. In particular, cardiac xenotransplantation from genetically multi-modified (GM) organ-source pigs is an emerging new option as demonstrated by the consistent long-term success of heterotopic (non-life-supporting) abdominal and life-supporting orthotopic porcine heart transplantation in baboons, and by a recent 'compassionate use' transplant of the heart from a GM pig with 10 modifications into a terminally ill patient who survived for two months (reviewed in Reichart et al., 2023).

[0009] However, multiple genetic modifications are required to prevent immune rejection, overcome physiological incompatibilities of xeno-organs, and to eliminate potential risk factors such as porcine endogenous retroviruses (PERV). For example, human membrane cofactor protein (CD46) controls complement activation and when expressed sufficiently as a transgene protects xenografts against complement-mediated rejection (see Loveland et al., 2004). Thus, also xenotransplantation relies on progress in the field of genome editing.

[0010] In summary, genetically engineered large animals are playing an increasingly important role in biomedicine. For all areas of application, generating such large animals with consistent and reliable transgene expression is critical.

[0011] SUMMARY OF THE INVENTION

[0012] The present invention meets the above-described needs and solves the above-mentioned problems in the art by providing the embodiments described below.

[0013] The present inventors surprisingly found that expressing CD46 under at least part of its native promoter provides for consistent and reliable transgene expression in porcine cells. Such genetically modified porcine cells can be used for generating genetically modified pigs by somatic cell nuclear transfer (SCNT). The present inventors have further found that performing such SCNT using a non-clonal population of genetically modified cells increases the success rate and decreases the time that is needed to generate genetically modified pigs. The resulting genetically modified pigs may be used for xenotransplantation.

[0014] Accordingly, the present invention is characterized inter alia by the following preferred items:

[0015] 1. A porcine cell comprising the following genetic modification (a):

[0016] (a) a genomic insertion of a polynucleotide (i) comprising a CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, wherein the promoter element consists of at least a part of the native CD46 promoter and / or achieves a CD46 expression level between 0.1-fold and 10-fold of the CD46 expression level that is achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 1.

[0017] 2. The porcine cell according to item 1, wherein the promoter element consists of a nucleotide sequence that is at least 50% identical to the nucleotide sequence shown in SEQ ID NO: 1.

[0018] 3. The porcine cell according to item 1 or 2, wherein the promoter element consists of a nucleotide sequence that is at least 70% identical to the nucleotide sequence shown in SEQ ID NO: 1. The porcine cell according to any one of items 1 to 3, wherein the promoter element consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 1. The porcine cell according to any one of items 1 to 4, wherein the promoter element consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 1. The porcine cell according to any one of items 1 to 5, wherein the promoter element consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 1. The porcine cell according to any one of items 1 to 6, wherein the promoter element consists of a nucleotide sequence that is at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 1. The porcine cell according to any one of items 1 to 7 , wherein the promoter element consists of the nucleotide sequence shown in SEQ ID NO: 1. The porcine cell according to any one of items 1 to 8, wherein the promoter element is located upstream of the CD46 expression sequence. The porcine cell according to any one of items 1 to 9, wherein the promoter element is located within the nucleotide sequence from -5000 bp to -1 bp before the ATG start codon of the CD46 expression sequence. The porcine cell according to any one of items 1 to 10, wherein the promoter element is located within the nucleotide sequence from -2000 bp to -1 bp before the ATG start codon of the CD46 expression sequence. The porcine cell according to any one of items 1 to 11, wherein the promoter element is located within the nucleotide sequence from -1000 bp to -1 bp before the ATG start codon of the CD46 expression sequence. The porcine cell according to any one of items 1 to 12, wherein the promoter element consists of the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence. The porcine cell according to any one of items 1 to 13, wherein the promoter element achieves a CD46 expression level between 0.5-fold and 2-fold of the CD46 expression level that is achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 1. The porcine cell according to any one of items 1 to 14, wherein the promoter element achieves a CD46 expression level between 0.8-fold and 1.2-fold of the CD46 expression level that is achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 1. The porcine cell according to any one of items 1 to 15, wherein the promoter element achieves about the same CD46 expression level as the CD46 expression level that is achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 1. The porcine cell according to any one of items 1 to 16, wherein the CD46 is human CD46 and the CD46 promoter is the human CD46 promoter. The porcine cell according to any one of items 1 to 17, wherein the CD46 expression sequence is part of a CD46 minigene. The porcine cell according to any one of items 1 to 18, wherein the nucleotide sequence of the CD46 expression sequence is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 2. The porcine cell according to any one of items 1 to 19, wherein the nucleotide sequence of the CD46 expression sequence is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 2. The porcine cell according to any one of items 1 to 20, wherein the nucleotide sequence of the CD46 expression sequence is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 2. The porcine cell according to any one of items 1 to 21, wherein the nucleotide sequence of the CD46 expression sequence is at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 2. The porcine cell according to any one of items 1 to 22, wherein the nucleotide sequence of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 2. The porcine cell according to any one of items 1 to 23, wherein the polynucleotide (i) further comprises a polyadenylation signal. The porcine cell according to item 24, wherein the polyadenylation signal is a Simian Virus 40 (SV40) polyadenylation signal. The porcine cell according to item 24 or 25, wherein the polyadenylation signal consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 3. The porcine cell according to any one of items 24 to 26, wherein the polyadenylation signal consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 3. The porcine cell according to any one of items 24 to 27, wherein the polyadenylation signal consists of the nucleotide sequence shown in SEQ ID NO: 3. The porcine cell according to any one of items 24 to 28, wherein the polyadenylation signal is located downstream of the promoter element and the CD46 expression sequence. The porcine cell according to any one of items 1 to 29, wherein the polynucleotide (i) further comprises a ubiquitous chromatin opening element (UCOE). The porcine cell according to item 30, wherein the UCOE consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 4. The porcine cell according to item 30 or 31, wherein the UCOE consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 4. The porcine cell according to any one of items 30 to 32, wherein the UCOE consists of the nucleotide sequence shown in SEQ ID NO: 4. The porcine cell according to any one of items 30 to 33, wherein the UCOE is located downstream of the promoter element, the CD46 expression sequence and the polyadenylation signal. The porcine cell according to any one of items 1 to 34, wherein the polynucleotide (i) further comprises a CAG promoter. The porcine cell according to item 35, wherein the CAG promoter does not control the expression of the CD46 expression sequence. The porcine cell according to item 35 or 36, wherein the CAG promoter consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 5. The porcine cell according to any one of items 35 to 37, wherein the CAG promoter consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 5. The porcine cell according to any one of items 35 to 38, wherein the CAG promoter consists of the nucleotide sequence shown in SEQ ID NO: 5. The porcine cell according to any one of items 35 to 39, wherein the CAG promoter is located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal and the UCOE. The porcine cell according to any one of items 1 to 40, wherein the polynucleotide (i) further comprises a first chimeric intron (Chiml). The porcine cell according to item 41, wherein the first Chiml consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 6. The porcine cell according to item 41 or 42, wherein the first Chiml consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 6. The porcine cell according to any one of items 41 to 43, wherein the first Chiml consists of the nucleotide sequence shown in SEQ ID NO: 6. The porcine cell according to any one of items 41 to 44, wherein the first Chiml is located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal, the UCOE and the CAG promoter. The porcine cell according to any one of items 1 to 45, wherein the polynucleotide (i) further comprises a part of a human thrombomodulin (hTBM) cDNA. The porcine cell according to item 46, wherein the part of the hTBM cDNA consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 7. The porcine cell according to item 46 or 47, wherein the part of the hTBM cDNA consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 7. The porcine cell according to any one of items 46 to 48, wherein the part of the hTBM cDNA consists of the nucleotide sequence shown in SEQ ID NO: 7. The porcine cell according to any one of items 46 to 49, wherein the part of the hTBM cDNA is located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal, the UCOE, the CAG promoter and the first Chiml. The porcine cell according to any one of items 1 to 50, wherein the polynucleotide (i) further comprises a second chimeric intron (Chiml). The porcine cell according to item 51, wherein the second Chiml consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 8. The porcine cell according to item 51 or 52, wherein the second Chiml consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 8. The porcine cell according to any one of items 51 to 53, wherein the second Chiml consists of the nucleotide sequence shown in SEQ ID NO: 8. The porcine cell according to any one of items 51 to 54, wherein the second Chiml is located upstream of the CD46 expression sequence and the promoter element. The porcine cell according to any one of items 1 to 55, wherein the polynucleotide (i) further comprises a part of an inverted ubiquitous chromatin opening element (UCOE). The porcine cell according to item 56, wherein the part of the inverted UCOE consists of a nucleotide sequence that is at least 95% to the nucleotide sequence shown in SEQ ID NO: 9. The porcine cell according to item 56 or 57, wherein the part of the inverted UCOE consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 9. The porcine cell according to any one of items 56 to 58, wherein the part of the inverted UCOE consists of the nucleotide sequence shown in SEQ ID NO: 9. The porcine cell according to any one of items 56 to 59, wherein the part of the inverted UCOE is located upstream of the CD46 expression sequence, the promoter element and the second Chiml. The porcine cell according to any one of items 1 to 60, wherein the polynucleotide (i) further comprises an inverted CAG promoter. The porcine cell according to item 61, wherein the inverted CAG promoter does not control the expression of the CD46 expression sequence. The porcine cell according to item 61 or 62, wherein the inverted CAG promoter consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 10. The porcine cell according to any one of items 61 to 63, wherein the inverted CAG promoter consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 10. The porcine cell according to any one of items 61 to 64, wherein the inverted CAG promoter consists of the nucleotide sequence shown in SEQ ID NO: 10. The porcine cell according to any one of items 61 to 65, wherein the inverted CAG promoter is located upstream of the CD46 expression sequence, the promoter element, the second Chiml and the part of the inverted UCOE. The porcine cell according to any one of items 1 to 66, wherein the polynucleotide (i) further comprises an inverted chimeric intron (Chiml). The porcine cell according to item 67, wherein the inverted Chiml consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 11. The porcine cell according to item 67 or 68, wherein the inverted Chiml consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 11. The porcine cell according to any one of items 67 to 69, wherein the inverted Chiml consists of the nucleotide sequence shown in SEQ ID NO: 11. The porcine cell according to any one of items 67 to 70, wherein the inverted Chiml is located upstream of the CD46 expression sequence, the promoter element, the second Chiml, the part of the inverted UCOE and the inverted CAG promoter. The porcine cell according to any one of items 1 to 71, wherein the polynucleotide (i) further comprises an inverted native human CD46 promoter. The porcine cell according to item 72, wherein the inverted native human CD46 promoter does not control the expression of the CD46 expression sequence. The porcine cell according to item 72 or 73, wherein the inverted native human CD46 promoter consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 12. The porcine cell according to any one of items 72 to 74, wherein the inverted native human CD46 promoter consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 12. The porcine cell according to any one of items 72 to 75, wherein the inverted native human CD46 promoter consists of the nucleotide sequence shown in SEQ ID NO: 12. The porcine cell according to any one of items 72 to 76, wherein the inverted native human CD46 promoter is located upstream of the CD46 expression sequence, the promoter element, the second Chiml, the part of the inverted UCOE, the inverted CAG promoter and the inverted Chiml. The porcine cell according to any one of items 1 to 77, wherein the polynucleotide (i) further comprises a part of an inverted CD46 minigene. The porcine cell according to item 78, wherein the part of the inverted CD46 minigene consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 13. The porcine cell according to item 78 or 79, wherein the part of the inverted CD46 minigene consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 13. The porcine cell according to any one of items 78 to 80, wherein the part of the inverted CD46 minigene consists of the nucleotide sequence shown in SEQ ID NO: 13. The porcine cell according to any one of items 78 to 81, wherein the part of the inverted CD46 minigene is located upstream of the CD46 expression sequence, the promoter element, the second Chiml, the part of the inverted UCOE, the inverted CAG promoter, the inverted Chiml and the inverted native human CD46 promoter. The porcine cell according to any one of items 1 to 82, wherein the polynucleotide (i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 14. The porcine cell according to any one of items 1 to 83, wherein the polynucleotide (i) consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 14. The porcine cell according to any one of items 1 to 84, wherein the polynucleotide (i) consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO:

[0019] 14. The porcine cell according to any one of items 1 to 85, wherein the polynucleotide (i) consists of the nucleotide sequence shown in SEQ ID NO: 14. The porcine cell according to any one of items 1 to 86, wherein the polynucleotide (i) is inserted into the endogenous GGTA1 gene. The porcine cell according to any one of items 1 to 87, wherein the polynucleotide (i) is inserted into an exon of the endogenous GGTA1 gene, preferably into exon 8 of the endogenous GGTA1 gene. The porcine cell according to item 87 or 88, wherein the insertion of the polynucleotide (i) leads to a disruption of the endogenous GGTA1 gene. The porcine cell according to any one of items 1 to 89, wherein the polynucleotide (i) is inserted into one or both alleles of the endogenous GGTA1 gene. The porcine cell according to any one of items 1 to 90, wherein the porcine cell comprises a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO:

[0020] 15. The porcine cell according to any one of items 1 to 91, wherein porcine cell comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 15. The porcine cell according to any one of items 1 to 92, wherein porcine cell comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 15. The porcine cell according to any one of items 1 to 93, wherein the porcine cell comprises the nucleotide sequence shown in SEQ ID NO: 15. The porcine cell according to any one of items 1 to 94, further comprising the following genetic modification (b):

[0021] (b) a genomic insertion of a polynucleotide (ii) comprising a thrombomodulin (TBM) expression sequence and a promoter element that controls the expression of the TBM expression sequence. The porcine cell according to item 95, wherein the polynucleotide (ii) is located upstream or downstream of the polynucleotide (i). The porcine cell according to item 95 or 96, wherein the TBM is human TBM. The porcine cell according to any one of items 95 to 97, wherein the TBM expression sequence is a TBM cDNA. The porcine cell according to any one of items 95 to 98, wherein the TBM expression sequence consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 16. The porcine cell according to any one of items 95 to 99, wherein the TBM expression sequence consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 16. The porcine cell according to any one of items 95 to 100, wherein the TBM expression sequence consists of the nucleotide sequence shown in SEQ ID NO: 16. The porcine cell according to any one of items 95 to 101, wherein the promoter element that controls the expression of the TBM expression sequence achieves a TBM expression level between 0.1-fold and 10-fold of the TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 5 or 17. The porcine cell according to any one of items 95 to 102, wherein the promoter element that controls the expression of the TBM expression sequence achieves a TBM expression level between 0.5-fold and 2-fold of the TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 5 or 17. The porcine cell according to any one of items 95 to 103, wherein the promoter element that controls the expression of the TBM expression sequence achieves a TBM expression level between 0.8-fold and 1.2-fold of the TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 5 or 17. The porcine cell according to any one of items 95 to 104, wherein the promoter element that controls the expression of the TBM expression sequence achieves about the same TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 5 or 17. The porcine cell according to any one of items 95 to 105, wherein the promoter element that controls the expression of the TBM expression sequence is a CAG promoter, or an EF1A promoter with a CMV enhancer. The porcine cell according to any one of items 95 to 106, wherein the promoter element that controls the expression of the TBM expression sequence consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 17. The porcine cell according to any one of items 95 to 107, wherein the promoter element that controls the expression of the TBM expression sequence consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 17. The porcine cell according to any one of items 95 to 108, wherein the promoter element that controls the expression of the TBM expression sequence consists of the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 17. The porcine cell according to any one of items 95 to 109, wherein the promoter element that controls the expression of the TBM expression sequence is located upstream of the TBM expression sequence. The porcine cell according to any one of items 95 to 110, wherein the polynucleotide (ii) further comprises a chimeric intron (Chiml). The porcine cell according to item 111, wherein the Chiml consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 18. The porcine cell according to item 111 or 112, wherein the Chiml consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 18. The porcine cell according to any one of items 111 to 113, wherein the Chiml consists of the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 18. The porcine cell according to any one of items 111 to 114, wherein the Chiml is located between the TBM expression sequence and the promoter element that controls the expression of the TBM expression sequence. The porcine cell according to any one of items 95 to 101, wherein the promoter element that controls the expression of the TBM expression sequence achieves a TBM expression level between 0.1-fold and 10-fold of the TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 48 or 50, preferably between 0.5-fold and 2-fold of the TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 48 or 50, most preferably between 0.8-fold and 1.2- fold of the TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 48 or 50. The porcine cell according to any one of items 95 to 101 and 116, wherein the promoter element that controls the expression of the TBM expression sequence achieves about the same TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 48 or 50. The porcine cell according to any one of items 95 to 101, 116 and 117, wherein the promoter element that controls the expression of the TBM expression sequence is a under the control of a non- ubiquitous promotor; preferably wherein the promoter element that controls the expression of the TBM expression sequence is a under the control of a tissue specific promotor; most preferably wherein the promoter element that controls the expression of the TBM expression sequence is a under the control of an endothelial-specific promotor. The porcine cell according to any one of items 95 to 101 and 116 to 118, wherein the promoter element that controls the expression of the TBM expression sequence is an ICAM2 promoter, or an endothelial-specific porcine TBM promoter. The porcine cell according to any one of items 95 to 101 and 116 to 119, wherein the promoter element that controls the expression of the TBM expression sequence consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 48 or SEQ ID NO: 50; preferably wherein the promoter element that controls the expression of the TBM expression sequence consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 48 or SEQ ID NO: 50. The porcine cell according to any one of items 95 to 101 and 116 to 120, wherein the promoter element that controls the expression of the TBM expression sequence consists of the nucleotide sequence shown in SEQ ID NO: 48 or SEQ ID NO: 50. The porcine cell according to any one of items 95 to 101 and 116 to 121, wherein the promoter element that controls the expression of the TBM expression sequence is located upstream of the TBM expression sequence. The porcine cell according to any one of items 95 to 101 and 116 to 122, wherein the polynucleotide (ii) comprising an ICAM2 promotor further comprises an intron, preferably wherein the intron is the complete or partial first intron of the ICAM2 gene, most preferably wherein the intron is the complete or partial first intron of the porcine ICAM2 gene. The porcine cell according to item 123, wherein the first intron of the ICAM2 gene consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 47, preferably wherein the first intron of the ICAM2 gene consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 47, most preferably wherein the first intron of the ICAM2 gene consists of the nucleotide sequence shown in SEQ ID NO: 47. The porcine cell according to any one of items 123 or 124, wherein the first intron of the ICAM2 gene is located upstream of the ICAM2 promotor element and the TBM expression sequence. The porcine cell according to any one of items 95 to 125, wherein the polynucleotide (ii) further comprises a polyadenylation signal. The porcine cell according to item 126, wherein the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal or a Simian Virus 40 (SV40) polyadenylation signal. The porcine cell according to item 126 or 127, wherein the polyadenylation signal consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 19 or SEQ ID NO: 20. The porcine cell according to any one of items 126 to 128, wherein the polyadenylation signal consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 19 or SEQ ID NO: 20. The porcine cell according to any one of items 126 to 129, wherein the polyadenylation signal consists of the nucleotide sequence shown in SEQ ID NO: 19 or SEQ ID NO: 20. The porcine cell according to any one of items 126 to 130, wherein the polyadenylation signal is located downstream of the promoter element and the TBM expression sequence. The porcine cell according to any one of items 95 to 131, wherein the polynucleotide (ii) further comprises a ubiquitous chromatin opening element (UCOE). The porcine cell according to item 132, wherein the UCOE consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 21. The porcine cell according to item 132 or 133, wherein the UCOE consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 21. The porcine cell according to any one of items 132 to 134, wherein the UCOE consists of the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 21. The porcine cell according to any one of items 132 to 135, wherein the UCOE is located upstream of the TBM expression sequence and the promoter element that controls the expression of the TBM expression sequence. The porcine cell according to any one of items 95 to 136, wherein the polynucleotide (ii) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 22, SEQ ID NO: 23, SED ID NO: 46 or SED ID NO: 49. The porcine cell according to any one of items 95 to 137, wherein the polynucleotide (ii) consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 22, SEQ ID NO: 23, SED ID NO: 46 or SED ID NO: 49. The porcine cell according to any one of items 95 to 138, wherein the polynucleotide (ii) consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 22, SEQ ID NO: 23, SED ID NO: 46 or SED ID NO: 49. The porcine cell according to any one of items 95 to 139, wherein the polynucleotide (ii) consists of the nucleotide sequence shown in SEQ ID NO: 22, SEQ ID NO: 23, SED ID NO: 46 or SED ID NO: 49. The porcine cell according to any one of items 95 to 140, wherein the polynucleotide (ii) is inserted into the endogenous GGTA1 gene. The porcine cell according to any one of items 95 to 141, wherein the polynucleotide (ii) is inserted into an exon of the endogenous GGTA1 gene, preferably into exon 6 of the endogenous GGTA1 gene. The porcine cell according to any one of items 95 to 142, wherein the insertion of the polynucleotide (ii) leads to a disruption of the endogenous GGTA1 gene. The porcine cell according to any one of items 95 to 143, wherein the polynucleotide (ii) is inserted into one or both alleles of the endogenous GGTA1 gene. The porcine cell according to any one of items 95 to 144, wherein the polynucleotide (i) and the polynucleotide (ii) are inserted into different loci. The porcine cell according to item 145, wherein the different loci are at least 2000 bp apart. The porcine cell according to item 145 or 146, wherein the different loci are at least 5000 bp apart. The porcine cell according to any one of items 145 to 147, wherein the different loci are at least 10000 bp apart. The porcine cell according to any one of items 95 to 148, wherein the polynucleotide (i) and the polynucleotide (ii) are inserted into different loci of the endogenous GGTA1 gene. The porcine cell according to any one of items 95 to 149, wherein the polynucleotide (i) and the polynucleotide (ii) are inserted into different exons of the endogenous GGTA1 gene. The porcine cell according to any one of items 95 to 150, wherein the polynucleotide (i) is inserted into exon 8 of the endogenous GGTA1 gene and the polynucleotide (ii) is inserted into exon 6 of the endogenous GGTA1 gene. The porcine cell according to item 151, wherein the porcine cell comprises a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 24 or SEQ ID NO: 25. The porcine cell according to item 151 or 152, wherein porcine cell comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 24 or SEQ ID NO: 25. The porcine cell according to any one of items 151 to 153, wherein porcine cell comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 24 or SEQ ID NO: 25. The porcine cell according to any one of items 151 to 154, wherein the porcine cell comprises the nucleotide sequence shown in SEQ ID NO: 24 or SEQ ID NO: 25. The porcine cell according to any one of items 95 to 144, wherein the polynucleotide (i) and the polynucleotide (ii) are located on a single polynucleotide. The porcine cell according to item 156, wherein the single polynucleotide further comprises a ubiquitous chromatin opening element (UCOE) that is located between the polynucleotide (i) and the polynucleotide (ii). The porcine cell according to item 157, wherein the UCOE consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 4. The porcine cell according to item 157 or 158, wherein the UCOE consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 4. The porcine cell according to any one of items 157 to 159, wherein the UCOE consists of the nucleotide sequence shown in SEQ ID NO: 4. The porcine cell according to any one of items 156 to 160, wherein the porcine cell comprises a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 26. The porcine cell according to any one of items 156 to 161, wherein the porcine cell comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 26. The porcine cell according to any one of items 156 to 162, wherein the porcine cell comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 26. The porcine cell according to any one of items 156 to 163, wherein the porcine cell comprises the nucleotide sequence shown in SEQ ID NO: 26. The porcine cell according to any one of items 1 to 164, further comprising the following genetic modification (c):

[0022] (c) a disruption of the endogenous alpha-1, 3-galactosyltransferase (GGTA1) gene. The porcine cell according to item 165, wherein the disruption of the endogenous GGTA1 gene is a biallelic disruption. The porcine cell according to any one of items 1 to 166, further comprising the following genetic modification (d): (d) a disruption of the endogenous cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) gene. The porcine cell according to item 167, wherein the disruption of the endogenous CMAH gene is a monoallelic or a biallelic disruption. The porcine cell according to any one of items 1 to 168, further comprising the following genetic modification (e):

[0023] (e) a disruption of the endogenous R-l,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2) gene and a disruption of the endogenous B4GALNT2-like (B4GALNT2L) gene. The porcine cell according to item 169, wherein the disruption of the endogenous B4GALNT2 gene and the disruption of the endogenous B4GALNT2L gene are monoallelic or biallelic disruptions. The porcine cell according to any one of items 1 to 170, further comprising the following genetic modification (f):

[0024] (f) a genomic insertion of a polynucleotide (iii) comprising a human beta-2-microglobulin / human leukocyte antigen G1 (hB2M / HLA-Gl) expression sequence and a promoter element that controls the expression of the B2M / HLA-G1 expression sequence. The porcine cell according to item 171, wherein the polynucleotide (iii) is located upstream or downstream of the polynucleotide (ii). The porcine cell according to any one of items 171 to 172, wherein the hB2M / HLA-Gl expression sequence is a hB2M / HLA-Gl cDNA. The porcine cell according to any one of items 171 to 173, wherein the hB2M / HLA-Gl expression sequence consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 56. The porcine cell according to any one of items 171 to 174, wherein the hB2M / HLA-Gl expression sequence consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 56. The porcine cell according to any one of items 171 to 175, wherein the hB2M / HLA-Gl expression sequence consists of the nucleotide sequence shown in SEQ ID NO: 56. The porcine cell according to any one of items 171 to 176, wherein the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence achieves a hB2M / HLA-Gl expression level between O.l-fold and 10-fold of the hB2M / HLA-Gl expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 5. The porcine cell according to any one of items 171 to 177 , wherein the promoter element that controls the expression of the TBM expression sequence achieves a TBM expression level between 0.5-fold and 2-fold of the hB2M / HLA-Gl expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 5. The porcine cell according to any one of items 171 to 178, wherein the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence achieves a hB2M / HLA-Gl expression level between 0.8-fold and 1.2-fold of the TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 5. The porcine cell according to any one of items 171 to 179, wherein the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence achieves about the same hB2M / HLA-Gl expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 5. The porcine cell according to any one of items 171 to 180, wherein the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence is a CAG promoter. The porcine cell according to any one of items 171 to 181, wherein the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 5. The porcine cell according to any one of items 171 to 182, wherein the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 5. The porcine cell according to any one of items 171 to 183, wherein the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence consists of the nucleotide sequence shown in SEQ ID NO: 5. The porcine cell according to any one of items 171 to 184, wherein the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence is located upstream of the hB2M / HLA-Gl expression sequence. The porcine cell according to any one of items 171 to 185, wherein the polynucleotide (iii) further comprises a chimeric intron (Chiml). The porcine cell according to item 186, wherein the Chiml consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 6. The porcine cell according to item 186 or 187, wherein the Chiml consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 6. The porcine cell according to any one of items 186 or 188, wherein the Chiml consists of the nucleotide sequence shown in SEQ ID NO: 6. The porcine cell according to any one of items 186 to 189, wherein the is located upstream of the hB2M / HLA-Gl expression sequence, preferably wherein the Chiml is located between the hB2M / HLA-Gl expression sequence and the promoter element that controls the expression of the TBM expression sequence. The porcine cell according to any one of items 171 to 190, wherein the polynucleotide (iii) further comprises a polyadenylation signal. The porcine cell according to item 191 wherein the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal. The porcine cell according to item 191 or 192, wherein the polyadenylation signal consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO:19. The porcine cell according to any one of items 191 to 193, wherein the polyadenylation signal consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 19. The porcine cell according to any one of items 191 to 194, wherein the polyadenylation signal consists of the nucleotide sequence shown in SEQ ID NO: 19. The porcine cell according to any one of items 191 to 195, wherein the polyadenylation signal is located downstream of the promoter element and the hB2M / HLA-Gl expression sequence. The porcine cell according to any one of items 171 to 196, wherein the polynucleotide (iii) further comprises a ubiquitous chromatin opening element (UCOE). The porcine cell according to item 197, wherein the UCOE consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 21. The porcine cell according to any one of items 197 to 198, wherein the UCOE consists of the nucleotide sequence shown in SEQ ID NO: 21. The porcine cell according to any one of items 197 to 199, wherein the UCOE is located upstream of the hB2M / HLA-Gl expression sequence and the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence. The porcine cell according to any one of items 171 to 200, wherein the polynucleotide (iii) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 51. The porcine cell according to any one of items 171 to 201, wherein the polynucleotide (iii) consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 51. The porcine cell according to any one of items 171 to 202, wherein the polynucleotide (iii) consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 51. The porcine cell according to any one of items 171 to 203, wherein the polynucleotide (iii) consists of the nucleotide sequence shown in SEQ ID NO: 51. The porcine cell according to any one of items 171 to 204, wherein the polynucleotide (iii) is inserted into the endogenous GGTA1 gene. The porcine cell according to any one of items 171 to 205, wherein the polynucleotide (iii) is inserted into an exon of the endogenous GGTA1 gene, preferably into exon 6 of the endogenous GGTA1 gene. The porcine cell according to any one of items 171 to 206, wherein the insertion of the polynucleotide (iii) leads to a disruption of the endogenous GGTA1 gene. The porcine cell according to any one of items 171 to 207, wherein the polynucleotide (iii) is inserted into one or both alleles of the endogenous GGTA1 gene. The porcine cell according to any one of items 171 to 208, wherein the polynucleotide (ii) and the polynucleotide (iii) are inserted into the same loci. The porcine cell according to any one of items 171 to 209, wherein the polynucleotide (i) is inserted into exon 8 of the endogenous GGTA1 gene and the polynucleotide (ii) and polynucleotide (iii) are inserted into exon 6 of the endogenous GGTA1 gene. The porcine cell according to any one of items 1 to 210, wherein the porcine cell is a primary cell. The porcine cell according to any one of items 1 to 211, wherein the porcine cells is a porcine kidney cell or a porcine heart cell. The porcine cell according to any one of items 1 to 212, wherein the porcine cell is derived from an Auckland Island pig. The porcine cell according to any one of items 1 to 213, wherein the porcine cell is an isolated porcine cell. A composition comprising the porcine cell according to any one of items 1 to 214 and cell culture medium. A porcine organ comprising the genetic modification(s) according to any one of items 1 to 210. A porcine organ comprising the porcine cell according to any one of items 1 to 213. The porcine organ according to item 216 or 217, wherein the porcine organ is a porcine heart. The porcine organ according to item 216 or 217, wherein the porcine organ is a porcine kidney. The porcine organ according to any one of items 216 to 219, wherein the porcine organ is derived from an Auckland Island pig comprising the genetic modification(s) according to any one of items 1 to 210. The porcine organ according to any one of items 216 to 220, wherein the porcine organ is an isolated porcine organ. A pig comprising the genetic modification(s) according to any one of items 1 to 210. A pig comprising the porcine cell according to any one of items 1 to 213 or the porcine organ according to any one of items 216 to 220. The pig according to item 222 or 223, wherein the pig is an Auckland Island pig. The porcine cell according to any one of items 1 to 214, the composition according to item 215, the porcine organ according to any one of items 216 to 221, or the pig according to any one of items 222 to 224, wherein the porcine cell, the composition, the porcine organ or the pig, respectively, is specific-pathogen-free (SPF). The porcine cell according to any one of items 1 to 214 and 225, the composition according to item 215 or 225, the porcine organ according to any one of items 216 to 221 and 225, or the pig according to any one of items 222 to 225, wherein the porcine cell, the composition, the porcine organ or the pig, respectively, is for xenotransplantation. The porcine cell according to any one of items 1 to 214, 225 and 226, the composition according to any one of items 215, 225 and 226, the porcine organ according to any one of items 216 to 221, 225 and 226, or the pig according to any one of items 222 to 226 for use in a method of xenotransplantation. Use of the porcine cell according to any one of items 1 to 214, 225 and 226, the composition according to any one of items 215, 225 and 226, the porcine organ according to any one of items 216 to 221, 225 and 226, or the pig according to any one of items 222 to 226 for xenotransplantation. A method of xenotransplantation comprising transplanting the porcine cell according to any one of items 1 to 214, 225 and 226, or the porcine organ according to any one of items 216 to 221, 225 and 226. The porcine cell, the composition, the porcine organ or the pig according to item 226 or 227 , the use according to item 228, or the method according to item 229, wherein the xenotransplantation is a pig-to-baboon xenotransplantation. The porcine cell, the composition, the porcine organ or the pig according to item 226 or 227 , the use according to item 228, or the method according to item 229, wherein the xenotransplantation is a pig-to-human xenotransplantation. A method for producing a porcine cell according to any one of items 1 to 214, 225, 226, 230 and 231, wherein the method comprises: inserting the polynucleotide (i) into the genome of a porcine cell. The method according to item 232, wherein the method further comprises inserting the polynucleotide (ii) into the genome of the porcine cell. The method according to item 232 or 233, wherein the method further comprises disrupting at least one allele of the endogenous GGTA1 gene of the porcine cell. The method according to item 234, wherein the disrupting comprises disrupting both alleles of the endogenous GGTA1 gene of the porcine cell. The method according to any one of items 232 to 235, wherein the method further comprises disrupting the endogenous cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) gene of the porcine cell. The method according to item 236, wherein the disrupting comprises disrupting both alleles of the endogenous CMAH gene of the porcine cell. The method according to any one of items 232 to 237, wherein the method further comprises disrupting the endogenous R-l,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2) gene and disrupting the endogenous B4GALNT2-like (B4GALNT2L) gene of the porcine cell. The method according to item 238, wherein the disrupting comprises disrupting both alleles of the endogenous B4GALNT2 gene and the endogenous B4GALNT2L gene of the porcine cell. The method according to any one of items 232 to 239, wherein the inserting comprises CRISPR-Cas9- based homology-directed repair (HDR) and the disrupting comprises CRISPR-Cas9-based non- homologous end joining (NHEJ). A method for producing a population of genetically modified porcine cells, wherein the genetically modified porcine cells are porcine cells according to any one of items 1 to 214, 225, 226, 230 and 231, and wherein the method comprises: exposing a population of porcine cells to genome-modifying treatment comprising inserting the polynucleotide (i) into the genomes of the porcine cells. The method according to item 241, wherein the method further comprises isolating a subpopulation of porcine cells that express CD46. The method according to item 241 or 242, wherein the genome-modifying treatment further comprises inserting the polynucleotide (ii) into the genomes of the porcine cells. The method according to item 243, wherein the method further comprises isolating a subpopulation of porcine cells that express thrombomodulin (TBM). The method according to any one of items 241 to 244, wherein the genome-modifying treatment further comprises disrupting at least one allele of the endogenous GGTA1 gene of the porcine cells. The method according to item 245, wherein the disrupting comprises disrupting both alleles of the endogenous GGTA1 gene of the porcine cells. The method according to any one of items 241 to 246, wherein the method further comprises isolating a subpopulation of porcine cells that do not express or express a reduced amount of alpha- 1,3-galactosyltransferase (GGTA1). The method according to any one of items 241 to 247, wherein the genome-modifying treatment further comprises disrupting the endogenous cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) gene of the porcine cells. The method according to item 248, wherein the disrupting comprises disrupting both alleles of the endogenous CMAH gene of the porcine cells. The method according to any one of items 241 to 249, wherein the method further comprises isolating a subpopulation of porcine cells that do not express or express a reduced amount of CMAH. The method according to any one of items 241 to 250, wherein the genome-modifying treatment further comprises disrupting the endogenous R-l,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2) gene and the endogenous B4GALNT2-like (B4GALNT2L) gene of the porcine cells. The method according to item 251, wherein the disrupting comprises disrupting both alleles of the endogenous B4GALNT2 gene and the endogenous B4GALNT2L gene of the porcine cells. The method according to any one of items 241 to 252, wherein the method further comprises isolating a subpopulation of porcine cells that do not express or express reduced amounts of B4GALNT2 and B4GALNT2L. The method according to any one of items 241 to 253, wherein the genome-modifying treatment comprises CRISPR-Cas9-based homology-directed repair (HDR) and / or CRISPR-Cas9-based non- homologous end joining (NHEJ). The method according to any one of items 232 to 254, wherein the method is an in vitro method. A method for producing a pig according to any one of items 222 to 227, 230 and 231. The method according to item 256, wherein the method comprises the method for producing a population of genetically modified porcine cells according to any one of items 241 to 255, and using the cell population to generate genetically modified pig embryos by somatic cell nuclear transfer (SCNT). A method for producing a genetically modified pig, wherein the method comprises in the following order: exposing a population of porcine cells to genome-modifying treatment, isolating a non-clonal subpopulation of porcine cells comprising the genomic modification, using the non-clonal subpopulation of genetically modified porcine cells for somatic cell nuclear transfer (SCNT). The method according to item 258, wherein the SCNT is performed no more than 40 days after exposing the population of porcine cells to the genome-modifying treatment. The method according to item 258 or 259, wherein the SCNT is performed no more than 30 days after exposing the population of porcine cells to the genome-modifying treatment. The method according to any one of items 258 to 260, wherein the SCNT is performed no more than 25 days after exposing the population of porcine cells to the genome-modifying treatment. The method according to any one of items 258 to 261, wherein the SCNT is performed no more than 20 days after exposing the population of porcine cells to the genome-modifying treatment. The method according to any one of items 258 to 262, wherein the non-clonal subpopulation of genetically modified porcine cells is passaged no more than 18 times before the SCNT. The method according to any one of items 258 to 263, wherein the non-clonal subpopulation of genetically modified porcine cells is passaged no more than 15 times before the SCNT. The method according to any one of items 258 to 264, wherein the non-clonal subpopulation of genetically modified porcine cells is passaged no more than 12 times before the SCNT. The method according to any one of items 258 to 265, wherein the genome-modifying treatment comprises CRISPR-Cas9-based homology-directed repair (HDR) and / or CRISPR-Cas9-based non- homologous end joining (NHEJ). The method according to any one of items 258 to 266, wherein the porcine cells are primary porcine cells. The method according to item 267, wherein the primary porcine cells are derived from a pig within three weeks after its birth. The method according to any one of items 258 to 268, wherein the porcine cells are porcine kidney cells or porcine heart cells. The method according to any one of items 258 to 269, wherein the porcine cells are porcine kidney cells. The method according to item 270, wherein the porcine kidney cells comprise porcine kidney epithelial cells and porcine kidney fibroblasts. The method according to any one of items 258 to 271, wherein the non-clonal subpopulation of genetically modified porcine cells that is used for SCNT predominantly comprises genetically modified porcine kidney fibroblasts. The method according to any one of items 258 to Til, wherein the non-clonal subpopulation of genetically modified porcine cells that is used for SCNT comprises at least 5 different clonal subpopulations. The method according to any one of items 258 to 273, wherein the non-clonal subpopulation of genetically modified porcine cells that is used for SCNT comprises at least 10 different clonal subpopulations. The method according to any one of items 258 to 274, wherein the non-clonal subpopulation of genetically modified porcine cells that is used for SCNT comprises at least 20 different clonal subpopulations. 7 . The method according to any one of items 258 to 275, wherein the method does not include a step of isolating a single-cell clone.

[0025] 277. The method according to any one of items 258 to 276, wherein the cell density of the (sub- )population of porcine cells does not decrease below 200 cells per ml, or not below 100 cells per ml, or not below 50 cells per ml.

[0026] 278. The method according to any one of items 258 to 277, wherein the cell density of the (sub- )population of porcine cells does not decrease below 100 cells per cm2culture surface area, or not below 50 cells per cm2culture surface area, or not below 20 cells per cm2culture surface area.

[0027] 279. The method according to any one of items 258 to 278, wherein the non-clonal subpopulation of genetically modified porcine cells that is used for SCNT comprises at least 1 x 106, or at least 5 x 106, or at least 1 x 107, or at least 5 x 107, or at least 1 x 108genetically modified porcine cells.

[0028] 280. The method according to any one of items 257 to 279, wherein the method further comprises transferring 100 to 150 genetically modified pig embryos into a recipient pig.

[0029] 281. The method according to any one of items 258 to 280, wherein the genetically modified pig is the pig according to any one of items 222 to 227 , 230 and 231.

[0030] 282. The method according to item 281, wherein the method comprises the method for producing a population of genetically modified porcine cells according to any one of items 241 to 255.

[0031] 283. The method according to item 281 or 282, wherein the method further comprises breeding a first pig comprising one or more of the genetic modification(s) according to any one of items 1 to 210 with a second pig comprising one or more of the genetic modification(s) according to any one of items 1 to 210.

[0032] 284. The method according to any one of items 281 to 283, wherein the method further comprises breeding a first pig comprising a porcine cell according to any one of items 1 to 213 with a second pig comprising a porcine cell according to any one of items 1 to 213.

[0033] BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1: Breeding scheme for the generation of genetically multi-modified organ source pigs. Figure 2A-B: A, A schematic diagram of the porcine GGTA1 gene. The porcine GGTA1 gene has 8 exons, and the exon 8 was targeted for the transgene integration. E = Exon; sgRNA = single guide RNA. B, A schematic diagram of Homology Arms (HAs) matching the 5' and 3' sequence on either sides of the GGTA1 E8 cut site.

[0035] Figure 3A-B: A, A schematic diagram of hCD46 expression cassette. CAG = CAG promoter; Chiml = chimeric intron; A2UCOE = ubiquitous chromatin opening element. B, A schematic diagram of hTBM expression cassette.

[0036] Figure 4A-B: A, Step 1 of generating the dual-cut donor plasmid. The hCD46 expression cassette was inserted between the 5' and 3' E8 HAs by restriction digestion and ligation method. B, The second step of generating the dual-cut donor plasmid. The hTBM expression cassette was inserted downstream of the hCD46 expression cassette by restriction digestion and ligation method. In this final dual-cut donor plasmid, the expression cassettes of the two transgenes are between the 5' and 3' E8 HAs.

[0037] Figure 5: Schematic diagram showing the development of a new genotype after transgene integration.

[0038] Figure 6: Workflow to generate single-cell clones for SCNT.

[0039] Figure 7A-B: A, Schematic diagram of the genotype of SCCs with biallelic integration of the transgenes cassette. B, Schematic diagram of the genotype of SCCs with monoallelic integration of the transgenes cassette.

[0040] Figure 8A-B: A, Exemplary SCCs used for SCNT. B, Outcomes.

[0041] Figure 9A-B: A, MACS sorting of cells for generating single-cell clones from male and female Auckland Island Kidney Cells. Cells which were Gal negative and CD46 positive were used for generating single-cell clones. B, Elongated conceptuses recovered from the recipients that received embryos generated by SCNT of SCCs.

[0042] Figure 10: Workflow to generate bulk cell samples for SCNT.

[0043] Figure 11 A-B: A, Super screening of cells for SCNT using bulk cells (Auckland Island Male Kidney Cells). B, Western blot analysis for immunodetection of the transgenes.

[0044] Figure 12: Litters from the SCNT using bulk cell samples.

[0045] Figure 13: Gal-IHC analysis on the tail samples of the piglets. All piglets were negative for Gal epitope. Figure 14: hCD46-IHC analysis on the tail samples of the piglet. All liveborn piglets had a strong hCD46 expression.

[0046] Figure 15: hTBM-IHC analysis on the tail samples of the piglets. None of the liveborn piglets had a hTBM expression.

[0047] Figure 16: The IGV alignment of the sequence of target region from each liveborn piglet against the reference sequence.

[0048] Figure 17: Sanger sequencing of the PCR product generated using the primers spanning the GGTA1 E8- sgRNA target site. The data shows that all liveborn animals had a similar mutation in the E8 of GGTA1 allele 2. (The depicted sequences are shown in SEQ ID NO: 38-45.)

[0049] Figure 18: Schematic diagram depicting the genotype of the 4 liveborn piglets.

[0050] Figure 19A-B: A, Total inserted sequence as in genetically modified piglet. B, Total inserted sequence as in genetically modified piglet, plus flanking genomic regions.

[0051] Figure 20: IHC analysis showing the expression of hCD46 in different tissues of one of the liveborn piglets.

[0052] Figure 21A-E: A, Expression cassette comprising hTBM under CAG promoter. B, Expression cassette comprising hTBM under EF1A promoter. C, Overview of integration of hTBM at GGTA1 Exon 6 locus. D, Super screening of cells with CAG-hTBM integration at GGTA1 Exon 6 locus. E, Super screening of cells with EFlA-hTBM integration at GGTA1 Exon 6 locus.

[0053] Figure 22A-B: A, Schematic diagram depicting the predicted genotype for the cells with hTBM under the CAG promoter. B, Schematic diagram depicting the predicted genotype for the cells with hTBM under the EF1A promoter.

[0054] Figure 23: Schematic diagram depicting the predicted genotype for the cells transfected with the new targeting vector.

[0055] Figure 24A-E: A, Expression cassette comprising hTBM under endothelial-specific ICAM2 promoter. B, Expression cassette comprising hTBM under endothelial-specific porcine TBM promoter. C, Screening of cells with integration of hTBM under porcine TBM promoter (left) or integration of hTBM under ICAM2 promoter (right) at GGTA1 Exon 6 locus. D, PCR of single-cell clones to confirm targeted integration of hTBM under ICAM2 promoter at GGTA1 Exon 6 Locus. The presence of the transgene was determined in a first PCR (left) using the FW Primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and the REV Primer: GATGTCCGTGCAGATGAAAC (SEQ ID NO: 58); SCCs 7, 16, 18, 21, 25, 27 , 29, 30, 36, 38 and 42 were selected for second round of PCRs. In the second round of PCRs (right), the target site was confirmed in two PCRs, the first one using the FW Primer: GTGGCCCTACAGTCCATTCT (SEQ ID NO: 59) and the REV Primer: GGTTTCCGACTGGGCGTC (SEQ ID NO: 60) and a second PCR using the FW Primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and the REV Primer: TCTCTTGAAGGGAGCTTGGT (SEQ ID NO: 62); SCCs 7 , 16, 27 and 38 were used for SCNT. E, PCR of single-cell clones to confirm targeted integration of hTBM under porcine TBM promoter at GGTA1 Exon 6 Locus. The presence of the transgene was determined in a first PCR (left) using the FW Primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and the REV Primer: GATGTCCGTGCAGATGAAAC (SEQ ID NO: 58); SCCs 11, 16, 25, 26, 35, 38, 41, 46 and 54 were selected for second round of PCRs. In the second round of PCRs (right), the target site was confirmed in two PCRs, the first one using the FW Primer: GTGGCCCTACAGTCCATTCT (SEQ ID NO: 59) and the REV Primer: GGTTTCCGACTGGGCGTC (SEQ ID NO: 60) and a second PCR using the FW Primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and the REV Primer: TCTCTTGAAGGGAGCTTGGT (SEQ ID NO: 62); SCC 25 was used for SCNT.

[0056] Figure 25A-C: A, Expression cassette comprising hB2M / HLA-Gl under CAG promoter. B, Expression cassette comprising hTBM under ICAM2 promoter and hB2M / HLA-Gl under CAG promoter. C, Expression cassette comprising hTBM under endogenous porcine TBM promoter and hB2M / HLA-Gl under CAG promoter.

[0057] Figure 26: Strategy for the development of TKO pigs. (The depicted sequences are shown in SEQ ID NO: 28-37.)

[0058] DETAILED DESCRIPTION OF THE INVENTION

[0059] Unless otherwise defined below, the terms used in the present invention shall be understood in accordance with their common meaning known to the person skilled in the art.

[0060] In the present invention, the terms "comprise" and "consist of" have the meaning known in the art. Optionally, on each occurrence the term "comprise(s)" as used in the invention can be replaced by the term "consist(s) of".

[0061] All publications, patents and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

[0062] Definitions

[0063] The term "expression sequence" as used herein refers to a nucleotide sequence that encodes a protein of interest and is suitable to be expressed in a mammalian system such as a porcine cell. For example, an expression sequence may be a cDNA and / or may be part of a minigene. Preferred proteins of interest in accordance with the present invention are CD46 and thrombomodulin (TBM). Thus, preferred expression sequences in accordance with the present invention are a CD46 expression sequence and a TBM expression sequence.

[0064] The term "promoter element" is used according to its general meaning known in the art. It refers to a nucleotide sequence that controls the expression of a corresponding coding sequence (CDS) encoding a protein of interest. In particular, a promoter element in accordance with the present invention controls the expression level of the protein of interest. The promoter element may control tissue-specific expression of the corresponding CDS. When reference is made herein to a "promoter element" in accordance with the present invention, this does not exclude the presence of further nucleotide sequences other than the promoter that may influence the expression of the corresponding CDS. Such further nucleotide sequences that may influence expression may comprise, for example, regulatory elements such as enhancers, silencers and / or insulators.

[0065] The term "identity" or "sequence identity" is used herein according to its general meaning known in the art. It indicates the similarity between two (or more) sequences, for example nucleotide or amino acid sequences. For determining the sequence identity, first the nucleotide or amino acid residues of two (or more) biological sequences are matched up to achieve maximal levels of identity. This is referred to as an alignment. Then, the extent to which the two (or more) nucleotide or amino acid sequences have the same residues at the same positions in the alignment is calculated. The result is usually expressed as a percentage. Accordingly, when reference is made in the present invention to a nucleotide sequence being, for example, "at least 50% identical" to another nucleotide sequence, this refers to 50% "identity" or "sequence identity" as described above. For determining the percentage "identity" or percentage "sequence identity" of two (or more) sequences, all residues (for example, all nucleotides) of the two (or more) sequences are taken into account, i.e., all residues are included in the alignment or at least included in the calculation of the percentage "identity" or percentage "sequence identity". Thus, for example, if a sequence A consists of 10 nucleotides and a sequence B consists of the same 10 nucleotides in the same order, but sequence B additionally contains 10 more nucleotides, the alignment will consist of 20 nucleotides in total and the sequences A and B will have 10 nucleotides at the same positions in the alignment. The percentage sequence identity between sequence A and sequence B will thus be 50%.

[0066] The term "xenogeneic" is used according to its general meaning known in the art. For example, a "xenogeneic transplantation" (also referred to herein as "xenotransplantation") is a transplantation wherein the graft is derived from a donor organism of a different species than the species of the recipient organism.

[0067] The term "overgrowth" as used herein generally refers to any increase in organ or tissue mass or volume that is detrimental for organ or tissue function, in particular due to exogenous factors (e.g. compression due to space limitation) or due to endogenous factors (e.g. hypoxia due to insufficient microvascular circulation). For example, when a heart or kidney is transplanted at a weight within a physiological range of the respective organ of the recipient organism, the term "overgrowth" may mean that the weight of the organ has increased to reach a weight that is 50% higher than the physiological weight. When a lung is transplanted at a volume within a physiological range of the lung of the recipient organism, the term "overgrowth" may mean that the volume of the lung has increased to reach a volume that is 50% larger than the physiological volume. A weight or volume within a physiological range as used herein means a weight or volume, respectively, that does not deviate by more than + / - 20%, preferably by not more than + / - 10% from the physiological weight or volume of the respective organ of the respective recipient organism. The physiological weight or volume of an organ can be determined by the skilled person for any given recipient based on common general knowledge. Exemplary physiological weights and volumes of organs are given in Konus et al. (1998) and Rao & Wagner (1972). In one embodiment of the present invention, the term "overgrowth" as used herein means that a transplanted organ (e.g., a heart) triples to quadruples in volume and weight within approximately one month after transplantation.

[0068] When reference is made herein to an organ or an animal "comprising genetic modification(s)", the cells of said organ or animal comprise a genome with the respective genetic modification(s).

[0069] The term "native promoter" as used herein refers to the promoter that naturally controls the expression of the respective gene in the respective organism. For example, the native human CD46 promoter is the promoter that controls the expression of human CD46 in the human genome.

[0070] When base pairs (bp) are numbered herein with reference to the ATG start codon of a reference sequence, the A of the ATG start codon is the +1 bp, the T of the ATG start codon is the +2 bp, the G of the ATG start codon is the +3 bp, and so forth. The nucleotide immediately preceding the A of the ATG start codon is the -1 bp, the nucleotide immediately preceding the -1 bp is the -2 bp, and so forth. There is no bp 0.

[0071] The terms "upstream" and "downstream" are used herein according to their general meanings known in the art. When used for specifying the relative location of two nucleotide sequences within a single polynucleotide, the term upstream refers to the 5' location and the term downstream to the 3' location. Thus, when a sequence A is located upstream of a sequence B, the sequence A is located 5' of the sequence B.

[0072] When a numerical range is given herein in the form of "from X to Y" wherein X and Y are integers, the range includes the integers X and Y. Thus, for example, "the nucleotide sequence from -826 bp to -1 bp before the ATG start codon" includes the -826 bp nucleotide as well as the -1 bp nucleotide, resulting in a nucleotide sequence of 826 bp in total. The terms "clone" and "clonal" are used herein according to their general meanings known in the art. Accordingly, a clonal (sub-)population of cells is a group of genetically identical cells that share a common ancestry, meaning that they are derived from the same cell.

[0073] The term "primary cell" is used herein according to its general meaning known in the art. A primary cell is a cell taken directly from living tissue (e.g., biopsy material) and established for growth in vitro. A primary cell has generally undergone only few cell divisions in vitro.

[0074] The term "endogenous" is used herein according to its general meaning known in the art. For example, an endogenous gene is a gene that is naturally present in the genome of the respective cell.

[0075] The term "ubiquitous promotor" is used herein according to its general meaning known in the art. Generally, ubiquitous promoters are promotors that are strongly active in a wide range of cells, tissues and cell cycles.

[0076] The term "specific-pathogen-free (SPF)" is used herein according to its general meaning known in the art. SPF generally means that, e.g., laboratory animals are guaranteed free of particular pathogens. Use of SPF laboratory animals ensures that specified diseases do not interfere with a particular application. The skilled person will be aware of the pathogens relevant for any specific application, e.g., for xenotransplantation.

[0077] The term "CAG promoter" is used herein according to its general meaning known in the art. The CAG promoter comprises the cytomegalovirus (CMV) early enhancer as well as part of the chicken beta-actin gene.

[0078] Embodiments

[0079] The following describes embodiments of the present invention. All of these embodiments can be combined with each other, unless indicated otherwise.

[0080] Genetically modified porcine cell

[0081] The present invention is based on surprising and unpredictable genetic rearrangements that took place when the present inventors generated Auckland Island (Al) pigs for pig-to-human xenotransplantation. Specifically, the present inventors transfected a transgene expression cassette comprising human CD46 (hCD46) and human thrombomodulin (hTBM) on a donor plasmid into kidney cells from Al pigs. On the expression cassette, both the human CD46 and the hTBM were under the control of CAG promoters. The expression cassette additionally comprised the native human CD46 promoter before the CD46 CDS. The expression cassette was designed to integrate into the endogenous alpha-1, 3-galactosyltransferase (GGTA1) gene by CRISPR-Cas9-based homology-directed repair (HDR). Following transfection, cells that were negative for GGTA1 and positive for hCD46 were selected and further propagated, but no single-cell clones were isolated. The resulting non-clonal population of cells was used for somatic cell nuclear transfer (SCNT). Using two recipient hybrid pigs, 100 to 150 embryos were transferred per recipient, resulting in four piglets that were born alive.

[0082] Strikingly, all liveborn piglets showed seemingly identical rearrangements in the expression cassette that had been transfected into the porcine cells. At the start of the expression cassette, a fragment of the donor plasmid comprising the CAG promoter had a reverse orientation. However, the chimeric intron, the native hCD46 promoter and the hCD46 sequence had the correct orientation. The last part of the transgene expression cassette (belonging to hTBM cDNA) was missing. The transgene expression cassette was inserted at the GGTA1 E8 locus, which was in accordance with the experimental design. All liveborn piglets comprised these genetic modifications (i.e., comprised the rearranged transgenes) and showed strong human CD46 expression. The analysis of one liveborn piglet showed that hCD46 was expressed in all tested tissues. None of the liveborn pigs showed GGTA1 or hTBM expression.

[0083] Without wishing to be bound by theory, the present inventors suggest that the strong expression of human CD46 in the liveborn piglets is being driven by the native human CD46 promoter. Promoters that are considerably stronger than the native CD46 promoter may be disadvantageous and contribute to cell death and early conceptus / fetal resorption during SCNT. Promoters that are considerably weaker than the native CD46 promoter may be unsuitable to provide for sufficient expression. According to the present invention, the expression level achieved by the native CD46 promoter is thus particularly advantageous for CD46 expression in pigs. This effect is exemplified by the CD46 expression level that is achieved by the rearranged expression cassette.

[0084] Based on the above, provided herein is a porcine cell comprising a genomic insertion of a polynucleotide (referred to herein as polynucleotide (i)), wherein the polynucleotide (i) comprises a CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, and wherein the promoter element consists of at least a part of the native CD46 promoter and / or achieves a CD46 expression level between 0.1-fold and 10-fold of the CD46 expression level that is achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 1. The nucleotide sequence shown in SEQ ID NO: 1 consists of the native hCD46 promoter that was identified in the genomes of the liveborn Al piglets and mediated high hCD46 expression. In preferred embodiments, the promoter element achieves a CD46 expression level between 0.2-fold and 5-fold, between 0.3-fold and 3-fold, between 0.5-fold and 2-fold, or between 0.8-fold and 1.2-fold of the CD46 expression level that is achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 1. Most preferably, the promoter element achieves about the same CD46 expression level that is achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 1.

[0085] As follows from the above, in a preferred embodiment of the present invention the promoter element that controls the expression of the CD46 expression sequence consists of at least a part of the native CD46 promoter and / or achieves a CD46 expression level between 0.1-fold and 10-fold of the CD46 expression level that is achieved by the porcine cells of the liveborn piglets of the invention. These liveborn piglets comprise the nucleotide sequence as shown in SEQ ID NO: 14 inserted into exon 8 of the endogenous GGTA1 gene. Accordingly, the liveborn piglets also comprise the nucleotide sequence as shown in SEQ ID NO: 15, which consists of the insert sequence of SEQ ID NO: 14 plus genomic sequences of exon 8 of GGTA1 that flank the 5' and 3' ends of the insert. It follows that, in a preferred embodiment of the present invention, the promoter element that controls the expression of the CD46 expression sequence consists of at least a part of the native CD46 promoter and / or achieves a CD46 expression level between 0.1-fold and 10-fold of the CD46 expression level that is achieved by porcine cells comprising the nucleotide sequence shown in SEQ ID NO: 15. In preferred embodiments, the promoter element achieves a CD46 expression level between 0.2-fold and 5-fold, between 0.3-fold and 3-fold, between 0.5-fold and 2-fold, or between 0.8-fold and 1.2-fold of the CD46 expression level that is achieved by porcine cells comprising the nucleotide sequence shown in SEQ ID NO: 15. Most preferably, the promoter element achieves about the same CD46 expression level that is achieved by porcine cells comprising the nucleotide sequence shown in SEQ ID NO: 15.

[0086] The skilled person is well aware of how to determine and compare CD46 expression levels that are achieved by different nucleotide sequences including different promoters. For example, the strengths of different promoters can be determined by determining the expression levels of reporter genes that are controlled by the nucleotide sequences / promoters to be analyzed. In such assays, the expression levels of the reporter genes correlate with the strengths of the tested promoters. The strengths determined for the different promoters are expected to achieve corresponding expression levels of CD46. Alternatively, when the expression of CD46 is controlled by different nucleotide sequences including different promoters, the expression levels that are achieved can be assayed by determining CD46 expression directly. CD46 expression can be determined, for example, by quantitative reverse transcription polymerase chain reaction (qRT-PCR), western blotting, immunohistochemistry, immunofluorescence, or other detection techniques well known to the skilled person. As will be clear to the skilled person, when comparing the relative CD46 expression level that is achieved by a certain nucleotide sequence / promoter to the relative CD46 expression level that is achieved by another nucleotide sequence / promoter, it is required to at least minimize or completely exclude the influence of other factors, such as other nucleotide sequences, on the comparison. Such other nucleotide sequences that could influence the comparison may be, for example, regulatory elements such as enhancers, silencers and / or insulators. The influence other factors can be minimized or excluded, e.g., by either excluding or including these factors in both of the nucleotide sequences / promoters that are compared. As noted above, provided herein is a porcine cell comprising a genomic insertion of a polynucleotide (i) comprising a CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, wherein the promoter element consists of at least a part of the native CD46 promoter and / or achieves a CD46 expression level between O.l-fold and 10-fold of the CD46 expression level that is achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 1. Preferably, the promoter element consists of a nucleotide sequence that is at least 50%, at least 70%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 1. Most preferably, the promoter element consists of the nucleotide sequence shown in SEQ ID NO: 1.

[0087] A definition of "identity" or "sequence identity" is given above. Such "identity" or "sequence identity", whenever referred to in the present invention, can be determined using known tools such as online tools. Exemplary tools for generating a sequence alignment and, based thereon, determining the "identity" or "sequence identity" are the BLAST® tool provided by the NIH National Library of Medicine (https: / / blast.ncbi.nlm.nih.gov / ) and the Clustal Omega tool provided by the EMBL-EBI (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ). In any case, for determining the "identity" or "sequence identity" of two (or more) nucleotide sequences, all nucleotides of the two (or more) sequences are taken into account. Thus, if a tool for generating a sequence alignment does not include all nucleotides in the alignment, all nucleotides must nevertheless be considered for calculating the percentage "identity" or "sequence identity".

[0088] In the polynucleotide (i) in accordance with the present invention, the promoter element that controls the expression of the CD46 expression sequence is preferably located upstream of the CD46 expression sequence, so that it can control the expression of the CD46 expression sequence. In preferred embodiments, the promoter element is located within the nucleotide sequence from -5000 bp to -1 bp before the ATG start codon of the CD46 expression sequence, or within the nucleotide sequence from - 2000 bp to -1 bp before the ATG start codon of the CD46 expression sequence, or within the nucleotide sequence from -1000 bp to -1 bp before the ATG start codon of the CD46 expression sequence. In a preferred embodiment, the promoter element consists of the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence.

[0089] The CD46 expression sequence in accordance with the present invention is preferably part of a CD46 minigene, such as the CD46 minigene comprised in the liveborn piglets of the invention. Further, the CD46 expression sequence in accordance with the present invention is preferably similar to the CD46 expression sequence comprised in the liveborn piglets of the present invention, which is shown in SEQ ID NO: 2. Thus, the nucleotide sequence of the CD46 expression sequence in accordance with the present invention is preferably at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 2, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 2, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 2, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 2. Most preferably, the nucleotide sequence of the CD46 expression sequence in accordance with the present invention is the nucleotide sequence shown in SEQ ID NO: 2.

[0090] In one embodiment, the polynucleotide (i) in accordance with the present invention further comprises a polyadenylation signal that mediates polyadenylation of the CD46 mRNA. The skilled person will be aware of various polyadenylation signals that are suitable for this purpose. However, in the liveborn piglets of the present invention, the polyadenylation signal was a Simian Virus 40 (SV40) polyadenylation signal consisting of the nucleotide sequence shown in SEQ ID NO: 3. Accordingly, in a preferred embodiment of the present invention, the polyadenylation signal of the polynucleotide (i) is a Simian Virus 40 (SV40) polyadenylation signal. Preferably, the polyadenylation signal consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 3, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 3, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 3, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 3. Most preferably, the polyadenylation signal consists of the nucleotide sequence shown in SEQ ID NO: 3. The polyadenylation signal is preferably located downstream of the promoter element and the CD46 expression sequence, so that it can mediate polyadenylation of the CD46 mRNA.

[0091] In one embodiment, the polynucleotide (i) in accordance with the present invention further comprises a ubiquitous chromatin opening element (UCOE). The skilled person will be aware of various suitable UCOEs. However, in the liveborn piglets of the present invention, the UCOE consisted of the nucleotide sequence shown in SEQ ID NO: 4. Accordingly, in a preferred embodiment of the present invention, the UCOE of the polynucleotide (i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 4, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 4, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 4, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 4. Most preferably, the UCOE consists of the nucleotide sequence shown in SEQ ID NO: 4. The UCOE may be located upstream or downstream of the promoter element, the CD46 expression sequence and the polyadenylation signal. However, in the liveborn piglets of the present invention, it was located downstream of the promoter element, the CD46 expression sequence and the polyadenylation signal. Therefore, in the polynucleotide (i) in accordance with the present invention, the UCOE is preferably located downstream of the promoter element, the CD46 expression sequence and the polyadenylation signal.

[0092] In the liveborn piglets of the present invention, a CAG promoter was located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal and the UCOE. Without wishing to be bound by theory, at this location the CAG promoter may not have controlled the expression of the CD46 expression sequence. Hence, in one embodiment, the polynucleotide (i) in accordance with the present invention further comprises a CAG promoter. The skilled person will be aware of suitable CAG promoters. However, in the liveborn piglets of the present invention, the CAG promoter consisted of the nucleotide sequence shown in SEQ ID NO: 5. Accordingly, in a preferred embodiment of the present invention, the CAG promoter of the polynucleotide (i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 5, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 5, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 5, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 5. Most preferably, the CAG promoter consists of the nucleotide sequence shown in SEQ ID NO: 5. In the polynucleotide (i) in accordance with the present invention, the CAG promoter is preferably located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal and the UCOE. The CAG promoter may not control the expression of the CD46 expression sequence.

[0093] A chimeric intron can be integrated to enhance gene expression, increase mRNA stability and facilitate transgene expression in gene therapy. The chimeric intron can be integrated downstream of the promoter (between the promoter and the ORF) or upstream of the promoter. It is thought that the chimeric intron functions equally well when it is upstream of the promoter. For example, Godwin et al., 2006 showed that a first intron of the ICAM2 gene integrated upstream of the ICAM2 promoter sequence significantly increased gene expression. Without wishing to be bound by theory, an intact chimeric intron (which originally belonged to the CAG promoter) could support strong and stable hCD46 expression in the modified pigs. Partial or inverted chimeric intron may also influence gene expression.

[0094] In the liveborn piglets of the present invention, a first chimeric intron (Chiml) was located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal, the UCOE and the CAG promoter. Without wishing to be bound by theory, at this location the first Chiml may have had an influence on the expression of the CD46 expression sequence, or may only have had a minor influence on the expression of the CD46 expression sequence, or no influence at all. Hence, in one embodiment, the polynucleotide (i) in accordance with the present invention further comprises a first Chiml. The skilled person will be aware of suitable Chimls. However, in the liveborn piglets of the present invention, the first Chiml consisted of the nucleotide sequence shown in SEQ ID NO: 6. Accordingly, in a preferred embodiment of the present invention, the first Chiml of the polynucleotide (i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 6, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 6, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 6, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 6. Most preferably, the first Chiml consists of the nucleotide sequence shown in SEQ ID NO: 6. In the polynucleotide (i) in accordance with the present invention, the first Chiml is preferably located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal, the UCOE, and the CAG promoter.

[0095] In the liveborn piglets of the present invention, a part of a human thrombomodulin (hTBM) cDNA was located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal, the UCOE, the CAG promoter and the first Chiml. Without wishing to be bound by theory, since no hTBM was detected in the liveborn piglets of the present invention, the part of the hTBM cDNA in the liveborn piglets may not have been expressed, presumably due to its truncation. Hence, in one embodiment, the polynucleotide (i) in accordance with the present invention further comprises a part of a hTBM cDNA. In the liveborn piglets of the present invention, the part of the hTBM cDNA consisted of the nucleotide sequence shown in SEQ ID NO: 7. Accordingly, in a preferred embodiment of the present invention, the part of the hTBM cDNA of the polynucleotide (i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 7, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 7, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 7, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 7. Most preferably, the part of the hTBM cDNA consists of the nucleotide sequence shown in SEQ ID NO: 7. In the polynucleotide (i) in accordance with the present invention, the part of the hTBM cDNA is preferably located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal, the UCOE, the CAG promoter and the first Chiml. It may not be expressed.

[0096] In the liveborn piglets of the present invention, a second chimeric intron (Chiml) was located upstream of the CD46 expression sequence and the promoter element. Hence, in one embodiment, the polynucleotide (i) in accordance with the present invention further comprises a second Chiml. The skilled person will be aware of suitable Chimls. However, in the liveborn piglets of the present invention, the second Chiml consisted of the nucleotide sequence shown in SEQ ID NO: 8. Accordingly, in a preferred embodiment of the present invention, the second Chiml of the polynucleotide (i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 8, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 8, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 8, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 8. Most preferably, the second Chiml consists of the nucleotide sequence shown in SEQ ID NO: 8. In the polynucleotide (i) in accordance with the present invention, the second Chiml is preferably located upstream of the CD46 expression sequence and the promoter element.

[0097] In the liveborn piglets of the present invention, a part of an inverted ubiquitous chromatin opening element (UCOE) was located upstream of the CD46 expression sequence, the promoter element and the second Chiml. Without wishing to be bound by theory, since the UCOE in the liveborn piglets was inverted and truncated, it may not have exerted its full chromatin opening function. Hence, in one embodiment, the polynucleotide (i) in accordance with the present invention further comprises a part of an inverted UCOE. In the liveborn piglets of the present invention, the part of the inverted UCOE consisted of the nucleotide sequence shown in SEQ ID NO: 9. Accordingly, in a preferred embodiment of the present invention, the part of the inverted UCOE of the polynucleotide (i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 9, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 9, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 9, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 9. Most preferably, the part of the inverted UCOE consists of the nucleotide sequence shown in SEQ ID NO: 9. In the polynucleotide (i) in accordance with the present invention, the part of the inverted UCOE is preferably located upstream of the CD46 expression sequence, the promoter element and the second Chiml.

[0098] In the liveborn piglets of the present invention, an inverted CAG promoter was located upstream of the CD46 expression sequence, the promoter element, the second Chiml and the part of the inverted UCOE. Without wishing to be bound by theory, being inverted this CAG promoter may not have controlled the expression of the CD46 expression sequence. Hence, in one embodiment, the polynucleotide (i) in accordance with the present invention further comprises an inverted CAG promoter. In the liveborn piglets of the present invention, the inverted CAG promoter consisted of the nucleotide sequence shown in SEQ ID NO: 10. Accordingly, in a preferred embodiment of the present invention, the inverted CAG promoter of the polynucleotide (i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 10, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 10, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 10, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 10. Most preferably, the inverted CAG promoter consists of the nucleotide sequence shown in SEQ ID NO: 10. In the polynucleotide (i) in accordance with the present invention, the inverted CAG promoter is preferably located upstream of the CD46 expression sequence, the promoter element, the second Chiml and the part of the inverted UCOE. The inverted CAG promoter may not control the expression of the CD46 expression sequence.

[0099] In the liveborn piglets of the present invention, an inverted chimeric intron (Chiml) was located upstream of the CD46 expression sequence, the promoter element, the second Chiml, the part of the inverted UCOE and the inverted CAG promoter. Without wishing to be bound by theory, at this location the inverted Chiml may only have had a minor influence on the expression of the CD46 expression sequence, or no influence at all. Hence, in one embodiment, the polynucleotide (i) in accordance with the present invention further comprises an inverted Chiml. In the liveborn piglets of the present invention, the inverted Chiml consisted of the nucleotide sequence shown in SEQ ID NO: 11. Accordingly, in a preferred embodiment of the present invention, the inverted Chiml of the polynucleotide (i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 11, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 11, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 11, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 11. Most preferably, the inverted Chiml consists of the nucleotide sequence shown in SEQ ID NO: 11. In the polynucleotide (i) in accordance with the present invention, the inverted Chiml is preferably located upstream of the CD46 expression sequence, the promoter element, the second Chiml, the part of the inverted UCOE and the inverted CAG promoter.

[0100] In the liveborn piglets of the present invention, an inverted native human CD46 promoter was located upstream of the CD46 expression sequence, the promoter element, the second Chiml, the part of the inverted UCOE, the inverted CAG promoter and the inverted Chiml. Without wishing to be bound by theory, being inverted and at this location the inverted native human CD46 promoter may not have controlled the expression of the CD46 expression sequence. Hence, in one embodiment, the polynucleotide (i) in accordance with the present invention further comprises an inverted native human CD46 promoter. In the liveborn piglets of the present invention, the inverted native human CD46 promoter consisted of the nucleotide sequence shown in SEQ ID NO: 12. Accordingly, in a preferred embodiment of the present invention, the inverted native human CD46 promoter of the polynucleotide (i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 12, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 12, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 12, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 12. Most preferably, the inverted native human CD46 promoter consists of the nucleotide sequence shown in SEQ ID NO: 12. In the polynucleotide (i) in accordance with the present invention, the inverted native human CD46 promoter is preferably located upstream of the CD46 expression sequence, the promoter element, the second Chiml, the part of the inverted UCOE, the inverted CAG promoter and the inverted Chiml. The inverted native human CD46 promoter may not control the expression of the CD46 expression sequence.

[0101] In the liveborn piglets of the present invention, a part of an inverted CD46 minigene was located upstream of the CD46 expression sequence, the promoter element, the second Chiml, the part of the inverted UCOE, the inverted CAG promoter, the inverted Chiml and the inverted native human CD46 promoter. Without wishing to be bound by theory, since this part of the CD46 minigene was truncated and inverted, it may not have been expressed in the liveborn piglets. Hence, in one embodiment, the polynucleotide (i) in accordance with the present invention further comprises a part of an inverted CD46 minigene. In the liveborn piglets of the present invention, the part of the inverted CD46 minigene consisted of the nucleotide sequence shown in SEQ ID NO: 13. Accordingly, in a preferred embodiment of the present invention, the part of the inverted CD46 minigene of the polynucleotide (i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 13, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 13, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 13, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 13. Most preferably, the part of the inverted CD46 minigene consists of the nucleotide sequence shown in SEQ ID NO: 13. In the polynucleotide (i) in accordance with the present invention, the part of the inverted CD46 minigene is preferably located upstream of the CD46 expression sequence, the promoter element, the second Chiml, the part of the inverted UCOE, the inverted CAG promoter, the inverted Chiml and the inverted native human CD46 promoter. It may not be expressed.

[0102] As is apparent from the above, not all components of the genomic insert comprised in the liveborn piglets of the present invention contribute to CD46 expression to the same extent, and some may not contribute at all. Therefore, in a preferred embodiment, the porcine cell of the invention comprises a genomic insertion of a polynucleotide (i), wherein the polynucleotide (i) comprises a human CD46 expression sequence and a promoter element that controls the expression of the human CD46 expression sequence, and wherein the promoter element consists of the nucleotide sequence shown in SEQ ID NO: 1. In this embodiment, the promoter element preferably consists of the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence. In another preferred embodiment, the porcine cell of the invention comprises a genomic insertion of a polynucleotide (i), wherein the polynucleotide (i) comprises a CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, wherein the promoter element consists of the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 2. In this embodiment, the promoter element preferably consists of the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence. In another preferred embodiment, the porcine cell of the invention comprises a genomic insertion of a polynucleotide (i), wherein the polynucleotide (i) comprises a CD46 expression sequence, a promoter element that controls the expression of the CD46 expression sequence and a chimeric intron (Chiml), wherein the promoter element consists of the nucleotide sequence shown in SEQ ID NO: 1, the nucleotide sequence of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 2 and the Chiml consists of the nucleotide sequence shown in SEQ ID NO: 8. In this embodiment, the promoter element preferably consists of the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence. In another preferred embodiment, the porcine cell of the invention comprises a genomic insertion of a polynucleotide (i), wherein the polynucleotide (i) comprises a CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, wherein the promoter element achieves about the same CD46 expression level that is achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 1. In another preferred embodiment, the porcine cell of the invention comprises a genomic insertion of a polynucleotide (i), wherein the polynucleotide (i) comprises a CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, wherein the promoter element achieves aboutthe same CD46 expression level that is achieved by porcine cells comprising the nucleotide sequence shown in SEQ ID NO: 15.

[0103] The nucleotide sequence of the entire rearranged expression cassette (also referred to herein as the entire "insert") that was comprised in the genomes of the liveborn piglets is shown in SEQ ID NO: 14. A schematic depiction of the nucleotide sequence of SEQ ID NO: 14 is shown in Figure 19A. The piglets comprising this nucleotide sequence survived and showed particularly good human CD46 expression. Accordingly, in one embodiment, the porcine cell in accordance with the present invention comprises a genomic insertion of a polynucleotide (i), wherein the polynucleotide (i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 14, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 14, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 14, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 14. Most preferably, the polynucleotide (i) consists of the nucleotide sequence shown in SEQ ID NO: 14. In the liveborn piglets, the entire insert shown in SEQ ID NO: 14 was integrated into exon 8 of the endogenous (N-acetyllactosaminide) alpha-1, 3-galactosyltransferase (GGTA1) gene. This site of insertion provided the further advantage of disrupting the porcine GGTA1 gene. The porcine GGTA1 gene encodes porcine GGTA1. GGTA1 synthesizes galactose-alphal,3-galactose (alphaGai). GGTA1 is defective in humans and old-world monkeys, and alphaGai is consequently absent. Immunogenic contact with bacterial alphaGai epitopes in the intestinal tract causes humans and old-world monkeys to raise anti- alphaGal antibodies in early life. Consequently, alphaGai is the major xeno-antigen triggering hyperacute xenograft rejection of pig organs by humans or non-human primates after xenotransplantation. Binding of the preformed antibodies against alphaGai triggers hyperacute rejection of the pig-to-primate xenografts. Subsequent activation of the complement system cannot be controlled due to species incompatibilities between the regulators on the xenograft and the recipient's effector molecules (reviewed in Kourtzelis et al., 2015). Therefore, disruption of the porcine GGTA1 gene, thereby abolishing GGTA1 expression, is advantageous for pig-to-primate xenografts.

[0104] Accordingly, in one embodiment, the polynucleotide (i) of the present invention is inserted into the endogenous GGTA1 gene of the porcine cells. Preferably, the polynucleotide (i) of the present invention is inserted into an exon of the endogenous GGTA1 gene of the porcine cells, more preferably into exon 8 of the endogenous GGTA1 gene of the porcine cells. Preferably, the insertion of the polynucleotide (i) of the present invention leads to a disruption of the endogenous GGTA1 gene, thereby abolishing the expression of porcine GGTA1.

[0105] When the polynucleotide (i) of the present invention is inserted into the genome of porcine cells, it is flanked by genomic sequences at the 5' and 3' ends of the insert. In the liveborn piglets of the present invention, the entire insert shown in SEQ ID NO: 14 was integrated into a specific site of exon 8 of the GGTA1 gene. In these piglets, the insert shown in SEQ ID NO: 14 was thus flanked by specific genomic sequences of exon 8 of the GGTA1 gene. The nucleotide sequence shown in SEQ ID NO: 15 consists of the insert sequence of SEQ ID NO: 14 plus the specific genomic sequences of exon 8 of GGTA1 that flanked the 5' and 3' ends of the insert in the liveborn piglets. A schematic depiction of the nucleotide sequence of SEQ ID NO: 15 is shown in Figure 19B. The piglets comprising this nucleotide sequence survived and showed particularly good human CD46 expression. Accordingly, in one embodiment, the porcine cell in accordance with the present invention comprises a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 15, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 15, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 15, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 15. Most preferably, the porcine cell in accordance with the present invention comprises the nucleotide sequence shown in SEQ ID NO: 15.

[0106] As will be known to the skilled person, cells have two alleles of most genes, located on two chromosomes. Accordingly, the polynucleotide (i) of the present invention may be inserted into one or both alleles of the endogenous GGTA1 gene. In the liveborn piglets of the present invention, the polynucleotide (i) was inserted only in one allele of the GGTA1 gene. Thus, in a preferred embodiment, the polynucleotide (i) of the present invention is inserted into one allele of the endogenous GGTA1 gene.

[0107] The porcine cell of the present invention may be used for xenotransplantation, e.g., to generate pigs that are suitable donors for xenotransplantation of porcine organs into humans. A facet of the pathobiology of pig organ xenotransplantation is coagulation pathway dysregulation (reviewed in Cowan & Robson, 2015, and Pierson et al., 2020). The contributing mechanisms include immune responses, which trigger inflammation, vascular injury, a procoagulant surface on the porcine endothelium, and molecular incompatibilities between porcine and human / NHP regulators of coagulation. While a systemic lifethreatening consumptive coagulopathy can be avoided by the measures used to prevent hyperacute xenograft rejection, pig hearts after heterotopic abdominal transplantation in baboons showed microvascular thrombosis, or thrombotic microangiopathy (TM), even though the recipients received anticoagulation therapy (see Mohiuddin et al., 2012, and Shimizu et al., 2008). TM could be avoided by transgenic expression of human thrombomodulin (hTBM) in the donor pigs (e.g., Mohiuddin et al., 2016, and Iwase et al., 2015), thereby overcoming the inability of porcine TBM in complex with human thrombin to promote the activation of human protein C in the anticoagulant pathway.

[0108] Accordingly, in one embodiment, the porcine cell in accordance with the present invention further comprises a genomic insertion of a polynucleotide (ii), wherein the polynucleotide (ii) comprises a thrombomodulin (TBM) expression sequence and a promoter element that controls the expression of the TBM expression sequence. The polynucleotide (ii) may be located upstream or downstream of the polynucleotide (i). Optionally, the TBM expression sequence is a TBM cDNA.

[0109] The TBM expression sequence in accordance with the present invention may consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 16, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 16, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 16, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 16. Preferably, the nucleotide sequence of the TBM expression sequence in accordance with the present invention consists of the nucleotide sequence shown in SEQ ID NO: 16.

[0110] In Examples 2.7 and 2.8, a CAG promoter consisting of the nucleotide sequence shown in SEQ ID NO: 5 or an EF1A promoter with a CMV enhancer consisting of the nucleotide sequence shown in SEQ ID NO: 17 was used to control the expression of hTBM. Thus, in preferred embodiments, the promoter element that controls the expression of the TBM expression sequence achieves a TBM expression level between 0.1- fold and 10-fold, between 0.2-fold and 5-fold, between 0.3-fold and 3-fold, between 0.5-fold and 2-fold or between 0.8-fold and 1.2-fold of the TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 5 or 17. Most preferably, the promoter element achieves about the same TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 5 or 17. The skilled person is well aware of how to determine and compare TBM expression levels, e.g., as described for the CD46 expression levels above.

[0111] In another embodiment, the promoter element that controls the expression of the TBM expression sequence is a CAG promoter, or an EF1A promoter with a CMV enhancer. Preferably, the promoter element consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 5 or 17, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 5 or 17, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 5 or 17, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 5 or 17. Most preferably, the promoter element that controls the expression of the TBM expression sequence consists of the nucleotide sequence shown in SEQ ID NO: 5 or 17. In the polynucleotide (ii) in accordance with the present invention, the promoter element that controls the expression of the TBM expression sequence is preferably located upstream of the TBM expression sequence, so that it can control the expression of the TBM expression sequence.

[0112] In the polynucleotide (ii) of Examples 2.7 and 2.8, a chimeric intron (Chiml) consisting of the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 18 was located between the TBM expression sequence and the promoter element that controls the expression of the TBM expression sequence. Hence, in one embodiment, the polynucleotide (ii) in accordance with the present invention further comprises a Chiml. In a preferred embodiment of the present invention, the Chiml consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 18, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 18, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 18, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 18. Most preferably, the Chiml consists of the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 18. In the polynucleotide (ii) in accordance with the present invention, the Chiml is preferably located between the TBM expression sequence and the promoter element that controls the expression of the TBM expression sequence.

[0113] In the polynucleotide (ii) of Examples 2.7 and 2.8, a bGH or SV40 polyadenylation signal consisting of the nucleotide sequence shown in SEQ ID NO: 19 or SEQ ID NO: 20, respectively, was located downstream of the promoter element and the TBM expression sequence. Hence, in one embodiment, the polynucleotide (ii) in accordance with the present invention further comprises a polyadenylation signal. In a preferred embodiment, the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal or a Simian Virus 40 (SV40) polyadenylation signal. Preferably, the polyadenylation signal consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 19 or SEQ ID NO: 20, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 19 or SEQ ID NO: 20, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 19 or SEQ ID NO: 20, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 19 or SEQ ID NO: 20. Most preferably, the polyadenylation signal consists of the nucleotide sequence shown in SEQ ID NO: 19 or SEQ ID NO: 20. In the polynucleotide (ii) in accordance with the present invention, the polyadenylation signal is preferably located downstream of the promoter element and the TBM expression sequence, so that it can mediate polyadenylation of the TBM mRNA.

[0114] In the polynucleotide (ii) of Examples 2.7 and 2.8, a ubiquitous chromatin opening element (UCOE) consisting of the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 21 was located upstream of the TBM expression sequence and the promoter element that controls the expression of the TBM expression sequence. Hence, in one embodiment, the polynucleotide (ii) in accordance with the present invention further comprises a UCOE. Preferably, the UCOE consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 21, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 21, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 21, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 21. Most preferably, the UCOE consists of the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 21. In the polynucleotide (ii) in accordance with the present invention, the UCOE is preferably located upstream of the TBM expression sequence and the promoter element that controls the expression of the TBM expression sequence.

[0115] In Example 2.7 , the expression cassette comprising hTBM under the control of the CAG promoter consisted of the nucleotide sequence shown in SEQ ID NO: 22. The expression cassette comprising hTBM under the control of the EF1A promoter consisted of the nucleotide sequence shown in SEQ ID NO: 23. Accordingly, in one embodiment, the polynucleotide (ii) of the present invention consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 22 or SEQ ID NO: 23, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 22 or SEQ ID NO: 23, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 22 or SEQ ID NO: 23, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 22 or SEQ ID NO: 23. Preferably, the polynucleotide (ii) consists of the nucleotide sequence shown in SEQ ID NO: 22 or SEQ ID NO: 23.

[0116] In Example 2.7 , the expression cassette comprising hTBM under the control of the CAG promoter was targeted into exon 6 of the endogenous porcine GGTA1 gene. This site of insertion provided the further advantage of disrupting the porcine GGTA1 gene. Disruption of the porcine GGTA1 gene, thereby abolishing GGTA1 expression, is advantageous for the reasons laid out above with respect to the polynucleotide (i) of the invention. Accordingly, in one embodiment, the polynucleotide (ii) of the present invention is inserted into the endogenous GGTA1 gene of the porcine cells. Preferably, the polynucleotide (ii) of the present invention is inserted into an exon of the endogenous GGTA1 gene of the porcine cells, more preferably into exon 6 of the endogenous GGTA1 gene of the porcine cells. Preferably, the insertion of the polynucleotide (ii) of the present invention leads to a disruption of the endogenous GGTA1 gene, thereby abolishing the expression of porcine GGTA1. As will be known to the skilled person, cells have two alleles of most genes, located on two chromosomes. Accordingly, the polynucleotide (ii) of the present invention may be inserted into one or both alleles of the endogenous GGTA1 gene.

[0117] In Example 2.7 , the polynucleotide (ii) (encoding hTBM) was targeted into a different locus than the polynucleotide (i) (encoding CD46). Without wishing to be bound by theory, sufficient distance between the polynucleotides may provide for increased stability of the genomic DNA. Thus, in one embodiment, the polynucleotide (i) and the polynucleotide (ii) of the present invention are inserted into different loci. Preferably, the different loci are at least 2000 bp apart, or at least 5000 bp apart, or at least 10000 bp apart.

[0118] In one embodiment, the polynucleotide (i) and the polynucleotide (ii) of the present invention are inserted into different loci of the endogenous GGTA1 gene, preferably into different exons of the endogenous GGTA1 gene. More preferably, the polynucleotide (i) is inserted into exon 8 of the endogenous GGTA1 gene and the polynucleotide (ii) is inserted into exon 6 of the endogenous GGTA1 gene.

[0119] In Example 2.7 , when the nucleotide sequence of SEQ ID NO: 22 (schematically depicted in Figure 21A) was inserted into exon 6 of the GGTA1 gene, the resulting predicted genomic nucleotide sequence is shown in SEQ ID NO: 24 (schematically depicted in Figure 22A). When the nucleotide sequence of SEQ ID NO: 23 (schematically depicted in Figure 21B) was inserted into exon 6 of the GGTA1 gene, the resulting predicted genomic nucleotide sequence is shown in SEQ ID NO: 25 (schematically depicted in Figure 22B). Accordingly, in a preferred embodiment, the porcine cell of the present invention comprises a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 24 or SEQ ID NO: 25, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 24 or SEQ ID NO: 25, at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 24 or SEQ ID NO: 25, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 24 or SEQ ID NO: 25. Most preferably, the porcine cell comprises the nucleotide sequence shown in SEQ ID NO: 24 or SEQ ID NO: 25.

[0120] In Example 2.8, the polynucleotide (i) (encoding hCD46) and the polynucleotide (ii) (encoding hTBM) were located on a single polynucleotide. This provides the advantage that the polynucleotides (i) and (ii) are less likely to segregate during cell division. When the polynucleotides (i) and (ii) are located on different polynucleotides, e.g., on different chromosomes, they are much more likely to segregate during cell division. Accordingly, in one embodiment, the polynucleotides (i) and (ii) of the present invention are located on a single polynucleotide.

[0121] The single polynucleotide of Example 2.8 further comprised a ubiquitous chromatin opening element (UCOE) consisting of the nucleotide sequence of SEQ ID NO: 4 between the polynucleotide (i) and the polynucleotide (ii). Therefore, in one embodiment, the single polynucleotide described above further comprises a ubiquitous chromatin opening element (UCOE) that is located between the polynucleotide (i) and the polynucleotide (ii). Preferably, the UCOE consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 4, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 4, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 4, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 4. More preferably, the UCOE consists of the nucleotide sequence shown in SEQ ID NO: 4.

[0122] In Example 2.8, the new targeting vector was targeted into exon 8 of the endogenous GGTA1 gene. The resulting predicted genomic nucleotide sequence is shown in SEQ ID NO: 26 (schematically depicted in Figure 23). Thus, in one embodiment, the porcine cell of the present invention comprises a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 26, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 26, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 26, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 26. Preferably, the porcine cell comprises the nucleotide sequence shown in SEQ ID NO: 26.

[0123] Disruption of the porcine GGTA1 gene, thereby abolishing GGTA1 expression, is advantageous for the reasons laid out above. Accordingly, in one embodiment, the porcine cell of the present invention further comprises a disruption of the endogenous alpha-1, 3-galactosyltransferase (GGTA1) gene. The disruption may be caused by the insertion of the polynucleotide (i) and / or (ii) of the present invention or by other mutations. The disruption of the endogenous GGTA1 gene is preferably a bial lei ic disruption. In this case, one allele may be disrupted by the insertion of the polynucleotide (i) and / or (ii) of the present invention and the other allele by a different mutation. Alternatively, the disruption of both alleles may be caused by the insertion of the polynucleotide (i) and / or (ii) of the present invention. In the porcine cells of the present invention described in Example 2.6, one allele was disrupted by the insertion of polynucleotide (i) and the other allele was disrupted by a different mutation. Therefore, in a preferred embodiment, in the porcine cell of the present invention, one allele is disrupted by the insertion of polynucleotide (i) and the other allele is disrupted by a different mutation.

[0124] The polynucleotides of Examples 2.7 and 2.8 are schematically depicted in Figures 21 and 23. Accordingly, these polynucleotides represent preferred embodiments of the present invention. In particular, in a preferred embodiment, the porcine cell of the present invention, in addition to comprising a genomic insertion of polynucleotide (i), comprises a genomic insertion of a polynucleotide (ii), wherein the polynucleotide (ii) comprises a human thrombomodulin (hTBM) expression sequence, a promoter element that is located upstream of the TBM expression sequence and controls the expression of the human TBM expression sequence and a chimeric intron (Chiml) that is located between the human TBM expression sequence and the promoter element. In this embodiment, it is preferable that the promoter element that controls the expression of the human TBM expression sequence consists of the nucleotide sequence shown in SEQ ID NO: 5 and that the Chiml consists of the nucleotide sequence shown in SEQ ID NO: 6, or that the promoter element that controls the expression of the human TBM expression sequence consists of the nucleotide sequence shown in SEQ ID NO: 17 and that the Chiml consists of the nucleotide sequence shown in SEQ ID NO: 18. In another preferred embodiment, the porcine cell of the present invention comprises a genomic insertion of polynucleotides (i) and (ii) located on a single polynucleotide, wherein the polynucleotide (i) comprises a human CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, wherein the promoter element consists of the nucleotide sequence shown in SEQ ID NO: 1, and wherein the polynucleotide (ii) is located upstream of the polynucleotide (i) and comprises a human thrombomodulin (TBM) expression sequence, a promoter element that is located upstream of the human TBM expression sequence and controls the expression of the human TBM expression sequence and a chimeric intron (Chiml) that is located between the human TBM expression sequence and the promoter element. In this embodiment, it is preferable that the promoter element that controls the expression of the human TBM expression sequence consists of the nucleotide sequence shown in SEQ ID NO: 5 and that the Chiml consists of the nucleotide sequence shown in SEQ ID NO: 6.

[0125] In Example 2.9, an endothelial-specific ICAM2 promoter consisting of the nucleotide sequence shown in SEQ ID NO: 48 or an endothelial-specific porcine TBM promoter consisting of the nucleotide sequence shown in SEQ ID NO: 50 was used to control the expression of hTBM. Endothelial-specific expression of hTBM may be preferable for SCNT and the generation of genetically modified pigs. Thus, in preferred embodiments, the promoter element that controls the expression of the TBM expression sequence achieves a TBM expression level between 0.1-fold and 10-fold, between 0.2-fold and 5-fold, between 0.3- fold and 3-fold, between 0.5-fold and 2-fold or between 0.8-fold and 1.2-fold of the TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 48 or 50. Most preferably, the promoter element achieves about the same TBM expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 48 or 50. The skilled person is well aware of how to determine and compare TBM expression levels, e.g., as described for the CD46 expression levels above.

[0126] In another embodiment, the promoter element that controls the expression of the TBM expression sequence is an endothelial-specific ICAM2 promoter, or an endothelial-specific porcine TBM promoter. Preferably, the promoter element consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 48 or 50, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 48 or 50, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 48 or 50, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 48 or 50. Most preferably, the promoter element that controls the expression of the TBM expression sequence consists of the nucleotide sequence shown in SEQ ID NO: 48 or 50. In the polynucleotide (ii) in accordance with the present invention, the promoter element that controls the expression of the TBM expression sequence is preferably located upstream of the TBM expression sequence, so that it can control the expression of the TBM expression sequence.

[0127] In the polynucleotide (ii) of Example 2.9, a first intron of the ICAM2 gene or part of ICAM2 intron 1 consisting of the nucleotide sequence shown in SEQ ID NO: 47, was located upstream of the ICAM2 promoter element and the TBM expression sequence. Hence, in one embodiment, the polynucleotide (ii) comprising an ICAM2 promotor in accordance with the present invention further comprises an intron. In a preferred embodiment, the intron is a chimeric intron. Preferably, the intron is the complete or partial first intron of the ICAM2 gene, most preferably the intron is the complete or partial first intron of the porcine ICAM2 gene. Preferably, the first intron of the ICAM2 gene consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 47, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 47, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 47, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 47. Most preferably, the polyadenylation signal consists of the nucleotide sequence shown in SEQ ID NO: 47. In the polynucleotide (ii) comprising an ICAM2 promotor in accordance with the present invention, the first intron of the ICAM2 gene is preferably located upstream of the promoter element and the TBM expression sequence, so that it can modulate TBM expression.

[0128] In the polynucleotide (ii) of Example 2.9, a bGH polyadenylation signal consisting of the nucleotide sequence shown in SEQ ID NO: 19, was located downstream of the promoter element and the TBM expression sequence. Hence, in one embodiment, the polynucleotide (ii) in accordance with the present invention further comprises a polyadenylation signal. In a preferred embodiment, the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal polyadenylation signal. Preferably, the polyadenylation signal consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 19, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 19, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 19, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 19. Most preferably, the polyadenylation signal consists of the nucleotide sequence shown in SEQ ID NO: 19. In the polynucleotide (ii) in accordance with the present invention, the polyadenylation signal is preferably located downstream of the promoter element and the TBM expression sequence, so that it can mediate polyadenylation of the TBM mRNA.

[0129] In Example 2.9, the expression cassette comprising hTBM under the control of the ICAM2 promoter consisted of the nucleotide sequence shown in SEQ ID NO: 46. The expression cassette comprising hTBM under the control of the endothelial-specific porcine TBM promoter consisted of the nucleotide sequence shown in SEQ ID NO: 49. Accordingly, in one embodiment, the polynucleotide (ii) of the present invention consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 46 or SEQ ID NO: 49, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 46 or SEQ ID NO: 49, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 46 or SEQ ID NO: 49, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 46 or SEQ ID NO: 49. Preferably, the polynucleotide (ii) consists of the nucleotide sequence shown in SEQ ID NO: 46 or SEQ ID NO: 49. The polynucleotides of Examples 2.9 are schematically depicted in Figure 24A and B.

[0130] In Example 2.9, the expression cassette comprising hTBM under the control of the CAG promoter was targeted into exon 6 of the endogenous porcine GGTA1 gene. This site of insertion provided the further advantage of disrupting the porcine GGTA1 gene. Disruption of the porcine GGTA1 gene, thereby abolishing GGTA1 expression, is advantageous for the reasons laid out above with respect to the polynucleotide (i) of the invention. Accordingly, in one embodiment, the polynucleotide (ii) of the present invention is inserted into the endogenous GGTA1 gene of the porcine cells. Preferably, the polynucleotide (ii) of the present invention is inserted into an exon of the endogenous GGTA1 gene of the porcine cells, more preferably into exon 6 of the endogenous GGTA1 gene of the porcine cells. Preferably, the insertion of the polynucleotide (ii) of the present invention leads to a disruption of the endogenous GGTA1 gene, thereby abolishing the expression of porcine GGTA1.

[0131] As will be known to the skilled person, cells have two alleles of most genes, located on two chromosomes. Accordingly, the polynucleotide (ii) of the present invention may be inserted into one or both alleles of the endogenous GGTA1 gene.

[0132] In Example 2.9, the polynucleotide (ii) (encoding hTBM) targets a different locus than the polynucleotide (i) (encoding CD46). Without wishing to be bound by theory, sufficient distance between the polynucleotides may provide for increased stability of the genomic DNA. Thus, in one embodiment, the polynucleotide (i) and the polynucleotide (ii) of the present invention are inserted into different loci. Preferably, the different loci are at least 2000 bp apart, or at least 5000 bp apart, or at least 10000 bp apart.

[0133] In one embodiment, the polynucleotide (i) and the polynucleotide (ii) of the present invention are inserted into different loci of the endogenous GGTA1 gene, preferably into different exons of the endogenous GGTA1 gene. More preferably, the polynucleotide (i) is inserted into exon 8 of the endogenous GGTA1 gene and the polynucleotide (ii) is inserted into exon 6 of the endogenous GGTA1 gene.

[0134] The non-classical human leukocyte antigens (HLA)-G play an immunomodulatory role by binding the inhibitory receptors: Ig-like transcript 2 (ILT2) on dendritic cells, B cells, NK cells and T cells; ILT4 on cells of myeloid origin; and killer cell immunoglobulin-like receptor 2DL4 (KIR2DL4) on NK cells. HLA-G expression is beneficial and promotes graft tolerance in solid organ transplantation, as evidenced by increased HLA-G expression in allografts and / or plasma, which correlates with improved graft acceptance. HLA-G forms a complex with P2-microglobulin (B2M) and complex formation is crucial for the recognition of certain inhibitor receptors. Therefore, fusion of HLA-G with P2-microglobulin (B2M) is considered beneficial. For instance, the tolerogenic function of B2M-HLA-G fusion proteins i.e., the ability to significantly delay allogeneic graft rejection, has been demonstrated.

[0135] Accordingly, in one embodiment, the porcine cell in accordance with the present invention further comprises a genomic insertion of a polynucleotide (iii), wherein the polynucleotide (iii) comprises a human beta-2-microglobulin / human leukocyte antigen G1 (hB2M / HLA-Gl) expression sequence and a promoter element that controls the expression of the hB2M / HLA-Gl expression sequence. The polynucleotide (iii) may be located upstream or downstream of the polynucleotide (i) or the polynucleotide (ii). Optionally, the hB2M / HLA-Gl expression sequence is a hB2M / HLA-Gl cDNA.

[0136] The hB2M / HLA-Gl expression sequence in accordance with the present invention may consist of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 56, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 56, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 56, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 56. Preferably, the nucleotide sequence of the hB2M / HLA-Gl expression sequence in accordance with the present invention consists of the nucleotide sequence shown in SEQ ID NO: 56.

[0137] In Example 2.10, a CAG promoter consisting of the nucleotide sequence shown in SEQ ID NO: 5 was used to control the expression of hB2M / HLA-Gl. Thus, in preferred embodiments, the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence achieves a hB2M / HLA-Gl expression level between 0.1-fold and 10-fold, between 0.2-fold and 5-fold, between 0.3-fold and 3-fold, between 0.5-fold and 2-fold or between 0.8-fold and 1.2-fold of the hB2M / HLA-Gl expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 5. Most preferably, the promoter element achieves about the same hB2M / HLA-Gl expression level that is achieved by the nucleotide sequence shown in SEQ ID NO: 5. The skilled person is well aware of how to determine and compare hB2M / HLA-Gl expression levels, e.g., as described for the CD46 expression levels above.

[0138] In the polynucleotide (iii) of Example 2.10, a chimeric intron (Chiml) consisting of the nucleotide sequence shown in SEQ ID NO: 6 was located between the hB2M / HLA-Gl expression sequence and the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence. Hence, in one embodiment, the polynucleotide (iii) in accordance with the present invention further comprises a Chiml. In a preferred embodiment of the present invention, the Chiml consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 6, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 6, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 6, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 6. Most preferably, the Chiml consists of the nucleotide sequence shown in SEQ ID NO: 6. In the polynucleotide (iii) in accordance with the present invention, the Chiml is preferably located between the hB2M / HLA-Gl expression sequence and the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence.

[0139] In the polynucleotide (iii) of Example 2.10, a bGH signal consisting of the nucleotide sequence shown in SEQ ID NO: 19 was located downstream of the promoter element and the hB2M / HLA-Gl expression sequence. Hence, in one embodiment, the polynucleotide (iii) in accordance with the present invention further comprises a polyadenylation signal. In a preferred embodiment, the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal. Preferably, the polyadenylation signal consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 19, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 19, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 19, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 19. Most preferably, the polyadenylation signal consists of the nucleotide sequence shown in SEQ ID NO: 19. In the polynucleotide (iii) in accordance with the present invention, the polyadenylation signal is preferably located downstream of the promoter element and the HB2M / HLA- G1 expression sequence, so that it can mediate polyadenylation of the hB2M / HLA-Gl mRNA.

[0140] In the polynucleotide (iii) of Examples 2.10, a ubiquitous chromatin opening element (UCOE) consisting of the nucleotide sequence shown in SEQ ID NO: 21 was located upstream of the hB2M / HLA-Gl expression sequence and the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence. Hence, in one embodiment, the polynucleotide (iii) in accordance with the present invention further comprises a UCOE. Preferably, the UCOE consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 21, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 21, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 21, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 21. Most preferably, the UCOE consists of the nucleotide sequence shown in SEQ ID NO: 21. In the polynucleotide (iii) in accordance with the present invention, the UCOE is preferably located upstream of the hB2M / HLA-Gl expression sequence and the promoter element that controls the expression of the hB2M / HLA-Gl expression sequence.

[0141] In Example 2.10, the expression cassette comprising hB2M / HLA-Gl under the control of the CAG promoter consisted of the nucleotide sequence shown in SEQ ID NO: 51. Accordingly, in one embodiment, the polynucleotide (iii) of the present invention consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 51, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 51, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 51, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 51. Preferably, the polynucleotide (iii) consists of the nucleotide sequence shown in SEQ ID NO: 51.

[0142] In Example 2.10, the expression cassette comprising hB2M / HLA-Gl under the control of the CAG promoter is targeted into exon 6 of the endogenous porcine GGTA1 gene. This site of insertion provided the further advantage of disrupting the porcine GGTA1 gene. Disruption of the porcine GGTA1 gene, thereby abolishing GGTA1 expression, is advantageous for the reasons laid out above with respect to the polynucleotide (i) of the invention. Accordingly, in one embodiment, the polynucleotide (iii) of the present invention is inserted into the endogenous GGTA1 gene of the porcine cells. Preferably, the polynucleotide (iii) of the present invention is inserted into an exon of the endogenous GGTA1 gene of the porcine cells, more preferably into Exon 6 of the endogenous GGTA1 gene of the porcine cells. Preferably, the insertion of the polynucleotide (iii) of the present invention leads to a disruption of the endogenous GGTA1 gene, thereby abolishing the expression of porcine GGTA1. As will be known to the skilled person, cells have two alleles of most genes, located on two chromosomes. Accordingly, the polynucleotide (iii) of the present invention may be inserted into one or both alleles of the endogenous GGTA1 gene.

[0143] The polynucleotides of Example 2.10 are schematically depicted in Figure 25. Accordingly, these polynucleotides represent preferred embodiments of the present invention. In particular, in a preferred embodiment, the porcine cell of the present invention, in addition to comprising a genomic insertion of polynucleotide (i) and a genomic insertion of a polynucleotide (ii), comprises a genomic insertion of a polynucleotide (iii), wherein the polynucleotide (iii) comprises a human beta-2-microglobulin / human leukocyte antigen G1 (hB2M / HLA-Gl) expression sequence, a promoter element that is located upstream of the hB2M / HLA-Gl expression sequence and controls the expression of the hB2M / HLA-Gl expression sequence.

[0144] The polynucleotide (ii) (encoding hTBM) and the polynucleotide (iii) (encoding hB2M / HLA-Gl) may be located on a single polynucleotide. This provides the advantage that the polynucleotides (ii) and (iii) are less likely to segregate during cell division. When the polynucleotides (ii) and (iii) are located on different polynucleotides, e.g., on different chromosomes, they are much more likely to segregate during cell division. Accordingly, in one embodiment, the polynucleotides (ii) and (iii) of the present invention are located on a single polynucleotide. The polynucleotide (iii) may be located upstream or downstream of the polynucleotide (ii), preferably the polynucleotide (iii) is located downstream of the polynucleotide (ii).

[0145] The single polynucleotide of Example 2.10 further comprises a ubiquitous chromatin opening element (UCOE) consisting of the nucleotide sequence of SEQ ID NO: 21 between the polynucleotide (iii) and the polynucleotide (ii). Therefore, in one embodiment, the single polynucleotide described above further comprises a ubiquitous chromatin opening element (UCOE) that is located between the polynucleotide (iii) and the polynucleotide (ii). Preferably, the UCOE consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 21, or at least 95% identical to the nucleotide sequence shown in SEQ ID NO: 21, or at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 21, or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 21. More preferably, the UCOE consists of the nucleotide sequence shown in SEQ ID NO: 21.

[0146] Hence, in another preferred embodiment, the porcine cell of the present invention comprises a genomic insertion of polynucleotides (ii) and (iii) located on a single polynucleotide, wherein the polynucleotide (ii) comprises a human thrombomodulin expression sequence and a promoter element that controls the expression of the thrombomodulin expression sequence, and wherein the polynucleotide (iii) is located downstream of the polynucleotide (ii) and comprises a human beta-2-microglobulin / human leukocyte antigen G1 (hB2M / HLA-Gl) expression sequence, a promoter element that is located upstream of the human TBM expression sequence and controls the expression of the human TBM expression sequence consists of the nucleotide sequence shown in SEQ ID NO: 48 or 50 and a promoter element that is located upstream of the human hB2M / HLA-Glexpression sequence and controls the expression of the human hB2M / HLA-Gl expression sequence consists of the nucleotide sequence shown in SEQ. ID NO: 5.

[0147] The porcine cell of the present invention may be used for xenotransplantation, e.g., to generate pigs that are suitable donors for xenotransplantation of porcine organs into humans. All humans and nonhuman primates (NHPs) develop antibodies during infancy that cross-react with antigens present on the cell surfaces of wild-type pig cells (i.e., cells from a genetically-unmodified pig). Thus, when a wild-type pig organ transplant is carried out in a human or baboon, these antibodies immediately bind to the graft vascular endothelial cells. Some bound antibodies activate the complement cascade, and others attract leukocytes which adhere and infiltrate through Fc-receptor-mediated and Fc-independent mechanisms; the graft is usually rejected within minutes to hours (Lexer et al., 1986). Hyperacute xenograft rejection of pig organs by humans or non-human primates is mainly triggered by antibodies against galactose- alpha(l,3)-galactose (alpha Gal), as described above. In addition, humans have natural antibodies against N-glycolylneuraminic acid (Neu5Gc) and a glycan corresponding to the human Sd(a) blood group antigen (often termed P4Gal). In contrast, NHPs have only anti-alphaGal and anti-Sd(a) antibodies (reviewed in Byrne et al., 2018, as well as Sykes & Sachs, 2019). To eliminate the alphaGai, Neu5Gc, and Sd(a) epitopes as anti-xenograft target antigens, pigs with inactivated a-l,3-galactosyltransferase (GGTA1), cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH), and p-l,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2) / B4GALNT2L) genes, so-called triple-knockout (TKO) pigs were generated as candidate pig organ donors for humans (reviewed in Reichart et al., 2023).

[0148] Thus, in one embodiment, the porcine cells of the present invention further comprise a disruption of the endogenous cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) gene. The disruption of the endogenous CMAH gene may be a monoallelic or a biallelic disruption. Pigs with a monoallelic disruption of the endogenous CMAH gene are suitable source pigs for preclinical xenotransplantation experiments, where a biallelic CMAH knockout proved to be detrimental (Mohiuddin et al. 2022; Estrada et al. 2015; Yamamoto et al. 2020 a; Yamamoto et al. 2020 b; Cui et al. 2020; Iwase et al. 2021 a), whereas pigs with a biallelic disruption of the endogenous CMAH gene may be used for pig-to-human xenotransplantations.

[0149] In another embodiment, the porcine cells of the present invention further comprise a disruption of the endogenous R-l,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2) gene and a disruption of the endogenous B4GALNT2-like (B4GALNT2L) gene (when reference is made herein to a disruption of "B4GALNT2 / B4GALNT2L", this refers to a disruption of the B4GALNT2 gene and a disruption of the B4GALNT2L gene). The disruptions of the endogenous B4GALNT2 gene and the endogenous B4GALNT2L gene may be monoallelic or biallelic disruptions. Pigs with monoallelic disruptions of the endogenous B4GALNT2 gene and the endogenous B4GALNT2L gene are suitable source pigs for pig-to-baboon xenotransplantations, pigs with biallelic disruptions of the endogenous B4GALNT2 gene and the endogenous B4GALNT2L gene are suitable source pigs for pig-to-human xenotransplantations. Complement can also be activated by pathways that do not involve antibody binding, e.g., consequent to ischemia-reperfusion injury. For this reason, and to minimize the consequences of any anti-pig antibody that is either preformed in the recipient or elicited after transplantation, additional protection of the pig organ from complement-mediated injury is likely to prove beneficial to reduce xenograft injury. Protection of pig organs from complement-mediated injury has been achieved by the transgenic expression of human complement pathway regulatory proteins (CPRPs), i.e., CD46, CD55, and CD59, to inhibit the activation of the complement cascade. Organs from pigs transgenic for one or more human CPRPs have a high degree of protection from human complement-mediated injury (see Cozzi & White, 1995, and White et al., 1995). CD46 is the preferred CPRP of the present invention. Hence, the porcine cell of the present invention comprises a genomic insertion of a CD46 expression sequence, as is described in detail above. Further, since the present invention delineates an approach for generating organ donor pigs with a minimum set of genetic modifications, the porcine cell of the present invention is preferably not genetically modified to express any of the other human CPRPs. For the same reason, in another preferred embodiment, the porcine cell of the present invention comprises only the genetic modifications described herein (in particular the inactivation of the porcine genes GGTA1, CMAH, and B4GALNT2 / B4GALNT2L and the transgenic expression of hCD46 and hTBM), and no further genetic modifications.

[0150] Nevertheless, the combination of the GGTA1, CMAH, and B4GALNT2 / B4GALNT2LTKO and the expression of human CPRPs in addition to hCD46 may further reduce pig cell injury (Yamamoto et al., 2021). Thus, in another embodiment, the porcine cell of the present invention may be further genetically modified to express further CPRPs, in particular human CD55 and / or human CD59. Similarly, activation of human protein C in the anticoagulant pathway is enhanced by the additional expression of endothelial protein C receptor (EPCR), and - while porcine EPCR appears to be functionally compatible with the human protein C pathway (Salvaris et al., 2020) - transgenic pigs expressing human EPCR have been produced that are expected to express higher EPCR levels and thus enhance protective thromboregulation. Thus, in another embodiment, the porcine cell of the present invention may be further genetically modified to express human endothelial protein C receptor. Further genetic modifications that may be combined with the present invention are described in WO 2019 / 185936, which is incorporated herein in its entirety for all purposes.

[0151] In a preferred embodiment of the present invention, the porcine cell of the present invention is a primary cell. Primary cells were used in the Examples of the present invention. Further, since a primary cell has generally undergone only few cell divisions in vitro, it is generally more representative of the in vivo state than, e.g., (tumor or artificially immortalized) cell lines.

[0152] In embodiments of the present invention, the porcine cell of the present invention may be a porcine kidney cell, a porcine heart cell, a porcine lung cell, or a porcine liver cell. Preferably, the porcine cell of the present invention is a primary porcine kidney cell, a primary porcine heart cell, a primary porcine lung cell, or a primary porcine liver cell. In Example 2.2, primary porcine kidney cells were used. Therefore, in a preferred embodiment, the porcine cell of the present invention is a porcine kidney cell, preferably a primary porcine kidney cell. Primary porcine kidney cells as well as their genetic manipulation are described in detail in the publication Richter et al. (2012), which is incorporated herein in its entirety. In particular, the genetic modification(s) of the primary porcine kidney cell in accordance with the present invention is / are preferably introduced as described in Richter et al. (2012). As will be clear to the skilled person, a (primary) porcine kidney cell may be, e.g., a (primary) porcine kidney epithelial cell or a (primary) porcine kidney fibroblast. In other embodiments of the present invention, the porcine cell of the present invention may be a stem cell, such as an embryonic stem cell, an adult stem cell or an induced pluripotent stem cell.

[0153] The porcine cell of the present invention may be derived from various pigs, e.g., from a pig of German Landrace / Large White cross-bred genetic background, a Duroc pig, a Schwabisch-Hallische pig, a black mini pig, or an Auckland Island pig. However, a consistent observation in preclinical cardiac xenotransplantation studies was a detrimental overgrowth of the xeno-heart (e.g. Langin et al., 2018). One idea to solve this problem is the generation of donor pigs with loss-of-function mutations of the growth hormone receptor (GHR) gene, which reduced their body and organ weights by about 50% without causing major metabolic disturbances (see Hinrichs et al., 2018, and Riedel et al., 2020; discussed in Iwase et al., 2021 b; see also WO 2019 / 185936). Holistic proteome analysis of GHR-deficient pig hearts did not reveal signs of major molecular abnormalities (Hinrichs et al., 2021). Recent studies demonstrated that GHR deficiency- among othergenetic modifications -facilitated the survival of orthotopic porcine cardiac xenografts beyond 6 months (see Goerlich et al., 2021, and Mohiuddin et al., 2022). Thus, in one embodiment, the porcine cells of the present invention and the pig in accordance with the present invention may have a disruption of the endogenous GHR gene. Preferably, the disruption of the endogenous GHR gene is a biallelic disruption.

[0154] In an alternative and preferred approach in accordance with the present invention, the genetic modifications of the present invention are based on Auckland Island (Al) pigs which fit the size of humans. Morphologically, Auckland Island pigs have smaller body stature compared to many domestic pig breeds, rendering their organ dimensions well-suited for human transplantation. Furthermore, echocardiography assessments of Auckland Island pig hearts indicated normal structure and functioning across various age groups throughout the study. Single nucleotide polymorphism (SNP) analysis revealed higher runs of homozygosity (ROH) in Auckland Island pigs compared to other domestic pig breeds and demonstrated that the entire locus coding the swine leukocyte antigens (SLAs) was homozygous. High ROH levels, indicate a high degree of inbreeding. However, and surprisingly, no signs of inbreeding depression were found. In addition, Al pigs possess blood group O, naturally addressing a crucial barrier in xenotransplantation, i.e., they are less likely to elicit a strong immune response in humans. Based on these findings, Auckland Island pigs represent a promising genetic background for organ xenotransplantation (Lange et al., 2024). Compared to other pig breeds, Al pigs are extremely hard to clone. Hence, there have not been any reports on genetically modified Al pigs to date.

[0155] Al porcine cells and Al pigs were also used in the Examples of the present invention. Thus, in a preferred embodiment, the porcine cell of the present invention is derived from an Al pig, i.e., the porcine cell of the present invention is preferably an Al porcine cell.

[0156] The porcine cell of the present invention may be an isolated porcine cell.

[0157] Composition, porcine organ and pig of the present invention

[0158] The present invention also provides a composition comprising the porcine cell of the invention and cell culture medium.

[0159] The present invention also provides a porcine organ comprising the genetic modification(s) described above with respect to the porcine cell of the present invention, as well as a porcine organ comprising the porcine cell of the present invention. The porcine organ may be a porcine heart, a porcine kidney, a porcine lung or a porcine liver. Preferably, the porcine organ is a porcine heart. The porcine organ may be derived from an Auckland Island pig comprising the genetic modification(s) described above with respect to the porcine cell of the present invention. An Auckland Island pig fits the size of humans as described above. The porcine organ of the present invention may be an isolated porcine organ.

[0160] The present invention also provides a pig comprising the genetic modification(s) described above with respect to the porcine cell of the present invention, as well as a pig comprising the porcine cell of the present invention or the porcine organ of the present invention. The pig is preferably an Auckland Island Pig-

[0161] The porcine cell of the present invention, the composition of the present invention, the porcine organ of the present invention and the pig of the present invention are preferably specific-pathogen-free (SPF). In a particularly preferred embodiment, the porcine cell of the present invention, the composition of the present invention, the porcine organ of the present invention and the pig of the present invention are free of porcine endogenous retrovirus type C (PERV-C).

[0162] Suitability and uses in xenotransplantation

[0163] For the reasons laid out in detail above, the porcine cell of the present invention, the composition of the present invention, the porcine organ of the present invention and the pig of the present invention can be used in xenotransplantation. Thus, the present invention also provides the porcine cell of the present invention, the composition of the present invention, the porcine organ of the present invention and the pig of the present invention, wherein the porcine cell, the composition, the porcine organ or the pig, respectively, is for xenogeneic organ transplantation, or for use in a method of xenotransplantation. Also provided is the use of the porcine cell of the present invention, the composition of the present invention, the porcine organ of the present invention and the pig of the present invention for xenotransplantation and a method of xenotransplantation comprising transplanting the porcine cell of the present invention or the porcine organ of the present invention. The xenotransplantation may be a pig-to-baboon xenotransplantation or a pig-to-human xenotransplantation.

[0164] Human transgenes in porcine xenografts are generally suitable both for pig-to-baboon xenotransplantation and pig-to-human xenotransplantation. Therefore, in a particularly preferred embodiment of the present invention, the transgenes of the present invention are human transgenes. In particular, in the porcine cell of the present invention, the composition of the present invention, the porcine organ of the present invention and the pig of the present invention, the genomic insertion of the CD46 transgene is preferably a genomic insertion of the human CD46 transgene, i.e., the CD46 expression sequence is preferably a human CD46 expression sequence and the promoter element that controls the expression of the CD46 expression sequence preferably consists of at least part of the human native CD46 promoter. Similarly, in the porcine cell of the present invention, the composition of the present invention, the porcine organ of the present invention and the pig of the present invention, the genomic insertion of the thrombomodulin (TBM) transgene is preferably a genomic insertion of the human TBM transgene, i.e., the TBM expression sequence is preferably a human TBM expression sequence.

[0165] Method for producing a porcine cell, a population of porcine cells, or a pig

[0166] The present invention also provides a method for producing a porcine cell of the present invention, wherein the method comprises inserting the polynucleotide (i) into the genome of a porcine cell. The method may further comprise inserting the polynucleotide (ii) into the genome of the porcine cell. The method may further comprise disrupting at least one allele of the endogenous GGTA1 gene of the porcine cell. The disrupting may comprise disrupting both alleles of the endogenous GGTA1 gene of the porcine cell. The method may further comprise disrupting the endogenous cytidine monophosphate-N- acetylneuraminic acid hydroxylase (CMAH) gene of the porcine cell. The disrupting may comprise disrupting both alleles of the endogenous CMAH gene of the porcine cell. The method may further comprise disrupting the endogenous R-l,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2) gene and the endogenous B4GALNT2-like (B4GALNT2L) gene of the porcine cell. The disrupting may comprise disrupting both alleles of the endogenous B4GALNT2 / B4GALNT2L gene of the porcine cell. The skilled person is well aware of how to genetically modify porcine cells, e.g., of how to insert a transgene or disrupt an endogenous gene. The inserting preferably comprises CRISPR-Cas9-based homology-directed repair (HDR) and the disrupting preferably comprises CRISPR-Cas9-based non-homologous end joining (NHEJ), e.g., as described in the Examples of the present invention. The method for producing a porcine cell of the present invention may be an in vitro method. The present invention also provides a method for producing a population of genetically modified porcine cells, wherein the genetically modified porcine cells are porcine cells of the invention, and wherein the method comprises exposing a population of porcine cells to genome-modifying treatment comprising inserting the polynucleotide (i) into the genomes of the porcine cells. The method may further comprise isolating a subpopulation of porcine cells that express CD46 (which is encoded by the polynucleotide (i)). The genome-modifying treatment may further comprise inserting the polynucleotide (ii) into the genomes of the porcine cells. The method may further comprise isolating a subpopulation of porcine cells that express thrombomodulin (TBM, which is encoded by the polynucleotide (ii)). The genome-modifying treatment may further comprise disrupting at least one allele of the endogenous GGTA1 gene of the porcine cells. The disrupting may comprise disrupting both alleles of the endogenous GGTA1 gene of the porcine cells. The method may further comprise isolating a subpopulation of porcine cells that do not express or express a reduced amount of alpha-1, 3-galactosyltransferase (GGTA1). The genome-modifying treatment may further comprise disrupting the endogenous cytidine monophosphate-N- acetylneuraminic acid hydroxylase (CMAH) gene of the porcine cells. The disrupting may comprise disrupting both alleles of the endogenous CMAH gene of the porcine cells. The method may further comprise isolating a subpopulation of porcine cells that do not express or express a reduced amount of CMAH. The genome-modifying treatment may further comprise disrupting the endogenous R-l,4-N- acetyl-galactosaminyl transferase 2 (B4GALNT2) gene and disrupting the B4GALNT2-like (B4GALNT2L) gene of the porcine cells. The disrupting may comprise disrupting both alleles of the endogenous B4GALNT2 / B4GALNT2L gene of the porcine cells. The method may further comprise isolating a subpopulation of porcine cells that do not express or express a reduced amount of B4GALNT2 / B4GALNT2L. The genome-modifying treatment may comprise CRISPR-Cas9-based homology- directed repair (HDR) and / or CRISPR-Cas9-based non-homologous end joining (NHEJ). The skilled person is well aware of how to isolate subpopulations of genetically modified porcine cells, e.g., of genetically modified porcine cells that express a transgene or do not express an endogenous gene. This may be performed, e.g., as described in the Examples of the present invention. The method for producing a population of genetically modified porcine cells may be an in vitro method.

[0167] The present invention also provides a method for producing a pig according of the invention. This method may comprise the method for producing a population of genetically modified porcine cells described above, and using the cell population to generate genetically modified pig embryos by somatic cell nuclear transfer (SCNT). SCNT is preferably performed according to the standard protocol described in Kurome et al., 2015, which is incorporated herein in its entirety.

[0168] Method for producing genetically modified pig

[0169] When the presented inventors generated clonal populations of genetically modified porcine cells and used these for SCNT, no full-term development of the cloned embryos was obtained. It was concluded that the selection of single-cell clones causes stress on the cells that may be detrimental to the SCNT efficacy of the cells (see Example 2.3). In order to avoid this stress, the inventors developed an alternative approach relying on bulk cell samples (see Example 2.4). The bulk cell sample approach has the additional advantage of decreasing the time that is needed to generate cell samples for SCNT and thus to generate genetically modified pigs.

[0170] Accordingly, the present invention also provides a method for producing a genetically modified pig, wherein the method comprises in the following order: (1) exposing a population of porcine cells to genome-modifying treatment, (2) isolating a non-clonal subpopulation of porcine cells comprising the genomic modification, and (3) using the non-clonal subpopulation of genetically modified porcine cells obtained in step (2) for somatic cell nuclear transfer (SCNT). SCNT is preferably performed according to the standard protocol described in Kurome et al., 2015, which is incorporated herein in its entirety.

[0171] The method for producing a genetically modified pig of the present invention has the advantage that generating the bulk cell samples requires less time than generating single-cell clones (compare Figures 6 and 10), so that the time required to generate cells for SCNT is much reduced. Accordingly, in one embodiment, in the method for producing a genetically modified pig of the present invention SCNT is performed no more than 40 days after exposing the population of porcine cells to the genome-modifying treatment, or no more than 30 days after exposing the population of porcine cells to the genomemodifying treatment, or no more than 25 days after exposing the population of porcine cells to the genome-modifying treatment. In a preferred embodiment, the SCNT is performed no more than 20 days after exposing the population of porcine cells to the genome-modifying treatment. In another preferred embodiment, the SCNT is performed no more than 18 days after exposing the population of porcine cells to the genome-modifying treatment.

[0172] Also, the number of cell passages required to generate a sample of genetically modified cells that can be used for SCNT is much lower for the bulk cell sample approach than for the single cell clone approach (compare Figures 6 and 10). Accordingly, in one embodiment, in the method for producing a genetically modified pig of the present invention the non-clonal subpopulation of genetically modified porcine cells is passaged no more than 18 times before the SCNT, or no more than 15 times before the SCNT. In a preferred embodiment, the non-clonal subpopulation of genetically modified porcine cells is passaged no more than 12 times before the SCNT.

[0173] In the method for producing a genetically modified pig of the present invention, the genome-modifying treatment preferably comprises CRISPR-Cas9-based homology-directed repair (HDR) and / or CRISPR-Cas9- based non-homologous end joining (NHEJ), as it was used in the Examples of the present invention.

[0174] In the method for producing a genetically modified pig of the present invention, the porcine cells are preferably primary porcine cells. Since primary cells have generally undergone only few cell divisions in vitro, they are therefore generally more representative of the in vivo state than, e.g., (tumor or artificially immortalized) cell lines. The primary porcine cells may be derived from a pig within three weeks after its birth.

[0175] In the method for producing a genetically modified pig of the present invention, the porcine cells may be porcine kidney cells, porcine heart cells, porcine lung cells, or porcine liver cells. Preferably, the porcine cells are primary porcine kidney cells, primary porcine heart cells, primary porcine lung cells, or primary porcine liver cells. In Example 2.2, primary porcine kidney cells were used. Therefore, in a preferred embodiment, the porcine cells are porcine kidney cells, preferably primary porcine kidney cells. Primary porcine kidney cells as well as their genetic manipulation are described in detail in the publication Richter et al. (2012), which is incorporated herein in its entirety. In particular, the genome-modifying treatment of primary porcine kidney cells in accordance with the present invention is preferably performed as described in Richter et al. (2012).

[0176] As will be clear to the skilled person, (primary) porcine kidney cells comprise (primary) porcine kidney epithelial cells and (primary) porcine kidney fibroblasts. During generation of the cell samples for SCNT in the Examples of the present invention, the proportion of primary porcine kidney fibroblasts increased. Thus, in one embodiment of the method for producing a genetically modified pig of the present invention, the porcine kidney cells comprise porcine kidney epithelial cells and porcine kidney fibroblasts. In another embodiment, the non-clonal subpopulation of genetically modified porcine cells that is used for SCNT predominantly comprises genetically modified porcine kidney fibroblasts, i.e., more than 50% of the cells comprised in the non-clonal subpopulation of genetically modified porcine cells are genetically modified porcine kidney fibroblasts.

[0177] The bulk cell sample approach as described in Example 2.4 of the present invention does not include a step of isolating a single-cell clone (SSC). For this reason, the non-clonal subpopulation of genetically modified porcine cells of Example 2.4 comprised numerous different clonal subpopulations. Accordingly, in one embodiment of the method for producing a genetically modified pig of the present invention, the method does not include a step of isolating a single-cell clone. In a preferred embodiment, the non-clonal subpopulation of genetically modified porcine cells that is used for SCNT comprises at least 5 different clonal subpopulations, or at least 10 different clonal subpopulations. In a preferred embodiment, the non- clonal subpopulation of genetically modified porcine cells that is used for SCNT comprises at least 20 different clonal subpopulations.

[0178] Since the method for producing a genetically modified pig of the present invention does not include a step of isolating a single-cell clone (SSC), the cell density remains relatively high during the entire method. Without wishing to be bound by theory, the present inventors consider that maintaining such relatively high cell density reduces the stress on the cells and therefore contributes to successful SCNT. Thus, in one embodiment of the method for producing a genetically modified pig of the present invention, the cell density of the (sub-)population of porcine cells does not decrease below 200 cells per ml, or not below 100 cells per ml. Preferably, the cell density of the (sub-)population of porcine cells does not decrease below 50 cells per ml. In another embodiment, the cell density of the (sub-)population of porcine cells does not decrease below 100 cells per cm2culture surface area, or not below 50 cells per cm2culture surface area. Preferably the cell density of the (sub-)population of porcine cells does not decrease below 20 cells per cm2culture surface area. In another embodiment, the non-clonal subpopulation of genetically modified porcine cells that is used for SCNT comprises at least 1 x 106, or at least 5 x 106, or at least 1 x 107, or at least 5 x 107genetically modified porcine cells. Preferably, the non-clonal subpopulation of genetically modified porcine cells that is used for SCNT comprises at least 1 x 108genetically modified porcine cells.

[0179] The method for producing a genetically modified pig of the present invention may, after the SCNT, further comprise transferring 100 to 150 genetically modified pig embryos into a recipient pig.

[0180] In the method for producing a genetically modified pig of the present invention, the genetically modified pig is preferably the pig of the present invention described above. Thus, the genetically modified pig may comprise one or more of the genetic modifications described above, and / or the genetically modified pig may comprise the (genetically modified) porcine cell of the present invention. Further, the method for producing a genetically modified pig of the present invention may comprise the method for producing a population of genetically modified porcine cells of the present invention described above. In one embodiment, this method for producing a population of genetically modified porcine cells of the present invention produces porcine cells comprising a disruption of the endogenous GGTA1 gene, a disruption of the endogenous CMAH gene, a disruption of the endogenous B4GALNT2 / B4GALNT2L gene, a genomic insertion of a CD46 (preferably human CD46) expression sequence and a genomic insertion of a TBM (preferably human TBM) expression sequence.

[0181] The method for producing a genetically modified pig of the present invention may further comprise breeding a first pig comprising one or more of the genetic modifications of the present invention and / or a (genetically modified) porcine cell of the present invention with a second pig comprising one or more of the genetic modifications of the present invention and / or a (genetically modified) porcine cell of the present invention. For example, in Example 1 of the present invention Line A has a biallelic disruption of the endogenous GGTA1 gene and genomic insertions of hCD46 and hTBM into the GGTA1 locus. Line B has biallelic disruptions of the endogenous GGTA1, CMAH, and B4GALNT2 / B4GALNT2L genes (TKO). Crossing (i.e., breeding) of the two lines results in pigs that lack aGal and express hCD46 and hTBM and are heterozygous for the CMAH and B4GALNT2 / B4GALNT2L mutations. Accordingly, in a preferred embodiment of the method for producing a genetically modified pig of the present invention, the method further comprises breeding a first pig comprising (a porcine cell comprising) a genomic insertion of a CD46 (preferably human CD46) expression sequence, a genomic insertion of a TBM (preferably human TBM) expression sequence and a biallelic disruption of the endogenous GGTA1 gene with a second pig comprising (a porcine cell comprising) a biallelic disruption of the endogenous GGTA1 gene, a biallelic disruption of the endogenous CMAH gene and a biallelic disruption of the endogenous B4GALNT2 / B4GALNT2L gene.

[0182] In the following, the present invention will be illustrated by examples, without being limited thereto.

[0183] EXAMPLES

[0184] Example 1: Strategy

[0185] To allow the production of genetically modified donor pigs for preclinical and clinical xenotransplantation studies by breeding, the strategy for genetic modification illustrated in Figure 1 was designed:

[0186] Two lines of founder pigs are generated: One (Line A) has a biallelic knockout of GGTA1 with expression cassettes for hCD46 and hTBM inserted into the GGTA1 locus. The other (LINE B) lacks GGTA1, CMAH, and B4GALNT2 / B4GALNT2L (TKO). Crossing of the two lines results in Fl pigs that lack aGal and express hCD46 and hTBM, but are only heterozygous for the CMAH and B4GALNT2 / B4GALNT2L mutations. These are suitable source pigs for preclinical xenotransplantation experiments, where a biallelic CMAH knockout proved to be detrimental (Mohiuddin et al. 2022; Estrada et al. 2015; Yamamoto et al. 2020 a; Yamamoto et al. 2020 b; Cui et al. 2020; Iwase et al. 2021 a). In the F2 generation, TKO pigs expressing hCD46 and hTBM are obtained as organs source for a clinical pilot study.

[0187] Example 2: Development of Line A

[0188] Example 2 describes the development of Line A in accordance with Figure 1.

[0189] Example 2.1: Generation of plasmid

[0190] Experimental Design

[0191] The aim was to integrate two transgenes into the GGTA1 locus using CRISPR-Cas9-based homology- directed repair (HDR). The insertion of the transgene cassette into the GGTA1 locus generates a GGTA1 knockout and hCD46 / hTBM knock-in in one step.

[0192] • The porcine GGTA1 gene has eight exons, and exon 8 was targeted for transgene integration.

[0193] • The CRISPR-Cas9 system was used as a ribonucleoprotein (RNP) complex. A highly efficient gRNA was designed to target the Exon 8 (E8) of the porcine GGTA1 and was synthesized by The Synthego. (Figure 2A) CTGACGAGTTCACCTACGAGAGG (AGG is the PAM sequence) (SEQ ID NO: 37)

[0194] • For HDR-based targeted integration of the transgenes, 751 base pairs long homology arms were designed to match the GGTA1 sequence on either side of the sgRNA target site. (Figure 2B)

[0195] • The GGTA1-E8 gRNA was also integrated at the ends of the 5'- and 3'- HAs, which act as internal cut sites, and the donor plasmid is referred to as "dual-cut donor plasmid". This way, only one sgRNA targets the GGTA1 E8 to create a double-stranded break (DSB), as well as to cut the donor plasmid to cause its internal linearization.

[0196] Expression cassettes for human transgenes

[0197] • Two human transgenes were to be integrated into the GGTA1 locus through CRISPR-Cas9 based HDR. o Human complement regulatory protein, also known as cluster of differentiation 46 (hCD46) o Human thrombomodulin (hTBM)

[0198] • The expression cassettes for hCD46 and hTBM were separately prepared and then cloned into the GGTA1 E8 HAs.

[0199] • The hCD46 expression cassette included a ubiquitous chromatin opening element (A2UCOE) for stable expression, a CAG promoter with chimeric intron (Chiml), and the hCD46 minigene. The hCD46 minigene contained 826 bps upstream of the transcription start site in Exon 1 (CD46 promoter), followed by Exon 1, Intron 1, Exon 2, Intron 2, exons 3-13, and an SV40 poly(A) signal. (Figure 3A)

[0200] • The hTBM expression cassette included a ubiquitous chromatin opening element (A2UCOE) for stable expression, a CAG promoter with chimeric intron (Chiml), a hTBM cDNA sequence, and the bovine growth hormone (bGH) poly(A) signal. (Figure 3B)

[0201] Synthesis of the dual-cut donor plasmid

[0202] • To obtain the dual-cut donor plasmid (E8-HAs / hCD46 / hTBM), cloning by restriction digest and ligation was performed in two steps.

[0203] • In the first step, the expression cassette for hCD46 was cloned into the GGTA1 E8 HAs to generate E8- HAs / hCD46 plasmid (Figure 4A).

[0204] • In the second step, the hTBM expression cassette was cloned downstream of the hCD46 expression cassette to generate E8-HAs / hCD46 / hTBM plasmid (Figure 4B). • This final dual-cut donor plasmid (E8-HAs / hCD46 / hTBM) contained two internal cut sites (target sequence + PAM for E8 sgRNA) upstream of the 5'-HA and downstream to the 3'-HA (Figure 4B).

[0205] Example 2.2: Transfection and screening of porcine cells

[0206] Nucleofection for transgenes integration into the porcine GGTA1 E8

[0207] 1) The porcine kidney cells from Auckland pigs (pKC-AUCK) for GGTA1 KO and human transgenes' knock- in.

[0208] 2) As described earlier, the CRISPR-Cas9 system was used as RNP complex.

[0209] 3) The pKC-AUCK were transfected with the RNP complex and the donor plasmid by nucleofection (an electroporation-based transfection method) using Nucleofector I from Amaxa-biosystems.

[0210] NOTE: The sgRNA sequence used to target GGTA1 Exon 8 is: CTGACGAGTTCACCTACGAGAGG (AGG is the PAM sequence) (SEQ ID NO: 37).

[0211] 4) Briefly, 37.5 picomoles of sgRNA targeting GGTA1 E8 and 37.5 picomoles of the Cas9 protein (True- cut Cas9 V2 from Thermo Scientific) were mixed in a 100 pL of Nucleofection solution. This mixture was incubated at room temperature for a minimum of 10 minutes for the RNP complex formation.

[0212] 5) During the incubation time, 1 million pKC-AUCK were pelleted in a tube by centrifugation.

[0213] 6) After the incubation, 4 pg of the dual-cut donor plasmid (E8-HAs / hCD46 / hTBM) was added to the RNP mixture.

[0214] 7) The cell pellet was resuspended in the RNP-Donor plasmid mixture and transferred into the electroporation cuvette, and the cells were nucleofected using Nucleofector I.

[0215] 8) Immediately after nucleofection, the cells were seeded in a collagen-coated 10 cm plate in the appropriate cell culture medium with supplements.

[0216] 9) After 72 h in culture, the cells were collected and screened for the absence of Gal epitope (a confirmation of GGTA1 KO) and the presence of hCD46.

[0217] 10) Both negative and positive screenings were done using magnetic-activated cell sorting (MACS) system from Miltenyi Biotec.

[0218] Expected gene assembly of the sorted cells or the animals generated by SCNT

[0219] 1) The RNP-complex targets the GGTA1 E8, as well as the two target sites integrated in the donor plasmid (E8-HAs / hCD46 / hTBM). It creates a double-stranded break (DSB) in the genomic DNA and also linearizes the donor plasmid.

[0220] 2) The linearized donor plasmid is integrated into the DSB by homology directed repair (HDR).

[0221] 3) A schematic diagram showing the expected development of a new genotype after transgene integration is shown in Figure 5.

[0222] Screening of Gal-negative cells The following protocol was used for the screening of Gal-negative cells:

[0223] 1) Collect the cells from the 10 cm plate, and pellet them in a tube by centrifuging at 300xg for 5 minutes.

[0224] 2) Resuspend the cell pellet in lOOpI MACS buffer and incubate the cells with biotin-labeled Isolecin GS- IB4 (Thermo Scientific - 121414) for 15 minutes at 4°C. Isolectin IB4 binds the Gal epitope on the cells.

[0225] 3) Wash cells with MACS buffer, resuspend in 90 pL of MACS buffer, add 10 pL of Streptavidin MicroBeads (Miltenyi Biotec - 130-048-102), incubate for 15 minutes at 4°C.

[0226] 4) Wash cells by adding 2 mL of MACS buffer and resuspend in 500 pL of MACS buffer.

[0227] 5) Place the LS-MACS column in a suitable MACS Separator.

[0228] 6) Prepare the column by it rinsing with 3 mL of MACS buffer.

[0229] 7) Apply cell suspension onto the column.

[0230] 8) Collect unlabeled cells that pass through. This is the unlabeled cell fraction which have no Gal epitope anymore.

[0231] Screening of hCD46-positive cells

[0232] The following protocol was used for the screening of hCD46-positive cells:

[0233] 1) Use the cells from the previous step of negative sorting, and pellet them in a tube by centrifuging at 300xg for 5 minutes.

[0234] 2) Resuspend the cell pellet in lOOpI MACS buffer and incubate the cells with biotin-labeled hCD46 antibody (Miltenyi Biotec - 130-105-585) for 15 minutes at 4°C.

[0235] 3) Wash cells with MACS buffer, resuspend in 90 pL of MACS buffer, add 10 pL of Streptavidin MicroBeads (Miltenyi Biotec - 130-048-102), incubate for 15 minutes at 4°C.

[0236] 4) Wash cells by adding 2 mL of MACS buffer and resuspend in 500 pL of MACS buffer.

[0237] 5) Place the LS-MACS column in a suitable MACS Separator.

[0238] 6) Prepare the column by rinsing it with 3 mL of MACS buffer.

[0239] 7) Apply cell suspension onto the column. The cells positive for hCD46 (now attached to the microbeads) will not pass through.

[0240] 8) Wash the column twice with 3 ml MACS buffer.

[0241] 9) Remove the column from the MACS separator and flush the cells out of the column using a 5 ml MACS buffer.

[0242] 10) This cell fraction contains GGTA1 KO (Gal negative) and hCD46-positive cells (see Figure 9A).

[0243] 11) From this point onward, the cells were either used to generate single-cell clones (SCC) or (in a subsequently developed approach) grown and screened further to generate bulk cell samples for SCNT, as is described in the following Examples 2.3 and 2.4, respectively.

[0244] Example 2.3: Single-cell clone approach After the initial negative and positive sorting of the cells (see Example 2.2 above), single-cell clones (SCC) were generated for SCNT. The targeting construct was transfected into primary kidney cells from Auckland Island (Al) pigs, and single-cell clones were selected and screened by PCR for targeted integration of the construct. The following protocol was used for the generation of single cell-clones:

[0245] 1) All the plates used in this protocol were collagen-coated.

[0246] 2) The cells collected after negative and positive sortings were seeded in the 96-well plates to generate single-cell clones.

[0247] 3) After calculating the cells, a total of three cells were seeded in each well of a 96-well plate in 150 pL media.

[0248] 4) The media on these cells was changed on regular basis after every 3 days.

[0249] 5) At around day 12-14, the plates were screened and the wells with only single healthy clones were marked.

[0250] 6) The selected clones were passaged into a fresh 96 well and incubated for another 2-3 days to reach 80-90% confluency.

[0251] 7) On reaching the confluency, the single-cell clones were passaged from one to three wells.

[0252] 8) When confluent, the cells from one well were used to extract genomic DNA, whereas the cells from the other two wells were frozen back for SCNT.

[0253] 9) The successful transgene integration was confirmed by multiple overlapping PCRs and long-range PCRs.

[0254] 10) Only the clones with monoallelic or biallelic insertion of the complete transgenes expression cassette at the GGTA1 locus were used for SCNT.

[0255] The above-described workflow to generate single cell-clones is illustrated in Figure 6.

[0256] Correctly targeted cell clones were used for somatic cell nuclear transfer (SCNT) according to a standard protocol (Kurome et al., 2015).

[0257] Key points about the single-cell clones

[0258] 1) The integration of a complete transgene cassette (including both hCD46 and hTBM) at the targeted GGTA1-E8 locus was confirmed in the SCCs.

[0259] 2) SCCs can have either monoallelic or biallelic transgene insertion.

[0260] 3) It is a one-step knockout / knock-in model. If the transgene is integrated at the GGTA1-E8 locus, the GGTA1 is automatically knocked out.

[0261] 4) Hence, in the case of biallelic insertion of the transgenes at the GGTA1-E8 locus, both GGTA1 alleles are knocked out (Figure 7A). Whereas, in the case of monoallelic insertion, the knockout of the second GGTA1 allele was confirmed by sanger sequencing (Figure 7B). 5) Both types of SCCs with either monoallelic or biallelic transgenes insertion were used in the SCNT (Figure 8A). Each time, the recipient got pregnant but there was a fetal / conceptus resorption between weeks 5-7 (Figure 8B).

[0262] 6) On necropsy of a couple of recipients at week 6 or 7 respectively, the elongated conceptuses could be recovered but no fetal tissue development could be detected (Figure 9B).

[0263] 7) The analysis of the recovered tissue showed that it had an integration of complete transgene (as confirmed in SCCs before SCNT), and also expressed hCD46 and hTBM.

[0264] Thus, overall, although a few initial pregnancies were established, no full-term development of the cloned embryos was obtained. It was concluded that the selection of single-cell clones may be detrimental to the SCNT efficacy of the cells. Based on the results from different SCNTs and observations during the generation of SCCs, early conceptus / fetal resorption may be due to the stress on the cells during the generation of SCCs and due to the simultaneous strong expression of two human transgenes, in particular of hCD46.

[0265] Example 2.4: Bulk cell sample approach

[0266] In view of the above-described failure of the single-cell clone approach, a screening procedure was established to select cells lacking alphaGai and expressing hCD46, resulting in bulk cell samples. After the initial negative and positive sorting of the cells (see Example 2.2 above), the following protocol was used for the generation of bulk cell samples by super screening:

[0267] 1) All the plates used in this protocol were collagen-coated.

[0268] 2) To generate bulk cell samples, the cells collected after the initial negative and positive sorting were cultured further.

[0269] 3) Depending upon the number of cells recovered after MACS sorting, the cells were seeded in an appropriately sized plate (6-well or 10 cm).

[0270] 4) On reaching confluency, the cells were again subjected to both negative and positive sorting with biotin-labeled Isolectin IB4 or biotin-labeled hCD46 antibody respectively.

[0271] 5) Similarly, the cells were processed through a third round of negative and positive sorting.

[0272] 6) At the final step, the cells were sorted only using the hCD46 antibody, and frozen back for SCNT.

[0273] 7) Multiple screenings ensure the removal of any false negative or false positive cells from the bulk cell population.

[0274] The above-described workflow to generate bulk cell samples for SCNT is illustrated in Figure 10.

[0275] Example 2.5: Somatic cell nuclear transfer using bulk cell samples

[0276] Key points about the bulk samples 1) The bulk cells are a mixed population of cells, and were sorted multiple times for only isolectin IB4 and hCD46 antibody, i.e. the absence of Gal epitope and presence of hCD46, but not for hTBM (Figure 11A). The super-screened population of cells was used for SCNT.

[0277] 2) Western blot using the protein samples from these bulk cells confirmed the expression of both transgenes, hCD46 and hTBM, in these cells (Figure 11B). However, it cannot ascertain if every cell expressed both proteins.

[0278] 3) Although these cells express the transgenes, the integration site of the transgenes cannot be determined in each cell of this population. However, when the animals were born through SCNT using these cells, the integration site of the transgenes was confirmed by nanopore sequencing and this data is shown below.

[0279] Somatic cell nuclear transfer

[0280] 1) A male pKC-AUCK cell line was used in this experiment.

[0281] 2) Embryos were generated using the cells from the bulk samples and using two recipients 100-150 embryos were transferred / recipient.

[0282] • Embryo transfer date - Friday 20-05-2022

[0283] • Birth date -12-09-2022

[0284] 3) A total of 4 animals were born alive (# 13225, 13227, 13228, 13229), and one animal was stillborn (#13226) without any apparent abnormalities (Figure 12).

[0285] 4) Tail samples were collected from the animals and used for immunohistochemical analysis.

[0286] 5) Genomic DNA was extracted from the tail samples for PCR-based detection of the transgene and nanopore sequencing.

[0287] Example 2.6: Analysis of piglets

[0288] Immunohistochemical analysis of the newborn piglets

[0289] IHC was performed for immunodetection of 3 different molecules (Gal epitope, hCD46, hTBM). None of the piglets had Gal epitope (Figure 13), indicating successful knockout of the GGTA1. All liveborn piglets had a strong expression of hCD46 (Figure 14). None of the liveborn piglets expressed hTBM, whereas the stillborn piglet had a strong hTBM expression (Figure 15).

[0290] Nanopore sequencing of DNA from liveborn piglets to confirm the integration site

[0291] Nanopore sequencing was performed using the genomic DNA from each liveborn piglet. The sequencing result of one of the piglets for the total inserted sequence is shown in SEQ. ID NO: 27. The sequence from the targeted region was aligned against the transgenes expression cassette with an extended length of homology arms. The Integrative Genomics Viewer (IGV) was used for alignment. The following conclusions were generated from the nanopore sequencing data:

[0292] 1) A transgenes expression cassette was inserted at the GGTA1 E8 locus, which is in accordance with the experimental design.

[0293] 2) At the start of the expression cassette, a fragment of the donor plasmid had a reverse orientation (marked by blue circles in Figure 16) compared to the remaining correctly-integrated DNA. However, the chimeric intron, hCD46-promoter, and the hCD46-minigene sequence had the correct orientation. It is suggested that the strong expression of hCD46 in these liveborn piglets is being driven by the hCD46-promoter.

[0294] 3) The last part of the transgene expression cassette (belonging to hTBM cDNA) was missing (marked by red circles in Figure 16). This explains why the liveborn piglets had no hTBM expression.

[0295] 4) Sanger sequencing data further suggested that there was no off-target or random integration of the transgene cassette in any of the liveborn piglets.

[0296] 5) The transgene cassette was inserted in only one GGTA1 allele (hereafter called allele 1), whereas the GGTA1 allele 2 had only a mutation at the E8-sgRNA target site (Figure 17).

[0297] 6) All above-described features, including the mutation on GGTA1 allele 2, were similar in all liveborn piglets. As the cells used in this SCNT were from a bulk sample cultured for over two weeks, each cell divides multiple times resulting in the presence of identical cells in the culture. A tremendous similarity between the liveborn piglets suggests that they might have originated from the SCNT of the identical cells present in the bulk cell samples.

[0298] A schematic diagram depicting the genotype of the 4 liveborn piglets is shown in Figure 18. All liveborn piglets had GGTA1 knockout and a monoallelic transgene insertion at GGTA1 locus.

[0299] A more detailed depiction of the total inserted sequence is shown in Figure 19A. Figure 19B depicts the total inserted sequence plus flanking genomic regions.

[0300] The nucleotide sequence of the insert assumed to be present in all liveborn piglets is shown in SEQ ID NO: 14. This sequence was generated based on the nanopore sequencing results, wherein presumed sequencing errors were corrected based on the known sequence of the transfected plasmid when possible. The nucleotide sequence of the insert plus flanking genomic regions is shown in SEQ ID NO: 15.

[0301] Tissue expression profiling ofhCD46 in one of the liveborn piglets

[0302] Due to the striking similarities between all liveborn piglets, there is a prevailing opinion that these piglets are identical. To determine the expression of hCD46 in different tissues, one of the liveborn piglets (#13227) was sacrificed and the tissue samples were collected for immunodetection of hCD46 by IHC. IHC results showed a strong hCD46 expression in all tissues including the heart (both atrium and ventricle), kidneys, lungs, pancreas, and liver (Figure 20). These data show that the about 800 bp hCD46 promoter sequence is sufficient to provide excellent expression of hCD46.

[0303] Concluding remarks for the piglets

[0304] 1) Analysis of DNA from the stillborn piglet by PCR and Oxford Nanopore sequencing showed that the targeting construct was completely integrated, but immunohistochemical analysis of tissue samples revealed low / absent hCD46 expression and high hTBM expression, but not on the endothelium (data not shown).

[0305] 2) The four liveborn piglets had a strong expression of hCD46.

[0306] 3) For one of these four liveborn animals, strong hCD46 expression in all tested tissues was shown.

[0307] 4) As the liveborn piglets are strikingly similar and possibly originated from identical cells, the tissue expression profile of hCD46 in these animals should also be similar.

[0308] 5) A pKC cell line from the sacrificed liveborn animal # 13227 was generated. These cells have been used for the integration of other transgenes such as hTBM into different exons of the GGTA1 locus (see following Example 2.7). A list of additional modifications can also be taken from WO 2019 / 185936, which is incorporated herein in its entirety.

[0309] Example 2.7: Insertion of hTBM into exon 6 of GGTA1 under a ubiquitous promotor

[0310] The pKC cell line from the existing hCD46 transgenic background described above has been used to target separate expression cassettes for hTBM into exon 6 of the GGTA1 locus. In one approach, the expression cassette comprised hTBM under the control of the CAG promoter (Figure 21A). The nucleotide sequence of the expression cassette comprising hTBM under the control of the CAG promoter is shown in SEQ ID NO: 22. In another approach, the expression cassette comprised hTBM under the control of the EF1A promoter (Figure 21B). The nucleotide sequence of the expression cassette comprising hTBM under the control of the EF1A promoter is shown in SEQ ID NO: 23. An overview of the two approaches is shown in Figure 21C. For both approaches, cells were transfected and successfully screened for hCD46 and hTBM expression. In particular, the nucleofected cells were MACS sorted twice using hTBM antibody (Figure 21D and E), and the resultant bulk cell population was used for SCNT.

[0311] A schematic diagram depicting the predicted genotype for the cells with hTBM under the CAG promoter is shown in Figure 22A. The predicted genomic nucleotide sequence is shown in SEQ ID NO: 24. A schematic diagram depicting the predicted genotype for the cells with hTBM under the EF1A promoter is shown in Figure 22B. The predicted genomic nucleotide sequence is shown in SEQ ID NO: 25.

[0312] Example 2.8: New targeting vector with linked expression cassettes for hCD46 and hTBM In another approach not relying on the existing hCD46 transgenic background described above, unmodified Al pig kidney cells were transfected with a new targeting vector with linked expression cassettes for hCD46 and hTBM, wherein hCD46 is under the control of the native hCD46 promoter. Cells were successfully screened for hCD46 and hTBM expression. A schematic diagram depicting the predicted genotype for the cells transfected with the new targeting vector is shown in Figure 23. The predicted genomic nucleotide sequence is shown in SEQ ID NO: 26.

[0313] Example 2.9: Insertion of hTBM into exon 6 of GGTA1 under an endothelial promotor

[0314] Ubiquitous hTBM expression may be detrimental for SCNT and the generation of genetically modified pigs. Therefore, in another approach, a separate expression cassette for hTBM was targeted to exon 6 of the GGTA1 locus and the human thrombomodulin (hTBM) was under a non-ubiquitous, endothelial- specific promoter. In one approach, the expression cassette comprised the hTBM under the control of the endothelial-specific ICAM2 promoter (Figure 24A). The nucleotide sequence of the expression cassette comprising hTBM under the endothelial-specific ICAM2 promoter is shown in SEQ ID NO: 46. In another approach, the expression cassette comprised hTBM under control of an endothelial-specific porcine TBM promoter (Figure 24B). The nucleotide sequence of the expression cassette comprising hTBM under the control of the endothelial-specific porcine TBM promoter is shown in SEQ ID NO: 49. Prior to introducing these expression cassettes into kidney cells of the genetically modified porcine kidney cells from Auckland pigs (GGTAlKO / hCD46), these expression cassettes were introduced into unmodified porcine kidney cells from Auckland pigs. For both expression cassettes, unmodified porcine kidney cells from Auckland pigs (pKC-AUCK) were transfected with the RNP complex and the donor plasmid by nucleofection. The cells were screened for the absence of alpha Gal using IB-4 lectin by magnetic-activated cell sorting (MACS) system from Miltenyi Biotec. Negatively screened cells were used to generate single-cell clones (Figure 24C). The single cell clones were further screened by PCR to confirm the presence of the transgene integration at the targeted site (see Figures 24D, E). Either single-cell clones or bulk cell samples were used for SCNT.

[0315] Example 2.10: Insertion of hB2M / HLA-Gl under CAG promoter at GGTA1 Exon 6 locus

[0316] B2M-HLA-G fusion proteins can significantly delay allogeneic graft rejection. Therefore, a separate expression cassette for hB2M / HLA-Gl under CAG promoter that targets Exon 6 of the GGTA1 locus was generated (Figure 25A). The nucleotide sequence of the expression cassette comprising expression of hB2M / HLA-Gl under CAG promoter is shown in SEQ ID NO: 51.

[0317] In another approach, a hTBM under endogenous porcine TBM promoter and hB2M / HLA-Gl under CAG promoter will be cloned in the same expression cassette / donor plasmid. In one approach the new targeting vector will comprise a linked expression cassette for hTBM under ICAM2 promoter and hB2M / HLA under CAG (Figure 25B). In another approach the new targeting vector will comprise a linked expression cassette for hTBM under an endothelial-specific porcine TBM promoter and hB2M / HLA under CAG (Figure 25C).

[0318] The hB2M / HLA-Gl / hTBM expression cassettes will be integrated at GGTA-1 Exon 6 locus by CRISPR-Cas9 based HDR. WT Auckland Island kidney cells (male or female) will be electroporated with the RNP complex targeting GGTA1 Exon 6 and the dual-cut donor plasmid carrying hTBM under endogenous porcine TBM promoter and hB2M / HLA-Gl under CAG promoter. 3-4 days post-nucleofection, the cells will be screened for the absence of alpha Gal epitope using IB-4 lectin and for the presence of hB2M / HLA-Gl using anti- HLA-G1 antibody. Double screened cells will be either used for SCNT as a bulk sample or used for generating single-cell clones (SCCs). The single-cell clones will be verified for successful targeted integration of transgene expression cassette by multiple PCRs. SCCs with correct genetic modifications will be used for SCNT.

[0319] Example 3: Development of Line B

[0320] For the development of TKO pigs, primary kidney cells from Al pigs were electroporated with Cas9 protein and guide RNAs specific for the GGTA1, CMAH, and B4GALNT2 / B4GALNT2L genes (Figure 26). The cells were then seeded and selected for the absence of aGal, Neu5Gc, and Sd(a). Bulk cells were used for SCNT and the first piglets with frameshift mutations were obtained.

[0321] SEQUENCES

[0322] INDUSTRIAL APPLICABILITY

[0323] The genetically modified porcine cell, genetically modified porcine organ and genetically modified pig of the present invention are useful in research as well as medicine, e.g., for xenotransplantations. The methods of the present invention are useful for producing the genetically modified porcine cell, the genetically modified porcine organ and the genetically modified pig of the present invention. Thus, the products and methods of the present invention are industrially applicable.

[0324] REFERENCES

[0325] G. Byrne, S. Ahmad-Villiers, Z. Du, C. McGregor, B4GALNT2 and xenotransplantation: A newly appreciated xenogeneic antigen. Xenotransplantation 25, el2394 (2018).

[0326] E. Cozzi, D. J. White, The generation of transgenic pigs as potential organ donors for humans. Nat Med 1, 964-966 (1995). P. J. Cowan, S. C. Robson, Progress towards overcoming coagulopathy and hemostatic dysfunction associated with xenotransplantation. Int J Surg 23, 296-300 (2015).

[0327] Y. Cui et al., Evidence for GTKO / P4GalNT2KO Pigs as the Preferred Organ-source for Old World Nonhuman Primates as a Preclinical Model of Xenotransplantation. Transplant Direct 6, e590 (2020).

[0328] J. L. Estrada et al., Evaluation of human and non-human primate antibody binding to pig cells lacking GGTAl / CMAH / beta4GalNT2 genes. Xenotransplantation 22, 194-202 (2015).

[0329] C. E. Goerlich et al., The growth of xenotransplanted hearts can be reduced with growth hormone receptor knockout pig donors. J Thorac Cardiovasc Surg 10.1016 / j.jtcvs.2021.07.051 (2021).

[0330] J.W. Godwin et al., Towards endothelial cell-specific transgene expression in pigs: characterization of the pig ICAM-2 promoter. Xenotransplantation 13: 514-521 (2006).

[0331] A. Hinrichs et al., Growth hormone receptor-deficient pigs resemble the pathophysiology of human Laron syndrome and reveal altered activation of signaling cascades in the liver. Mol Metab 11, 113-128 (2018).

[0332] A. Hinrichs et al., Growth hormone receptor knockout to reduce the size of donor pigs for preclinical xenotransplantation studies. Xenotransplantation 28, el2664 (2021).

[0333] H. Iwase et al., Pig-to-baboon heterotopic heart transplantation-exploratory preliminary experience with pigs transgenic for human thrombomodulin and comparison of three costimulation blockade-based regimens. Xenotransplantation 22, 211-220 (2015).

[0334] H. Iwase et al., Evidence suggesting that deletion of expression of N-glycolylneuraminic acid (Neu5Gc) in the organ-source pig is associated with increased antibody-mediated rejection of kidney transplants in baboons. Xenotransplantation 28, el2700 (2021 a).

[0335] H. Iwase et al., Growth hormone receptor knockout: Relevance to xenotransplantation. Xenotransplantation 28, el2652 (2021 b).

[0336] Konu§ OL, Ozdemir A, Akkaya A, Erba§ G, Celik H, l§ik S. Normal liver, spleen, and kidney dimensions in neonates, infants, and children: evaluation with sonography. AJR Am J Roentgenol. 1998 Dec;171(6):1693- 8. PubMed PMID: 9843315.

[0337] Kourtzelis I, Magnusson PU, Kotlabova K, Lambris JD, & Chavakis T (2015) Regulation of instant blood mediated inflammatory reaction (IBMIR) in pancreatic islet xenotransplantation: points for therapeutic inventions. Advances in experimental medicine and biology 865:171-188. M. Kurome, B. Kessler, A. Wuensch, H. Nagashima, E. Wolf, Nuclear transfer and transgenesis in the pig. Methods Mol Biol 1222, 37-59 (2015).

[0338] Lange et al., Genetic diversity, growth and heart function of Auckland Island pigs, a potential source for organ xenotransplantation. Xenotransplantation 31(2): el2858 (2024).

[0339] M. Langin et al., Consistent success in life-supporting porcine cardiac xenotransplantation. Nature 564, 430-433 (2018).

[0340] G. Lexer et al., Hyperacute rejection in a discordant (pig to baboon) cardiac xenograft model. J Heart Transplant 5, 411-418 (1986).

[0341] Loveland BE, Milland J, Kyriakou P, Thorley BR, Christiansen D, Lanteri MB, van Regensburg M, Duffield M, French AJ, Williams L, Baker L, Brandon MR, Xing P-X, Kahn D, McKenzie IFC. Characterization of a CD46 transgenic pig and protection of transgenic kidneys against hyperacute rejection in nonimmunosuppressed baboons. Xenotransplantation 2004; 11: 171-183.

[0342] M. M. Mohiuddin et al., B-cell depletion extends the survival of GTKO.hCD46Tg pig heart xenografts in baboons for up to 8 months. Am J Transplant 12, 763-771 (2012).

[0343] M. M. Mohiuddin et al., Chimeric 2C10R4 anti-CD40 antibody therapy is critical for long-term survival of GTKO.hCD46.hTBM pig-to-primate cardiac xenograft. Nat Commun 7, 11138 (2016).

[0344] M. M. Mohiuddin et al., Progressive genetic modifications of porcine cardiac xenografts extend survival to 9 months. Xenotransplantation 10.1111 / xen.12744, el2744 (2022).

[0345] R. N. Pierson, 3rd et al., Progress Toward Cardiac Xenotransplantation. Circulation 142, 1389-1398 (2020).

[0346] Rao UV, Wagner HN Jr. Normal weights of human organs. Radiology. 1972 Feb;102(2):337-9. PubMed PMID: 5009936.

[0347] B. Reichart et al., Cardiac xenotransplantation: from concept to clinic. Cardiovasc Res 118, 3499-3516 (2023).

[0348] A. Richter, et al., Potential of primary kidney cells for somatic cell nuclear transfer mediated transgenesis in pig. BMC Biotechnol 12: 84 (2012). doi: 10.1186 / 1472-6750-12-84. E. O. Riedel et al., Functional changes of the liver in the absence of growth hormone (GH) action - Proteomic and metabolomic insights from a GH receptor deficient pig model. Mol Metab 36, 100978 (2020).

[0349] E. J. Salvaris et al., Pig endothelial protein C receptor is functionally compatible with the human protein C pathway. Xenotransplantation 27 , el2557 (2020).

[0350] A. Shimizu et al., Thrombotic microangiopathy associated with humoral rejection of cardiac xenografts from alphal,3-galactosyltransferase gene-knockout pigs in baboons. Am J Pathol 172, 1471-1481 (2008).

[0351] M. Sykes, D. H. Sachs, Transplanting organs from pigs to humans. Sci Immunol 4, eaau6298 (2019).

[0352] D. J. G. White, G. Langford, E. Cozzi, V. K. Young, Production of pigs transgenic for human DAF: A strategy for xenotransplantation. Xenotransplantation 2, 213-217 (1995).

[0353] T. Yamamoto et aL, Old World Monkeys are less than ideal transplantation models for testing pig organs lacking three carbohydrate antigens (Triple-Knockout). Sci Rep 10, 9771 (2020 a).

[0354] T. Yamamoto et al., The final obstacle to successful pre-clinical xenotransplantation? Xenotransplantation 27, el2596 (2020 b).

[0355] T. Yamamoto, H. Hara, D. Ayares, D. K. C. Cooper, The problem of the "4th xenoantigen" after pig organ transplantation in non-human primates may be overcome by expression of human "protective" proteins. Xenotransplantation 28, el2658 (2021).

Claims

CLAIMS1. A porcine cell comprising the following genetic modification (a):(a) a genomic insertion of a polynucleotide (i) comprising a CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, wherein the promoter element consists of at least a part of the native CD46 promoter and / or achieves a CD46 expression level between 0.1-fold and 10-fold of the CD46 expression level that is achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 1.

2. The porcine cell according to claim 1, wherein the promoter element consists of the nucleotide sequence shown in SEQ ID NO: 1, and wherein the promoter element consists of the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence.

3. The porcine cell according to claim 1 or 2, wherein the promoter element achieves about the same CD46 expression level as the CD46 expression level that is achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence shown in SEQ ID NO: 1.

4. The porcine cell according to any one of claims 1 to 3, wherein the CD46 is human CD46 and the CD46 promoter is the human CD46 promoter.

5. The porcine cell according to any one of claims 1 to 4, wherein the polynucleotide (i) consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence shown in SEQ ID NO: 14, preferably wherein the polynucleotide (i) consists of the nucleotide sequence shown in SEQ ID NO: 14.

6. The porcine cell according to any one of claims 1 to 5, wherein the polynucleotide (i) is inserted into an exon of the endogenous GGTA1 gene, preferably into exon 8 of the endogenous GGTA1 gene.

7. The porcine cell according to any one of claims 1 to 6, further comprising the following genetic modification (b):(b) a genomic insertion of a polynucleotide (ii) comprising a thrombomodulin (TBM) expression sequence and a promoter element that controls the expression of the TBM expression sequence, preferably wherein the TBM is human TBM.

8. The porcine cell according to any one of claims 1 to 7 , further comprising the following genetic modifications (c), (d) and (e):(c) a disruption of the endogenous alpha-1, 3-galactosyltransferase (GGTA1) gene;(d) a disruption of the endogenous cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) gene; and(e) a disruption of the endogenous R-l,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2) gene and a disruption of the endogenous B4GALNT2-like (B4GALNT2L) gene.

9. The porcine cell according to any one of claims 1 to 8, wherein the porcine cell is a primary porcine kidney cell and / or wherein the porcine cell is derived from an Auckland Island pig.

10. A porcine organ comprising the porcine cell according to any one of claims 1 to 9.

11. A pig comprising the porcine cell according to any one of claims 1 to 9 or the porcine organ according to claim 10.

12. The porcine cell according to any one claims 1 to 9, the porcine organ according to claim 10, or the pig according to claim 11 for use in a method of xenotransplantation.

13. A method for producing a genetically modified pig, wherein the method comprises in the following order: exposing a population of porcine cells to genome-modifying treatment, isolating a non-clonal subpopulation of porcine cells comprising the genomic modification, using the non-clonal subpopulation of the genetically modified porcine cells for somatic cell nuclear transfer (SCNT).

14. The method according to claim 13, wherein the non-clonal subpopulation of genetically modified porcine cells that is used for SCNT comprises at least 10 different clonal subpopulations.

15. The method according to claim 13 or 14, wherein the genetically modified pig is the pig according to claim 11.

Images