T cell receptors that bind presented hpv16-, mart1-, cmv-, ebv-, or influenza- peptides

EP4720109A1Pending Publication Date: 2026-04-08REGENERON PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-05-24
Publication Date
2026-04-08

AI Technical Summary

Technical Problem

Current methods for identifying and targeting low-frequency T cell reactivities in patients require large blood volumes and do not provide direct pairing of TCR ligand information for immunogenic antigen selection and therapeutic development.

Method used

The Rapid TCR:Epitope Ranker (RAPTER) assay uses single cell RNA sequencing and hash-tag oligonucleotide coding to assess functional T cell reactivity, allowing for the identification of T cell receptors that specifically bind to HPV16-, MART1-, CMV-, EBV-, or influenza-peptides, and their use in therapeutic applications.

Benefits of technology

Enables the identification of low-frequency T cell clones and functionally confirmed TCRs that activate T cell responses, facilitating targeted therapies for diseases associated with these antigens, such as HPV16-related cancers and viral infections.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024030997_28112024_PF_FP_ABST
    Figure US2024030997_28112024_PF_FP_ABST
Patent Text Reader

Abstract

Described herein are isolated T cell receptors that specifically bind to an HLA-displayed HPV16-, MART1-, CMV-, EBV-, or influenza-peptide, as well as therapeutic and diagnostic methods of using those isolated TCRs.
Need to check novelty before this filing date? Find Prior Art

Description

T CELL RECEPTORS THAT BIND PRESENTED HPV16-, MART1-, CMV-, EBV-, OR INFLUENZA- PEPTIDES CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No.63 / 579,554, filed on August 30, 2023, and U.S. Provisional Application No 63 / 504,425, filed on May 25, 2023, the disclosures of each of which are hereby incorporated by reference in their entirety. SEQUENCE LISTING

[0002] A Sequence Listing in XML format entitled “11384WO01 Sequence Listing XML.xml”, which was created May 22, 2024, and is 1222 Kb, is incorporated herein by reference in its entirety. BACKGROUND OF THE INVENTION

[0003] T cell receptors (TCRs) are membrane bound heterodimers comprising α and β chains, each resembling an immunoglobulin variable (V) and constant (C) region. The TCR α chain includes a V-α chain covalently linked to a C-α chain, whereas the β chain includes a V-β chain covalently linked to a C-β chain. The V-α and V-β chains form a pocket or cleft that can bind an antigen in the context of a major histocompatibility complex (MHC) (known in humans as an HLA complex).

[0004] TCRs are primary effectors of the immune system that have unique advantages as a platform for developing therapeutics. While conventional antibody therapeutics are limited to recognition of pathogens in the blood and extracellular spaces, or to protein targets on the cell surface, T cell receptors can recognize antigens displayed with MHC molecules on the surface of cells, including antigens derived from intracellular proteins. Depending on the subtype of T cells that recognize displayed antigen and become activated, TCRs can participate in controlling various immune responses. For instance, T cells are involved in regulation of the humoral immune response through induction of differentiation of B cells into antibody producing cells. In addition, activated T cells act to initiate cell-mediated immune responses. Thus, TCRs can recognize additional targets not available to antibodies. In addition, TCRs have been reported to 1  mediate cell killing, increase B cell proliferation, and impact the development and severity of various disorders including cancer, allergies, viral infections, and autoimmune disorders.

[0005] In view of the function of TCRs, antigen-specific TCRs have been evaluated for use in immunotherapy for their ability to redirect T cells to tumors expressing an antigen of interest. TCRs will bind to a small peptide, only 8-12 amino acids in length, which are bound on the surface of a target cell by the Major Histocompatibility Complex (MHC). TCRs can therefore recognize intracellular antigens derived from cancer or viral proteins because these antigens are processed and displayed as peptides in the context of the surface MHC. Hence, TCRs can recognize additional internal cell targets not available to conventional antibodies or therapies that cannot penetrate the cell.

[0006] Identifying epitopes that T cells respond to is critical to understanding T cell- mediated immunity. There remains a need to identify low-frequency T cell reactivities using primary cells from low blood volumes, where the resulting paired TCR ligand information can directly allow for immunogenic antigen selection for vaccine epitope inclusion, antigen-specific TCR tracking, and TCR cloning for further therapeutic development. SUMMARY OF THE INVENTION

[0007] Using a Rapid TCR:Epitope Ranker (RAPTER) assay, which is a single cell RNA sequencing (scRNA-SEQ) method that uses primary human T cells and antigen presenting cells (APCs) to assess functional T cell reactivity at single cell resolution, and hash-tag oligonucleotide (HTO) coding and T cell activation-induced markers (AIM), defined paired epitope specificity and TCR sequence were assessed. Described herein are low-frequency circulating HPV16-specific T cell clones from a cervical cancer patient. Additionally, described herein are T Cell Receptors (TCRs) identified by RAPTER that target MART1, EBV, CMV, and influenza epitopes that are functionally confirmed in in vitro assays.

[0008] In some embodiments, the invention provides a TCR (e.g., an isolated TCR or a TCR expressed on an isolated cell) that specifically binds to an HLA presented HPV16-, MART1-, CMV-, EBV-, or influenza-peptide and is identified using a RAPTER method, wherein the antigen-binding protein exhibits one or more of the following characteristics: (i) comprises an alpha chain variable (TCR V ^) domain comprising a complementarity determining region ( ^CDR) 1, ^CDR2 and / or ^CDR3 at least 95% identical to an amino acid sequence as set 2  forth in Table 9, and / or (ii) comprises a beta chain variable (TCR V ^) domain comprising a complementarity determining region ( ^CDR) 1, ^CDR2, and / or ^CDR3 at least 95% identical to an amino acid sequence as set forth in Table 9; and / or (iii) comprises a TCR V ^ domain at least 95% identical to an amino acid sequence as set forth in Table 9, and / or (iv) a TCR V ^ domain at least 95% identical to an amino acid sequence as set forth in Table 9; and / or (v) does not specifically bind to cells expressing predicted off-target peptides but not an HLA-presented HPV16-, MART1-, CMV-, EBV-, or influenza-peptide, as determined by a luminescence assay; and / or (vi) activates a T cell response about two times greater than a patient-derived HPV16-, MART1-, CMV-, EBV-, or influenza-specific TCR, e.g., activates a T cell response about two times greater, or about three times greater, or about four times greater than a patient-derived HPV16-, MART1-, CMV-, EBV-, or influenza-specific TCR as determined by a TCR-mediated T cell signaling luminescent bioassay.

[0009] Also described herein are isolated cells expressing a TCR variable domain and / or a TCR α / β variable domain pair as described herein, isolated polynucleotide molecules encoding a TCR variable domain and / or TCR α / β variable domain pair as described herein, targeting vectors comprising polynucleotides described herein, isolated cells expressing the targeting vectors descried herein, and pharmaceutical compositions comprising the TCR variable domains and / or TCR α / β variable domain pairs, cells, and / or polynucleotides described herein. Also described are methods of using (i) a TCR α / β variable domain specific for an HPV16 peptide as described herein, e.g., in methods of treating an HPV-16 related disease in a patient in need thereof, (ii) a TCR α / β variable domain specific for a MART1 peptide as described herein, e.g., in methods of treating an MART1 related disease in a patient in need thereof, (iii) a TCR α / β variable domain specific for an EBV peptide as described herein, e.g., in methods of treating an EBV related disease in a patient in need thereof, or (iv) a TCR α / β variable domain specific for an influenza peptide as described herein, e.g., in methods of treating influenza in a patient in need thereof.

[0010] Accordingly, provided herein is a T cell receptor (TCR), or a variable domain thereof, comprising: (i) a TCR ^ variable (TCR V ^) domain comprising a TCR ^ complementarity determining region ( ^CDR) 1, an ^CDR2, and / or an ^CDR3 that is 90% identical to an αCDR1, αCDR2 and / or αCDR3 amino acid sequence set forth in Table 9; and / or (ii) a TCR ^ variable (TCR V ^) domain comprising a TCR ^ complementarity determining region 3  ( ^CDR) 1, a ^CDR2, and / or a ^CDR3 that is 90% identical to a βCDR1, βCDR2 and / or βCDR3 amino acid sequence set forth in Table 9, wherein the TCR or variable domain thereof specifically binds to an HLA presented peptide, and optionally wherein the TCR, or variable domain thereof, has been identified using a Rapid TCR:Epitope Ranker (RAPTER) assay method.

[0011] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 comprising an amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence of a TCR V ^ domain as set forth in Table 9; and / or (ii) a ^CDR3 comprising an amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence of a TCR V ^ domain as set forth in Table 9.

[0012] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ domain as set forth in Table 9; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ domain as set forth in Table 9.

[0013] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain comprising an amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence as set forth in Table 9; and / or (ii) a TCR V ^ domain comprising an amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence as set forth in Table 9.

[0014] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 comprising an amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9; and (ii) a ^CDR3 comprising an amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence of the TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9.

[0015] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ domain as set forth in Table 9; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to 4  a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ domain as set forth in Table 9.

[0016] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain comprising an amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9; and (ii) a TCR V ^ domain comprising an amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence of the TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9.

[0017] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 comprising an ^CDR3 amino acid sequence of a TCR V ^ domain as set forth in Table 9; and / or (ii) a ^CDR3 comprising a ^CDR3 amino acid sequence of a TCR V ^ domain as set forth in Table 9.

[0018] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ domain as set forth in Table 9, respectively; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ domain as set forth in Table 9, respectively.

[0019] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain comprising a TCR V ^ domain amino acid sequence as set forth in Table 9; and / or (ii) a TCR V ^ domain comprising a TCR V ^ domain amino acid sequence as set forth in Table 9.

[0020] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 comprising a ^CDR3 amino acid sequence of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9; and (ii) a ^CDR3 comprising a ^CDR3 amino acid sequence of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9.

[0021] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9.

[0022] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ amino acid sequence of a TCR V ^ ^V ^ amino acid sequence pair as set 5  forth in Table 9; and (ii) a TCR V ^ amino acid sequence of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9.

[0023] In some embodiments, the HLA presented peptide comprises an HPV16-peptide.

[0024] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 133, 149, 165, 181, 197, and 213; and / or (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 sequence selected from the group consisting of SEQ ID NOs: 141, 157, 173, 189, 205, and 221.

[0025] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 129-131-133; 145-147-149; 161-163-165; 177-179-181; 193-195-197; and 209-211-213; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 137-139-141; 153-155-157; 169- 171-173; 185-187-189; 201-203-205; and 217-219-221.

[0026] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 135, 151, 167, 183, 199, and 215; and / or (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 143, 159, 175, 191, 207, and 223.

[0027] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 133, 149, 165, 181, 197, and 213; and (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 141, 157, 173, 189, 205, and 221.

[0028] In some embodiments, the TCR, or variable domain thereof, as described herein comprises:

[0029] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR3 / ^CDR3 amino acid sequence pair at least 95% identical to an 6  ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 133 / 141, 149 / 157, 165 / 173, 181 / 189, 197 / 205, and 213 / 221.

[0030] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 133 / 141, 149 / 157, 165 / 173, 181 / 189, 197 / 205, and 213 / 221.

[0031] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 129-131-133; 145-147-149; 161-163-165; 177-179-181; 193-195-197; and 209-211-213; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 137-139-141; 153-155-157; 169- 171-173; 185-187-189; 201-203-205; and 217-219-221.

[0032] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 129-131-133-137-139-141; 145- 147-149-153-155-157; 161-163-165-169-171-173; 177-179-181-185-187-189; 193-195-197- 201-203-205; and 209-211-213-217-219-221.

[0033] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 129-131-133-137-139-141; 145-147-149- 153-155-157; 161-163-165-169-171-173; 177-179-181-185-187-189; 193-195-197-201-203- 205; and 209-211-213-217-219-221.

[0034] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 135, 151, 167, 183, 199, and 215; and (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 143, 159, 175, 191, 207, and 223. 7

[0035] In some embodiments, the TCR, or variable domain thereof, as described herein comprises a TCR V ^ ^V ^ amino acid sequence pair at least 95% identical to a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 135 / 143; 151 / 159; 167 / 175; 183 / 191; 199 / 207; and 215 / 223.

[0036] In some embodiments, the TCR, or variable domain thereof, as described herein comprises a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 135 / 143; 151 / 159; 167 / 175; 183 / 191; 199 / 207; and 215 / 223.

[0037] In some embodiments, the HLA presented peptide comprises a MART1-peptide.

[0038] In some embodiments, the TCR, or variable domain thereof, as described herein comprises:

[0039] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 965, 981, 997, 1013, 1029, 1045, 1061, 1077, 1093, 1109, and 1125; and / or (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 sequence selected from the group consisting of SEQ ID NOs: 973, 989, 1005, 1021, 1037, 1053, 1069, 1085, 1101, 1117, and 1133.

[0040] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequence selected from the group consisting of SEQ ID NOs: 961-963-965; 977-979-981; 993-995-997; 1009-1011-1013; 1025-1027-1029; 1041-1043-1045; 1057-1059- 1061; 1073-1075-1077; 1089-1091-1093; 1105-1107-1109; and 1121-1123-1125; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 969-971-973; 985-987-989; 1001-1003-1005; 1017-1019-1021; 1033-1035-1037; 1049-1051-1053; 1065-1067-1069; 1081- 1083-1085; 1097-1099-1101; 1113-1115-1117; and 1129-1131-1133.

[0041] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111, and 1127; and / or (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the 8  group consisting of SEQ ID NOs: 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119, and 1135.

[0042] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 965, 981, 997, 1013, 1029, 1045, 1061, 1077, 1093, 1109, and 1125; and (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 973, 989, 1005, 1021, 1037, 1053, 1069, 1085, 1101, 1117, and 1133.

[0043] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR3 / ^CDR3 amino acid sequence pair at least 95% identical to an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 965 / 973, 981 / 989, 997 / 1005, 1013 / 1021, 1029 / 1037, 1045 / 1053, 1061 / 1069, 1077 / 1085, 1093 / 1101, 1109 / 1117, and 1125 / 1133.

[0044] In some embodiments, the TCR, or variable domain thereof, as described herein comprises a ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 965 / 973, 981 / 989, 997 / 1005, 1013 / 1021, 1029 / 1037, 1045 / 1053, 1061 / 1069, 1077 / 1085, 1093 / 1101, 1109 / 1117, and 1125 / 1133.

[0045] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 961-963-965; 977-979-981; 993-995-997; 1009-1011-1013; 1025-1027-1029; 1041-1043-1045; 1057-1059- 1061; 1073-1075-1077; 1089-1091-1093; 1105-1107-1109; and 1121-1123-1125; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 969-971-973; 985-987-989; 1001-1003-1005; 1017-1019-1021; 1033-1035-1037; 1049-1051-1053; 1065-1067-1069; 1081- 1083-1085; 1097-1099-1101; 1113-1115-1117; and 1129-1131-1133.

[0046] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 961-963-965-969-971-973; 977- 9  979-981-985-987-989; 993-995-997-1001-1003-1005; 1009-1011-1013-1017-1019-1021; 1025- 1027-1029-1033-1035-1037; 1041-1043-1045-1049-1051-1053; 1057-1059-1061-1065-1067- 1069; 1073-1075-1077-1081-1083-1085; 1089-1091-1093-1097-1099-1101; 1105-1107-1109- 1113-1115-1117; and 1121-1123-1125-1129-1131-1133.

[0047] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 961-963-965-969-971-973; 977-979-981- 985-987-989; 993-995-997-1001-1003-1005; 1009-1011-1013-1017-1019-1021; 1025-1027- 1029-1033-1035-1037; 1041-1043-1045-1049-1051-1053; 1057-1059-1061-1065-1067-1069; 1073-1075-1077-1081-1083-1085; 1089-1091-1093-1097-1099-1101; 1105-1107-1109-1113- 1115-1117; and 1121-1123-1125-1129-1131-1133.

[0048] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111, and 1127; and (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119, and 1135.

[0049] In some embodiments, the TCR, or variable domain thereof, as described herein comprises a TCR V ^ ^V ^ amino acid sequence pair at least 95% identical to a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 967 / 975, 983 / 991, 999 / 1007, 1015 / 1023, 1031 / 1039, 1047 / 1055, 1063 / 1071, 1079 / 1087, 1095 / 1103, 1111 / 1119, and 1127 / 1135.

[0050] In some embodiments, the TCR, or variable domain thereof, as described herein comprises a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 967 / 975, 983 / 991, 999 / 1007, 1015 / 1023, 1031 / 1039, 1047 / 1055, 1063 / 1071, 1079 / 1087, 1095 / 1103, 1111 / 1119, and 1127 / 1135.

[0051] In some embodiments, the HLA presented peptide comprises a CMV-peptide.

[0052] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 21, 37, 53, 69, 85, 101, and 117; 10  and / or (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 sequence selected from the group consisting of SEQ ID NOs: 13, 29, 45, 61, 77, 93, 109, and 125.

[0053] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequence selected from the group consisting of SEQ ID NOs: 1-3-5; 17-19- 21; 33-35-37; 49-51-53; 65-67-69; 81-83-85; 97-99-101; and 113-115-117; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 9-11-13; 25-27-29; 41-43-45; 57- 59-61; 73-75-77; 89-91-93; 105-107-109; and 121-123-125.

[0054] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 23, 39, 55, 71, 87, 103, and 119; and / or (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 15, 31, 47, 63, 79, 95, 111, and 127.

[0055] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 21, 37, 53, 69, 85, 101, and 117; and (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 29, 45, 61, 77, 93, 109, and 125.

[0056] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR3 / ^CDR3 amino acid sequence pair at least 95% identical to an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 5 / 13, 21 / 29, 37 / 45, 53 / 61, 69 / 77, 85 / 93, 101 / 109, and 117 / 125.

[0057] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 5 / 13, 21 / 29, 37 / 45, 53 / 61, 69 / 77, 85 / 93, 101 / 109, and 117 / 125.

[0058] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 1-3-5; 17-19- 11  21; 33-35-37; 49-51-53; 65-67-69; 81-83-85; 97-99-101; and 113-115-117; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 9-11-13; 25-27-29; 41-43-45; 57- 59-61; 73-75-77; 89-91-93; 105-107-109; and 121-123-125.

[0059] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 1-3-5-9-11-13; 17-19-21-25-27- 29; 33-35-37-41-43-45; 49-51-53-57-59-61; 65-67-69-73-75-77; 81-83-85-89-91-93; 97-99-101- 105-107-109; and 113-115-117-121-123-125.

[0060] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 1-3-5-9-11-13; 17-19-21-25-27-29; 33-35- 37-41-43-45; 49-51-53-57-59-61; 65-67-69-73-75-77; 81-83-85-89-91-93; 97-99-101-105-107- 109; and 113-115-117-121-123-125.

[0061] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 23, 39, 55, 71, 87, 103, and 119; and (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 15, 31, 47, 63, 79, 95, 111, and 127.

[0062] In some embodiments, the TCR, or variable domain thereof, as described herein comprises a TCR V ^ ^V ^ amino acid sequence pair at least 95% identical to a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 7 / 15, 23 / 31, 39 / 47, 55 / 63, 71 / 79, 87 / 95, 103 / 111, and 119 / 127.

[0063] In some embodiments, the TCR, or variable domain thereof, as described herein comprises a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 7 / 15, 23 / 31, 39 / 47, 55 / 63, 71 / 79, 87 / 95, 103 / 111, and 119 / 127.

[0064] In some embodiments, the HLA presented peptide comprises an EBV-peptide. 12

[0065] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 229, 245, 261, 277, 293, 309, 325, 341, 357, 373, 389, 405, and 421; and / or (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 sequence selected from the group consisting of SEQ ID NOs: 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413, and 429.

[0066] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequence selected from the group consisting of SEQ ID NOs: 225-227-229; 241-243-245; 257-259-261; 273-275-277; 289-291-293; 305-307-309; 321-323-325; 337-339- 341; 353-355-357; 369-371-373; 385-387-389; 401-403-405; and 417-419-421; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 233-235-237; 249-251-253; 265-267-269; 281-283-285; 297-299-301; 313-315-317; 329-331-333; 345-347-349; 361-363- 365; 377-379-381; 393-395-397; 409-411-413; 425-427-429.

[0067] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407, and 423; and / or (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415, and 431.

[0068] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 229, 245, 261, 277, 293, 309, 325, 341, 357, 373, 389, 405, and 421; and (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413, and 429.

[0069] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR3 / ^CDR3 amino acid sequence pair at least 95% identical to an 13  ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 229 / 237, 245 / 253, 261 / 269, 277 / 285, 293 / 301, 309 / 317, 325 / 333, 341 / 349, 357 / 365, 373 / 381, 389 / 397, 405 / 413, and 421 / 429.

[0070] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 229 / 237, 245 / 253, 261 / 269, 277 / 285, 293 / 301, 309 / 317, 325 / 333, 341 / 349, 357 / 365, 373 / 381, 389 / 397, 405 / 413, and 421 / 429.

[0071] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 225-227-229; 241-243-245; 257-259-261; 273-275-277; 289-291-293; 305-307-309; 321-323-325; 337-339- 341; 353-355-357; 369-371-373; 385-387-389; 401-403-405; and 417-419-421; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 233-235-237; 249-251-253; 265-267-269; 281-283-285; 297-299-301; 313-315-317; 329-331-333; 345-347-349; 361-363- 365; 377-379-381; 393-395-397; 409-411-413; and 425-427-429.

[0072] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 225-227-229-233-235-237; 241- 243-245-249-251-253; 257-259-261-265-267-269; 273-275-277-281-283-285; 289-291-293- 297-299-301; 305-307-309-313-315-317; 321-323-325-329-331-333; 337-339-341-345-347- 349; 353-355-357-361-363-365; 369-371-373-377-379-381; 385-387-389-393-395-397; 401- 403-405-409-411-413; and 417-419-421-425-427-429.

[0073] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 225-227-229-233-235-237; 241-243-245- 249-251-253; 257-259-261-265-267-269; 273-275-277-281-283-285; 289-291-293-297-299- 301; 305-307-309-313-315-317; 321-323-325-329-331-333; 337-339-341-345-347-349; 353- 355-357-361-363-365; 369-371-373-377-379-381; 385-387-389-393-395-397; 401-403-405- 409-411-413; and 417-419-421-425-427-429. 14

[0074] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407, and 423; and (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415, and 431.

[0075] In some embodiments, the TCR, or variable domain thereof, as described herein comprises a TCR V ^ ^V ^ amino acid sequence pair at least 95% identical to a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 231 / 239, 247 / 255, 263 / 271, 279 / 287, 295 / 303, 311 / 319, 327 / 335, 343 / 351, 359 / 367, 375 / 383, 391 / 399, 407 / 415, and 423 / 431.

[0076] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 231 / 239, 247 / 255, 263 / 271, 279 / 287, 295 / 303, 311 / 319, 327 / 335, 343 / 351, 359 / 367, 375 / 383, 391 / 399, 407 / 415, and 423 / 431.

[0077] In some embodiments, the HLA presented peptide comprises an influenza- peptide.

[0078] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 437, 453, 469, 485, 501, 517, 533, 549, 565, 581, 597, 613, 629, 645, 661, 677, 693, 709, 725, 741, 757, 773, 789, 805, 821, 837, 853, 869, 885, 901, 917, 933, and 949; and / or (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 sequence selected from the group consisting of SEQ ID NOs: 445, 461, 477, 493, 509, 525, 541, 557, 573, 589, 605, 621, 637, 653, 669, 685, 701, 717, 733, 749, 765, 781, 797, 813, 829, 845, 861, 877, 893, 909, 925, 941, and 957.

[0079] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequence selected from the group consisting of SEQ ID NOs: 433-435-437; 449-451-453; 465-467-469; 481-483-485; 497-499-501; 513-515-517; 529-531-533; 545-547- 549; 561-563-565; 577-579-581; 593-595-597; 609-611-613; 625-627-629; 641-643-645; 657- 15  659-661; 673-675-677; 689-691-693; 705-707-709; 721-723-725; 737-739-741; 753-755-757; 769-771-773; 785-787-789; 801-803-805; 817-819-821; 833-835-837; 849-851-853; 865-867- 869; 881-883-885; 897-899-901; 913-915-917; 929-931-933; and 945-947-949; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 441-443-445; 457-459-461; 473-475-477; 489-491-493; 505-507-509; 521-523-525; 537-539-541; 553-555-557; 569-571- 573; 585-587-589; 601-603-605; 617-619-621; 633-635-637; 649-651-653; 665-667-669; 681- 683-685; 697-699-701; 713-715-717; 729-731-733; 745-747-749; 761-763-765; 777-779-781; 793-795-797; 809-811-813; 825-827-829; 841-843-845; 857-859-861; 873-875-877; 889-891- 893; 905-907-909; 921-923-925; 937-939-941; and 953-955-957.

[0080] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, and 951; and / or (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687, 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943, and 959.

[0081] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 437, 453, 469, 485, 501, 517, 533, 549, 565, 581, 597, 613, 629, 645, 661, 677, 693, 709, 725, 741, 757, 773, 789, 805, 821, 837, 853, 869, 885, 901, 917, 933, and 949; and (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 445, 461, 477, 493, 509, 525, 541, 557, 573, 589, 605, 621, 637, 653, 669, 685, 701, 717, 733, 749, 765, 781, 797, 813, 829, 845, 861, 877, 893, 909, 925, 941, and 957.

[0082] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR3 / ^CDR3 amino acid sequence pair at least 95% identical to an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 437 / 445, 453 / 461, 469 / 477, 485 / 493, 501 / 509, 517 / 525, 533 / 541, 549 / 557, 565 / 573, 581 / 589, 16  597 / 605, 613 / 621, 629 / 637, 645 / 653, 661 / 669, 677 / 685, 693 / 701, 709 / 717, 725 / 733, 741 / 749, 757 / 765, 773 / 781, 789 / 797, 805 / 813, 821 / 829, 837 / 845, 853 / 861, 869 / 877, 885 / 893, 901 / 909, 917 / 925, 933 / 941, and 949 / 957.

[0083] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 437 / 445, 453 / 461, 469 / 477, 485 / 493, 501 / 509, 517 / 525, 533 / 541, 549 / 557, 565 / 573, 581 / 589, 597 / 605, 613 / 621, 629 / 637, 645 / 653, 661 / 669, 677 / 685, 693 / 701, 709 / 717, 725 / 733, 741 / 749, 757 / 765, 773 / 781, 789 / 797, 805 / 813, 821 / 829, 837 / 845, 853 / 861, 869 / 877, 885 / 893, 901 / 909, 917 / 925, 933 / 941, and 949 / 957.

[0084] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 433-435-437; 449-451-453; 465-467-469; 481-483-485; 497-499-501; 513-515-517; 529-531-533; 545-547- 549; 561-563-565; 577-579-581; 593-595-597; 609-611-613; 625-627-629; 641-643-645; 657- 659-661; 673-675-677; 689-691-693; 705-707-709; 721-723-725; 737-739-741; 753-755-757; 769-771-773; 785-787-789; 801-803-805; 817-819-821; 833-835-837; 849-851-853; 865-867- 869; 881-883-885; 897-899-901; 913-915-917; 929-931-933; and 945-947-949; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 441-443-445; 457-459-461; 473-475-477; 489-491-493; 505-507-509; 521-523-525; 537-539-541; 553-555-557; 569-571- 573; 585-587-589; 601-603-605; 617-619-621; 633-635-637; 649-651-653; 665-667-669; 681- 683-685; 697-699-701; 713-715-717; 729-731-733; 745-747-749; 761-763-765; 777-779-781; 793-795-797; 809-811-813; 825-827-829; 841-843-845; 857-859-861; 873-875-877; 889-891- 893; 905-907-909; 921-923-925; 937-939-941; and 953-955-957.

[0085] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 433-435-437-441-443-445; 449- 451-453-457-459-461; 465-467-469-473-475-477; 481-483-485-489-491-493; 497-499-501- 505-507-509; 513-515-517-521-523-525; 529-531-533-537-539-541; 545-547-549-553-555- 557; 561-563-565-569-571-573; 577-579-581-585-587-589; 593-595-597-601-603-605; 609- 17  611-613-617-619-621; 625-627-629-633-635-637; 641-643-645-649-651-653; 657-659-661- 665-667-669; 673-675-677-681-683-685; 689-691-693-697-699-701; 705-707-709-713-715- 717; 721-723-725-729-731-733; 737-739-741-745-747-749; 753-755-757-761-763-765; 769- 771-773-777-779-781; 785-787-789-793-795-797; 801-803-805-809-811-813; 817-819-821- 825-827-829; 833-835-837-841-843-845; 849-851-853-857-859-861; 865-867-869-873-875- 877; 881-883-885-889-891-893; 897-899-901-905-907-909; 913-915-917-921-923-925; 929- 931-933-937-939-941; and 945-947-949-953-955-957.

[0086] In some embodiments, the TCR, or variable domain thereof, as described herein comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 433-435-437-441-443-445; 449-451-453- 457-459-461; 465-467-469-473-475-477; 481-483-485-489-491-493; 497-499-501-505-507- 509; 513-515-517-521-523-525; 529-531-533-537-539-541; 545-547-549-553-555-557; 561- 563-565-569-571-573; 577-579-581-585-587-589; 593-595-597-601-603-605; 609-611-613- 617-619-621; 625-627-629-633-635-637; 641-643-645-649-651-653; 657-659-661-665-667- 669; 673-675-677-681-683-685; 689-691-693-697-699-701; 705-707-709-713-715-717; 721- 723-725-729-731-733; 737-739-741-745-747-749; 753-755-757-761-763-765; 769-771-773- 777-779-781; 785-787-789-793-795-797; 801-803-805-809-811-813; 817-819-821-825-827- 829; 833-835-837-841-843-845; 849-851-853-857-859-861; 865-867-869-873-875-877; 881- 883-885-889-891-893; 897-899-901-905-907-909; 913-915-917-921-923-925; 929-931-933- 937-939-941; and 945-947-949-953-955-957.

[0087] In some embodiments, the TCR, or variable domain thereof, as described herein comprises: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, and 951; and (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687, 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943, and 959.

[0088] In some embodiments, the TCR, or variable domain thereof, as described herein comprises a TCR V ^ ^V ^ amino acid sequence pair at least 95% identical to a TCR V ^ ^V ^ 18  amino acid sequence pair selected from the group consisting of SEQ ID NOs: 439 / 447, 455 / 463, 471 / 479, 487 / 495, 503 / 511, 519 / 527, 535 / 543, 551 / 559, 567 / 575, 583 / 591, 599 / 607, 615 / 623, 631 / 639, 647 / 655, 663 / 671, 679 / 687, 695 / 703, 711 / 719, 727 / 735, 743 / 751, 759 / 767, 775 / 783, 791 / 799, 807 / 815, 823 / 831, 839 / 847, 855 / 863, 871 / 879, 887 / 895, 903 / 911, 919 / 927, 935 / 943, and 951 / 959.

[0089] In some embodiments, the TCR, or variable domain thereof, as described herein comprises a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 439 / 447, 455 / 463, 471 / 479, 487 / 495, 503 / 511, 519 / 527, 535 / 543, 551 / 559, 567 / 575, 583 / 591, 599 / 607, 615 / 623, 631 / 639, 647 / 655, 663 / 671, 679 / 687, 695 / 703, 711 / 719, 727 / 735, 743 / 751, 759 / 767, 775 / 783, 791 / 799, 807 / 815, 823 / 831, 839 / 847, 855 / 863, 871 / 879, 887 / 895, 903 / 911, 919 / 927, 935 / 943, and 951 / 959.

[0090] Also provided here is a nucleic acid molecule comprising a sequence encoding the TCR, or variable domain thereof, as described herein.

[0091] Also provided herein is a complex comprising the TCR, or variable domain thereof, as described herein, and a moiety selected from the group consisting of: a ligand, a detectable moiety and a therapeutic moiety.

[0092] Also provided herein is a cell comprising the TCR, or variable domain thereof, as described herein, optionally wherein the cell is a T cell.

[0093] Also provided herein is a host cell comprising he TCR, or variable domain thereof, as described herein.

[0094] Also provided herein is a pharmaceutical composition comprising the TCR, or variable domain thereof, as described herein, and a pharmaceutically acceptable excipient.

[0095] Also provided herein is a TCR, or variable domain thereof, a nucleic acid encoding the same, a complex comprising the same, a cell or host cell comprising the same, or a pharmaceutical composition comprising the same, as described herein, for use in the treatment of a HPV16-, MART1-, CMV-, EBV-, or influenza-associated disease or disorder.

[0096] Also provided herein is a use of a TCR, or variable domain thereof, a nucleic acid encoding the same, a complex comprising the same, a cell or host cell comprising the same, or a pharmaceutical composition comprising the same, as described herein, in the manufacture of a medicament for the treatment of a HPV16-, MART1-, CMV-, EBV-, or influenza-associated disease or disorder. 19

[0097] Also provided herein is a method of treating a HPV16-, MART1-, CMV-, EBV-, or influenza-associated disease or disorder, comprising administering to a subject in need a TCR, or variable domain thereof, a nucleic acid encoding the same, a complex comprising the same, a cell or host cell comprising the same, or a pharmaceutical composition comprising the same, as described herein.

[0098] In some embodiments of the uses and methods as described herein, the HLA presented peptide is derived from a polypeptide selected from the group consisting of: CMV pp65, HPV16 E6-p1, HPV16 E6-p2, EBV BMLF1, EBV LMP2A, EBV YVL, Influenza M1, Influenza M2, and MART1. BRIEF DESCRIPTION OF THE DRAWINGS

[0099] FIG.1A, FIG.1B, FIG.1C, FIG.1D, FIG.1E, FIG.1F, and FIG.1G provide an illustration (not to scale) of a non-limiting exemplary RAPTER assay embodiment of the invention. RAPTER uses hashing reagents and T cell activation-induced markers (AIMs) to select and characterize antigen-specific T cells. (FIG.1A) In this schematic, PBMCs were distributed evenly across assay wells. Desired T cell stimuli (protein, peptides, RNA, etc.) were added to individual wells in an arrayed format and cultured with cells for the desired assay time. (FIG.1B) Following stimulation, T cells from each well were labeled with unique hash tag oligonucleotide (HTO)-labeled reagents, e.g., anti-CD2 antibodies, to zip-code the assay well location of all T cells and, hence, their corresponding antigen exposure. (FIG.1C) HTO-labeled samples were pooled and stained with desired flow cytometry and scRNA-SEQ reagents, including fluorescently tagged antibodies and CITE-seq antibodies. (FIG.1D) Antigen-specific T cells were isolated by fluorescence activated cell sorting (FACS) using T cell AIMs for functional enrichment. (FIG.1E) Sorted cells were loaded into the 10X Genomics single cell Chromium partitioner and 5’ sequencing libraries for the transcriptome, HTO, TCR-seq, and, if desired, CITE-seq, and oligo-multimers were generated for HT sequencing. (FIG.1F) Individual HTO assignments were bioinformatically demultiplexed to link individual T cell TCR and phenotype with specific antigen reactivity. (FIG.1G) Antigen-specific TCR sequences were further resolved by evaluating frequency, clone size, and level of CD137 / 4-1BB expression.

[0100] FIG.2A, FIG.2B, FIG.2C, FIG.2D, FIG.2E, FIG.2F, and FIG.2G show that activation-induced markers (AIMs) were upregulated on antigen-specific T cells following 20  antigen-specific activation. T cells from a CMV serum positive, HLA-A*02:01+ healthy donor (HD1) were expanded for 10 days in the presence of CMV pp65 peptide (NLVPMVATV; SEQ ID NO: 1283) for these proof-of-concept tests. (FIG.2A) Pre-expanded T cells were restimulated with cognate CMV pp65 peptide in RAPTER assay culture conditions over a 96- hour time course. The percentages of AIM+ CD8+ T cells were assessed by flow cytometry. (FIG.2B) Pre-expanded T cells were restimulated with DMSO or CMV pp65 peptide (NLVPMVATV; SEQ ID NO: 1283) for 24 hrs. The percentages of CMV pp65 dextramer+ and CD137 / 4-1BB CD8+ T cells were assessed by flow cytometry. (FIG.2C) The percentage of CD137 / 4-1BB+ T cells within the dextramer+ T cell population post-restimulation was assessed by flow cytometry. (FIG.2D) T cells from HD1 and three additional HDs with varying HLA haplotypes and CMV positivity were expanded for 10 days in the presence of CMV pp65 peptide (NLVPMVATV; SEQ ID NO: 1283). The percentages of CMV pp65 dextramer+ and CD137 / 4- 1BB CD8+ T cells post-restimulation was assessed by flow cytometry. (FIG.2E) Pre-expanded T cells from HD1 were restimulated with DMSO or CMVpp65 peptide for 24 hrs and the percentages of dextramer+, CD137 / 4-1BB+, and PD-1+ CD8+ T cells were assessed by flow cytometry. (FIG.2F) CMV pp65 and MART1 dextramer+, and CMV pp65 CD137 / 4-1BB+, and PD-1+ CD8+ T cells were isolated by FACS then analyzed by scTCR-SEQ. Heat map shows the percent overlap between TCR sequences across conditions. All dextramer+ TCRs were compared to CD137 / 4-1BB+, and PD-1+ TCRs with clone sizes >= 10 cells. (FIG.2G) CMV pp65 and MART1 dextramer+, and CMV pp65 CD137 / 4-1BB+, and PD-1+ CD8+ T cells were isolated by FACS then analyzed by scTCR-SEQ. The heat map shows the percent overlap between TCR sequences across conditions. All dextramer+ TCRs were compared to CD137 / 4-1BB+, and PD-1+ TCRs with clone sizes >= 1 cell.

[0101] FIG.3A, FIG.3B, FIG.3C, FIG.3D, FIG.3E, FIG.3F, and FIG.3G show RAPTER’s limit of detection. PBMCs from an HLA-A*02:01+healthy donor were cultured for 10 days with an HLA-A*02:01-restricted MART1 peptide (ELAGIGILTV; SEQ ID NO: 1284) to expand epitope-specific T cells. (FIG.3A) The percent of MART1 dextramer+CD8+T cells pre- and post- expansion was assessed by flow cytometry. (FIG.3B) MART1 peptide-expanded T cells were diluted with unexpanded autologous T cells in a 2-fold dilution series (theoretical MART1+range: 4.26% to 0.02% of total CD8+T cells). T cells from each dilution point were re- stimulated for 24 hr with cognate MART1 peptide. Each dilution point was uniquely hashed, 21  then all samples were pooled. CD137 / 4-1BB+CD3+T cells and MART1 dextramer+CD8+T cells were isolated by FACS for scRNA / TCR-seq. (FIG.3C) HTO demultiplexing was performed to assign CD137 / 4-1BB+, MART1-reactive T cells to specific dilution points. TCR clone sizes range from 1-140 cells (Gray: clone was not present. Blue: clone size=1). All TCR clones that overlapped with dextramer sorted clones are shown. Expected percent dextramer+CD8+T cells in each sample is indicated on the left of the TCR clone map. (FIG.3D) Uniform Manifold Approximation and Projection (UMAP) plot of MART1+dextramer-sorted and RAPTER-sorted CD8+T cells. A total of 3,554 CD137 / 4-1BB+, MART1-reactive CD8+T cells were captured and comprised 565 unique clones (red) and 9,930 of MART1 dextramer+T cells were captured and comprised 587 unique clones (aqua). MART1+T cells from the dextramer and RAPTER sorts were resolved into 7 distinct phenotypic UMAP clusters based on RNA-seq data. (FIG.3E) Heat map showing the most differentially expressed genes in each cluster and violin plots of relevant phenotypic and functional T cell markers. (FIG.3F) Schematic representation of AP-1 firefly luciferase reporter assay. (FIG.3G) Luciferase activity in Jurkat-TCR cells expressing MART1 (ELAGIGILTV; SEQ ID NO: 1284) epitope-reactive TCRs. Firefly luciferase activity was measured in Jurkat-TCR cultured with DC alone treated with DMSO (black circles), Jurkat-TCR cultured alone (black squares) or with dendritic cells pulsed with a CEF peptide pool (black triangles), MART1 peptide (blue open circles), or DC treated with anti- CD3 and anti-CD28 antibodies (black open triangles). MART1 TCRs identified in both the RAPTER and dextramer binding assays (DR3,4,5), in just the RAPTER assay (R3), in the dextramer binding assay (D1, D3, D5) or as background in the RAPTER assay (B6) were tested.

[0102] FIG.4A, FIG.4B, and FIG.4C show gating strategies to isolate antigen specific CD8+T cells. PBMCs from an HLA-A*02:01+healthy donor were cultured for 10 days with an HLA-A*02:01-restricted MART1 peptide (ELAGIGILTV; SEQ ID NO: 1284) to expand epitope-specific T cells. MART1 peptide-expanded T cells were diluted with unexpanded autologous T cells in a 2-fold dilution series, then re-stimulated for 24 hr with cognate MART1 peptide. Each dilution point was uniquely hashed, then all samples were pooled (FIG.4B). (FIG.4A) Upper-level FACS gating including the FMO gate for the PE channel. (FIG.4B) CD137 / 4-1BB+CD3+T cells and (FIG.4C) MART1 dextramer+CD8+T cells were isolated by FACS for scRNA / TCR-seq. 22

[0103] FIG.5A and FIG.5B show flow cytometry analyses of frequencies of antigen specific CD8+ T cells. PBMCs from an HLA-A*02:01+ healthy donor were stained with individual PE-conjugated oligo-tagged dextramers (HLA haplotype matched and unmatched). Dextramer+ cells were gated to assess the abundance of antigen specific CD8+ T cells for each epitope. (FIG.5A) Gating strategies for CD8+ dextramer+ T cells. (FIG.5B) Flow cytometry plots of CD8+ dextramer+ T cells associated with individual dextramer specificities. The percentage of CD8+ T cells that were stained positive for the indicated dextramer is shown in each plot.

[0104] FIG.6A and FIG.6B show pooled oligo-tagged dCODE dextramer screens. (FIG.6A) Schematic summarizing the pooled oligo-tagged dextramer staining workflow. PBMC from a healthy donor were stained with a pool of 23 PE-conjugated oligo-tagged dCODE dextramers to detect antigen-specific T cells. Additional flow cytometry and CITE-seq reagents for FACS and cell surface protein detection by CITE-seq were also applied. (FIG.6B) Cells were sorted on a Sony MA900 FACS machine to isolate CD8+ dextramer+ T cells for scRNA- SEQ.

[0105] FIG.7A, FIG.7B, FIG.7C, and FIG.7D show clonally expanded epitope- specific TCRs identified in both RAPTER and a pooled oligo-tagged dextramer assays. PBMCs from an HLA-A*02:01+, A*29:02+, B*35:01+, and B*57:01+ healthy donor were expanded for 7 days with 22 HLA haplotyped matched and unmatched peptides to expand epitope-specific T cells. (FIG.7A) Schematic describing the RAPTER and pooled dextramer workflows that were performed on peptide-expanded T cells. Peptide-expanded T cells were divided and tested in either the RAPTER assay (top panel) or a pooled oligo-tagged dCODE dextramer assay with 24 unique pooled dextramers (bottom panel). (FIG.7B) UMAP displaying CD8+ T cell clusters from the dCODE dextramer and RAPTER assays. (FIG.7C) Heat map showing the most differentially expressed genes in the dCODE dextramer and RAPTER+ T cell clusters (left panel) and Venn diagrams representing paired TCR a / b chain sequence overlap between dextramer+CD8+ T cells pre- (gray) and post-expansion (white) for all TCR clones (top), clone sizes >1 (middle) and >10 (bottom). (FIG.7D) Correlation plots of paired TCR a / b chain sequence overlap between peptide expanded dextramer+ (y-axis) versus peptide expanded RAPTER+ (x-axis) CD8+ T cells across clone sizes (log10 scale). The dashed lines indicate TCR clone sizes >= 5 cells. 23

[0106] FIG.8 shows HPV antigen-specific T cell reactivity in PBMC from an HPV+ cervical cancer patient. Cryopreserved PBMC from an HLA-A*02:01+ cervical cancer patient were tested in an IFNγ ELISpot assay after resting overnight. The number of IFNγ+ spots per 2x105PBMCs indicated was obtained following an overnight stimulation with pools of 15-mer overlapping peptides derived from the HPV proteins E6, E7 and L1, or with short peptides of common viral antigens of CMV, EBV and influenza M (collectively referred to as “CEF”).

[0107] FIG.9A, FIG.9B, FIG.9C, FIG.9D, FIG.9E, FIG.9F, FIG.9G, FIG.9H, and FIG.9I show viral memory T cell detection in a cervical patient blood sample. (FIG.9A) 30 x 106PBMCs from an HLA-A*02:01+ patient with early-stage, treatment-naïve cervical cancer were tested in an IFNγ ELISPOT assay for reactivity against a panel of human papilloma virus (HPV) E615-mer synthetic long peptides (SLP) and 5 HLA-A*02:01-restricted CEF 9-mer peptides. The number of IFNγ spots per 2x105 PBMC is shown. (FIG.9B) UMAP of total sorted CD8+ T cells and CD137 / 4-1BB+ T cells from the RAPTER assay. Unexpanded PBMCs from the patient in FIG.9A were tested in RAPTER to identify HPV16 E6 and CEF peptide specific CD8+ T cells. (FIG.9C) RAPTER signal was demultiplexed by HTO labels to assign individual T cells with cognate peptide reactivities. Out of a total of 3129 T cells, 352 unique TCR clones were identified. TCR clone size (y-axis) was plotted for each HTO designation (x- axis). (FIG.9D) Feature map violin plots of relevant phenotypic and functional T cell markers. (FIG.9E) TCR clones identified by RAPTER to be specific for HPV and CEF epitopes were projected onto the scRNA-SEQ UMAP from FIG.9B. The color scale represents the TCR clone size. (FIG.9F) UMAP of total sorted CD8+T cells and CD137 / 4-1BB+T cells from the RAPTER assay of this Figure (left panel) and heat map showing the most differentially expressed genes for each T cell cluster in the UMAP (right panel). (FIG.9G) Heat map showing the top 16 differentially expressed genes among the Influenza M, HPV16_E6_101, EBV BMLF1, and LMP2A reactive T cell clusters from FIG.9E. (FIG.9H) TCR sequences that correspond to influenza A epitope (GILGFVFTL [SEQ ID NO: 1287], HTO84) and EBV BMLF1 epitope (GLCTLVAML [SEQ ID NO: 1286], HTO83) were cloned and functionally tested in a Jurkat-TCR luciferase reporter assay. Luciferase activity in Jurkat-TCR cells expressing Influenza M (GILGFVFTL; SEQ ID NO: 1287) or EBV BMLF1 (GLCTLVAML; SEQ ID NO: 1286) epitope-reactive TCRs. The relative abundance of each TCR from the RAPTER assay is indicated and the specific clone frequency is provided under the TCR name. 24  Luciferase activity was measured in Jurkat-TCR cultured alone or Jurkat-TCR co-cultured with dendritic cells pulsed with indicated peptides. (FIG.9I) Luciferase activity in Jurkat-TCR cells engineered with two non-specific background TCRs that were associated with multiple HTO at low frequencies.

[0108] FIG.10A, FIG.10B, FIG.10C, FIG.10D, FIG.10E, and FIG.10F show that both anti-CD2 antibody- and lipid-based hashing reagents enable efficient identification of T cells based on HTO classification. Each aliquot of T cells was labeled with two HTOs: a uniquely barcoded anti-CD2 antibody and a separate, uniquely barcoded lipid HTO. After staining, the aliquots were washed and pooled for capture. (FIG.10A and FIG.10B) Histograms of raw HTO UMI distributions for each anti-CD2 antibody (FIG.10A, hTag_105_regn through hTag_144_regn, in left-to-right, top-to-bottom order) or lipid HTO (FIG.10B, hTag_145_regn through hTag_171_regn, followed by hTag_173_regn through hTag_184_regn, in left-to-right, top-to-bottom order). (FIG.10C and FIG.10D) Number of cells identified as doublet, negative, or singlet based on independent classification using anti- CD2 antibody (FIG.10C) or lipid HTO (FIG.10D) demultiplexing. Triplicate captures are shown. (FIG.10E) Comparison of cell classification between anti-CD2 antibody and lipid HTOs. Lipid HTO demultiplexing was largely concordant with anti-CD2 antibody HTO classification. (FIG.10F) Matrix showing the percentage of total cells classified by all possible antibody:lipid HTO pairs. The input pairing for each T cell aliquot is on the diagonal and was recovered by HTO demultiplexing.

[0109] FIG.11A and FIG.11B demonstrate how CMV pp65+ T cells were expanded in culture to enable proof-of-concept experiments. (FIG.11A) The baseline percentage of CMV pp65 dextramer+ CD8+ T cells from a CMV serum positive, HLA-A*02:01+ healthy donor (HD1) was assessed by flow cytometry. (FIG.11B) HD1 T cells were expanded in culture for 10 days in the presence of CMV pp65 peptide (NLVPMVATV; SEQ ID NO: 1283) and DC and T cell supporting cytokines. Post-expansion, the percentage of CMV pp65 dextramer+ CD8+ T cells was determined by flow cytometry.

[0110] FIG.12 shows that activation-induced markers are upregulated on antigen- specific T cells following antigen-specific activation. T cells from a CMV serum positive, HLA- A*02:01+ healthy donor (HD1) were expanded for 10 days in the presence of CMV pp65 peptide (NLVPMVATV; SEQ ID NO: 1283) to enable proof-of-concept tests. Expanded T cells 25  were restimulated with DMSO or CMV pp65 peptide (NLVPMVATV; SEQ ID NO: 1283) for 24 hrs. The percentages of CD8+ T cells that stain positive for the indicated AIMs were assessed by flow cytometry. The CD137 / 4-1BB+ CD8+ T cells within each AIM+ gate are indicated by the blue-red color scale. The T cells within the dashed outlines of each dot plot indicate the cells with the highest CD137 / 4-1BB as shown by the dashed box on the color scale.

[0111] FIG.13A, FIG.13B, FIG.13C, FIG.13D, and FIG.13E show the fluorescence activated cell sorting (FACS) gating strategy to isolate CD8+ T cell populations for scRNA- and TCR-seq analysis. (FIG.13A) FACS upper-level gating including the fluorescence minus one (FMO) gate for the PE channel. (FIG.13B) CD137 / 4-1BB+ CD8+ T cells. (FIG.13C) PD-1+ CD8+ T cells. (FIG.13D) CMV pp65 dextramer+ CD8+ T cells. (FIG.13E) MART1 dextramer+ CD8+ T cells.

[0112] FIG.14A and FIG.14B demonstrate how CMV pp65 and MART1 dextramer+, and CMV pp65 CD137 / 4-1BB+, and PD-1+ CD8+ T cells were isolated by FACS then analyzed by scTCR-SEQ. (FIG.14A) Total scRNA-SEQ captures from all samples pre-filtering and (FIG.14B) post-filtering to select TCR sequences with paired ^ and ^ chains. Any TCR captures with multiple chains were eliminated from analysis.

[0113] FIG.15A, FIG.15B, FIG.15C, FIG.15D, FIG.15E, FIG.15F, FIG.15G, FIG.15H, FIG.15I, and FIG.15J show flow cytometry plots of dextramer specificity of MART1 TCRs identified in the dextramer assay (FIG.15A, FIG.15B, FIG.15C, and FIG. 15D), RAPTER assay (FIG.15E), or both assays (FIG.15F and FIG.15G). TCR-engineered Jurkat cells expressing the MART1 ELAGIGILTV (SEQ ID NO: 1284) epitope reactive TCRs were stained with the MART1 ELAGIGILTV (SEQ ID NO: 1284) dextramer (FIG.15A, FIG. 15B, FIG.15C, FIG.15D, FIG.15E, FIG.15F, FIG.15G, and FIG.15H) or a negative control dextramer. Representative negative control dextramer stain (FIG.15I) and FMO control (FIG.15J) are shown.

[0114] FIG.16A, FIG.16B, FIG.16C, FIG.16D, FIG.16E, and FIG.16F show that epitope-specific memory T cell expansion maintains clonal T cells. PBMC from an HLA- A*02:01+, A*29:02+, B*35:01+, and B*57:01+ healthy donor were expanded for 7 days with HLA haplotyped matched and unmatched peptides (see Table 3 in the Examples below) to expand epitope-specific T cells. (FIG.16A) UMAP plot of unexpanded (n=6592 cells) and peptide expanded (n=3453 cells) total CD8+ T cells resolved into 7 distinct UMAP clusters 26  using scRNA-SEQ data. (FIG.16B) Feature maps representing the clonal frequencies of total unexpanded, and peptide expanded TCR sequences for paired TCR a / b chains. (FIG.16C) Stacked plots representing individual paired TCR a / b chain sequences in the pre-expansion versus peptide expanded CD8+ T cells from the memory (left panel) and naïve (right panel) T cell compartments. T cell memory phenotype was determined using RNA- and CITE-seq data. (FIG.16D) Venn diagrams representing paired TCR a / b chain sequence overlap between pre- (gray) and post-expansion (white) CD8+ T cells (All clones, clones >=2 cells, and clones >=10 cells). (FIG.16E) Violin plots of relevant phenotypic and functional T cell markers for the unexpanded and expanded CD8+ T cells in FIG.16A. (FIG.16F) Heat map showing the most differentially expressed genes in unexpanded versus peptide expanded T cell clusters.

[0115] FIG.17A, FIG.17B, and FIG.17C show flow cytometry plots of dextramer specificity of TCRs identified in the RAPTER assay. TCR-engineered Jurkat cells expressing the (FIG.17A) Influenza M (GILGFVFTL; SEQ ID NO: 1287) epitope-reactive TCRs (TCR2, TCR4 and TCR5), (FIG.17B) EBV BMLF1 (GLCTLVAML; SEQ ID NO: 1286) epitope- reactive TCRs (TCR8, TCR9 and TCR10) or (FIG.17C) two non-specific TCRs (TCR13 and TCR15) were stained with the indicated dextramers. DESCRIPTION

[0116] The identification and functional assessment of antigen-specific T cells from human samples is essential to understand disease pathogenesis, resolve which antigens induce T cell responses, and develop effective targeted vaccine and TCR-based cellular therapies. The observation that tumors associated with higher mutation burden (TMB) or viral drivers are more sensitive to immune checkpoint inhibitor (ICI) therapy has focused much attention toward identifying which tumor antigens elicit functional T cell-mediated anti-tumor responses. Advances in sequencing technologies now permit routine identification of tumor-restricted mutations, and computational algorithms that import bulk whole exome sequence (WES) and RNA sequence (RNA-seq) information from matched tumor and normal tissues can predict which tumor-restricted peptides are likely to be presented on human leukocyte antigen (HLA) alleles. However, the actual functional relevance of these epitopes must be determined by T cell assays.

[0117] In oncology, there is increasing interest in considering functional T cell reactivity when ranking immunogenic tumor or viral antigens to better understand which antigens should 27  be therapeutically targeted for tumor control. Primary human T cell functional reactivity tests widely employ traditional, low-throughput assays including enzyme linked immune-spot (ELISpot) and intracellular cytokine staining (ICS). ELISPOT and ICS provide functional information by capturing T cells that produce activation-induced T cell cytokines. However, both methods require relatively large numbers of cells to screen reactivities at a high throughput and neither provide TCR sequences.

[0118] More recent advances in single cell sequencing technologies have enabled higher- throughput resolution of cognate TCR-ligand interactions. DNA oligonucleotide (oligo)-tagged dextramer technologies permit higher-throughput multimer screening directly on clinical blood samples. Notable limitations include the requirement for haplotype matching, dextramer reagent cost, and limited availability of HLA class II dextramers. Other sequence-based methods that aim to pair TCR with ligand at a high throughput include yeast display, T-Scan, SABR, cytokine capture, and similar assays, although all require engineered expression systems and are not directly applied to clinical samples.

[0119] The Multiplexed Identification of T cell Receptor Antigen specificity (MIRA) assay developed by Adaptive Biotechnologies uses a system of assay well antigen “addressing” to screen T cell reactivities from primary human blood cells. Antigen-specific T cells are identified by upregulation of CD137 / 4-1BB expression following cognate antigen exposure and sorted for bulk TCR sequencing. While MIRA does not require engineered cells and uses an endogenous T cell activation marker, its method of antigen addressing requires many input cells to capture the low-frequency tumor antigen-specific T cell populations that are accessible in patients’ circulation.

[0120] The RAPTER assay was developed to provide a fast, flexible solution for screening candidate immunogenic T cell antigens. T cell reactivities of 10s-100s of antigens can be screened in parallel using limited patient blood cells, and paired epitope-TCR information is obtained simultaneously at single cell resolution. RAPTER was designed to use autologous human T cells and APCs and requires fewer cells than most other primary T cell assays, which makes it particularly attractive for testing clinical trial blood samples. Individual antigen reactivities are tracked by labeling T cells with unique hash tag oligonucleotide (HTO)- conjugated antibodies that correlate to the specific antigens to which the T cells were exposed. To maintain assay sensitivity and decrease the number of cells required for screening, HTO 28  labelling allows all functionally-reactive T cells to be pooled, sorted on the same cell surface activation-induced T cell marker (AIM), and undergo scRNA-SEQ. Antigen reactivity is later computationally resolved by HTO demultiplexing (DEMUX). Cellular Indexing of Transcriptomes and Epitopes by Sequencing (CITE-seq) antibody reagents can also be used in RAPTER to provide T cell surface protein information. Therefore, the RAPTER scRNA-SEQ assay read-out provides paired epitope:TCR information for all detected reactivities, as well as RNA- and protein-level phenotypic T cell Information. Paired TCR α / β sequences for certain epitopes (MART1, EBV, CMV, and influenza) are described herein. Also described herein are isolated cells expressing a TCR variable domain and / or a TCR α / β variable domain pair as described herein, isolated polynucleotide molecules encoding a TCR variable domain and / or TCR α / β variable domain pair as described herein, targeting vectors comprising polynucleotides described herein, isolated cells expressing the targeting vectors descried herein, and pharmaceutical compositions comprising the TCR variable domains and / or TCR α / β variable domain pairs, cells, and / or polynucleotides described herein. Also described are methods of using (i) a TCR α / β variable domain specific for an HPV16 peptide as described herein, e.g., in methods of treating an HPV 16 related disease in a patient in need thereof, (ii) a TCR α / β variable domain specific for a MART1 peptide as described herein, e.g., in methods of treating an MART1 related disease in a patient in need thereof, (iii) a TCR α / β variable domain specific for an EBV peptide as described herein, e.g., in methods of treating an EBV related disease in a patient in need thereof, or (iv) a TCR α / β variable domain specific for an influenza peptide as described herein, e.g., in methods of treating influenza in a patient in need thereof. Definitions

[0121] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0122] Singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to “a method” includes one or more methods, and / or steps of the type described herein and / or which will become apparent to those persons skilled in the art upon reading this disclosure.

[0123] The term “about” or “approximately” includes being within a meaningful range of a value. The allowable variation encompassed by the term “about” or “approximately” depends 29  on the particular system under study, and can be readily appreciated by one of ordinary skill in the art.

[0124] The term “comprising” or “comprises” is used herein in reference to compositions, methods, and respective component(s) thereof, that are essential to the disclosure, yet open to the inclusion of unspecified elements, whether essential or not.

[0125] The term “consisting of’ refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.

[0126] T cells bind epitopes on small antigenic determinants on the surface of antigen- presenting cells that are associated with a major histocompatibility complex (MHC). T cells bind these epitopes through a T cell receptor (TCR) complex on the surface of the T cell. T cell receptors are heterodimeric structures composed of two types of chains: an ^ (alpha) and ^ (beta) chain, or a γ (gamma) and ^ (delta) chain. The ^ chain is encoded by the nucleic acid sequence located within the ^ locus on human chromosome 14, which also encompasses the entire ^ locus, and the ^ chain is encoded by the nucleic acid sequence located within the ^ locus on human chromosome 7. The majority of T cells have an ^ ^ TCR; while a minority of T cells bear a γ ^ TCR. Although the α and β chains are commonly referred to herein, the methods, compositions and kits described herein may be similarly applied to γδ TCR chains.

[0127] T-cell receptor ^ and ^ polypeptides (and similarly γ and ^ polypeptides) are linked to each other via a disulfide bond. Each of the two polypeptides that make up the TCR contains an extracellular domain comprising constant and variable regions, a transmembrane domain, and a cytoplasmic tail (the transmembrane domain and the cytoplasmic tail also being a part of the constant region). The variable region of the TCR determines its antigen specificity, and similar to immunoglobulins, comprises 3 complementarity determining regions (CDRs), e.g., CDR1, CDR2, and CDR3. Also similar to immunoglobulin genes, T cell receptor variable gene loci (e.g., TCR ^ and TCR ^ loci) contain a number of unrearranged V(D)J segments (variable (V), joining (J), and in TCR ^ and ^, diversity (D) segments). During T cell development in the thymus, TCR ^ variable gene locus undergoes rearrangement, such that the resultant TCR ^ variable domain is encoded by a specific combination of VJ segments (V ^ / J ^ sequence); and TCR ^ variable gene locus undergoes rearrangement, such that the resultant TCR ^ variable 30  domain is encoded by a specific combination of VDJ segments (V ^ / D ^ / J ^ sequence). The TCR α and β variable domains, in particular the CDR1, CDR2, and CDR3 and more particularly the CDR3, provide the specificity with which the TCR binds an MHC.

[0128] The term “T cell receptor” (TCR), as used herein, refers to an immunoglobulin superfamily member having a variable binding domain, a constant domain, a transmembrane region, and a short cytoplasmic tail; see, e.g., Janeway et al. , Immunobiology : The Immune System in Health and Disease, 3rd Ed., Current Biology Publications, p.4:33, 1997) capable of specifically binding to an antigen peptide bound to a MHC receptor. A TCR can be found on the surface of a cell and generally is comprised of a heterodimer having α and β chains (also known as TCRα and TCRβ, respectively), or γ and δ chains (also known as TCRγ and TCRδ, respectively). Like immunoglobulins, the extracellular portion of TCR chains (e.g., α-chain, β- chain) contain two immunoglobulin regions, a variable region (e.g., TCR variable α region or Vα and TCR variable b region or Vβ; typically amino acids 1 to 116 based on Kabat numbering at the N-terminus), and one constant region (e.g., TCR constant domain α or Cα and typically amino acids 117 to 259 based on Kabat, TCR constant domain β or Cβ, typically amino acids 117 to 295 based on Rabat) adjacent to the cell membrane. Also, like immunoglobulins, the variable domains contain complementary determining regions (CDRs) separated by framework regions (FRs). In certain embodiments, a TCR is found on the surface of T cells (or T lymphocytes) and associates with the CD3 complex. The source of a TCR of the present disclosure may be from various animal species, such as a human, mouse, rat, rabbit or other mammal. In some embodiments, the source of select portions of a TCR of the present invention is a mouse genetically engineered to produce TCRs comprising human alpha and beta chains (see, e.g., PCT Publication No. WO 2016 / 164492, the entire contents of which are incorporated herein by reference). For instance, a genetically modified mouse may be used to provide alpha and / or beta chains (or the sequences thereof) upon which variable regions or CDRs determined by a RAPTER assay may be engrafted (substituted for the homologous portions).

[0129] The term “variable region” (variable region of an alpha chain (Vα or Va), variable region of a beta chain (Vβ or Vb)) as used herein denotes each portion of the alpha and beta chains which is involved directly in binding the TCR to the antigen.

[0130] The “constant region” of the alpha chain and of the beta chain are not involved directly in binding of a TCR to an antigen, but exhibit various effector functions. 31

[0131] The terms “major histocompatibility complex,” and “MHC” encompass the terms “human leukocyte antigen” or “HLA” (the latter two of which are generally reserved for human MHC), naturally occurring MHC, individual chains of MHC (e.g., MHC class I α (heavy) chain, β2 microglobulin, MHC class II α chain, and MHC class II β chain), individual subunits of such chains of MHC (e.g., α1, α2, and / or α3 subunits of MHC class I α chain, α1-α2 subunits of MHC class II α chain, β1- β2 subunits of MHC class II β chain) as well as portions (e.g., the peptide- binding portions, e.g., the peptide-binding grooves), mutants and various derivatives thereof (including fusions proteins), wherein such portion, mutants and derivatives retain the ability to display an antigenic peptide for recognition by a T cell receptor (TCR), e.g., an antigen-specific TCR. An MHC I comprises a peptide binding groove formed by the α1 and α2 domains of the heavy α chain that can stow a peptide of around 8-10 amino acids. Despite the fact that both classes of MHC bind a core of about 9 amino acids (e.g., 5 to 17 amino acids) within peptides, the open-ended nature of the MHC class II peptide binding groove (the α1 domain of a class II MHC α polypeptide in association with the β1 domain of a class II MHC β polypeptide) allows for a wider range of peptide lengths. Peptides binding MHC class II usually vary between 13 and 17 amino acids in length, though shorter or longer lengths are not uncommon. As a result, peptides may shift within the MHC class II peptide binding groove, changing which 9-mer sits directly within the groove at any given time.

[0132] The term "antigen" encompasses any agent (e.g., protein, peptide, polysaccharide, glycoprotein, glycolipid, nucleotide, portions thereof, or combinations thereof) that, when introduced into an immunocompetent host is recognized by the immune system of the host and elicits an immune response by the host. The T-cell receptor (TCR) recognizes a peptide presented in the context of a major histocompatibility complex (MHC) as part of an immunological synapse. The peptide-MHC (pMHC) complex is recognized by TCR, with the peptide (antigenic determinant) and the TCR idiotype providing the specificity of the interaction. Accordingly, the term “antigen” encompasses peptides presented in the context of MHCs, e.g., peptide-MHC complexes, e.g., pMHC complexes. The peptide displayed on MHC may also be referred to as an "epitope" or an “antigenic determinant”. The terms "peptide," "antigenic determinant," "epitopes," etc., encompass not only those presented naturally by antigen-presenting cells (APCs), but may be any desired peptide so long as it is recognized by a 32  T cell when presented appropriately to the T cell. For example, a peptide having an artificially prepared amino acid sequence may also be used as the epitope.

[0133] TCR engagement with cognate pMHC is generally short-lived although this interaction may be stabilized by the “avidity effect” afforded by incorporating multiple pMHC on a single backbone, e.g., surface, e.g., the use of multimers, e.g., tetramers, dextramers, etc. Various pMHC multimerization platforms have been utilized, many of which are commercially available. See, e.g., Wooldridge et al. (2009) Immunol.126:147-64. In order to accommodate such avidity effect, in some embodiments, MHC herein is preferably surface bound such that an appropriate density of MHC may be achieved.

[0134] Non-limiting exemplary surfaces to which MHCs may be bound in non-limiting embodiments disclosed herein include: a. cell membranes, e.g., wherein the MHC is expressed on the surface of an antigen presenting cell (e.g., a professional antigen presenting cell such as a dendritic cell, monocyte, macrophage, and B cell), the surface of a liposome, the envelope membrane of a viral vector, etc., b. a bead, c. a cell culture dish, e.g., a well of a multi-well plate, and d. as a multimer, e.g., a tetramer, dextramer, etc.

[0135] An antigen may comprise synthetic peptides, protein, mRNA, viruses, viral vectors, DNA, live cells, cell lysates, etc. In some non-limiting embodiments, an antigen is a tumor associated antigen, including peptide portions thereof. In such an embodiment, the tumor associated antigen may be selected from the group consisting of ALK, BAGE proteins, BIRC5 (survivin), BIRC7, CA9, CALR, CCR5, CD19, CD20 (MS4A1), CD22, CD27, CD30, CD33, CD38, CD40, CD44, CD52, CD56, CD79, CDK4, CEACAM3, CEACAM5, CLEC12A, EGFR, EGFR variant III, ERBB2 (HER2), ERBB3, ERBB4, EPCAM, EPHA2, EPHA3, FCRL5, FLT3, FOLR1, GAGE proteins, GD2, GD3, GPNMB, GM3, GPR112, IL3RA, KIT, KRAS, LGR5, EBV-derived LMP2, L1CAM, MAGE proteins, MART1, MLANA, MSLN, MUC1, MUC2, MUC3, MUC4, MUC5, MUC16, MUM1, ANKRD30A, NY-ESO1 (CTAG1B), OX40, PAP, PAX3, PAX5, PLAC1, PRLR, PMEL, PRAME, PSMA (FOLH1), RAGE proteins, RET, RGS5, ROR1, SART1, SART3, SLAMF7, SLC39A6 (LIV1), STEAP1, STEAP2, TERT, TMPRSS2, Thompson-nouvelle antigen, TNFRSF17, TYR, UPK3A, VTCN1, WT1. 33

[0136] In another embodiment, an antigen may be associated with an infectious disease. In such embodiments, for example, a biological sample may become a unique biological sample with the addition of an infectious agent or epitope derived therefrom. In one such embodiment, the infectious disease associated antigen may be a viral antigen and the viral antigen is selected from the group consisting of HIV, hepatitis A, hepatitis B, hepatitis C, herpes virus (e.g., HSV-1, HSV-2, CMV, HAV-6, VZV, Epstein Barr virus), adenovirus, influenza virus, flavivirus, echovirus, rhinovirus, coxsackie virus, coronavirus (e.g., SARS-CoV-2), respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV, dengue virus, papillomavirus (e.g., human papilloma virus (HPV), molluscum virus, poliovirus, rabies virus, JC virus, ebola virus, and arboviral encephalitis virus antigen. In another such embodiment, the infectious disease associated antigen may be a bacterial antigen and the bacterial antigen is selected from the group consisting of chlamydia, rickettsia, mycobacteria, staphylococci, streptococci, pneumococci, meningococci, gonococci, klebsiella, proteus, serratia, pseudomonas, legionella, diphtheria, salmonella, bacilli, cholera, tetanus, botulism, anthrax, plague, leptospira, and Lyme disease bacterial antigen.

[0137] The term "biological sample" as used in the methods described herein refers to a culture comprising a biologically active cell, an activator of the biologically active cell, and optionally, medium that supports the viability of the cell and / or the biological activation, e.g., activity, of the cell. The biologically active cell may be a homogenous population of cells, such as isolated cells of a particular type (e.g., T cells), or a mixture of different cell types (e.g., peripheral blood mononuclear cells (PBMCs), a co-culture of antigen presenting cells (APCs) and T cells, a co-culture of dendritic cells (DCs) and T cells, etc.), which may be isolated from or comprise a biological fluid or tissue isolated from a subject, e.g., a human or mammalian or other species subject. Biological fluid or tissue may include, as a non-limiting example, serum, plasma, whole blood, peripheral blood, saliva, urine, vaginal or cervical secretions, amniotic fluid, placental fluid, cerebrospinal fluid, serous fluids, or mucosal secretions (e.g., buccal, vaginal or rectal). Still other samples include a blood-derived or biopsy-derived biological sample or tissue, e.g., tissues comprising tumor infiltrating lymphocytes (e.g., tumors), indurations, etc.

[0138] Some non-limiting biological samples disclosed herein comprise a T cell and a surface-bound MHC presenting an antigen (e.g., a T cell epitope), e.g., the biologically active cell is a T cell, and the activator is a surface bound MHC presenting an antigen (e.g., a T cell 34  epitope). Some non-limiting biological samples disclosed herein comprise a T cell, a surface- bound MHC presenting an antigen (e.g., a T cell epitope), and one or more cytokines that support the viability, activation, and / or activity of the T cell, e.g., the biologically active cell is a T cell, the activator is a surface bound MHC presenting an antigen (e.g., a T cell epitope) and the medium comprises one or more cytokine that supports the viability, activation, and / or activity of the T cell. In some embodiments, a cytokine that supports the viability, activation, and / or activity of the T cell comprises an interleukin selected from the group consisting of IL-2, IL-4, IL-7, IL-15, IL-21 and a combination thereof. Some non-limiting biological samples disclosed herein comprise a T cell and a surface-bound MHC presenting an antigen, wherein the MHC is expressed on the surface of an antigen presenting cell, e.g., a somatic cell, which may optionally be a professional antigen presenting cell selected from the group consisting of a monocyte derived dendritic cell, a dendritic cell, a monocyte, a macrophage, and a B cell. These non- limiting biological samples comprising a T cell and a surface-bound MHC presenting an antigen, wherein the MHC is expressed on the surface of an antigen presenting cell may optionally further comprise a cytokine that supports the viability, activation, and / or activity of the T cell (e.g., IL-2, IL-4, IL-7, IL-15, and / or IL-21) and / or a cytokine that supports the viability, activation, and / or activity of the antigen presenting cell (e.g., GM-CSF, FLT3L, and / or IL-4). Additional cytokines or combinations of cytokines useful for supporting the viability, activation, and / or activity of a T cell and / or antigen presenting cell (and the amounts of the same for supporting the viability, activation, and / or activity of a T cell and / or antigen presenting cell) are well-known in the art. In some embodiments, additional factors that activate APCs are included, e.g., IFNα, LPS, poly-IC, TNF, IL-1β, IL-6, PGE2, etc. in the medium that supports the viability of the cell.

[0139] A biological sample is often obtained from, or derived from a specific source, subject or patient.

[0140] An “individual” or “subject” or “animal” refers to humans, veterinary animals (e.g., cats, dogs, cows, horses, sheep, pigs, etc.) and experimental animal models of diseases (e.g., mice, rats). In one embodiment, the subject is a human.

[0141] In a non-limiting embodiment herein, a biological sample comprises peripheral blood mononuclear cells (PBMCs) derived from a subject. The biological samples described herein may comprise newly isolated PBMCs, freshly thawed PBMCs that have been 35  cryopreserved, or PBMCs that have been primed, e.g., cultured for about a week in the presence of antigen to expand memory reactivities and increase assay signal.

[0142] Generally, a biological sample (e.g., a unique biological sample) as described herein comprises T cells and surface bound MHC in sufficient numbers to support activation of the T cells in response to an antigen, e.g., at least 1 x 105, 5 x 105, 1 x 106, or more whole peripheral blood mononuclear cells. The combination of hashing and multiplexing advantageously provides for the methods described herein to be performed on low blood volume samples, e.g., low volume human blood samples, since 1 mL whole (human) blood may comprise anywhere from 5 x 105to 3 x 106peripheral blood mononuclear cells (PBMCs) and / or may be used to isolate anywhere from 5 x 103to 5 x 105APCs (e.g., dendritic cells) and anywhere from 5 x 103to 5 x 106T cells. As a non-limiting example, a collection of cells derived from 10 mL of whole blood isolated from a subject may comprise anywhere from 5 x 106to 3 x 107PBMCs such that the collection of cells may be equally distributed into a plurality of individual biological samples, e.g., at least 20 biological samples each comprising about 1 x 105to 1 x 106PBMCs and / or 1 x 105to 5 x 105DCs and 1 x 105to 5 x 106T cells, etc., which may then be pooled (after addition of a unique antigen and / or unique HTO to each) and assayed according to a method described herein. Accordingly, in some embodiments, a collection of cells comprises a sufficient number of peripheral blood mononuclear cells (PBMCs) such that the collection of cells may be equally distributed into a plurality of biological samples. In some embodiments, the collection of cells comprises a sufficient number of PBMCs such that the collection of cells may be equally distributed into at least two individual biologicals samples, each comprising at least about 1 x 105PBMCs, at least about 5 x 105PBMCs, or at least about 1 x 106PBMCs, e.g., the collection of cells may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, e.g., a human subject. In some embodiments, the collection of cells comprises a sufficient number of PBMCs such that the collection of cells may be equally distributed into at least three individual samples, each comprising at least about 1 x 105PBMCs, at least about 5 x 105PBMCs, or at least about 1 x 106PBMCs, e.g., the collection of cells may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, e.g., a human subject. In some embodiments, the collection of cells comprises a sufficient number of PBMCs such that the collection of cells may 36  be equally distributed into at least five individual samples, each comprising at least about 1 x 105PBMCs, at least about 5 x 105PBMCs, or at least about 1 x 106PBMCs, e.g., the collection of cells may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, e.g., a human subject. In some embodiments, the collection of cells comprises a sufficient number of PBMCs such that the collection of cells may be equally distributed into at least ten individual samples, each comprising at least about 1 x 105PBMCs, at least about 5 x 105PBMCs, or at least about 1 x 106PBMCs, e.g., the collection of cells may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, e.g., a human subject. In some embodiments, the collection of cells comprises a sufficient number of PBMCs such that the collection of cells may be equally distributed into at least twenty individual samples, each comprising at least about 1 x 105PBMCs, at least about 5 x 105PBMCs, or at least about 1 x 106PBMCs, e.g., the collection of cells may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, e.g., a human subject. In some embodiments, the collection of cells comprises a sufficient number of PBMCs such that the collection of cells may be equally distributed into at least thirty individual samples, each comprising at least about 1 x 105PBMCs, at least about 5 x 105PBMCs, or at least about 1 x 106PBMCs, e.g., the collection of cells may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, e.g., a human subject. In some embodiments, the collection of cells comprises a sufficient number of PBMCs such that the collection of cells may be equally distributed into at least fifty individual samples, each comprising at least about 1 x 105PBMCs, at least about 5 x 105PBMCs, or at least about 1 x 106PBMCs, e.g., the collection of cells may be derived from about 1 mL, about 3 mL, about 5 mL, about 10 mL, about 15 mL, about 20 mL, or about 50 mL of whole blood isolated from a subject, e.g., a human subject. In some embodiments, the collection of cells comprises a sufficient number of T cells and antigen presenting cells (APCs), (e.g., dendritic cells (DCs)) such that the collection of cells may be equally distributed into a plurality of individual biological samples. In some embodiments, the collection of cells comprises a sufficient number of T cells and antigen presenting cells (APCs), (e.g., dendritic cells (DCs)) such that the collection of cells may be equally distributed into a plurality of individual biological samples. In some embodiments, the 37  collection of cells comprises a sufficient number of APCs and T cells isolated from a subject, e.g., a human subject, such that the collection of cells may be equally distributed into a plurality of individual biological samples, each comprising APCs and T cells (e.g., DCs and T cells) in APC:T cell ratio of about 1:1, about 1:5, or about 1:10, e.g. wherein each sample comprises at least about 5 x 103, 5 x 104, or 5 x 105DCs and about 5 x 103, 1 x 104, 2.5 x 104, 5 x 104, 1 x 106, 2.5 x 105, 5 x 105, 1 x 106, 2.5 x 106, or 5 x 106T cells, e.g., the collection of cells can be derived from about 5 mL, about 10 mL, about 15 mL, about 20 mL ,or about 50 mL of whole blood isolated from a subject, e.g., a human subject.

[0143] A biological sample isolated from a subject may further be diluted with saline, buffer or a physiologically acceptable diluent. Alternatively, a biological sample from a subject may be concentrated by conventional means. A biological sample isolated from a subject may also be divided into two or more aliquots to form a “plurality of biological samples,” wherein each of the plurality of biological samples comprises about the same number of biologically active cells (e.g., T cells) and about the same amount of a supporting reagent. Accordingly, unless otherwise specified, a “plurality of biological samples” as used herein refers to a plurality of distinct populations of biologically active cells, wherein each population of biologically active cells is isolated from the same subject, comprises about the same number of biologically active cells, and is maintained in similar culture conditions, e.g., with a supporting reagent, that support the viability, activation, and / or activity of the biologically active cell.

[0144] In some embodiments of the invention, a biological sample is primed ex vivo, e.g., pre-expanded, by incubation with an antigen for about a week (e.g.., about 7-10 days) before in vitro re-stimulation with the antigen for about one to three days (e.g., 6-72 hours, e.g.18-24 hours) and subsequent hashing, enrichment and / or analysis of the unique biological sample. In some embodiments of the invention, a biological sample is not primed ex vivo before in vitro re- stimulation with the antigen and subsequent hashing of the biological sample, enrichment and / or analysis of the unique biological sample. Ex vivo priming is generally not necessary for those biological samples which may have encountered the antigen while in vivo. Priming and re- stimulation protocols, including the timing for same (e.g., 7-10 days for priming and 6-72 hours, such as 18-24 hours, for re-stimulation), for biological samples comprising T cells are well- known in the art. 38

[0145] In some non-limiting embodiments, each of a plurality of biological samples becomes a unique biological sample by being incubated with its own unique stimulus or unique combination of stimuli (e.g., antigen or pool of antigens (e.g., T cell epitope)) and / or its own unique barcode, e.g., (hashtag oligonucleotide) for hashtagging and optional multiplexing.

[0146] “Hash tagging,” “hashing,” “tagging,” and the like as used herein comprises contacting the biologically active cell of a unique biological sample with an molecule conjugated to a unique barcode, e.g., a unique hashtag oligonucleotide (HTO), wherein the unique barcode identifies the unique characteristic of the unique biological sample, e.g., the unique antigen (e.g., a unique T cell epitope) or a lack of a unique antigen, and wherein the molecule incorporates into the cell membrane of and / or specifically binds to a cell surface marker expressed by the biologically active cell, regardless of the activation state of the biologically active cell. In some embodiments, the HTO-molecule may incorporate into any cell, e.g., any dividing cell, and / or binds a cell surface marker expressed by most or all cells (e.g., β2 microglobulin, CD298). In some embodiments, the cell marker selected is expressed by T cells regardless of activation state, (e.g., CD2, CD3, CD4, and / or CD8, etc.). In some embodiments, where two or more molecules that label a cell with an HTO in two or more different ways (e.g., one molecule may incorporate itself into the cell membrane while the other binds a marker, the two or more molecules may bind two or more different markers) are each conjugated to an HTO and are each used in a hashtagging method to tag the same unique biological sample, the two or more molecules may comprise the same barcode. In some embodiments, the two or more markers used to hashtag a unique biological sample may be the same or different markers. In some embodiments, a first unique biological marker may be tagged with a first molecule conjugated to a first unique barcode, e.g., a first HTO, a second unique biological sample is tagged with a second molecule conjugated to a second unique barcode, e.g., a second HTO, and a third biological sample is tagged with a third molecule conjugated to a third barcode, e.g., a third barcode, wherein each of the first, second, and third molecules are identical, e.g., each incorporate itself into a cell membrane or specifically bind to the same marker, however wherein each of the first, second and third molecules comprise a unique barcode that is sufficiently different that each of the first, second and third molecule may be distinguished. After washing away unbound molecules, unique biological samples that are uniquely hashed may be pooled and optionally incubated an additional reagents for further functional and phenotypic analyses of an antigen-specific 39  activated T cell population (e.g., flow cytometric analysis and / or fluorescence cell activated sorting, single-cell sequence analysis, etc.) since the hashtagging allows for later detection, tracking and or quantitation of the each of the samples and targets that are derived from the same sample.

[0147] Some non-limiting embodiments may further enhance the sensitivity and / or robustness of a method described herein. For example, in some non-limiting embodiments, pooling 20 potentially reactive oligo-hashed assay samples per scSEQ sample typically results in adequate enrichment. In some embodiments, a combinatorial hashing approach may be taken to increase the sensitivity of the assay. For example, two or more molecules that respectively label a cell with its respective HTO in two or more different ways (e.g., one molecule may incorporate itself into the cell membrane while the other binds a marker, the two or more molecules may bind two or more different markers etc. (e.g., β2 microglobulin and CD2)), are each conjugated to the same barcode, e.g., an HTO comprising the same sequence, and are each used in a hashtagging method to tag the same unique biological sample.

[0148] Generation and use of a “hashtag oligonucleotide,” “HTO,” or the like, including the conjugation of a hashtag oligonucleotide, e.g., to a molecule (e.g., an antibody or other macromolecule, e.g., a lipid) that optionally and in some non-limiting embodiments preferably bind an activation induced marker, are well-known. See, e.g., WO2018144813; Stoeckius et al. (2018) Genome Biol.19:224; van Buggenum JAGL et al., each of which reference is incorporated herein in its entirety by reference. Generally, an HTO comprises a unique barcode, e.g., a nucleic acid comprising a unique sequence that may be determined according to standard polymerase chain reaction protocols, e.g., single cell RNA sequencing protocols that sequence the cellular transcriptome (see, e.g., Stoeckius et al. (2017) Nat. Method 9:2579-10), which unique sequence identifies, in the embodiments described herein, a stimulus or combination of stimuli that activates a biological sample, e.g., causes the biological sample to express an activation induced marker. Conjugation chemistry, e.g., iEDDA click chemistry, may be used to conjugate, e.g., covalently attach the hashtag oligonucleotides to a molecule, e.g., a ligand that binds a cell surface marker, e.g., a constitutively expressed cell surface marker. In some embodiments, the cell surface marker is expressed by most or all cells including T cells (e.g., β2 microglobulin, CD298). In some embodiments, the cell marker is selected expressed by T cells regardless of activation state, (e.g., CD2, CD3, CD4, and / or CD8, etc.). Although oligo-tagged 40  antibodies are described herein, other oligo-tagged tracking molecules beyond antibodies can be used, such as oligo-tagged cell membrane incorporating lipids and cell penetrating nucleic acids, particularly for further functional and / or phenotypic characterization based on single cell sequencing analysis.

[0149] A hashtag oligonucleotide (HTO) used in these compositions and methods may be conjugated any naturally occurring or synthetic biological or chemical molecule which may be used to label a cell, e.g., a lipid that incorporates into a cell membrane and / or a ligand that binds specifically to a single identified marker. The binding can be covalently or non-covalent, i.e., conjugated or by any known means taking into account the nature of the ligand and its respective target. The terms "first HTO-conjugated molecule" and "additional HTO-conjugated molecule" or “second HTO-conjugated molecule” and the like refer to HTO-conjugated molecules that label a cell in different ways, e.g., one molecule may incorporate itself into the cell membrane while the second molecule binds a marker, the two or more molecules may bind to different targets or different portions of a target. For example, multiple "first HTO-conjugated molecules" incorporate into the cell membrane or bind to the same marker at the same site. Multiple additional HTO-conjugated molecules bind to a marker different than the first HTO-conjugated molecule and different than any additional HTO-conjugated molecule. An HTO-conjugated molecule (e.g., a first HTO-conjugated molecule, and additional HTO-conjugated molecules, e.g., a second, third, fourth and fifth HTO-conjugated molecules, etc.) may independently be selected from a peptide, a protein, an antibody or antibody fragment (e.g., an antigen binding portion of an antibody), an antibody mimetic, an affibody, a ribo- or deoxyribo-nucleic acid sequence, an aptamer, a lipid, a cholesterol, a polysaccharide, a lectin, or a chimeric molecule formed of multiples of the same or different molecules. Additional non-limiting examples of HTO-conjugated molecules include those comprising a Fab, Fab', F(ab')2, Fv fragment, single- chain Fv (scFv), diabody (Dab), synbody, nanobodies, BiTEs, SMIPs, DARPins, DNLs, Duocalins, adnectins, fynomers, Kunitz Domains Albu-dabs, DARTs, DVD-IG, Covx-bodies, peptibodies, scFv-Igs, SVD-Igs, dAb-Igs, Knob-in-Holes, triomAbs, the like or combinations thereof. In some embodiments, a molecule conjugated to an HTO is a recombinant or naturally occurring protein. In certain embodiments, a molecule conjugated to an HTO is a monoclonal or polyclonal antibody, or fragment thereof. In one embodiment, the molecule to which the HTO is conjugated may itself also be directly labeled with one or more detectable labels, such as 41  fluorophores that can be measured by methods independent of the methods of measuring or detecting the barcode, e.g., HTO, according to well-known methods.

[0150] In some embodiments an HTO-conjugated molecule comprises a lipid that incorporates itself into the cell membrane. In some embodiments an HTO-conjugated molecule comprises cholesterol that incorporates itself into the cell membrane. In some embodiments, an HTO-conjugated molecule comprises lipid- and cholesterol-modified oligonucleotides (LMOs and CMOs). See, e.g., McGinnis et al. (2019) Nature Methods 16:619-26, incorporated by reference in its entirety.

[0151] Assays for the further functional and phenotypic analysis of an antigen-specific activated T cell population are well-known in the art and include, but are not limited to fluorescence cell activated sorting and / or flow cytometric analysis using fluorescently labeled binding proteins (e.g., antibodies) or MHC multimers, single-cell RNA sequencing (scRNA-seq) and / or Cellular Indexing of Transcriptomes and Epitopes by sequencing (CITE-seq) analysis, etc. “Flow cytometry” encompasses methods comprising suspending cells or particles in a fluid and injected the suspension into a flow cytometer, which focuses the sample to ideally flow one cell at a time through a laser beam, where the light scattered is characteristic to the cells and their components. Cells labeled with fluorescent labels absorb the laser light and emitted in a band of wavelengths that may be used to distinguish the cells. In a preferred embodiment, after hashing and pooling, unique biological samples are enriched for activated T cells, e.g., sorted for those cells expressing activation-induced markers. In one embodiment, the cells are enriched for activated T cells, e.g., sorted, using a fluorescently labeled antibody to an activation induced marker and fluorescence activated cell sorting (FACS) prior to or simultaneous with any further functional and phenotypic analyses of the cells, e.g., prior to or simultaneous with any additional flow cytometric analyses and / or single cell sequence analysis (which may include CITE-seq analysis of any CITE-seq reagents added to the biological sample before or after the sorting). “CITE-seq” encompasses methods in which oligonucleotide-labeled molecules, e.g., oligonucleotide-labeled antibodies, are used to measure protein expression levels of a sample, e.g., during single cell sequencing approaches as described in, e.g., Stoeckius et al. (20017) Nat. Methods 14:865-868, incorporated herein in its entirety by reference. In some non-limiting embodiments, a further functional and phenotypic analysis of the cells comprises flow cytometric analysis with fluorescently labeled antibodies that detect protein expression levels of 42  cell surface markers, e.g., additional activation markers, or intracellular proteins, e.g., intracellular cytokines. In some non-limiting embodiments, a further functional and phenotypic analysis of the cells comprises single-cell RNA sequencing of each activated cell. Non-limiting exemplary platforms for single-cell RNA sequencing include, but are not limited to plate-based approaches or microfluidic / nanowell approaches, e.g., droplet-based microfluidic approaches such as but not limited to Drop-seq (Macosko, et al. (2015) Cell 161:1202-14), InDrop (Kein et al. (2015) Cell161:1187-1201), 10X Genomics (Zhen et al (2017) Nat. Commun.8:1-12), and the ILLUMINA® / BIO-RAD single-cell sequencing solution. Since mRNA expression level may not correlate well with protein expression levels in a cell, in some non-limiting embodiments, single-cell RNA sequencing is performed in combination with CITE-Seq analysis, using e.g., oligonucleotide tagged antibodies, MHC multimers, and the like (see, e.g., WO2018144813, incorporated herein by reference in its entirety).

[0152] An “activation-induced marker” (AIM) is a marker that is expressed, or in which the expression is upregulated, after activation of a T cell. Well-known activation-induced markers for T cells include, but are not limited to, CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, TIGIT, etc. In some embodiments, the T cell activation marker, e.g., the activation induced marker, comprises CD40L. CD40L may also be referred to as CD154. In some embodiments, the T cell activation marker, e.g., the activation induced marker, comprises CD137. CD137 is also referred to herein as 4-1BB. Accordingly, CD137 / 4-1BB refers to the molecule known in the art as CD137, 4- 1BB, and the like, and the phrases “CD137,” “4-1BB,” and “CD137 / 4-1BB” may be used interchangeably. CD137 / 4-1BB is a transient T cell activation marker that is upregulated rapidly upon antigen-specific TCR engagement and remains expressed on cells for approximately 72 hours. In methods described herein, between 20-36 hours after exposure to an antigen appears to be the optimal time point for functional enrichment of CD137 / 4-1BB expression and detection. In some embodiments, the activation-induced marker comprises CD107. CD107 may also be referred to as CD107a or LAMP1. In some embodiments, the activation-induced marker comprises interferon gamma (IFNγ), which may also be referred to as gamma interferon, IFNG, IFG, etc. In some embodiments, the activation-induced marker comprises PD-1, which may also be referred to as programmed cell death 1, CD279, and HPD-1. In some embodiments, the activation-induced marker comprises TNF Receptor Superfamily member 4, which may also be 43  referred to as OX40 and / or CD134. In some embodiments, the activation-induced marker comprises interleukin-2 receptor alpha, which may also be referred to as IL-2R, IL-2Rα, and / or CD25. In some embodiments, the activation-induced marker comprises CD69, which may also be referred to leukocyte surface antigen Leu-23 and / or MLR3. In some embodiments, the activation-induced marker comprises CD28, which may also be referred to Tp44 and / or T-cell specific surface glycoprotein. In some embodiments, the activation-induced marker comprises major histocompatibility complex class II DR, which may also be referred to as HLA-DR. In some embodiments, the activation-induced marker comprises C X C motif chemokine receptor (CX3CR1), which may also be referred to as IL-8 Receptor, IL-8Rα, and / or CDw128a. In some embodiments, the activation-induced marker comprises TIM3, which may also be referred to as Hepatitis A Virus Cellular Receptor 2, T cell Membrane Protein 3, and / or CD366. In some embodiments, the activation-induced marker comprises lymphocyte activation gene 3 (LAG3), which may also be referred to as CD223. In some embodiments, the activation-induced marker comprises T cell Immunoreceptor with Ig and ITIM Domains (TIGIT), which may also be referred to as V-Set and Immunoglobulin Domain Containing Protein 9 (VSIG9) and / or V-Set and / or Transmembrane Domain Containing 3 (VSTM3).

[0153] The terms “immunoglobulin,” “antibody,” “antibodies,” “binding protein” and the like refer to monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies, single-chain Fvs (scFv), single chain antibodies, Fab fragments, F(ab′) fragments, disulfide-linked Fvs (sdFv), intrabodies, minibodies, diabodies and anti- idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antigen-specific TCR), and epitope-binding fragments of any of the above. The terms “antibody” and “antibodies” also refer to covalent diabodies such as those disclosed in U.S. Pat. Appl. Pub.20070004909, incorporated herein by reference in its entirety, and Ig-DARTS such as those disclosed in U.S. Pat. Appl. Pub. 20090060910, incorporated herein by reference in its entirety.

[0154] As used herein, the term "detectable label" means a reagent, moiety or compound capable of providing a detectable signal, depending upon the assay format employed. A label may be associated with a molecule only and / or with the unique barcode (e.g., unique HTO) or a functional portion thereof. Alternatively, different labels may be used for each component of the HTO-conjugated molecule. Such labels are capable, alone or in concert with other compositions or compounds, of providing a detectable signal. In one embodiment, the labels are interactive to 44  produce a detectable signal. In one specific embodiment, the label is detectable visually, e.g., colorimetrically. A variety of enzyme systems operate to reveal a colorimetric signal in an assay, e.g., glucose oxidase (which uses glucose as a substrate) releases peroxide as a product that in the presence of peroxidase and a hydrogen donor such as tetramethyl benzidine (TMB) produces an oxidized TMB that is seen as a blue color. Other examples include horseradish peroxidase (HRP) or alkaline phosphatase (AP), and hexokinase in conjunction with glucose-6-phosphate dehydrogenase that reacts with ATP, glucose, and NAD+ to yield, among other products, NADH that is detected as increased absorbance at 340 nm wavelength. Still other label systems that may be utilized in the described methods and molecules are detectable by other means, e.g., colored latex microparticles (Bangs Laboratories, Indiana) in which a dye is embedded may be used in place of enzymes to provide a visual signal indicative of the presence of the labeled molecule in applicable assays. Still other labels include fluorescent compounds, fluorophores, radioactive compounds or elements. In one embodiment, a fluorescent detectable fluorochrome, e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE), allophycocyanin (APC), coriphosphine-0 (CPO) or tandem dyes, PE-cyanin-5 or -7 (PC5 or PC7)), PE-Texas Red (ECD), PE-cyanin-5.5, rhodamine, PerCP, and Alexa dyes. Combinations of such labels, such as Texas Red and rhodamine, FITC +PE, FITC + PECy5 and PE + PECy7, among others may be used depending upon assay method. The selection and / or generation of suitable labels for use in labeling the molecule and / or any component of the polymer molecule is within the skill of the art, provided with this specification.

[0155] The term "specifically binds," "binds in a specific manner," or the like, indicates that the molecules involved in the specific binding are (1) able to stably bind, e.g., associate, e.g., form intermolecular non-covalent bonds, under physiological conditions, and are (2) unable to stably bind under physiological conditions to other molecules outside the specified binding pair. Specifically binds also means that TCR forms a complex with an antigen that is relatively stable under physiologic conditions. Specific binding can be characterized by an equilibrium dissociation constant of at least about 1x10-6M or less, for example, 1x10-8M or less (e.g., a smaller KD denotes a tighter binding). Methods for determining whether two molecules specifically bind are well known in the art and include, for example, equilibrium dialysis, surface plasmon resonance, and the like. 45

[0156] The term “off-target peptide” refers to a peptide that differs by 1, 2, 3, 4, 5 or more amino acids from a target peptide. In certain embodiments, the term includes a peptide that differs by less than or equal to 3 amino acids than the target peptide. For example, for a 9-mer peptide, if 1, 2, or 3 amino acids are not identical to the target peptide, it is considered an “off- target” peptide. In certain embodiments, amino acid identity is expressed in terms of ‘degree of similarity’ (DoS). If 6 or more amino acids within a 9-mer peptide are identical, the DoS is 6. In certain embodiments, a peptide with DoS < 6 is considered an “off-target” peptide. The term “off-target” peptide also refers to a peptide that is similar to the target peptide based on sequence homology, is predicted to bind to HLA-A2 and is comprised in a protein that is expressed in essential, normal tissues. Accordingly, in some embodiments a TCR of the present disclosure can bind to an HPV16, MART1, CMV, EBV, or influenza peptide with an affinity corresponding to a KD value that is at least ten-fold lower than its affinity for binding to an off-target peptide.

[0157] The term “isolated” refers to a composition, compound, substance, or molecule altered by the hand of man from the natural state. For example, a composition or substance that occurs in nature is isolated if it has been changed or removed from its original environment, or both.

[0158] For example, a polynucleotide or a polypeptide naturally present in a living animal is not isolated, but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is isolated, as the term is employed herein. More particularly, an isolated TCR can refer to a TCR that has been removed from a cell, for example, a TCR that has been purified. TCRs can also be expressed by an isolated cell, e.g., a cell that has been isolated from an animal or a cell from cell culture. In this context, the isolated cell can express the TCR on its surface (i.e., the cell can “present” the TCR). Accordingly, any of the TCRs or variable domains disclosed herein may be provided as an isolated TCR or variable domain thereof. Similarly, any of the nucleic acid molecules comprising a sequence encoding a TCR or variable domain thereof disclosed herein may be provided as an isolated nucleic acid molecule. Likewise, any of the cells comprising a TCR or variable domain thereof disclosed herein or any of the host cells comprising a nucleic acid comprising a sequence encoding a TCR or variable domain herein may be provided as an isolated cell.

[0159] The term “protein” encompasses all kinds of naturally occurring and synthetic proteins, including protein fragments of all lengths, fusion proteins and modified proteins, 46  including without limitation, glycoproteins, as well as all other types of modified proteins (e.g., proteins resulting from phosphorylation, acetylation, myristoylation, palmitoylation, glycosylation, oxidation, formylation, amidation, polyglutamylation, ADP-ribosylation, pegylation, biotinylation, etc.).

[0160] The terms “oligonucleotide,” “nucleic acid” and “nucleotide” encompass both DNA, RNA, modified bases, or combinations of these bases unless specified otherwise. In some embodiments, a hashtag oligonucleotide comprises DNA. In some embodiments, a hashtag oligonucleotide comprises 3 to 100, 3 to 50, 3 to 30, 5 to 30, 10 to 20, 5 to 20, or 5 to 15 nucleotides. In some embodiments, a hashtag oligonucleotide comprises a sequence of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 80, 91, 92, 93, 94, 95, 96, 97, 98, 99 or up to 100 nucleotides. In some embodiments, a hashtag oligonucleotide comprises a polyA sequence, which may comprise ten or more (e.g., 10-40, 10-30 or 10-20) consecutive adenosine nucleotides, derivatives or variants of an adenosine nucleotide.

[0161] The term “recombinant”, as used herein, refers to TCRs of the invention created, expressed, isolated or obtained by technologies or methods known in the art as recombinant DNA technology which include, e.g., DNA splicing and transgenic expression. The term refers to TCRs expressed in a non-human mammal (including transgenic non-human mammals, e.g., transgenic mice), or a cell (e.g., CHO cells) expression system or isolated from a recombinant combinatorial human antibody library.

[0162] The term “autologous” refers to biological components isolated from the same source and includes those biological components not isolated from the same source, but which have physical (e.g., amino acid sequence) and functional characteristics as if the biological components were isolated from the same source. In contrast, “heterologous” refers to an agent or entity from a different source.

[0163] The term “vector” is a nucleic acid molecule that is able to replicate autonomously in a host cell and can accept foreign DNA. A vector carries its own origin of replication, one or more unique recognition sites for restriction endonucleases which can be used for the insertion of foreign DNA, and usually selectable markers such as genes coding for 47  antibiotic resistance, and often recognition sequences (e.g., promoter) for the expression of the inserted DNA. Common vectors include plasmid vectors and phage vectors.

[0164] In some embodiments, TCRs of the invention may be conjugated to a moiety such as a ligand, a detectable moiety, or a therapeutic moiety (“immunoconjugate”), such as a cytotoxin, an anti -cancer drug, or any other therapeutic moiety useful for treating a disease or condition including an HPV16-, MART1-, CMV-, EBV-, or influenza- associated disease or disorder.

[0165] The terms “non-naturally occurring” or “engineered”, as used herein, may refer to a protein (e.g., a TCR or variable domain thereof), a nucleic acid (e.g., a vector), or a cell (e.g., a host cell) that comprises a composite structure (e.g., an amino acid or nucleic acid sequence) that is made by human intervention exceeding isolation and that has not been found to exist in nature. In some instances, non-naturally occurring proteins, nucleic acids, or cells may be made by combining naturally occurring components of a protein, nucleic acid, or cell, such as by combining two or more sequences, by modifying a naturally occurring sequence (e.g., by a deletion, addition, or substitution), or by genetically modifying a cell to comprise a heterologous nucleic acid or to comprise or encode a heterologous protein. By way of example, non-naturally occurring proteins may comprise synthetic proteins, such as fusion proteins and other modified proteins, as described elsewhere herein, including soluble T cell receptors or variable regions thereof. Non-naturally occurring nucleic acids may comprise vectors that have been engineered to incorporate heterologous genetic elements, such as origins of replication, promoters, restriction endonuclease recognition sites, and / or other sequences, such as polynucleotide sequences encoding a TCR, or variable domain provided herein. Those of ordinary skill in the art are familiar with various ways for altering naturally occurring proteins, such as TCRs or variable domains thereof, without diminishing the function of the protein (e.g., the binding affinity or specificity of a naturally occurring TCR for its cognate antigen (e.g., HLA presented peptide)). Some modifications may in fact increase binding affinity or specificity. Similarly, those of ordinary skill in the art are familiar with various ways for altering naturally occurring nucleic acids to improve expression of an encoded protein (e.g., TCR or variable domain thereof) or for engineering cells to improve viability or the expression or functionality of an encoded protein (e.g., TCR or variable domain thereof). Accordingly, any of the TCRs or variable domains disclosed herein may be provided as a non-naturally occurring TCR or variable domain thereof 48  or a non-naturally occurring protein comprising the same. Similarly, any of the nucleic acid molecules comprising a sequence encoding a TCR or variable domain thereof disclosed herein may be provided as a non-naturally occurring nucleic acid molecule (e.g., a vector). Likewise, any of the cells comprising a TCR or variable domain thereof disclosed herein or any of the host cells comprising a nucleic acid comprising a sequence encoding a TCR or variable domain herein may be provided as a non-naturally occurring cell.

[0166] The term “surface plasmon resonance”, as used herein, refers to an optical phenomenon that allows for the analysis of real-time biomolecular interactions by detection of alterations in protein concentrations within a biosensor matrix, for example using the BIACORE™ system (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, N.J.).

[0167] The term “KD”, also known as KD or Kd, is intended to refer to the equilibrium dissociation constant of a particular biomolecule and its binding partner. KD measurements are particularly useful for assessing protein-protein interactions, e.g. as in an antigen-binding protein-antigen interaction. The smaller the value of the KD, the greater (or e.g. stronger) the binding interaction or affinity between the antigen-binding protein and antigen (e.g. target). The larger the value of the KD, the weaker the binding interaction or affinity between the antigen- binding protein and antigen.

[0168] The term “substantial identity” or “substantially identical,” when referring to a nucleic acid or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 90%, and more preferably at least about 95%, 96%, 97%, 98% or 99% of the nucleotide bases, as measured by any well-known algorithm of sequence identity, as discussed below. A nucleic acid molecule having substantial identity to a reference nucleic acid molecule may, in certain instances, encode a polypeptide having the same or substantially similar amino acid sequence as the polypeptide encoded by the reference nucleic acid molecule.

[0169] Sequence identity can be calculated using an algorithm, for example, the Needleman Wunsch algorithm (Needleman and Wunsch 1970, J. Mol. Biol.48: 443-453) for global alignment, or the Smith Waterman algorithm (Smith and Waterman 1981, J. Mol. Biol. 147: 195-197) for local alignment. Another preferred algorithm is described by Dufresne et al in 49  Nature Biotechnology in 2002 (vol.20, pp.1269-71) and is used in the software GenePAST (GQ Life Sciences, Inc. Boston, MA).

[0170] As applied to polypeptides, the term “substantial similarity” or “substantially similar” means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least 90% sequence identity, even more preferably at least 95%, 96%, 97%, 98% or 99% sequence identity. Preferably, residue positions, which are not identical, differ by conservative amino acid substitutions. A “conservative amino acid substitution” is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of a protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent or degree of similarity may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. See, e.g., Pearson (1994) Methods Mol. Biol.24: 307-331, which is herein incorporated by reference. Examples of groups of amino acids that have side chains with similar chemical properties include 1) aliphatic side chains: glycine, alanine, valine, leucine and isoleucine; 2) aliphatic-hydroxyl side chains: serine and threonine; 3) amide -containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartate and glutamate, and 7) sulfur-containing side chains: cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamate-aspartate, and asparagine- glutamine. Alternatively, a conservative replacement is any change having a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. (1992) Science 256: 144345, herein incorporated by reference. A “moderately conservative” replacement is any change having a nonnegative value in the PAM250 log -likelihood matrix.

[0171] Sequence similarity for polypeptides is typically measured using sequence analysis software. Protein analysis software matches similar sequences using measures of similarity assigned to various substitutions, deletions and other modifications, including conservative amino acid substitutions. For instance, GCG software contains programs such as GAP and BESTFIT which can be used with default parameters to determine sequence homology 50  or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a wild type protein and a mutein thereof. See, e.g., GCG Version 6.1. Polypeptide sequences also can be compared using FASTA with default or recommended parameters; a program in GCG Version 6.1. FASTA (e.g., FASTA2 and FASTA3) provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences (Pearson (2000) supra). Sequences also can be compared using the Smith-Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2, BLOSUM matrix of 62. Another preferred algorithm when comparing a sequence of the invention to a database containing a large number of sequences from different organisms is the computer program BLAST, especially BLASTP or TBLASTN, using default parameters. See, e.g., Altschul et al. (1990) J. Mol. Biol. 215: 403-410 and (1997) Nucleic Acids Res.25:3389-3402, each of which is herein incorporated by reference.

[0172] A “patient-derived TCR” is a TCR that is produced by isolating the alpha and beta chains of a specific antigen (e.g., HPV16, MART1, CMV, EBV, or influenza) reactive TCR isolated from the T-lymphocytes that mediated regression of a disease associated with the specific antigen (e.g., HPV16, MART1, CMV, EBV, or influenza).

[0173] An “affinity-matured TCR” is a TCR that is produced by mutagenesis and selection in vitro. For example, untargeted or targeted (e.g., oligonucleotide -directed) mutagenesis can be performed to introduce variation in TCR sequences, and the subsequent TCRs can then be screened for affinity against a target, e.g., by use of phage display.

[0174] By the phrase “therapeutically effective amount” is meant an amount that produces the desired effect for which it is administered. The exact amount will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, for example, Lloyd (1999) The Art, Science and Technology of Pharmaceutical Compounding). The term “effective amount” is intended to encompass contexts such as a pharmaceutically effective amount or therapeutically effective amount. For example, in certain embodiments, the effective amount is capable of achieving a beneficial state, beneficial outcome, functional activity in a screening assay, or improvement of a clinical condition.

[0175] As described herein, a TCR of the invention may be “administered” to a subject. 51

[0176] “Administering” a TCR of the invention includes, but is not limited to, administration of a cell expressing a TCR of the invention (e.g., an effector cell such as a T cell), administration of a nucleic acid expressing a TCR of the invention (e.g., a vector expressing such a TCR), and administration of a polypeptide comprising a TCR of the invention, wherein the polypeptide has been formatted for such administration (e.g., a bispecific polypeptide comprising a TCR chain and a CD3-binding antibody chain).

[0177] As used herein, the term “subject” refers to an animal, preferably a mammal, in need of amelioration, prevention and / or treatment of an HPV16-, MART1-, CMV-, EBV-, or influenza- associated disease or disorder. The term includes human subjects who have or are at risk of having a HPV16-, MART1-, CMV-, EBV-, or influenza--associated disease or disorder.

[0178] As used herein, “anti-cancer drug” means any agent useful to treat or ameliorate or inhibit cancer including, but not limited to, cytotoxins and agents such as antimetabolites, alkylating agents, anthracyclines, antibiotics, antimitotic agents, procarbazine, hydroxyurea, asparaginase, corticosteroids, cyclophosphamide, mytotane (0,P'-(DDD)), biologies (e.g., antibodies and interferons) and radioactive agents. As used herein, “a cytotoxin or cytotoxic agent”, also refers to a chemotherapeutic agent and means any agent that is detrimental to cells. Examples include Taxol® (paclitaxel), temozolamide, cytochalasin B, gramicidin D, ethidium bromide, emetine, cisplatin, mitomycin, etoposide, tenoposide, vincristine, vinbiastine, coichicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1 -dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof.

[0179] The terms “prevent”, “preventing”, “prevention”, “prophylactic treatment” and the like are meant to refer to reducing the probability of developing a disorder or condition in a subject, who does not have, but is at risk of or susceptible to developing a disorder or condition. Prevention and the like do not mean preventing a subject from ever getting the specific disease or disorder. Prevention may require the administration of multiple doses. Prevention can include the prevention of a recurrence of a disease in a subject for whom all disease symptoms were eliminated, or prevention of recurrence in a relapsing-remitting disease. In accordance with the disclosure herein, there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory 52  Manual, Second Edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989 (herein “Sambrook et al., 1989”); DNA Cloning: A Practical Approach, Volumes I and II (D.N. Glover ed.1985); Oligonucleotide Synthesis (M.J. Gait ed.1984); Nucleic Acid Hybridization [B.D. Hames & S.J. Higgins eds. (1985)]; Transcription And Translation [B.D. Hames & S.J. Higgins, eds. (1984)]; Animal Cell Culture [R.I. Freshney, ed. (1986)]; Immobilized Cells And Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984); Ausubel, F.M. et al. (eds.). Current Protocols in Molecular Biology. John Wiley & Sons, Inc., 1994, each of which publications is incorporated herein in its entirety by reference. These techniques include site directed mutagenesis, see, e.g., in Kunkel, Proc. Natl. Acad. Sci. USA 82: 488- 492 (1985), U. S. Patent No.5,071, 743, Fukuoka et al., Biochem. Biophys. Res. Commun. 263: 357-360 (1999); Kim and Maas, BioTech.28: 196-198 (2000); Parikh and Guengerich, BioTech.24: 428-431 (1998); Ray and Nickoloff, BioTech.13: 342-346 (1992); Wang et al., BioTech.19: 556-559 (1995); Wang and Malcolm, BioTech.26: 680-682 (1999); Xu and Gong, BioTech.26: 639-641 (1999), U.S. Patents Nos.5,789, 166 and 5,932, 419, Hogrefe, Strategies l4.3: 74-75 (2001), U. S. Patents Nos.5,702,931, 5,780,270, and 6,242,222, Angag and Schutz, Biotech.30: 486-488 (2001), Wang and Wilkinson, Biotech.29: 976-978 (2000), Kang et al., Biotech.20: 44-46 (1996), Ogel and McPherson, Protein Engineer.5: 467-468 (1992), Kirsch and Joly, Nucl. Acids. Res.26: 1848-1850 (1998), Rhem and Hancock, J. Bacteriol.178: 3346- 3,349 (1996), Boles and Miogsa, Curr. Genet.28: 197-198 (1995), Barrenttino et al., Nuc. Acids. Res.22: 541-542 (1993), Tessier and Thomas, Meths. Molec. Biol.57: 229-237, and Pons et al., Meth. Molec. Biol.67: 209-218; each of which publications is incorporated herein in its entirety by reference. I. PV16-, MART1-, CMV-, EBV-, or influenza- T cells, T Cell Receptors (TCRs) and Compositions comprising PV16-, MART1-, CMV-, EBV-, or influenza- TCRs

[0180] T cells are a subgroup of cells which, together with other immune cell types (polymorphonuclear, eosinophils, basophils, mast cells, B-cells, NK cells), constitute the cellular component of the immune system. Under physiological conditions T cells function in immune surveillance and in the elimination of foreign antigen. However, under pathological conditions there is compelling evidence that T cells play a major role in the causation and propagation of 53  disease. In these disorders, breakdown of T cell immunological tolerance, either central or peripheral is a fundamental process in the causation of autoimmune disease.

[0181] T cells bind epitopes on small antigenic determinants on the surface of antigen- presenting cells that are associated with a major histocompatibility complex (MHC; in mice) or human leukocyte antigen (HLA; in humans) complex. T cells bind these epitopes through a T cell receptor (TCR) complex on the surface of the T cell. T cell receptors are heterodimeric structures composed of two types of chains: an α (alpha) and β (beta) chain, or a γ (gamma) and ^ (delta) chain. The α chain is encoded by the nucleic acid sequence located within the α locus (on human or mouse chromosome 14), which also encompasses the entire δ locus, and the β chain is encoded by the nucleic acid sequence located within the β locus (on mouse chromosome 6 or human chromosome 7). The majority of T cells have an αβ TCR; while a minority of T cells bears a ^ ^ TCR.

[0182] T cell receptor α and β polypeptides, i.e., α and β chains (and similarly ^ and ^ polypeptides, i.e., ^ and ^ chains) are linked to each other via a disulfide bond. Each of the two polypeptides that make up the TCR contains an extracellular domain comprising constant and variable regions, a transmembrane domain, and a cytoplasmic tail (the transmembrane domain and the cytoplasmic tail also being a part of the constant region). The variable region of the TCR determines its antigen specificity, and similar to immunoglobulins, comprises three complementarity determining regions (CDRs). The TCR is expressed on most T cells in the body and is known to be involved in the recognition of MHC-restricted antigens. The TCR α chain includes a covalently linked Vα and Cα region, whereas the β chain includes a Vβ region covalently linked to a Cβ region. The Vα and Vβ regions form a pocket or cleft that can bind an antigen in the context of a major histocompatibility complex (MHC) (or HLA in humans). TCRs are detection molecules with exquisite specificity, and exhibit, like antibodies, an enormous diversity.

[0183] The general structure of TCR molecules and methods of making and using, including binding to a peptide:Major Histocompatibility Complex have been disclosed. See, for example PCT / US98 / 04274; PCT / US98 / 20263; W099 / 60120.

[0184] Non-human animals (e.g., rodents, e.g., mice or rats) can be genetically engineered to express a human or humanized T cell receptor (TCR) comprising a variable domain encoded by at least one human TCR variable region gene segment, as described in, for 54  example, PCT Publication No. WO 2016 / 164492, the entire contents of which are hereby incorporated herein by reference. For example, the VelociT® mouse technology (Regeneron), a genetically modified mouse that allows for the production of fully human therapeutic TCRs against tumor and / or viral antigens, can be used to produce select portions of the TCRs of the invention. Those of skill in the art, through standard mutagenesis techniques, in conjunction with the assays described herein, can obtain altered TCR sequences and test them for particular binding affinity and / or specificity. Useful mutagenesis techniques known in the art include, without limitation, c / e novo gene synthesis, oligonucleotide-directed mutagenesis, region- specific mutagenesis, linker-scanning mutagenesis, and site-directed mutagenesis by PCR (see, e.g., Sambrook et al. (1989) and Ausubel et al. (1999)).

[0185] Briefly, in some embodiments, methods for generating a TCR to a HPV16-, MART1-, CMV-, EBV-, or influenza- peptide may include immunizing a non-human animal (e.g., a rodent, e.g., a mouse or a rat), such as a genetically engineered non-human animal that comprises in its genome an un-rearranged human TCR variable gene locus, with a PV16-, MART1-, CMV-, EBV-, or influenza- peptide or nucleic acid encoding a PV16-, MART1-, CMV-, EBV-, or influenza- peptide; allowing the animal to mount an immune response to the peptide; isolating from the animal a T cell reactive to the peptide; determining a nucleic acid sequence of a human TCR variable region expressed by the T cell; cloning the human TCR variable region into a nucleotide construct comprising a nucleic acid sequence of a human TCR constant region such that the human TCR variable region is operably linked to the human TCR constant region; and expressing from the construct a human T cell receptor specific for the PV16-, MART1-, CMV-, EBV-, or influenza- peptide, respectively. In some embodiments, the steps of isolating a T cell, determining a nucleic acid sequence of a human TCR variable region expressed by the T cell, cloning the human TCR variable region into a nucleotide construct comprising a nucleic acid sequence of a human TCR constant region, and expressing a human T cell receptor are performed using standard techniques known to those of skill the art.

[0186] In some embodiments, methods of identifying a TCR sequence specific for a cognate HPV16-, MART1-, CMV-, EBV-, or influenza- peptide comprises a method set forth in WO / 2021067851, incorporated herein in its entirety by reference, and briefly described in Example 1 and FIG.1 herein. Such TCR sequences may then be cloned and expressed according to standard techniques know to those of skill in the art for the generation of human therapeutics. 55  In some embodiments, portions of TCR sequences (e.g., Vα and / or Vβ or one or more CDRs thereof) such as, for example, portions obtained by the method set forth in WO / 2021067851 or Example 1 and FIG.1 as described herein, may be combined (e.g., engrafted onto) with other molecules, such as, for example, TCR sequences or portions thereof obtained from different TCR sequences, including different TCR sequences obtained from the same method (e.g., from the same subject or a different subject) or TCR sequences obtained from different methods entirely (e.g., from immunizing humanized mice, such as those described in PCT Publication No. WO 2016 / 164492). For example, in some embodiments a fusion protein comprises the Vα or Vβ of a TCR sequence set forth herein combined with the sequence(s) of a constant domain, transmembrane domain, cytoplasmic tail, or combination thereof (including an entire constant region) of another TCR, including a different TCR set forth herein or a common or universal sequence, such as one used for therapeutic purposes. The TCR sequences or portions thereof combined may be autologous or heterologous. In some preferred embodiments, all portions of a TCR sequence are human.

[0187] In some embodiments, the nucleotide sequence encoding a T cell receptor specific for an antigen of interest is expressed in a cell. In some embodiments, the cell expressing the TCR is selected from a CHO, COS, 293, HeLa, PERC.6™ cell, etc.

[0188] In obtaining variant TCR coding sequences, those of ordinary skill in the art will recognize that TCR-derived proteins may be modified by certain amino acid substitutions, additions, deletions, and post-translational modifications, without loss or reduction of biological activity. In particular, it is well known that conservative amino acid substitutions, that is, substitution of one amino acid for another amino acid of similar size, charge, polarity and conformation, are unlikely to significantly alter protein function. The 20 standard amino acids that are the constituents of proteins can be broadly categorized into four groups of conservative amino acids as follows: the nonpolar (hydrophobic) group includes alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan and valine; the polar (uncharged, neutral) group includes asparagine, cysteine, glutamine, glycine, serine, threonine and tyrosine; the positively charged (basic) group contains arginine, histidine and lysine; and the negatively charged (acidic) group contains aspartic acid and glutamic acid. Substitution in a protein of one amino acid for another within the same group is unlikely to have an adverse effect on the biological activity of the protein. 56

[0189] In some embodiments, a TCR of the present disclosure comprises a TCR ^ ^chain polypeptide and / or a TCR ^ ^chain polypeptide. In some embodiments, the TCR ^ ^chain polypeptide comprises a TCR ^ variable (TCR V ^) domain and / or the TCR ^ ^chain polypeptide comprises a TCR ^ variable (TCR V ^) domain. In some embodiments, the TCR V ^ domain comprises a TCR ^ complementarity determining region ( ^CDR) 1, an ^CDR2, and / or an ^CDR3 and / or the TCR V ^ domain comprises a TCR ^ complementarity determining region ( ^CDR) 1, a ^CDR2, and / or a ^CDR3. In some embodiments, a CDR of the present disclosure, e.g., an ^CDR1, an ^CDR2, an ^CDR3, a ^CDR1, a ^CDR2, and / or a ^CDR3, may comprise 1 or more substitutions as compared to a reference CDR amino acid sequence as disclosed herein. For example, a TCR of the present disclosure can comprise a CDR sequence with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more substitutions as compared to a CDR sequence of a TCR identified as described herein.

[0190] Table 9 below lists sequence identifiers for amino acid sequences of the ^CDRs (e.g., ^CDR1, ^CDR2, and ^CDR3), ^CDRs (e.g., ^CDR1, ^CDR2, and ^CDR3), TCR V ^ domains and TCR V ^ domains of TCRs of the present disclosure, with sequence identifiers for nucleic acids encoding the same shown in parentheses.

[0191] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR1 of a TCR V ^ domain as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0192] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR2 of a TCR V ^ domain as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0193] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR3 of a TCR V ^ domain as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0194] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR1 of a TCR V ^ domain as set forth in Table 9, or a substantially 57  similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0195] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR2 of a TCR V ^ domain as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0196] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR3 of a TCR V ^ domain as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0197] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR3 amino acid sequence of a TCR V ^ ^domain as set forth in Table 9, and a ^CDR3 amino acid sequence of a TCR V ^ domain as set forth in Table 9, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined.

[0198] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a pair of ^CDR3 and ^CDR3 amino acid sequences from the same TCR, i.e., an ^CDR3 / ^CDR3 amino acid sequence pair, of a pair of TCR V ^ ^domain and TCR V ^ domain sequences from the same TCR, e.g., a TCR V ^ ^V ^ ^pair of amino acid sequences, as set forth in Table 9, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined.

[0199] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a set of three ^CDR sequences, i.e., an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences, of a TCR V ^ domain as set forth in Table 9, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined.

[0200] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a set of three ^CDR sequences, i.e., an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences, of a TCR V ^ domain as set forth in Table 9, or substantially similar 58  sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined.

[0201] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a set of six CDR sequences, i.e., an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences, of a pair of TCR V ^ ^domain and TCR V ^ domain sequences from the same TCR, i.e., a TCR V ^ ^V ^ ^pair of amino acid sequences, as set forth in Table 9, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined.

[0202] In various embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR1 comprising an amino acid sequence selected from any of the ^CDR1 amino acid sequences listed in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 17, 33, 49, 65, 81, 97, 113, 129, 145, 161, 177, 193, 209, 225, 241, 257, 273, 289, 305, 321, 337, 353, 369, 385, 401, 417, 433, 449, 465, 481, 497, 513, 529, 545, 561, 577, 593, 609, 625, 641, 657, 673, 689, 705, 721, 737, 753, 769, 785, 801, 817, 833, 849, 865, 881, 897, 913, 929, 945, 961, 977, 993, 1009, 1025, 1041, 1057, 1073, 1089, 1105, and 1121, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0203] In various embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR2 comprising an amino acid sequence selected from any of the ^CDR2 amino acid sequences listed in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 3, 19, 35, 51, 67, 83, 99, 115, 131, 147, 163, 179, 195, 211, 227, 243, 259, 275, 291, 307, 323, 339, 355, 371, 387, 403, 419, 435, 451, 467, 483, 499, 515, 531, 547, 563, 579, 595, 611, 627, 643, 659, 675, 691, 707, 723, 739, 755, 771, 787, 803, 819, 835, 851, 867, 883, 899, 915, 931, 947, 963, 979, 995, 1011, 1027, 1043, 1059, 1075, 1091, 1107, and 1123, or a substantially 59  similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0204] In various embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a ^CDR3 comprising an amino acid sequence selected from any of the ^CDR3 amino acid sequences listed in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 21, 37, 53, 69, 85, 101, 117, 133, 149, 165, 181, 197, 213, 229, 245, 261, 277, 293, 309, 325, 341, 357, 373, 389, 405, 421, 437, 453, 469, 485, 501, 517, 533, 549, 565, 581, 597, 613, 629, 645, 661, 677, 693, 709, 725, 741, 757, 773, 789, 805, 821, 837, 853, 869, 885, 901, 917, 933, 949, 965, 981, 997, 1013, 1029, 1045, 1061, 1077, 1093, 1109, and 1125, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0205] In various embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a ^CDR1 comprising an amino acid sequence selected from any of the ^CDR1 amino acid sequences listed in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a ^CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 25, 41, 57, 73, 89, 105, 121, 137, 153, 169, 185, 201, 217, 233, 249, 265, 281, 297, 313, 329, 345, 361, 377, 393, 409, 425, 441, 457, 473, 489, 505, 521, 537, 553, 569, 585, 601, 617, 633, 649, 665, 681, 697, 713, 729, 745, 761, 777, 793, 809, 825, 841, 857, 873, 889, 905, 921, 937, 953, 969, 985, 1001, 1017, 1033, 1049, 1065, 1081, 1097, 1113, and 1129, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0206] In various embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a ^CDR2 comprising an amino acid sequence selected from any of the ^CDR2 amino acid sequences listed in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a ^CDR2 60  comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 11, 27, 43, 59, 75, 91, 107, 123, 139, 155, 171, 187, 203, 219, 235, 251, 267, 283, 299, 315, 331, 347, 363, 379, 395, 411, 427, 443, 459, 475, 491, 507, 523, 539, 555, 571, 587, 603, 619, 635, 651, 667, 683, 699, 715, 731, 747, 763, 779, 795, 811, 827, 843, 859, 875, 891, 907, 923, 939, 955, 971, 987, 1003, 1019, 1035, 1051, 1067, 1083, 1099, 1115, and 1131, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0207] In various embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a ^CDR3 comprising an amino acid sequence selected from any of the ^CDR3 amino acid sequences listed in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a ^CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 29, 45, 61, 77, 93, 109, 125, 141, 157, 173, 189, 205, 221, 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413, 429, 445, 461, 477, 493, 509, 525, 541, 557, 573, 589, 605, 621, 637, 653, 669, 685, 701, 717, 733, 749, 765, 781, 797, 813, 829, 845, 861, 877, 893, 909, 925, 941, 957, 973, 989, 1005, 1021, 1037, 1053, 1069, 1085, 1101, 1117, and 1133, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0208] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a pair of ^CDR3 and ^CDR3 amino acid sequences from the same TCR, i.e., an ^CDR3 / ^CDR3 amino acid sequence pair, selected from a TCR V ^ ^V ^ ^pair of amino acid sequences as set forth in Table 9, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 5 / 13, 21 / 29, 37 / 45, 53 / 61, 69 / 77, 85 / 93, 101 / 109, 117 / 125, 133 / 141, 149 / 157, 165 / 173, 181 / 189, 197 / 205, 213 / 221, 229 / 237, 245 / 253, 261 / 269, 277 / 285, 293 / 301, 309 / 317, 325 / 333, 341 / 349, 357 / 365, 373 / 381, 389 / 397, 405 / 413, 421 / 429, 437 / 445, 453 / 461, 469 / 477, 485 / 493, 501 / 509, 517 / 525, 533 / 541, 549 / 557, 565 / 573, 581 / 589, 597 / 605, 613 / 621, 629 / 637, 645 / 653, 661 / 669, 677 / 685, 693 / 701, 709 / 717, 725 / 733, 741 / 749, 757 / 765, 61  773 / 781, 789 / 797, 805 / 813, 821 / 829, 837 / 845, 853 / 861, 869 / 877, 885 / 893, 901 / 909, 917 / 925, 933 / 941, 949 / 957, 965 / 973, 981 / 989, 997 / 1005, 1013 / 1021, 1029 / 1037, 1045 / 1053, 1061 / 1069, 1077 / 1085, 1093 / 1101, 1109 / 1117, and 1125 / 1133, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined.

[0209] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a set of three ^CDR sequences, i.e., an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences, as set forth in Table 9, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 1-3-5, 17-19-21, 33-35-37, 49-51- 53, 65-67-69, 81-83-85, 97-99-101, 113-115-117, 129-131-133, 145-147-149, 161-163-165, 177- 179-181, 193-195-197, 209-211-213, 225-227-229, 241-243-245, 257-259-261, 273-275-277, 289-291-293, 305-307-309, 321-323-325, 337-339-341, 353-355-357, 369-371-373, 385-387- 389, 401-403-405, 417-419-421, 433-435-437, 449-451-453, 465-467-469, 481-483-485, 497- 499-501, 513-515-517, 529-531-533, 545-547-549, 561-563-565, 577-579-581, 593-595-597, 609-611-613, 625-627-629, 641-643-645, 657-659-661, 673-675-677, 689-691-693, 705-707- 709, 721-723-725, 737-739-741, 753-755-757, 769-771-773, 785-787-789, 801-803-805, 817- 819-821, 833-835-837, 849-851-853, 865-867-869, 881-883-885, 897-899-901, 913-915-917, 929-931-933, 945-947-949, 961-963-965, 977-979-981, 993-995-997, 1009-1011-1013, 1025- 1027-1029, 1041-1043-1045, 1057-1059-1061, 1073-1075-1077, 1089-1091-1093, 1105-1107- 1109, and 1121-1123-1125, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined.

[0210] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a set of three ^CDR sequences, i.e., an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences, as set forth in Table 9, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR1- ^CDR2- ^CDR3 set of amino acid 62  sequences selected from the group consisting of SEQ ID NOs: 9-11-13, 25-27-29, 41-43-45, 57- 59-61, 73-75-77, 89-91-93, 105-107-109, 121-123-125, 137-139-141, 153-155-157, 169-171- 173, 185-187-189, 201-203-205, 217-219-221, 233-235-237, 249-251-253, 265-267-269, 281- 283-285, 297-299-301, 313-315-317, 329-331-333, 345-347-349, 361-363-365, 377-379-381, 393-395-397, 409-411-413, 425-427-429, 441-443-445, 457-459-461, 473-475-477, 489-491- 493, 505-507-509, 521-523-525, 537-539-541, 553-555-557, 569-571-573, 585-587-589, 601- 603-605, 617-619-621, 633-635-637, 649-651-653, 665-667-669, 681-683-685, 697-699-701, 713-715-717, 729-731-733, 745-747-749, 761-763-765, 777-779-781, 793-795-797, 809-811- 813, 825-827-829, 841-843-845, 857-859-861, 873-875-877, 889-891-893, 905-907-909, 921- 923-925, 937-939-941, 953-955-957, 969-971-973, 985-987-989, 1001-1003-1005, 1017-1019- 1021, 1033-1035-1037, 1049-1051-1053, 1065-1067-1069, 1081-1083-1085, 1097-1099-1101, 1113-1115-1117, and 1129-1131-1133, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined.

[0211] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a set of six CDR sequences, i.e., an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences, selected from a TCR V ^ ^V ^ ^pair of amino acid sequences as set forth in Table 9, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 1-3-5-9-11-13, 17-19-21-25- 27-29, 33-35-37-41-43-45, 49-51-53-57-59-61, 65-67-69-73-75-77, 81-83-85-89-91-93, 97-99- 101-105-107-109, 113-115-117-121-123-125, 129-131-133-137-139-141, 145-147-149-153-155- 157, 161-163-165-169-171-173, 177-179-181-185-187-189, 193-195-197-201-203-205, 209- 211-213-217-219-221, 225-227-229-233-235-237, 241-243-245-249-251-253, 257-259-261-265- 267-269, 273-275-277-281-283-285, 289-291-293-297-299-301, 305-307-309-313-315-317, 321-323-325-329-331-333, 337-339-341-345-347-349, 353-355-357-361-363-365, 369-371-373- 377-379-381, 385-387-389-393-395-397, 401-403-405-409-411-413, 417-419-421-425-427-429, 433-435-437-441-443-445, 449-451-453-457-459-461, 465-467-469-473-475-477, 481-483-485- 489-491-493, 497-499-501-505-507-509, 513-515-517-521-523-525, 529-531-533-537-539-541, 63  545-547-549-553-555-557, 561-563-565-569-571-573, 577-579-581-585-587-589, 593-595-597- 601-603-605, 609-611-613-617-619-621, 625-627-629-633-635-637, 641-643-645-649-651-653, 657-659-661-665-667-669, 673-675-677-681-683-685, 689-691-693-697-699-701, 705-707-709- 713-715-717, 721-723-725-729-731-733, 737-739-741-745-747-749, 753-755-757-761-763-765, 769-771-773-777-779-781, 785-787-789-793-795-797, 801-803-805-809-811-813, 817-819-821- 825-827-829, 833-835-837-841-843-845, 849-851-853-857-859-861, 865-867-869-873-875-877, 881-883-885-889-891-893, 897-899-901-905-907-909, 913-915-917-921-923-925, 929-931-933- 937-939-941, 945-947-949-953-955-957, 961-963-965-969-971-973, 977-979-981-985-987-989, 993-995-997-1001-1003-1005, 1009-1011-1013-1017-1019-1021, 1025-1027-1029-1033-1035- 1037, 1041-1043-1045-1049-1051-1053, 1057-1059-1061-1065-1067-1069, 1073-1075-1077- 1081-1083-1085, 1089-1091-1093-1097-1099-1101, 1105-1107-1109-1113-1115-1117, and 1121-1123-1125-1129-1131-1133, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for all of the sequences combined.

[0212] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a TCR V ^ domain as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a TCR V ^ domain selected from the group consisting of SEQ ID NOs: 7, 23, 39, 55, 71, 87, 103, 119, 135, 151, 167, 183, 199, 215, 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407, 423, 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, 951, 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111, and 1127, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0213] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a TCR V ^ domain as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a TCR V ^ domain selected from the group consisting of SEQ ID NOs: 15, 31, 47, 63, 79, 95, 111, 127, 143, 159, 175, 191, 207, 223, 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415, 431, 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687, 64  703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943, 959, 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119, and 1135, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0214] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a TCR V ^ domain and a TCR V ^ domain as set forth in Table 9, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined. In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a TCR V ^ domain selected from the group consisting of SEQ ID NOs: 7, 23, 39, 55, 71, 87, 103, 119, 135, 151, 167, 183, 199, 215, 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407, 423, 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, 951, 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111, and 1127, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and a TCR V ^ domain selected from the group consisting of SEQ ID NOs: 15, 31, 47, 63, 79, 95, 111, 127, 143, 159, 175, 191, 207, 223, 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415, 431, 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687, 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943, 959, 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119, and 1135, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0215] In some embodiments, a TCR, or a variable domain thereof, of the present disclosure comprises a pair of TCR V ^ and TCR V ^ domains of the same TCR, i.e., a TCR V ^ ^V ^ amino acid sequence pair, of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined. In some embodiments, the TCR V ^ ^V ^ amino acid sequence pair is selected from the group consisting of SEQ ID NOs: 7 / 15, 23 / 31, 39 / 47, 55 / 63, 71 / 79, 87 / 95, 103 / 111, 119 / 127, 135 / 143, 151 / 159, 167 / 175, 183 / 191, 199 / 207, 215 / 223, 231 / 239, 247 / 255, 263 / 271, 279 / 287, 295 / 303, 311 / 319, 327 / 335, 343 / 351, 359 / 367, 375 / 383, 391 / 399, 407 / 415, 423 / 431, 439 / 447, 455 / 463, 471 / 479, 487 / 495, 503 / 511, 519 / 527, 535 / 543, 551 / 559, 567 / 575, 583 / 591, 599 / 607, 615 / 623, 631 / 639, 647 / 655, 663 / 671, 679 / 687, 695 / 703, 711 / 719, 727 / 735, 743 / 751, 759 / 767, 775 / 783, 65  791 / 799, 807 / 815, 823 / 831, 839 / 847, 855 / 863, 871 / 879, 887 / 895, 903 / 911, 919 / 927, 935 / 943, 951 / 959, 967 / 975, 983 / 991, 999 / 1007, 1015 / 1023, 1031 / 1039, 1047 / 1055, 1063 / 1071, 1079 / 1087, 1095 / 1103, 1111 / 1119, and 1127 / 1135, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0216] In some embodiments of the present disclosure, the HLA presented peptide of the TCR, or variable domain thereof comprises an HPV16-peptide. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR3 selected from the group consisting of SEQ ID NOs: 133, 149, 165, 181, 197, and 213, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a ^CDR3 selected from the group consisting of SEQ ID NOs: 141, 157, 173, 189, 205, and 221, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 133 / 141, 149 / 157, 165 / 173, 181 / 189, 197 / 205, and 213 / 221, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0217] In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 129-131-133; 145-147-149; 161-163-165; 177-179-181; 193-195-197; and 209-211- 213, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined; and / or a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 137-139-141; 153-155-157; 169-171-173; 185-187-189; 201-203-205; and 217-219- 221, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 129-131-133-137-139-141; 145-147-149-153-155-157; 161-163-165-169-171-173; 177-179-181-185-187-189; 193-195-197-201-203-205; and 209-211-213-217-219-221, or 66  substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0218] In some embodiments, the TCR, or a variable domain thereof comprises a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 135, 151, 167, 183, 199, and 215, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 143, 159, 175, 191, 207, and 223, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the TCR, or a variable domain thereof comprises a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 135 / 143; 151 / 159; 167 / 175; 183 / 191; 199 / 207; and 215 / 223, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0219] In some embodiments of the present disclosure, the HLA presented peptide of the TCR, or variable domain thereof comprises an MART1-peptide. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR3 selected from the group consisting of SEQ ID NOs: 965, 981, 997, 1013, 1029, 1045, 1061, 1077, 1093, 1109, and 1125, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a ^CDR3 selected from the group consisting of SEQ ID NOs: 973, 989, 1005, 1021, 1037, 1053, 1069, 1085, 1101, 1117, and 1133, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 965 / 973, 981 / 989, 997 / 1005, 1013 / 1021, 1029 / 1037, 1045 / 1053, 1061 / 1069, 1077 / 1085, 1093 / 1101, 1109 / 1117, and 1125 / 1133, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0220] In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 961-963-965; 977-979-981; 993-995-997; 1009-1011-1013; 1025-1027-1029; 1041- 1043-1045; 1057-1059-1061; 1073-1075-1077; 1089-1091-1093; 1105-1107-1109; and 1121- 1123-1125, or substantially similar sequences thereof having at least 90%, at least 95%, at least 67  98% or at least 99% sequence identity for each of the sequences or for the sequences combined; and / or a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 969-971-973; 985-987-989; 1001-1003-1005; 1017-1019-1021; 1033-1035- 1037; 1049-1051-1053; 1065-1067-1069; 1081-1083-1085; 1097-1099-1101; 1113-1115-1117; and 1129-1131-1133, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 961-963-965-969-971-973; 977-979-981-985-987-989; 993-995-997-1001-1003-1005; 1009-1011-1013-1017-1019-1021; 1025-1027-1029-1033-1035- 1037; 1041-1043-1045-1049-1051-1053; 1057-1059-1061-1065-1067-1069; 1073-1075-1077- 1081-1083-1085; 1089-1091-1093-1097-1099-1101; 1105-1107-1109-1113-1115-1117; and 1121-1123-1125-1129-1131-1133, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0221] In some embodiments, the TCR, or a variable domain thereof comprises a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111, and 1127, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119, and 1135, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the TCR, or a variable domain thereof comprises a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 967 / 975, 983 / 991, 999 / 1007, 1015 / 1023, 1031 / 1039, 1047 / 1055, 1063 / 1071, 1079 / 1087, 1095 / 1103, 1111 / 1119, and 1127 / 1135, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0222] In some embodiments of the present disclosure, the HLA presented peptide of the TCR, or variable domain thereof comprises an CMV-peptide. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR3 selected from the group consisting of SEQ ID 68  NOs: 5, 21, 37, 53, 69, 85, 101, and 117, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a ^CDR3 selected from the group consisting of SEQ ID NOs: 13, 29, 45, 61, 77, 93, 109, and 125, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 5 / 13, 21 / 29, 37 / 45, 53 / 61, 69 / 77, 85 / 93, 101 / 109, and 117 / 125, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0223] In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 1-3-5; 17-19-21; 33-35-37; 49-51-53; 65-67-69; 81-83-85; 97-99-101; and 113-115- 117, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined; and / or a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 9-11-13; 25-27-29; 41-43-45; 57-59-61; 73-75-77; 89-91-93; 105-107-109; and 121- 123-125, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 1-3-5-9-11-13; 17-19-21-25-27-29; 33-35-37-41-43-45; 49-51-53-57-59-61; 65- 67-69-73-75-77; 81-83-85-89-91-93; 97-99-101-105-107-109; and 113-115-117-121-123-125, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0224] In some embodiments, the TCR, or a variable domain thereof comprises a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 23, 39, 55, 71, 87, 103, and 119; or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 15, 31, 47, 63, 79, 95, 111, and 127, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the TCR, or a variable domain thereof 69  comprises a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 7 / 15, 23 / 31, 39 / 47, 55 / 63, 71 / 79, 87 / 95, 103 / 111, and 119 / 127, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0225] In some embodiments of the present disclosure, the HLA presented peptide of the TCR, or variable domain thereof comprises an EBV-peptide. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR3 selected from the group consisting of SEQ ID NOs: 229, 245, 261, 277, 293, 309, 325, 341, 357, 373, 389, 405, and 421, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a ^CDR3 selected from the group consisting of SEQ ID NOs: 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413, and 429, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 229 / 237, 245 / 253, 261 / 269, 277 / 285, 293 / 301, 309 / 317, 325 / 333, 341 / 349, 357 / 365, 373 / 381, 389 / 397, 405 / 413, and 421 / 429, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0226] In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 225-227-229; 241-243-245; 257-259-261; 273-275-277; 289-291-293; 305-307-309; 321-323-325; 337-339-341; 353-355-357; 369-371-373; 385-387-389; 401-403-405; and 417- 419-421, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined; and / or a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 233-235-237; 249-251-253; 265-267-269; 281-283-285; 297-299-301; 313- 315-317; 329-331-333; 345-347-349; 361-363-365; 377-379-381; 393-395-397; 409-411-413; and 425-427-429, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 225-227-229-233-235-237; 241-243-245-249-251-253; 257-259- 70  261-265-267-269; 273-275-277-281-283-285; 289-291-293-297-299-301; 305-307-309-313- 315-317; 321-323-325-329-331-333; 337-339-341-345-347-349; 353-355-357-361-363-365; 369-371-373-377-379-381; 385-387-389-393-395-397; 401-403-405-409-411-413; and 417-419- 421-425-427-429, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0227] In some embodiments, the TCR, or a variable domain thereof comprises a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407, and 423, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415, and 431, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the TCR, or a variable domain thereof comprises a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 231 / 239, 247 / 255, 263 / 271, 279 / 287, 295 / 303, 311 / 319, 327 / 335, 343 / 351, 359 / 367, 375 / 383, 391 / 399, 407 / 415, and 423 / 431, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0228] In some embodiments of the present disclosure, the HLA presented peptide of the TCR, or variable domain thereof comprises an influenza-peptide. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR3 selected from the group consisting of SEQ ID NOs: 437, 453, 469, 485, 501, 517, 533, 549, 565, 581, 597, 613, 629, 645, 661, 677, 693, 709, 725, 741, 757, 773, 789, 805, 821, 837, 853, 869, 885, 901, 917, 933, and 949, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a ^CDR3 selected from the group consisting of SEQ ID NOs: 445, 461, 477, 493, 509, 525, 541, 557, 573, 589, 605, 621, 637, 653, 669, 685, 701, 717, 733, 749, 765, 781, 797, 813, 829, 845, 861, 877, 893, 909, 925, 941, and 957, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 437 / 445, 453 / 461, 469 / 477, 485 / 493, 501 / 509, 517 / 525, 533 / 541, 549 / 557, 565 / 573, 581 / 589, 71  597 / 605, 613 / 621, 629 / 637, 645 / 653, 661 / 669, 677 / 685, 693 / 701, 709 / 717, 725 / 733, 741 / 749, 757 / 765, 773 / 781, 789 / 797, 805 / 813, 821 / 829, 837 / 845, 853 / 861, 869 / 877, 885 / 893, 901 / 909, 917 / 925, 933 / 941, and 949 / 957, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0229] In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 433-435-437; 449-451-453; 465-467-469; 481-483-485; 497-499-501; 513-515-517; 529-531-533; 545-547-549; 561-563-565; 577-579-581; 593-595-597; 609-611-613; 625-627- 629; 641-643-645; 657-659-661; 673-675-677; 689-691-693; 705-707-709; 721-723-725; 737- 739-741; 753-755-757; 769-771-773; 785-787-789; 801-803-805; 817-819-821; 833-835-837; 849-851-853; 865-867-869; 881-883-885; 897-899-901; 913-915-917; 929-931-933; and 945- 947-949, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined; and / or a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 441-443-445; 457-459-461; 473-475-477; 489-491-493; 505-507-509; 521- 523-525; 537-539-541; 553-555-557; 569-571-573; 585-587-589; 601-603-605; 617-619-621; 633-635-637; 649-651-653; 665-667-669; 681-683-685; 697-699-701; 713-715-717; 729-731- 733; 745-747-749; 761-763-765; 777-779-781; 793-795-797; 809-811-813; 825-827-829; 841- 843-845; 857-859-861; 873-875-877; 889-891-893; 905-907-909; 921-923-925; 937-939-941; and 953-955-957, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined. In some embodiments, the TCR, or a variable domain thereof comprises an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 433-435-437-441-443-445; 449-451-453-457-459-461; 465-467- 469-473-475-477; 481-483-485-489-491-493; 497-499-501-505-507-509; 513-515-517-521- 523-525; 529-531-533-537-539-541; 545-547-549-553-555-557; 561-563-565-569-571-573; 577-579-581-585-587-589; 593-595-597-601-603-605; 609-611-613-617-619-621; 625-627- 629-633-635-637; 641-643-645-649-651-653; 657-659-661-665-667-669; 673-675-677-681- 683-685; 689-691-693-697-699-701; 705-707-709-713-715-717; 721-723-725-729-731-733; 737-739-741-745-747-749; 753-755-757-761-763-765; 769-771-773-777-779-781; 785-787- 72  789-793-795-797; 801-803-805-809-811-813; 817-819-821-825-827-829; 833-835-837-841- 843-845; 849-851-853-857-859-861; 865-867-869-873-875-877; 881-883-885-889-891-893; 897-899-901-905-907-909; 913-915-917-921-923-925; 929-931-933-937-939-941; and 945-947- 949-953-955-957, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0230] In some embodiments, the TCR, or a variable domain thereof comprises a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, and 951, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687, 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943, and 959, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the TCR, or a variable domain thereof comprises a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 439 / 447, 455 / 463, 471 / 479, 487 / 495, 503 / 511, 519 / 527, 535 / 543, 551 / 559, 567 / 575, 583 / 591, 599 / 607, 615 / 623, 631 / 639, 647 / 655, 663 / 671, 679 / 687, 695 / 703, 711 / 719, 727 / 735, 743 / 751, 759 / 767, 775 / 783, 791 / 799, 807 / 815, 823 / 831, 839 / 847, 855 / 863, 871 / 879, 887 / 895, 903 / 911, 919 / 927, 935 / 943, and 951 / 959, or substantially similar sequences thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each of the sequences or for the sequences combined.

[0231] Also provided herein are nucleic acid molecules encoding a TCR, variable domain thereof, or portion thereof, of the present disclosure. In some embodiments, a nucleic acid molecule of the present invention comprises a polynucleotide sequence of an ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), TCR V ^ domain and / or TCR V ^ domain selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 73  148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752, 754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782, 784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812, 814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842, 844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866, 868, 870, 872, 874, 876, 878, 880, 882, 884, 886, 888, 890, 892, 894, 896, 898, 900, 902, 904, 906, 908, 910, 912, 914, 916, 918, 920, 922, 924, 926, 928, 930, 932, 934, 936, 938, 940, 942, 944, 946, 948, 950, 952, 954, 956, 958, 960, 962, 964, 966, 968, 970, 972, 974, 976, 978, 980, 982, 984, 986, 988, 990, 992, 994, 996, 998, 1000, 1002, 1004, 1006, 1008, 1010, 1012, 1014, 1016, 1018, 1020, 1022, 1024, 1026, 1028, 1030, 1032, 1034, 1036, 1038, 1040, 1042, 1044, 1046, 1048, 1050, 1052, 1054, 1056, 1058, 1060, 1062, 1064, 1066, 1068, 1070, 1072, 1074, 1076, 1078, 1080, 1082, 1084, 1086, 1088, 1090, 1092, 1094, 1096, 1098, 1100, 1102, 1104, 1106, 1108, 1110, 1112, 1114, 1116, 1118, 1120, 1122, 1124, 1126, 1128, 1130, 1132, 1134, 1136, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto.

[0232] In various embodiments, a nucleic acid molecule of the present disclosure comprises a polynucleotide sequence encoding an ^CDR1 amino acid sequence as set forth in 74  Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding the ^CDR1 is selected from the group consisting of SEQ ID NOs: 2, 18, 34, 50, 66, 82, 98, 114, 130, 146, 162, 178, 194, 210, 226, 242, 258, 274, 290, 306, 322, 338, 354, 370, 386, 402, 418, 434, 450, 466, 482, 498, 514, 530, 546, 562, 578, 594, 610, 626, 642, 658, 674, 690, 706, 722, 738, 754, 770, 786, 802, 818, 834, 850, 866, 882, 898, 914, 930, 946, 962, 978, 994, 1010, 1026, 1042, 1058, 1074, 1090, 1106, and 1122, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0233] In various embodiments, a nucleic acid molecule of the present disclosure comprises a polynucleotide sequence encoding an ^CDR2 amino acid sequence as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding the ^CDR2 is selected from the group consisting of SEQ ID NOs: 4, 20, 36, 52, 68, 84, 100, 116, 132, 148, 164, 180, 196, 212, 228, 244, 260, 276, 292, 308, 324, 340, 356, 372, 388, 404, 420, 436, 452, 468, 484, 500, 516, 532, 548, 564, 580, 596, 612, 628, 644, 660, 676, 692, 708, 724, 740, 756, 772, 788, 804, 820, 836, 852, 868, 884, 900, 916, 932, 948, 964, 980, 996, 1012, 1028, 1044, 1060, 1076, 1092, 1108, and 1124, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0234] In various embodiments, a nucleic acid molecule of the present disclosure comprises a polynucleotide sequence encoding an ^CDR3 amino acid sequence as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding the ^CDR3 is selected from the group consisting of SEQ ID NOs: 6, 22, 38, 54, 70, 86, 102, 118, 134, 150, 166, 182, 198, 214, 230, 246, 262, 278, 294, 310, 326, 342, 358, 374, 390, 406, 422, 438, 454, 470, 486, 502, 518, 534, 550, 566, 582, 598, 614, 630, 646, 662, 678, 694, 710, 726, 742, 758, 774, 790, 806, 822, 838, 854, 870, 886, 902, 918, 934, 950, 966, 982, 998, 1014, 1030, 1046, 1062, 1078, 1094, 1110, and 1126, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0235] In various embodiments, a nucleic acid molecule of the present disclosure comprises a polynucleotide sequence encoding an ^CDR1 amino acid sequence as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 75  98% or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding the ^CDR1 is selected from the group consisting of SEQ ID NOs: 10, 26, 42, 58, 74, 90, 106, 122, 138, 154, 170, 186, 202, 218, 234, 250, 266, 282, 298, 314, 330, 346, 362, 378, 394, 410, 426, 442, 458, 474, 490, 506, 522, 538, 554, 570, 586, 602, 618, 634, 650, 666, 682, 698, 714, 730, 746, 762, 778, 794, 810, 826, 842, 858, 874, 890, 906, 922, 938, 954, 970, 986, 1002, 1018, 1034, 1050, 1066, 1082, 1098, 1114, and 1130, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0236] In various embodiments, a nucleic acid molecule of the present disclosure comprises a polynucleotide sequence encoding an ^CDR2 amino acid sequence as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding the ^CDR2 is selected from the group consisting of SEQ ID NOs: 12, 28, 44, 60, 76, 92, 108, 124, 140, 156, 172, 188, 204, 220, 236, 252, 268, 284, 300, 316, 332, 348, 364, 380, 396, 412, 428, 444, 460, 476, 492, 508, 524, 540, 556, 572, 588, 604, 620, 636, 652, 668, 684, 700, 716, 732, 748, 764, 780, 796, 812, 828, 844, 860, 876, 892, 908, 924, 940, 956, 972, 988, 1004, 1020, 1036, 1052, 1068, 1084, 1100, 1116, and 1132, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0237] In various embodiments, a nucleic acid molecule of the present disclosure comprises a polynucleotide sequence encoding an ^CDR3 amino acid sequence as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding the ^CDR3 is selected from the group consisting of SEQ ID NOs: 14, 30, 46, 62, 78, 94, 110, 126, 142, 158, 174, 190, 206, 222, 238, 254, 270, 286, 302, 318, 334, 350, 366, 382, 398, 414, 430, 446, 462, 478, 494, 510, 526, 542, 558, 574, 590, 606, 622, 638, 654, 670, 686, 702, 718, 734, 750, 766, 782, 798, 814, 830, 846, 862, 878, 894, 910, 926, 942, 958, 974, 990, 1006, 1022, 1038, 1054, 1070, 1086, 1102, 1118, and 1134, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0238] In various embodiments, a nucleic acid molecule of the present disclosure comprises a polynucleotide sequence encoding a TCR V ^ domain amino acid sequence as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the polynucleotide sequence 76  encoding the TCR V ^ domain is selected from the group consisting of SEQ ID NOs: 8, 24, 40, 56, 72, 88, 104, 120, 136, 152, 168, 184, 200, 216, 232, 248, 264, 280, 296, 312, 328, 344, 360, 376, 392, 408, 424, 440, 456, 472, 488, 504, 520, 536, 552, 568, 584, 600, 616, 632, 648, 664, 680, 696, 712, 728, 744, 760, 776, 792, 808, 824, 840, 856, 872, 888, 904, 920, 936, 952, 968, 984, 1000, 1016, 1032, 1048, 1064, 1080, 1096, 1112, and 1128, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0239] In various embodiments, a nucleic acid molecule of the present disclosure comprises a polynucleotide sequence encoding a TCR V ^ domain amino acid sequence as set forth in Table 9, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding the TCR V ^ domain is selected from the group consisting of SEQ ID NOs: 16, 32, 48, 64, 80, 96, 112, 128, 144, 160, 176, 192, 208, 224, 240, 256, 272, 288, 304, 320, 336, 352, 368, 384, 400, 416, 432, 448, 464, 480, 496, 512, 528, 544, 560, 576, 592, 608, 624, 640, 656, 672, 688, 704, 720, 736, 752, 768, 784, 800, 816, 832, 848, 864, 880, 896, 912, 928, 944, 960, 976, 992, 1008, 1024, 1040, 1056, 1072, 1088, 1104, 1120, and 1136, or a substantially similar sequence thereof having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0240] In certain embodiments, a TCR, or variable domain thereof, provided elsewhere herein may comprise an ^ ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), TCR V ^ domain, and / or TCR V ^ domain comprising a sequence that is substantially similar, but not identical, to the amino acid sequence of a corresponding ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), TCR V ^ domain, and / or TCR V ^ domain listed in Table 9 (or to the specific SEQ ID NO(s) otherwise specified) such that the subject ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), TCR V ^ domain, and / or TCR V ^ domain has at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto, but not 100% identity. For example, the ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), TCR V ^ domain, and / or TCR V ^ domain provided may comprise a substitution (e.g., a conservative substitution). Similarly, a nucleic acid molecule provided elsewhere herein 77  may comprise a polynucleotide sequence encoding an αCDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), TCR V ^ domain, and / or TCR V ^ domain comprising a sequence that is substantially similar, but not identical, to the amino acid sequence of a corresponding ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), TCR V ^ domain, and / or TCR V ^ domain listed in Table 9 (or to the specific SEQ ID NO(s) otherwise specified) such that the encoded ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), TCR V ^ domain, and / or TCR V ^ domain has at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto, but not 100% identity. Likewise, a nucleic acid molecule provided elsewhere herein may comprise a polynucleotide sequence encoding an αCDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), TCR V ^ domain, and / or TCR V ^ domain that is substantially similar, but not identical, to a polynucleotide sequence listed in Table 9 (or to the specific SEQ ID NO(s) otherwise specified) that encodes a corresponding ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), ^CDR (e.g., ^CDR1, ^CDR2, and / or ^CDR3), TCR V ^ domain, and / or TCR V ^ domain such that the subject polynucleotide sequence has at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto, but not 100% identity.

[0241] A nucleic acid molecule of the present invention may comprise any one of the polynucleotide sequences as disclosed herein or may comprise any combination of polynucleotide sequences as disclosed herein. In a preferred embodiment, a combination of polynucleotide sequences as disclosed herein are arranged within the nucleic acid molecule such that the nucleic acid molecule encodes a functional polypeptide product, e.g., a TCR, variable domain thereof, or antigen-binding portion thereof, capable of binding to an HLA presented peptide. For example, a nucleic acid molecule of the present invention encompasses any combination of CDRs and or V ^ ^V ^ domains as disclosed in Table 9 for a particular HLA- presented peptide, provided the encoded polypeptide product is capable of binding to the HLA- presented peptide.

[0242] In general, the TCRs of the present invention function by binding to an HLA presented HPV16-, MART1-, CMV-, EBV-, or influenza-peptide. As used herein, an HLA presented peptide (such as an HLA-A2 presented peptide) can refer to a peptide that is bound to 78  a human leukocyte antigen (HLA) protein, for example, an HLA protein expressed on the surface of a cell. Thus, a TCR that binds to an HLA presented peptide binds to the peptide that is bound by the HLA, and optionally also binds to the HLA itself. Interaction with the HLA can confer specificity for binding to a peptide presented by a particular HLA. In some embodiments, the TCR binds to an isolated HLA presented peptide. In some embodiments, the TCR binds to an HLA presented peptide on the surface of a cell. In some embodiments, the TCR specifically binds to an HLA presented peptide and is identified using a RAPTER method, as disclosed herein.

[0243] In general, the TCRs of the present invention can function by binding to an HLA - presented HPV16-, MART1-, CMV-, EBV-, or influenza- peptide. The present invention includes HPV16-, MART1-, CMV-, EBV-, or influenza-TCRs that bind a HPV16-, MART1-, CMV-, EBV-, or influenza- peptide, respectively, in the context of HLA with high specificity. In some embodiments, the HPV16-, MART1-, CMV-, EBV-, or influenza-TCRs do not bind to the HPV16-, MART1-, CMV-, EBV-, or influenza- peptide, respectively, in the absence of HLA, or such binding is minimal. Further, in some embodiments, the HPV16-, MART1-, CMV-, EBV-, or influenza- TCRs do not bind to an off-target peptide in the context of HLA, or such binding is minimal. As used herein, an off-target peptide can refer to a peptide that differs from a target peptide by 1, 2, 3, 4, 5, or more amino acids.

[0244] In some embodiments, binding specificity can be determined by a) measuring on- target binding (e.g., binding to the HLA presented HPV16-, MART1-, CMV-, EBV-, or influenza- peptide), b) measuring off-target binding, and c) quantifying the difference between the two, e.g., by calculating a ratio. This ratio can be calculated, for example, by dividing the values obtained in a) and b). Measurement of on-target and off-target binding can be achieved, for example, by measuring % binding to a peptide / HLA tetramer reagent (e.g., a HPV16-, MART1-, CMV-, EBV-, or influenza- / HLA tetramer reagent), or by other techniques known in the art. In some embodiments, an on-target binding / off-target binding value (e.g., a value obtained by dividing the values obtained in a) and b) described above) of a TCR of the present disclosure can be greater than 5, greater than 6, greater than 7, greater than 8, greater than 9, greater than 10, greater than 11, greater than 12, greater than 13, greater than 14, greater than 15, greater than 16, greater than 17, greater than 18, greater than 19, greater than 20, greater than 21, greater than 22, greater than 23, greater than 24, greater than 25, greater than 26, greater than 27, 79  greater than 28, greater than 29, greater than 30, greater than 35, greater than 40, greater than 45, greater than 50, greater than 55, greater than 60, greater than 65, greater than 70, greater than 75, greater than 80, greater than 85, greater than 90, greater than 95, greater than 100, greater than 110, greater than 120, greater than 130, greater than 140, greater than 150, greater than 160, greater than 170, greater than 180, greater than 190, greater than 200, greater than 225, greater than 250, greater than 275, greater than 300, greater than 325, greater than 350, greater than 375, greater than 400, greater than 425, greater than 450, greater than 475, greater than 500, greater than 550, greater than 600, greater than 650, greater than 700, greater than 750, greater than 800, greater than 850, greater than 900, greater than 950, greater than 1000, greater than 1100, greater than 1200, greater than 1300, greater than 1400, greater than 1500, greater than 1600, greater than 1700, greater than 1800, greater than 1900, or greater than 2000. In some embodiments, an on-target binding / off-target binding value (e.g., a value obtained by dividing the values obtained in a) and b) described above) can be about 5 to about 20, about 10 to about 30, about 20 to about 80, about 30 to about 70, about 40 to about 60, about 50 to about 250, about 100 to about 200, about 100 to about 1000, about 300 to about 700, about 500 to about 1500, about 800 to about 1200, about 900 to about 1100, about 800 to about 1500, about 1000 to about 1400, or about 1100 to about 1300.

[0245] In some embodiments, described herein are recombinant antigen-binding proteins (e.g., an isolated antigen-binding protein) that binds specifically to a conformational epitope of an HLA presented human HPV16-, MART1-, CMV-, EBV-, or influenza-peptide, wherein the antigen-binding protein has a property selected from the group consisting of: (a) binds monomeric HLA: HPV16-, MART1-, CMV-, EBV-, or influenza-peptide with a binding dissociation equilibrium constant (K ) of less than about 20nM as measured in a surface plasmon resonance assay at 25°C; (b) binds monomeric HLA: HPV16-, MART1-, CMV-, EBV-, or influenza- peptide with a binding dissociation equilibrium constant (K ) of less than about 25nM as measured in a surface plasmon resonance assay at 25°C; (c) binds to HLA: HPV16-, MART1- , CMV-, EBV-, or influenza- peptide-expressing cells with an EC50 less than about 6 nM and does not bind to cells expressing predicted off-target peptides as determined by luminescence assay; (d) binds to HLA: HPV16-, MART1-, CMV-, EBV-, or influenza- peptide-expressing cells with an EC50 less than about 1 nM and does not substantially bind to cells expressing predicted off-target peptides as determined by luminescence assay; (e) binds to HLA: HPV16-, 80  MART1-, CMV-, EBV-, or influenza-peptide expressing cells or HPV16-, MART1-, CMV-, EBV-, or influenza-peptide-expressing cells with an EC50 less than about 30 nM as determined by flow cytometry assay; and (f) binds to HLA: HPV16-, MART1-, CMV-, EBV-, or influenza- peptide-expressing cells with an EC50 less than about 75nM as determined by flow cytometry assay.

[0246] In some embodiments, the HPV16-, MART1-, CMV-, EBV-, or influenza-TCRs of the present disclosure have specific activity or affinity for HPV16-, MART1-, CMV-, EBV-, or influenza- peptide as measured by an in vitro assay. For example, cells (such as T2 cells) expressing an HLA can be pulsed with a HPV16-, MART1-, CMV-, EBV-, or influenza-peptide, or an off-target polypeptide thereby inducing the cells to present the polypeptide bound to the HLA. Alternatively, or in addition to using an off-target polypeptide as a control, an off-target HLA (an HLA other than the HLA that is recognized by the TCR of interest) can be used. For example, an off-target HLA can be used to present the HPV16-, MART1-, CMV-, EBV-, or influenza-peptide to test for specificity of binding to an HLA-A (e.g., HLA-A2) -presented HPV16-, MART1-, CMV-, EBV-, or influenza-peptide. In addition, a control can be a cell line that expresses neither HPV16-, MART1-, CMV-, EBV-, or influenza- nor the target HLA (e.g. , HLA-A2). Cells can be co-cultured with a T-cell population expressing the TCR of interest, and activity measured as a function of the amount of a cytokine (such as interferon gamma) produced by the cells. In certain embodiments, the assay can comprise in vitro co-cultures of a TCR- expressing T cell population with 10 M peptide-loaded T2 cells at an effector cell: target cell ratio of 1: 1 (1 x 10 effector cells / 96 well), and interferon gamma measurement 24 hours after co-culture (e.g., by a Meso Scale Discovery (MSD®) Sector Imager). In certain embodiments, the assay can comprise in vitro co-cultures of a TCR-expressing T cell population and effector cell at an effector cell:target cell ratio of 5: 1 (2.5 x 10 effector cells:5 x 10 target cells), and interferon gamma measurement 24 hours after co-culture (e.g., by a Meso Scale Discovery (MSD®) Sector Imager).

[0247] Increasing amounts of cytokine detected can serve as an indicator of activity. The activity or specificity of a TCR of interest to its target peptide in comparison to a control (off- target) polypeptide, or the activity or specificity of a TCR of interest to its on-target HLA-bound target peptide in comparison to an off-target HLA-bound target peptide can be 2-fold or greater, 3-fold or greater, 4-fold or greater, 5 -fold or greater, 6-fold or greater, 7-fold or greater, 8-fold 81  or greater, 9-fold or greater, 10-fold or greater, 15 -fold or greater, 20-fold or greater, 30-fold or greater, 40-fold or greater, 50-fold or greater, 100-fold or greater, 200-fold or greater, 300-fold or greater, 400-fold or greater, 500-fold or greater, 600-fold or greater, 700-fold or greater, 800- fold or greater, 900-fold or greater, 1 ,000-fold or greater, 1, 500-fold or greater, 2,000-fold or greater, 2,500-fold or greater, 3,000-fold or greater, 4,000-fold or greater, 5,000-fold or greater, 10,000-fold or greater, 20,000-fold or greater, 30,000-fold or greater, 40,000-fold or greater, 50,000-fold or greater, 60,000-fold or greater, 70,000-fold or greater, 80,000-fold or greater, 90,000-fold or greater, or 100,000-fold or greater.

[0248] In certain embodiments, the HPV16-, MART1-, CMV-, EBV-, or influenza-TCRs of the present disclosure are useful in inhibiting the growth of a tumor or delaying the progression of cancer when administered prophylactically to a subject in need thereof and may increase survival of the subject. For example, the administration of a HPV16-, MART1-, CMV-, EBV-, or influenza-TCR of the present invention may lead to shrinking of a primary tumor and may prevent metastasis or development of secondary tumors. In certain embodiments, the HPV16-, MART1-, CMV-, EBV-, or influenza-TCRs of the present invention are useful in inhibiting the growth of a tumor when administered therapeutically to a subject in need thereof and may increase survival of the subject. For example, the administration of a therapeutically effective amount of a HPV16-, MART1-, CMV-, EBV-, or influenza-TCR of the invention to a subject may lead to shrinking and disappearance of an established tumor in the subject.

[0249] In some embodiments, the invention provides a TCR (e.g., an isolated TCR or a TCR expressed on an isolated cell) identified through RAPTER. In some embodiments, the TCR specifically binds to an HLA presented HPV16-, MART1-, CMV-, EBV-, or influenza-peptide.

[0250] The TCRs of the present invention may possess one or more of the aforementioned biological characteristics, or any combinations thereof. Other biological characteristics of the antigen binding proteins of the present invention will be evident to a person of ordinary skill in the art from a review of the present disclosure including the working Examples herein.

[0251] In certain embodiments, a nucleic acid molecule encoding a HPV16-, MART1-, CMV-, EBV-, or influenza-TCR as described herein is inserted into a vector. The term "vector" as used herein refers to a vehicle into which a polynucleotide encoding a protein may be covalently inserted so as to bring about the expression of that protein and / or the cloning of the 82  polynucleotide. Such vectors may also be referred to as "expression vectors". The isolated polynucleotide may be inserted into a vector using any suitable methods known in the art, for example, without limitation, the vector may be digested using appropriate restriction enzymes and then may be ligated with the isolated polynucleotide having matching restriction ends. Expression vectors have the ability to incorporate and express heterologous or modified nucleic acid sequences coding for at least part of a gene product capable of being transcribed in a cell. In most cases, RNA molecules are then translated into a protein. Expression vectors can contain a variety of control sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operatively linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are discussed infra. An expression vector may comprise additional elements, for example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example in human cells for expression and in a prokaryotic host for cloning and amplification.

[0252] The expression vector may have the necessary 5' upstream and 3' downstream regulatory elements such as promoter sequences such as CMV, PGK and EF1α promoters, ribosome recognition and binding TATA box, and 3' UTR AAUAAA transcription termination sequence for the efficient gene transcription and translation in its respective host cell. Other suitable promoters include the constitutive promoter of simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), HIV LTR promoter, MoMuLV promoter, avian leukemia virus promoter, EBV immediate early promoter, and rous sarcoma virus promoter. Human gene promoters may also be used, including, but not limited to the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter. In certain embodiments inducible promoters are also contemplated as part of the vectors expressing chimeric antigen receptor. This provides a molecular switch capable of turning on expression of the polynucleotide sequence of interest or turning off expression. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, or a tetracycline promoter.

[0253] The expression vector may have additional sequence such as 6x-histidine, c-Myc, and FLAG tags which are incorporated into the expressed TCRs. Thus, the expression vector 83  may be engineered to contain 5' and 3' untranslated regulatory sequences that sometimes can function as enhancer sequences, promoter regions and / or terminator sequences that can facilitate or enhance efficient transcription of the nucleic acid(s) of interest carried on the expression vector. An expression vector may also be engineered for replication and / or expression functionality (e.g., transcription and translation) in a particular cell type, cell location, or tissue type. Expression vectors may include a selectable marker for maintenance of the vector in the host or recipient cell.

[0254] Examples of vectors are plasmid, autonomously replicating sequences, and transposable elements. Additional exemplary vectors include, without limitation, plasmids, phagemids, cosmids, artificial chromosomes such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), or PI -derived artificial chromosome (PAC), bacteriophages such as lambda phage or M13 phage, and animal viruses. Examples of categories of animal viruses useful as vectors include, without limitation, retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpesvirus (e.g., herpes simplex virus), poxvirus, baculovirus, papillomavirus, and papovavirus (e.g., SV40). Examples of expression vectors are Lenti-X™ Bicistronic Expression System (Neo) vectors (Clontrch), pClneo vectors (Promega) for expression in mammalian cells; pLenti4 / V5-DEST™, pLenti6 / V5-DEST™, and pLenti6.2N5-GW / lacZ (Invitrogen) for lentivirus-mediated gene transfer and expression in mammalian cells. The coding sequences of the TCRs disclosed herein can be ligated into such expression vectors for the expression of the chimeric protein in mammalian cells.

[0255] In certain embodiments, the nucleic acid molecules encoding the TCR of the present invention are provided in a viral vector. A viral vector can be those derived from retrovirus, lentivirus, or foamy virus. As used herein, the term, "viral vector," refers to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle. The viral vector can contain the coding sequence for the various proteins described herein in place of nonessential viral genes. The vector and / or particle can be utilized for the purpose of transferring DNA, RNA or other nucleic acids into cells either in vitro or in vivo. Numerous forms of viral vectors are known in the art.

[0256] In certain embodiments, the viral vector containing the coding sequence for a TCR described herein is a retroviral vector or a lentiviral vector. The term "retroviral vector" refers to a vector containing structural and functional genetic elements that are primarily derived 84  from a retrovirus. The term "lentiviral vector" refers to a vector containing structural and functional genetic elements outside the LTRs that are primarily derived from a lentivirus.

[0257] The retroviral vectors for use herein can be derived from any known retrovirus (e.g., type c retroviruses, such as Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend, Murine Stem Cell Virus (MSCV) and Rous Sarcoma Virus (RSV)). Retroviruses of the invention also include human T cell leukemia viruses, HTLV-1 and HTLV-2, and the lentiviral family of retroviruses, such as Human Immunodeficiency Viruses, HIV-1, HIV -2, simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine immnodeficiency virus (EIV), and other classes of retroviruses.

[0258] A lentiviral vector for use herein refers to a vector derived from a lentivirus, a group (or genus) of retroviruses that give rise to slowly developing disease. Viruses included within this group include HIV (human immunodeficiency virus; including HIV type 1, and HIV type 2); visna-maedi; a caprine arthritis-encephalitis virus; equine infectious anemia virus; feline immunodeficiency virus (FIV); bovine immune deficiency virus (BIV); and simian immunodeficiency virus (SIV).

[0259] Preparation of the recombinant lentivirus can be achieved using the methods according to Dull et al. and Zufferey et al. (Dull et al, J. Virol., 1998; 72: 8463-8471 and Zufferey et al, J. Virol.1998; 72:9873-9880).

[0260] Retroviral vectors (i.e., both lentiviral and non-lentiviral) for use in the present invention can be formed using standard cloning techniques by combining the desired DNA sequences in the order and orientation described herein ( Current Protocols in Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals; Eglitis, et al. (1985) Science 230: 1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141- 6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury etal. (1991) Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89: 10892-10895; Hwu 85  etal. (1993) J. Immunol 150:4104-4115; U.S. Pat. No.4,868,116; U.S. Pat. No.4,980,286; PCT Application WO 89 / 07136; PCT Application WO 89 / 02468; PCT Application WO 89 / 05345; and PCT Application WO 92 / 07573).

[0261] Suitable sources for obtaining retroviral (i.e., both lentiviral and non-lentiviral) sequences for use in forming the vectors include, for example, genomic RNA and cDNAs available from commercially available sources, including the Type Culture Collection (ATCC), Rockville, Md. The sequences also can be synthesized chemically.

[0262] For expression of a HPV16-, MART1-, CMV-, EBV-, or influenza- TCR, the vector may be introduced into a host cell to allow expression of the polypeptide within the host cell. The expression vectors may contain a variety of elements for controlling expression, including without limitation, promoter sequences, transcription initiation sequences, enhancer sequences, selectable markers, and signal sequences. These elements may be selected as appropriate by a person of ordinary skill in the art, as described above. For example, the promoter sequences may be selected to promote the transcription of the polynucleotide in the vector. Suitable promoter sequences include, without limitation, T7 promoter, T3 promoter, SP6 promoter, beta-actin promoter, EFla promoter, CMV promoter, and SV40 promoter. Enhancer sequences may be selected to enhance the transcription of the polynucleotide. Selectable markers may be selected to allow selection of the host cells inserted with the vector from those not, for example, the selectable markers may be genes that confer antibiotic resistance. Signal sequences may be selected to allow the expressed polypeptide to be transported outside of the host cell.

[0263] For cloning of the nucleic acid molecule, the vector may be introduced into a host cell (an isolated host cell) to allow replication of the vector itself and thereby amplify the copies of the polynucleotide contained therein. The cloning vectors may contain sequence components generally include, without limitation, an origin of replication, promoter sequences, transcription initiation sequences, enhancer sequences, and selectable markers. These elements may be selected as appropriate by a person of ordinary skill in the art. For example, the origin of replication may be selected to promote autonomous replication of the vector in the host cell.

[0264] In certain embodiments, the present disclosure provides isolated host cells containing the vectors provided herein. The host cells containing the vector may be useful in expression or cloning of the polynucleotide contained in the vector. Suitable host cells can include, without limitation, prokaryotic cells, fungal cells, yeast cells, or higher eukaryotic cells 86  such as mammalian cells. Suitable prokaryotic cells for this purpose include, without limitation, eubacteria, such as Gram negative or Gram -positive organisms, for example, Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as well as Bacilli such as B. subtilis and B. licheniformis, Pseudomonas such as P. aeruginosa, and Streptomyces.

[0265] The HPV16-, MART1-, CMV-, EBV-, or influenza-TCRs of the present invention are introduced into a host cell using transfection and / or transduction techniques known in the art. As used herein, the terms, "transfection," and "transduction," refer to the processes by which an exogenous nucleic acid sequence is introduced into a host cell. The nucleic acid may be integrated into the host cell DNA or may be maintained extrachromosomally. The nucleic acid may be maintained transiently, or a may be a stable introduction. Transfection may be accomplished by a variety of means known in the art including but not limited to calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, and biolistics. Transduction refers to the delivery of a gene(s) using a viral or retroviral vector by means of viral infection rather than by transfection. In certain embodiments, retroviral vectors are transduced by packaging the vectors into virions prior to contact with a cell. For example, a nucleic acid encoding a HPV16-, MART1-, CMV-, EBV-, or influenza-TCR of the invention carried by a retroviral vector can be transduced into a cell through infection and pro virus integration.

[0266] As used herein, the term "genetically engineered" or "genetically modified" refers to the addition of extra genetic material in the form of DNA or RNA into the total genetic material in a cell. The terms, "genetically modified cells," "modified cells," and "redirected cells," are used interchangeably.

[0267] In particular, the TCRs of the present invention are introduced and expressed in immune effector cells so as to redirect their specificity to a target antigen of interest, e.g., an HLA- displayed HPV16-, MART1-, CMV-, EBV-, or influenza- peptide.

[0268] Described herein are methods for making the immune effector cells which express the TCRs as described herein. In some embodiments, the method comprises transfecting or transducing immune effector cells, e.g., immune effector cells isolated from a subject, such as a subject having a HPV16-, MART1-, CMV-, EBV-, or influenza- associated disease or disorder, 87  such that the immune effector cells express one or more TCR as described herein. In certain embodiments, the immune effector cells are isolated from an individual and genetically modified without further manipulation in vitro. Such cells can then be directly re-administered into the individual. In further embodiments, the immune effector cells are first activated and stimulated to proliferate in vitro prior to being genetically modified to express a TCR. In this regard, the immune effector cells may be cultured before or after being genetically modified (i.e., transduced or transfected to express a TCR as described herein).

[0269] Prior to in vitro manipulation or genetic modification of the immune effector cells described herein, the source of cells may be obtained from a subject. In particular, the immune effector cells for use with the TCRs as described herein comprise T cells.

[0270] T cells can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph nodes tissue, cord blood, thymus issue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments, T cell can be obtained from a unit of blood collected from the subject using any number of techniques known to the skilled person, such as FICOLL separation. In some embodiments, cells from the circulating blood of an individual are obtained by apheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocyte, B cells, other nucleated white blood cells, red blood cells, and platelets. In some embodiments, the cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing. In some embodiments of the invention, the cells are washed with PBS. In alternative embodiments, the washed solution lacks calcium and may lack magnesium or may lack many if not all divalent cations. As would be appreciated by those of ordinary skill in the art, a washing step may be accomplished by methods known to those in the art, such as by using a semiautomated flow-through centrifuge. After washing, the cells may be resuspended in a variety of biocompatible buffers or other saline solution with or without buffer. In certain embodiments, the undesirable components of the apheresis sample may be removed in the cell directly resuspended culture media.

[0271] In certain embodiments, T cells are isolated from peripheral blood mononuclear cells (PBMCs) by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLL™ gradient. A specific subpopulation of T cells, such as CD28+, CD4+, CD8+, CD45RA+, and CD45RO+ T cells, can be further isolated by positive or 88  negative selection techniques. For example, enrichment of a T cell population by negative selection can be accomplished with a combination of antibodies directed to surface markers unique to the negatively selected cells. One method for use herein is cell sorting and / or selection via negative magnetic immunoadherence or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface markers present on the cells negatively selected. For example, to enrich for CD4+ cells by negative selection, a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CD1lb, CD16, HLA-DR, and CD8. Flow cytometry and cell sorting may also be used to isolate cell populations of interest for use in the present invention.

[0272] PBMC may be used directly for genetic modification with the TCRs using methods as described herein. In certain embodiments, after isolation of PBMC, T lymphocytes are further isolated and in certain embodiments, both cytotoxic and helper T lymphocytes can be sorted into naive, memory, and effector T cell subpopulations either before or after genetic modification and / or expansion.

[0273] The immune effector cells, such as T cells, can be genetically modified following isolation using known methods, or the immune effector cells can be activated and expanded (or differentiated in the case of progenitors) in vitro prior to being genetically modified. In some embodiments, the immune effector cells, such as T cells, are genetically modified with the chimeric antigen receptors described herein (e.g., transduced with a viral vector comprising a nucleic acid encoding a TCR) and then are activated and expanded in vitro. Methods for activating and expanding T cells are known in the art and are described, for example, in U.S. Pat. No.6,905,874; U.S. Pat. No.6,867,041; U.S. Pat. No.6,797,514; W02012079000, US 2016 / 0175358.

[0274] The invention provides a population of modified immune effector cells for the treatment of a HPV16-, MART1-, CMV-, EBV-, or influenza-associated disease or disorder, e.g., cancer, the modified immune effector cells comprising a HPV16-, MART1-, CMV-, EBV-, or influenza- TCR as disclosed herein.

[0275] HPV16-, MART1-, CMV-, EBV-, or influenza-TCR-expressing immune effector cells prepared as described herein can be utilized in methods and compositions for adoptive immunotherapy in accordance with known techniques, or variations thereof that will be apparent to those skilled in the art based on the instant disclosure. See, e.g., US Patent Application 89  Publication No.2003 / 0170238 to Gruenberg et al; see also U.S. Pat. No.4,690,915 to Rosenberg. II. Pharmaceutical Compositions

[0276] The invention provides therapeutic compositions comprising the HPV16-, MART1-, CMV-, EBV-, or influenza- TCRs of the invention or immune effector cells comprising the HPV16-, MART1-, CMV-, EBV-, or influenza-TCRs of the invention. Therapeutic compositions in accordance with the invention will be administered with suitable carriers, excipients, and other agents that are incorporated into formulations to provide improved transfer, delivery, tolerance, and the like. A multitude of appropriate formulations can be found in the formulary known to all pharmaceutical chemists: Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA. These formulations include, for example, powders, pastes, ointments, jellies, waxes, oils, lipids, lipid (cationic or anionic) containing vesicles (such as LIPOFECTIN™), DNA conjugates, anhydrous absorption pastes, oil-in-water and water-in- oil emulsions, emulsions carbowax (polyethylene glycols of various molecular weights), semi- solid gels, and semi-solid mixtures containing carbowax. See also Powell etal. "Compendium of excipients for parenteral formulations" PDA (1998) JPharm Sci Technol 52:238-311.

[0277] Depending on the severity of the condition, the frequency and the duration of the treatment can be adjusted. In certain embodiments, the initial dose may be followed by administration of a second or a plurality of subsequent doses of HPV16-, MART1-, CMV-, EBV-, or influenza- TCRs of the invention or immune effector cells comprising the HPV16-, MART1-, CMV-, EBV-, or influenza-TCRs of the invention in an amount that can be approximately the same or less than that of the initial dose.

[0278] In certain situations, the pharmaceutical composition can be delivered in a controlled release system. In some embodiments, a pump may be used.

[0279] Injectable preparations may include dosage forms for intravenous, subcutaneous, intracutaneous, intracranial, intraperitoneal and intramuscular injections, drip infusions, etc. The TCRs, pharmaceutical compositions, and cells described herein can be administered via parenteral administration. The preparations of the present disclosure may be prepared by methods publicly known. For example, the preparations may be prepared, e.g., by dissolving, suspending or emulsifying the antigen-binding protein or its salt described above in a sterile 90  aqueous medium or an oily medium conventionally used for injections. As the aqueous medium for injections, there are, for example, physiological saline, an isotonic solution containing glucose and other auxiliary agents, etc., which may be used in combination with an appropriate solubilizing agent such as an alcohol (e.g., ethanol), a polyalcohol (e.g., propylene glycol, polyethylene glycol), a nonionic surfactant [e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)], etc. As the oily medium, there are employed, e.g., sesame oil, soybean oil, etc., which may be used in combination with a solubilizing agent such as benzyl benzoate, benzyl alcohol, etc. The injection thus prepared is preferably filled in an appropriate ampoule.

[0280] In some embodiments, TCR-expressing immune effector cells are formulated by first harvesting them from their culture medium, and then washing and concentrating the cells in a medium and container system suitable for administration (a "pharmaceutically acceptable" carrier) in a treatment-effective amount. Suitable infusion medium can be any isotonic medium formulation, typically normal saline, Normosol R (Abbott) or Plasma-Lyte A (Baxter), but also 5% dextrose in water or Ringer's lactate can be utilized. The infusion medium can be supplemented with human serum albumin.

[0281] A treatment-effective number of cells in the composition is typically greater than 102cells, and up to 106up to and including 108or 109cells and can be more than 1010cells. The number of cells will depend upon the ultimate use for which the composition is intended as will the type of cells included therein.

[0282] The cells may be autologous or heterologous to the patient undergoing therapy. If desired, the treatment may also include administration of mitogens (e.g., PHA) or lymphokines, cytokines, and / or chemokines (e.g., IFN-γ, IL-2, IL-12, TNF-α, IL-18, and TNF-β, GM-CSF, IL- 4, IL-13, Flt3-L, RANTES, MIPlα, etc.) as described herein to enhance induction of the immune response.

[0283] The TCR expressing immune effector cell populations of the present invention may be administered either alone, or as a pharmaceutical composition in combination with diluents and / or with other components such as IL-2 or other cytokines or cell populations. Briefly, pharmaceutical compositions of the present invention may comprise a TCR-expressing immune effector cell population, such as T cells, as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such 91  compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. Compositions of the present invention are preferably formulated for intravenous administration. III. Therapeutic Uses of HPV16-, MART1-, CMV-, EBV-, or influenza- TCRs or Immune Effector Cells Comprising HPV16-, MART1-, CMV-, EBV-, or influenza- TCRs

[0284] An anti- HPV16-, MART1-, CMV-, EBV-, or influenza- immune response induced in a subject by administering TCR-expressing T cells described herein using the methods described herein, or other methods known in the art, may include cellular immune responses mediated by cytotoxic T cells capable of killing infected cells, regulatory T cells, and helper T cell responses. Humoral immune responses, mediated primarily by helper T cells capable of activating B cells thus leading to antibody production, may also be induced. A variety of techniques may be used for analyzing the type of immune responses induced by the compositions of the present invention, which are well described in the art; e.g., Current Protocols in Immunology, Edited by: John E. Coligan, Ada M. Kruisbeek, David H. Margulies, Ethan M. Shevach, Warren Strober (2001) John Wiley & Sons, NY, N.Y.

[0285] Thus, the HPV16-, MART1-, CMV-, EBV-, or influenza-TCRs of the invention are useful, inter alia, for the treatment, prevention and / or amelioration of any disease or disorder associated with or mediated by HPV16, MART1, CMV, EBV, or influenza. For example, the present invention provides methods for treating a HPV16-, MART1-, CMV-, EBV-, or influenza-associated disease or disorder, by administering a HPV16-, MART1-, CMV-, EBV-, or influenza- TCR (or pharmaceutical composition comprising a HPV16-, MART1-, CMV-, EBV-, or influenza- TCR or a plurality of cells comprising a HPV16-, MART1-, CMV-, EBV-, or influenza-TCR) as described herein to a patient in need of such treatment, and HPV16-, MART1-, CMV-, EBV-, or influenza- TCRs (or pharmaceutical composition comprising a HPV16-, MART1-, CMV-, EBV-, or influenza- TCR) for use in the treatment of a HPV16-, MART1-, CMV-, EBV-, or influenza-associated disease. The antigen-binding proteins of the present invention are useful for the treatment, prevention, and / or amelioration of disease or disorder or condition such as a HPV16-, MART1-, CMV-, EBV-, or influenza- associated 92  disorder and / or for ameliorating at least one symptom associated with such disease, disorder or condition. In the context of the methods of treatment described herein, the HPV16-, MART1-, CMV-, EBV-, or influenza- TCR (or pharmaceutical composition or plurality of cells) may be administered as a monotherapy (i.e., as the only therapeutic agent) or in combination with one or more additional therapeutic agents (examples of which are described elsewhere herein).

[0286] In some embodiments, an HPV16-associated disease or disorder comprises a disease or disorder selected from the group consisting of: HPV infection and HPV-related cancer. In some embodiments, the HPV-related cancer is selected from the group consisting of: cervical cancer, oropharyngeal cancer, anal cancer, penile cancer, vaginal cancer, and vulvar cancer.

[0287] In some embodiments, the MART1-associated disease or disorder comprises melanoma.

[0288] In some embodiments, the CMV-associated disease or disorder comprises a disease or disorder selected from the group consisting of: CMV infection, CMV-related mononucleosis and CMV-related hepatitis.

[0289] In some embodiments, the EBV-associated disease or disorder comprises a disease or disorder selected from the group consisting of: infectious mononucleosis syndrome and EBV-related cancer. In some embodiments, the EBV-related cancer is selected from the group consisting of: nasopharyngeal carcinoma, Burkitt's lymphoma, and Hodgkin’s lymphoma.

[0290] In some embodiments, the influenza-associated disease or disorder comprises influenza infection.

[0291] Accordingly, the present invention provides for methods of treating an individual diagnosed with or suspected of having, or at risk of developing, a HPV16-, MART1-, CMV-, EBV-, or influenza-associated disease or disorder comprising administering the individual a therapeutically effective amount of the TCR-expressing immune effector cells as described herein.

[0292] The methods for administering the cell compositions described herein includes any method which is effective to result in reintroduction of ex vivo genetically modified immune effector cells that either directly express a TCR of the invention in the subject or on reintroduction of the genetically modified progenitors of immune effector cells that on introduction into a subject differentiate into mature immune effector cells that express the TCR. 93  One method comprises transducing peripheral blood T cells ex vivo with a nucleic acid construct in accordance with the invention and returning the transduced cells into the subject.

[0293] One or more TCRs of the present invention may be administered to relieve or prevent or decrease the severity of one or more of the symptoms or conditions of the disease or disorder.

[0294] It is also contemplated herein to use one or more TCRs of the present invention prophylactically to patients at risk for developing a disease or disorder such as HPV16-, MART1-, CMV-, EBV-, or influenza-associated disease or disorder.

[0295] In further embodiments of the invention, the present TCRs are used for the preparation of a pharmaceutical composition for treating patients suffering from HPV16-, MART1-, CMV-, EBV-, or influenza-associated disease or disorder. In some embodiments of the invention, the present TCRs are used as adjunct therapy with any other agent, or any other therapy known to those skilled in the art useful for treating a HPV16-, MART1-, CMV-, EBV-, or influenza-associated disorder.

[0296] Combination therapies may include a HPV16-, MART1-, CMV-, EBV-, or influenza-TCR of the invention, such as immune effector cell comprising a TCR of the invention, or a pharmaceutical composition of the invention, and any additional therapeutic agent that may be advantageously combined with a TCR of the invention.

[0297] It is contemplated herein to use the TCRs of the invention in combination with immunostimulatory and / or immunosupportive therapies to inhibit tumor growth, and / or enhance survival of cancer patients. The immunostimulatory therapies include direct immunostimulatory therapies to augment immune cell activity by either “releasing the brake” on suppressed immune cells or “stepping on the gas” to activate an immune response. Examples include targeting other checkpoint receptors, vaccination and adjuvants. The immunosupportive modalities may increase antigenicity of the tumor by promoting immunogenic cell death, inflammation or have other indirect effects that promote an anti-tumor immune response. Examples include radiation, chemotherapy, anti-angiogenic agents, and surgery.

[0298] In various embodiments, one or more TCRs of the present invention may be used in combination with a PD-1 inhibitor (e.g., an anti-PD-1 antibody such as nivolumab, pembrolizumab, pidilizumab, BGB-A317 or REGN2810), a PD-L1 inhibitor (e.g., an anti-PD-Ll antibody such as avelumab, atezolizumab, durvalumab, MDX-1105, or REGN3504), a CTLA-4 94  inhibitor (e.g., ipilimumab), a TIM3 inhibitor, a BTLA inhibitor, a TIGIT inhibitor, a CD47 inhibitor, a GITR inhibitor, an antagonist of another T cell co-inhibitor or ligand (e.g., an antibody to CD-28, 2B4, LY108, LAIR1, ICOS, CD160 or VISTA), an indoleamine-2, 3- dioxygenase (IDO) inhibitor, a vascular endothelial growth factor (VEGF) antagonist [e.g., a “VEGF-Trap” such as aflibercept or other VEGF-inhibiting fusion protein as set forth in US 7,087,411, or an anti -VEGF antibody or antigen-binding fragment thereof (e.g., bevacizumab, or ranibizumab) or a small molecule kinase inhibitor of VEGF receptor (e.g., sunitinib, sorafenib, or pazopanib)], an Ang2 inhibitor (e.g., nesvacumab), a transforming growth factor beta (TGFβ) inhibitor, an epidermal growth factor receptor (EGFR) inhibitor (e.g., erlotinib, cetuximab), an NY-ESO-1 inhibitor (e.g., an anti-NY -ESO-1 antibody), a CD20 inhibitor (e.g., an anti-CD20 antibody such as rituximab), an antibody to a tumor-specific antigen [e.g., CA9, CA125, melanoma-associated antigen 3 (MAGE3), carcinoembryonic antigen (CEA), vimentin, tumor- M2-PK, prostate-specific antigen (PSA), mucin- 1, MART-1, and CA19-9], a vaccine (e.g., Bacillus Calmette-Guerin, a cancer vaccine), an adjuvant to increase antigen presentation (e.g., granulocyte-macrophage colony-stimulating factor), a costimulatory agent, a bispecific antibody (e.g., CD3xCD20 bispecific antibody, a PSMAxCD3 bispecific antibody, or a bispecific antibody that acts as a costimulatory agent, such as a bispecific antibody that binds a tumor antigen and has costimulatory activity), a cytotoxin, a chemotherapeutic agent (e.g., dacarbazine, temozolomide, cyclophosphamide, docetaxel, doxorubicin, daunorubicin, cisplatin, carboplatin, gemcitabine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, and vincristine), cyclophosphamide, radiotherapy, surgery, an IL-6R inhibitor (e.g., sarilumab), an IL-4R inhibitor (e.g., dupilumab), an IL-10 inhibitor, a cytokine such as IL-2, IL-7, IL-21, and IL-15, an antibody-drug conjugate (ADC) (e.g., anti-CD19-DM4 ADC, and anti-DS6-DM4 ADC), an anti-inflammatory drug (e.g., corticosteroids, and non-steroidal anti-inflammatory drugs), a dietary supplement such as anti-oxidants or any other therapy care to treat cancer. In certain embodiments, the TCRs of the present invention may be used in combination with cancer vaccines including dendritic cell vaccines, oncolytic viruses, tumor cell vaccines, etc. to augment the anti-tumor response.

[0299] For purposes of the present disclosure, such administration regimens are considered the administration of a HPV16-, MART1-, CMV-, EBV-, or influenza- TCR “in combination with” a second therapeutically active component. 95

[0300] The additional therapeutically active component(s) may be administered to a subject prior to administration of a HPV16-, MART1-, CMV-, EBV-, or influenza-TCR of the present invention. In other embodiments, the additional therapeutically active component(s) may be administered to a subject after administration of a HPV16-, MART1-, CMV-, EBV-, or influenza-TCR of the present invention. In yet other embodiments, the additional therapeutically active component(s) may be administered to a subject concurrent with administration of a HPV16-, MART1-, CMV-, EBV-, or influenza-TCR of the present invention. "Concurrent" administration, for purposes of the present invention, includes, e.g., administration of a HPV16-, MART1-, CMV-, EBV-, or influenza-TCR and an additional therapeutically active component to a subject in a single dosage form (e.g., co-formulated), or in separate dosage forms administered to the subject within about 30 minutes or less of each other. If administered in separate dosage forms, each dosage form may be administered via the same route; alternatively, each dosage form may be administered via a different route. In any event, administering the components in a single dosage from, in separate dosage forms by the same route, or in separate dosage forms by different routes are all considered "concurrent administration," for purposes of the present disclosure. For purposes of the present disclosure, administration of a HPV16-, MART1-, CMV-, EBV-, or influenza-TCR "prior to", "concurrent with," or "after" (as those terms are defined herein above) administration of an additional therapeutically active component is considered administration of a HPV16-, MART1-, CMV-, EBV-, or influenza- TCR "in combination with" an additional therapeutically active component).

[0301] In some embodiments, the adoptive T cell therapy methods described herein comprise identifying the nucleic acid sequences encoding the TCR α and / or β variable domains, e.g., the sequences of the CDR1, CDR2, and / or CDR3 of the TCR α and / or β variable domains, (or, in other embodiments, the nucleic acid sequences encoding the TCR ^ and / or γ variable domains) of antigen-specific T cells and the cognate antigen using the high throughput screening methods, compositions and / or kits described herein. In some embodiments, the nucleic acid sequences encoding the TCR α and / or β variable domains, e.g., the sequences of the CDR1, CDR2, and / or CDR3 of the TCR α and / or β variable domains, (or, in other embodiments, the nucleic acid sequences encoding the TCR ^ and / or γ variable domains) identified are employed in the creation of a human therapeutic. 96

[0302] In one embodiment, the human therapeutic is a T cell (e.g., a human T cell, e.g., a T cell derived from a human subject) harboring a nucleic acid sequence of interest (e.g., transfected or transduced or otherwise introduced with the nucleic acid of interest) such that the T cell expresses the TCR with affinity for an antigen of interest. In one aspect, a subject in whom the therapeutic is employed is in need of therapy for a particular disease or condition, and the antigen is associated with the disease or condition. In one aspect, the T cell is a cytotoxic T cell, the antigen is a tumor associated antigen, and the disease or condition is cancer. In one aspect, the T cell is derived from the subject. Accordingly, upon identification of the nucleic acids and the cognate antigen, an adoptive T cell therapy method described herein may further comprise cloning the nucleic acid sequence of the T cell receptor or a portion thereof (e.g., nucleic acid sequence of a TCR variable domain) identified by the method described herein, into an expression vector (e.g., a retroviral vector), introducing the vector into T cells derived from the subject such that the T cells express the antigen-specific T cell receptor, and infusing the T cells into the subject.

[0303] In other embodiments of an adoptive T cell therapy described herein, the nucleic acid sequence(s) encoding the TCR α and / or β variable domains, e.g., the sequences of the CDR1, CDR2, and / or CDR3 of the TCR α and / or β variable domains, (or, in other embodiments, the nucleic acid sequences encoding the TCR ^ and / or γ variable domains) of antigen-specific T cells are employed in the creation of a human T cell receptor therapeutic. In one embodiment, the therapeutic receptor is a soluble T cell receptor. Much effort has been expanded to generate soluble T cell receptors or TCR variable regions for use therapeutic agents. Generation of soluble T cell receptors depends on obtaining rearranged TCR variable regions. One approach is to design single chain TCRs comprising TCR ^ and TCR ^, and, similarly to scFv immunoglobulin format, fuse them together via a linker (see, e.g., International Application No. WO 2011 / 044186). The resulting scTv, if analogous to scFv, would provide a thermally stable and soluble form of TCR ^ / ^ binding protein. Alternative approaches include designing a soluble TCR having TCR ^ constant domains (see, e.g., Chung et al., (1994) Functional three- domain single-chain T-cell receptors, Proc. Natl. Acad. Sci. USA.91:12654-58); as well as engineering a non-native disulfide bond into the interface between TCR constant domains (reviewed in Boulter and Jakobsen (2005) Stable, soluble, high-affinity, engineered T cell receptors: novel antibody-like proteins for specific targeting of peptide antigens, Clinical and 97  Experimental Immunology 142:454-60; see also, U.S. Patent No.7,569,664). Other formats of soluble T cell receptors have been described. The method described herein may be used to determine a sequence of a T cell receptor that binds with high affinity to an antigen of interest, and subsequently design a soluble T cell receptor based on the sequence.

[0304] A soluble T cell receptor comprising the sequences identified according to the high throughput methods, compositions, and / or kits described herein may be used to block the function of a protein of interest, e.g., a viral, bacterial, or tumor associated protein. Alternatively, a soluble T cell receptor may be fused to a moiety that can kill an infected or cancer cell, e.g., a cytotoxic molecule (e.g., a chemotherapeutic), toxin, radionuclide, prodrug, antibody, etc. A soluble T cell receptor may also be fused to an immunomodulatory molecule, e.g., a cytokine, chemokine, etc. A soluble T cell receptor may also be fused to an immune inhibitory molecule, e.g., a molecule that inhibits a T cell from killing other cells harboring an antigen recognized by the T cell. Such soluble T cell receptors fused to immune inhibitory molecules can be used, e.g., in blocking autoimmunity. Various exemplary immune inhibitory molecules that may be fused to a soluble T cell receptor are reviewed in Ravetch and Lanier (2000) Immune Inhibitory Receptors, Science 290:84-89, incorporated herein by reference.

[0305] While the invention has been particularly shown and described with reference to a number of embodiments, it would be understood by those skilled in the art that changes in the form and details may be made to the various embodiments disclosed herein without departing from the spirit and scope of the invention and that the various embodiments disclosed herein are not intended to act as limitations on the scope of the claims.

[0306] The present invention is further illustrated by the following Examples, which are not intended to be limiting in any way. The entire contents of all references, patents and published patent applications cited throughout this application are hereby incorporated herein by reference. EXAMPLES

[0307] A non-limiting embodiment of an exemplary method useful to find T cell receptor sequences as described herein is illustrated in FIG.1. The examples herein provide data that a hashing methodology may be used in combination with a functional assay, such as activation- 98  induced marker (AIM) cell enrichment and single cell transcriptome sequencing to screen cognate T cell and antigen reactivities, e.g., T cell epitope reactivities, and that such method finds particular usefulness in primary human cells. Descriptions of the method and data presented herein, including the associated figures, may also now be found in Deering et al., (2023) Rapid TCR:Epitope Ranker (RAPTER): a primary human T cell reactivity screening assay pairing epitope and TCR at single cell resolution, Sci. Rep.13(1):8452, which is herein incorporated by reference in its entirety. Example 1 - Rapid TCR:Epitope Ranker

[0308] Identifying epitopes to which T cells respond is critical to understanding T cell- mediated immunity. Traditional multimer and other single cell assays often require large blood volumes and / or expensive HLA-specific reagents and provide limited phenotypic and functional information. Recently, WO / 2021067851, incorporated herein in its entirety by reference, described the Rapid TCR:Epitope Ranker (RAPTER) assay, which is schematically depicted in FIG.1A, FIG.1B, FIG.1C, FIG.1D, FIG.1E, FIG.1F, and FIG.1G. Using hash-tag oligonucleotide (HTO) coding, T cell activation-induced markers (AIMs), and a single cell RNA sequencing (scRNA-SEQ) methods on a sample, which may comprise primary human T cells and antigen presenting cells (APCs), RAPTER may assess functional T cell reactivity at single cell resolution, define paired epitope specificity and TCR sequences, and include RNA- and protein-level T cell phenotype information. With this high throughput method, novel and potentially personalized therapeutics may be quickly identified and generated. Indeed, the Examples provided herein demonstrate that the paired antigen reactivity and TCR information provided by RAPTER can be used to understand the breadth of antigen-specific T cell reactivities in human samples and has the potential to rapidly inform vaccine antigen inclusion and develop targeted TCR therapies. The materials and methods used throughout the Examples are described below.

[0309] Human Peripheral Blood Mononuclear Cells (PBMCs): Cryopreserved PBMCs were purchased (Precision for Medicine Frederick, Maryland) or isolated from fresh blood from human subjects isolated by density gradient centrifugation using Ficoll-Paque Plus (GE Healthcare Life Sciences, 45-001,749) reagent as per manufacturer’s instructions and cryopreserved in freezing media (90% human serum (Millipore Sigma), 10% tissue culture-grade DMSO (Millipore Sigma, 2438). 99

[0310] Peptides: Peptides were custom synthesized at Genscript (Piscataway, NJ). Lyophilized peptides were reconstituted in DMSO at 10-50 mg / mL for stock solutions and then further diluted to 10 μg / mL in the appropriate assay medium for use. The CEF Control Peptide Pool (Anaspec, AS-61036-003) was used at 10 ug / mL and Cell Stimulation Cocktail (ThermoFisher, 00-4970-93) as per manufacturer’s instructions.

[0311] Primary Cell Cultures: Cryopreserved PBMCs were thawed and incubated in CellGenix GMP DC serum-free media (CellGenix, 20801-0500) with 5% Human Serum AB (Millipore Sigma, H3667) and 1% penicillin-streptomycin (ThermoFisher Scientific, 15140163). Cultures were supplemented with dendritic cell and T cell supportive cytokines: T cell media (CellGenix dendritic cell media, cat#20801-0500 + 5% human serum AB (Sigma, cat#H3667)) + 1% penicillin / streptomycin / L-glutamine (ThermoFisher, cat#10378-016), the T cell supporting cytokines IL-7 and IL-15 at 5 ng / ml (CellGenix, cat# 1410-050 and 1413-050, respectively), and IL-2 at 10 U / ml (Peprotech, cat# 200-0).

[0312] Generation of oligo-tagged hashing antibodies: Monoclonal anti-human CD2 antibodies (Clone RPA-2, Biolegend) were conjugated to hashing oligoes (IDT) by inverse electron demand Diels-Alder (iEDDA) click chemistry as previously described. Hashtag oligos were ordered with 5’-amine modification (\5AmMC12\ GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXXXXXXXXXXXXXCCCATAT AAGA*A*A (SEQ ID NO: 1279), X denotes 15nt barcode unique to each hashtag), and purified by ethanol precipitation upon receipt. The * denotes a phosphorothioate bond that renders the inter-nucleotide linkage more resistant to nuclease degradation. Trans-cyclooctene-PEG4-NHS (TCO; Click Chemistry Tools, USA) was dissolved in dry DMSO to 100mM and added to purified oligos at a 10-fold excess in 1X borate buffered saline (BBS, 50 mM borate, 150 mM NaCl, pH 8.5) supplemented with DMSO such that the final DMSO concentration in the reaction mixture is 20%. After 15 min at room temperature, a second aliquot of TCO at 10-fold excess was added, and the reaction mixture incubated for another 15 min at room temperature. Residual NHS groups were quenched by the addition of glycine, and the modified oligo was purified by desalting using Micro Bio-Spin P6 columns (Bio-Rad, USA). Antibodies were buffer exchanged into 1X BBS using an Amicon Ultra-430 kDa MWCO centrifugal filter (Millipore, USA). Methyltetrazine-PEG4-NHS ester (Click Chemistry Tools, USA) was dissolved in dry DMSO and added at a 30-fold excess to the antibody. The reaction was left for 30 min at room 100  temperature. Residual NHS groups were quenched by the addition of glycine and residual free label was removed via centrifugal filtration. Antibody-oligo conjugates were formed by mixing the modified antibody and oligo at a ratio of 30 pmoles of oligo per ug of antibody and incubating at room temperature for at least 1 h, followed by overnight incubation at 4 degrees. Residual methyltetrazine groups on the antibody were quenched by the addition of trans- cyclooctene-PEG4-glycine to 1 mM. Unreacted oligo was removed by centrifugal filtration using an Amicon Ultra-450 kDa MWCO filter (Millipore, USA). Purified antibody-oligo conjugate was run on a 4% agarose E-gel (ThermoFisher, USA) to verify conjugation and removal of free oligo. The antibody-oligo conjugate was stored at 4 degrees in PBS (pH 7.2) containing 0.09% sodium azide and 1 mM EDTA.

[0313] Direct ex vivo IFNγ / GranzymeB ELISPOT: Dual Human IFNγ / GranzymeB FluoroSpot assays kits were purchased from ImmunoSpot (Cleveland, OH) and used per manufacturer’s protocol. Briefly, PBMCs were thawed and incubated in 200 uL in the FluoroSpot plates at 200,000 cells per well with peptide stimulation for 48 hours. ELISPOT reactivity was read out on an ImmunoSpot Analyzer using manufacturer’s automated software.

[0314] Antibodies and phenotypic characterization of T cells by flow cytometry: Fluorescently labeled antibodies were purchased from commercial vendors. To perform flow cytometry phenotypic characterization, cells were harvested, washed, and stained with LIVE / DEAD Green fixable viability dye (Invitrogen cat#L34970). For staining of surface antigens, cells were resuspended in flow cytometry staining buffer (Stain buffer BSA, BD Biosciences, cat#554657) containing Human Seroblock Fc blocking reagent (BioRad, #BUF070B), incubated for 10 minutes at room temperature, then fluorescently labeled antibodies of interest were added. Cells were incubated for 30 minutes at 4°C and then washed three times with staining buffer. For detection of intracellular proteins, cells were fixed and permeabilized using eBioscience FoxP3 / Transcription Factor Staining Buffer Set (Invitrogen #00-5523-00) as per manufactures instructions. Cells were stained for intracellular proteins using fluorescently labeled antibodies diluted in permeabilization buffer for 30 min at 4°C in dark. Cells were washed prior to acquisition on an A3 Symphony flow cytometer (BD Biosciences). Flow cytometry data were analyzed using the FlowJo analysis software (FlowJo, Ashland, OR). The following antibodies were purchased from BD Biosciences: Granzyme B Alexa Fluor 647 (clone GB11, #560212), CD27 APC-R700 (clone M-T271, #565116), CCR7 BB700 (clone 101  3D12, #566437), CD95 BUV395 (clone DX2, #740306), CD8 BUV496 (clone RPA-T8, #612942), CD4 BUV563 (clone SK3, #612912), CD3 BUV661 (clone SK7, #741692), Tim-3 BUV737 (clone 7D3, #748820), CD45RA BUV805 (clone HI100, #742020), GITR BV711 (clone V27-580, #747662), CD69 BV750 (clone FN50, #747522), HLA-DR / DP BV786 (clone G46-6, #564041), CX3CR1 PE-CF594 (clone 2A9-1, #565897), CD28 PE-Cy5 (clone 8124737, #555730), TCF-7 BB630 (clone S33-966, BD Customs, #624294), CTLA-4 BB660 (clone BNI3, BD Customs, #624295), Ki67 BB790 (clone B56, BD Customs, #624296), HLA-ABC BV570 (clone G46-2.6, BD Customs, #624298). The following antibodies were purchased from BioLegend: LAG-3 APC / Fire 750 (clone 7H2C65, #369214), TIGIT BV421 (clone A15153G, #372710), ICOS BV510 (clone C398.4.A, #313525), CD45RO BV605 (clone UCHL1, #304238), 4-1BB BV650 (clone 4B4-1, #309828), PD-1 PE (clone EH12.2H7, #329906). The following antibodies were purchased from Invitrogen: CD25 PE-Cy5.5 (clone PC61.5, #35- 0251-82), FoxP3 PE-Cy7 (clone PCH101, #25-4776-42).

[0315] Expansion of antigen-specific T cells: PBMCs were seeded to culture plates in T cell media supplemented with dendritic cell supporting factors GM-CSF at 1000U / mL (CellGenix, #1412-050) and IL-4 at 500 U / mL (CellGenix, #1403-050), T cell supporting cytokines IL-7 at 5 ng / mL (CellGenix, # 1410-050), IL-15 at 5 ng / ml (CellGenix #1413-050), and IL-2 at 10 U / ml (Peprotech, #200-02). Individual peptides or pools of peptides were added to cells at 10 µg / ml (Genscript). Medium containing cytokines was replenished every 2 to 3 days. Cells were re-stimulated with the individual peptides or peptide pools they were initially stimulated with or re-stimulated with DMSO, a control CEF peptide pool or anti-CD3 (clone HIT3a) / anti-CD28 (clone CD28.2) and analyzed 24 hours later by flow cytometry for activation induced markers. The antibodies used for flow cytometry analysis are described in “Antibodies and phenotypic characterization of T cells by flow cytometry” above.

[0316] Antigen-specific T cell reactivity assays: Peripheral blood mononuclear cells (PBMC) were isolated by Ficoll-Paque Plus gradient isolation. PBMC were seeded to culture plates, e.g., aliquoted, in T cell media (CellGenix GMP DC media, cat#20801-0500 + 5% human serum AB (Sigma, cat#H3667)) + 1% penicillin / streptomycin / L-glutamine (ThermoFisher, cat#10378-016), dendritic cell supporting factors GM-CSF at 1000U / mL and IL-4 at 500 U / mL (CellGenix, #1412-050 and CellGenix, #1403-050, respectively), T cell supporting cytokines IL- 7 and IL-15 at 5 ng / ml (CellGenix, # 1410-050 and 1413-050, respectively), and IL-2 at 10 U / ml 102  (Peprotech, cat# 200-0). Individual antigens, e.g., peptides of interest, were added to assay wells at 10 ug / ml (Genscript) to form unique biological samples. T cell reactivity was analyzed either 24 hours post-peptide stimulation or after 10-day expansion.

[0317] Overnight cultures were harvested 24 hours post-peptide stimulation and prepared for sorting and single cell sequencing. For 10-day pre-expansion cultures, cells were fed with fresh media and cytokines every two days for 10 days after the initial peptide addition. Then, individual peptides of interest were added to T cell expansion cultures for overnight re- stimulation to upregulate expression of an activation-induced marker e.g., CD137 / 4-1BB, and allow antigen-specific AIM based functional T cell sorting. Following peptide re-stimulation, cells were prepared for either flow cytometry characterization or were further processed to allow for hashing, pooling, and single cell sequencing. Antibodies used for flow cytometry analysis were purchased from commercial vendors. The following antibodies were purchased from BD Biosciences: CD3 BUV661 (clone SK7, #741692), CD8 BUV496 (clone RPA-T8, #612942), CD4 BUV563 (clone SK3, #612912), CD69 BV750 (clone FN50, #747522), HLADR BUV395 (clone DX2, #740306), Ki67 BB790 (clone B56, BD Customs #624296). The following antibodies were purchased from BioLegend: 4-1BB BV650 (clone 4B4-1, #309828), PD-1 PE (clone EH12.2H7, #329906), CD25 Alexa Fluor 488 (clone M-A251, #356116), IFNγ PE-Cy7 (clone 4S.B3, #502528), CX3CR1 PE / Dazzle594 (clone 2A9-1, #341623), CD40L BV421 (clone 24-31, #310824), OX40 APC (clone Ber-ACT35, #350008).

[0318] Cell hashing following functional T cell assay performance: Following functional stimulation, cells from individual assay wells were collected into a 96 well assay block, washed, and resuspended in flow cytometry BD BSA staining buffer (BD Biosciences, #554657) containing hashing reagents of interest. Cells were either stained with one or two hashtag oligonucleotide (HTO) antibodies, each at 1 μg / 106cells. Cells were incubated for 30 minutes at 4 ^C, washed twice, then pooled. If oligonucleotide-tagged dextramers were included in the analysis, then samples were stained with dextramers before proceeding to CITE-seq and flow cytometry antibody staining as per the oligo-tagged dextramer staining protocol below.

[0319] CITE-seq antibody staining and fluorescent antibody staining: Following the hashing staining procedure, pooled and hashed samples were resuspended in BD BSA staining buffer containing both CITE-seq antibodies as well as fluorescently tagged flow cytometry 103  antibodies at their respective optimal concentrations. Cells were incubated for 30 minutes at 4 ^C, washed twice, and then sorted for single cell sequencing.

[0320] Oligo-tagged dextramer staining and FACS sorting: Cryopreserved health donor PBMC were thawed briefly in a 37°C water bath. CD8+ T cells were enriched using magnetic beads (Miltenyi Biotec). Cells were washed by centrifugation and then treated with PBS (Gibco, 14190-250) containing benzonase (Millipore, 70664) and 50 nM Dasatinib (Axon Medchem, 1392) for 45 minutes at 37°C. Cells were transferred to a 96-well assay block (Corning, 3960), centrifuged, and supernatant was aspirated. The appropriate custom Immudex dCODE-PE dextramer pool (Copenhagen, Denmark) was added at 1 ul / 100 ul reaction for 30 minutes in dark at room temperature. Next, the fluorochrome-labeled surface markers were added, and the cells were incubated for additional 30 minutes in 4°C. After washes, the cells were immediately sorted. Flow cytometry antibody staining and washes were performed in staining buffer (BD, 554657). Surface markers for FACS included the following markers and fluors: Live / Dead – DAPI added on-site at the sorter (Sigma, 10236276001), CD3 BUV737 (BD Biosciences, 612750), CD4 BV510 (BD Biosciences, 563919), CD8 BUV805 (BD Biosciences, 612889), CCR7 AF647 (BioLegend 353218), and CD45RO BV605 (BioLegend 304238).

[0321] CD137 / 4-1BB+ T cell FACS sorting: Twenty-four hours following re-stimulation, cells were collected and stained with fluorescently-labeled antibodies for FACS using an Astrios cell sorter (Beckman Coulter) using the following surface antibodies: CD3 (BD Biosciences, cat#612750) and CD137 / 4-1BB (Biolegend, cat#309828). Gates for forward scatter plot, side scatter plot, and fluorescent channels were set to select live cells while excluding debris and doublets. A 100 µm nozzle was used to sort single CD3+ CD137 / 4-1BB+ cells for further processing.

[0322] Chromium single cell partitioning and library preparation: Sorted cells were then loaded onto a Chromium Single Cell 5’ Chip (10x Genomics, 1000287) and processed through the Chromium Controller to generate GEMs (Gel Beads in Emulsion). RNA-Seq libraries were prepared with the Chromium Single Cell 5’ Library & Gel Bead Kit (10x Genomics, 1000265) following the manufacturer’s protocol.

[0323] Plasmid cloning: TRA and TRB of EBV BMFL1 or Flu M TCRs were subcloned into the lentiviral vector pLVXEF1a at Genscript. TRA and TRB of MART1 TCRs were subcloned into the lentiviral vector pLVX-EF1a IRES-EGFP between SpeI and XbaI. 104

[0324] Transfection and lentiviral production: Lenti-X 293T cells were seeded on tissue culture plates coated with poly-D-lysine. Transfection was done using Lenti-X Packaging Single Shots (Takara) as per manufacturer’s instruction. Supernatant containing lentiviral particles was collected 48 hours and 72 hours post transfection. When needed, viral supernatant was concentrated using Amicon Ultra-15 centrifugal Filter Unit (NMWL 100 kDa. Millipore UFC910096).

[0325] Jurkat reporter cell lines: Jurkat / NFAT-Luc cell lines were generated by stable transfection of Jurkat (Clone E6-1, ATCC) with an NFAT response element-luciferase reporter plasmid. Jurkat TCRab dKO cell line was generated by CRISPR editing of the TRA and TRB in the Jurkat Clone E6-1 (ATCC TIB-152). TRB was edited using a single gRNA (AGGCTTCTTCCCCGACCACG [SEQ ID NO: 1280]). TRA was edited using two gRNAs (ACATACCAGAAGAGATATGG [SEQ ID NO: 1281] and TGGATTTAGAGTCTCTCAGC [SEQ ID NO: 1282]). Lentiviral particles expressing an AP-1 response element-firefly luciferase (Qiagen) were used to transduce Jurkat TCRab dKO cells to generate Jurkat TCRab dKO / AP1.Luc cells, which were subsequently transduced with lentiviral particles expressing human CD8 in pLVX. The resulting Jurkat TCRab dKO / AP1.Luc / hCD8 cells were used to assess antigen reactivity of TCRs. Briefly, lentiviral particles harboring the TRA and TRB of a TCR of interest were transduced into Jurkat TCRab dKO / AP1.Luc / hCD8 in the presence of 8 μg / mL polybrene. TCR expression was confirmed by flow cytometry analyses using the following antibodies: CD3 BUV661 (Clone SK7, BD Biosciences), CD4 BUV563 (Clone SK3, BD Biosciences), CD8 BUV496 (Clone RPA-T8, BD Biosciences) and TCRa / b PerCP-vio700 (Clone REA652, Miltenyi Biotec). When needed, TCR+ cells were enriched by anti-APC microbeads (Miltenyi Biotec) after labeling cells with an APC-conjugated anti-human TCRab antibody (Clone REA652, Miltenyi Biotec).

[0326] Jurkat firefly luciferase reporter assays: CD14+ cells isolated from PBMC using EasySep Human Monocyte Isolation Kit (STEMCELL) were cultured in CellGenix GMP DC serum-free media (CellGenix, #20801-0500) supplemented with 1% Human Serum AB (Millipore Sigma, #H3667) and 1% penicillin-streptomycin- L-glutamine (ThermoFisher Scientific, #10378-016). GM-CSF (1000 U / mL, CellGenix #1412-050) and IL-4 (500 U / mL, CellGenix #1403-050) were added to the medium to generate Mo-DC. On day 5, DC were pulsed with peptide pools or individual peptides at 10 μg / mL, in the presence of IFNγ 105  (500U / mL), GM-CSF (1000 U / mL) and IL-4 (500 U / mL).12,500 to 100,000 Jurkat TCRab dKO / AP1.Luc / hCD8 cells expressing an TCR of interest (Jurkat-TCR) were cocultured with 30,000 DC pulsed with antigen peptides for 5 hours before lysed to assess luciferase activity using One-Glo Luciferase Assay (Promega) as per manufacturer’s instructions. Co-culture of 100,000 Jurkat-TCR cells with 30,000 DC pulsed with irrelevant peptides or with DC treated with DMSO was used as negative controls. When a titration of Jurkat-TCR cells were used, Jurkat / NFAT-Luc cells were used as filler cells. Nonspecific activation of TCRs was achieved by soluble anti-CD3 (Clone HIT3a, BD Biosciences) and anti-CD28 (Clone CD28.2, BioLegend). Luminescence signal was measured using the EnVision plate reader. RLU values were plotted after background signals were subtracted.

[0327] Bioinformatic methods

[0328] The transcriptome, TCR (VDJ), hashing, CITE-seq, and dextramer libraries were sequenced and the raw sequencing data was processed using the 10X CellRanger analysis pipeline. The CellRanger analysis generated feature-barcode UMI count matrices and TCR(VDJ) amino acid sequences. The features include gene expression, hashing antibody, CITE-seq antibody, and dextramer capture. Using the feature-barcode matrices as the input, the R package Seurat v3.1.4 (Butler et al 2018) was used for downstream analysis. Standard log normalization of gene UMI counts was performed, followed by identification of 1000 most variable genes, and scaling and centering of the data. Next Principal Component Analysis (PCA) was performed, and 50 PCs were computed and stored. Clustering was then performed using Seurat’s graph-based clustering approach. A k-nearest neighbor (KNN) graph was computed based on the Euclidean distance in a 20-dimensional PCA space followed by clustering at various resolutions. At each resolution, top marker genes were identified and used to create a heatmap of gene expression across different clusters. Upon visual inspection, the optimal clustering resolution was determined. All the cells belonging to the dead cell cluster, with mitochondrial genes as the top gene markers, were removed from the downstream analysis. Cells for which number of genes detected was less than or equal to 500, and fraction of mitochondrial gene expression was greater than or equal to 0.25 were removed. Since one of the main goals of the assay is to identify T-cell reactivity against various antigens which are driven by TCR-antigen interactions, any cell with a single TCR chain, or a non-productive chain, or more than one alpha or beta chain was also removed. Any outlier cell with large number of genes detected and / or a large number of UMIs 106  detected was also removed. For the remaining cells, data from other features (CITE-seq, hashing, dextramer) was then processed. The data from count matrices corresponding to those features was normalized using centered log ratio transformation, and then scaled. Hashing data was used to demultiplex the cells using the MultiSeqDemux algorithm (McGinnis et al. (2019) Nature Methods 16:619-26; default parameters). Any cell that was not assigned a hashtag according to the hashing scheme was removed after multiplexing. For each cell, paired TCR amino acid sequence which defines the unique functional clonotype of the cell was obtained. After demultiplexing, the clonotype size of each T-cell clone among all the cells associated with a hash tagged assay well was calculated. Any clonotype with size > 20 was considered to have potential reactivity to the specific antigen in the hash tagged well. GEO accession numbers for single cell sequencing files are provided in Table 8.

[0329] The RAPTER assay was developed using either whole peripheral blood mononuclear cells (PBMCs) as the source of T cells and APCs, or T cells cultured with autologous monocyte-derived dendritic cells (moDC). However, the PBMC culture system may be a faster and more efficient use of patient blood.

[0330] To perform the RAPTER assay, PBMCs or T cell / moDC cultures were first distributed across assay wells in culture media. Either single antigens or antigen pools were then added to the culture wells (FIG.1A). In the experiments presented here, antigens were provided in the form of synthetic peptides. After 24 hours, T cells from each assay well were stained with an HTO-conjugated antibody (FIG.1B). While the antibody target for all wells was constant and should target a marker generally expressed by T cells, e.g., anti-CD2, the HTO sequence for each well was unique. Cell target-agnostic lipid-based hashing reagents can also be multiplexed to use in this assay (FIG.10A, FIG.10B, FIG.10C, FIG.10D, FIG.10E, and FIG.10F). HTOs were sequenced with the transcriptome using specific primers added to standard scRNA-SEQ protocols. The HTOs marked from which assay well each T cell came, and therefore to which antigen each T cell was exposed.

[0331] Once T cells from the individual wells were uniquely labeled with HTO antibodies, cells from all wells were pooled. Sample pooling provided multiple benefits: consistent staining with surface antibodies for flow cytometry and CITE-seq, ensured sufficient cells for fluorescence activated cell sorting (FACS), reduced use of scRNA-SEQ reagents, and overall reduced technical variation between wells (FIG.1C). While a single antigen-specific T 107  cell reactivity might comprise a very low, unsortable population of cells, pooling all wells together provides a larger composite population that permits rapid, efficient sorting. The design strategy was to perform scRNA-SEQ, HTO hashing, and oligo-tagged CITE-seq antibody / dextramer reagent staining simultaneously, but to generate distinct sequencing libraries from each of the three groups to optimize individual library amplification.

[0332] The pooled cell population was then sorted using AIM expression as the functional selection marker (FIG.1D). In at least one assay well, a pool of common viral antigens, such as a 35-peptide CMV-EBV-Influenza (CEF) peptide pool may be included to both serve as a positive control and to ensure a robust, sortable population of cells for FACS and single cell sequencing. Sorted AIM+ cells are “super loaded” into the 10X Genomics single cell partitioning instrument at an expected yield of 20,000 single cells (FIG.1E). Following sequencing, computational HTO demultiplexing was performed to link each T cell with the specific antigen to which it was exposed (FIG.1F) and HTO-specific TCRs are selected based on clone size and AIM expression (FIG.1G).

[0333] Although RAPTER may be used on either PBMCs or T cell / moDC cultures, all the Examples herein used a whole PBMC culture system.

[0334] T cells upregulate a variety of activation induced markers (AIM) following antigen-specific TCR signaling, including CD137 / 4-1BB, CD25, CD69, HLA-DR, CD40L, OX40, and PD-1. To initially develop the RAPTER assay, HLA class I-restricted viral epitope systems were used to test the kinetics of AIM upregulation on CD8+ T cells, HLA class I- restricted viral and tumor model epitope systems were used. Primary human T cells from an HLA-A*02:01+ healthy donor (HD) with confirmed CMV-specific antibody detection were pre- expanded for 10 days in the presence of CMVpp65495-503peptide (NLVPMVATV; SEQ ID NO: 1283) to increase the test population size (FIG.11A and FIG.11B). Following expansion, the cells were re-stimulated with CMVpp65495-503 peptide and the expression of various activation markers, including CD137 / 4-1BB, CD25, CD69, and PD-1 was measured at intervals over 96 hours. Compared to other AIMs, the percentage of CD8+ T cells that upregulated CD137 / 4-1BB at 24 hours post CMVpp65495-503 restimulation was comparable in size to the corresponding dextramer+ population (23.5% versus 23.9%) (FIG.2A and FIG.2B), in alignment with what has been previously reported (Wolfl, M. et al. (2007) Blood 110:201-210). Most CD137 / 4-1BB+ T cells co-expressed CD25 and high levels of PD-1 and HLA-DR (FIG.12), and the kinetics of 108  CD25 expression most closely tracked with CD137 / 4-1BB expression (FIG.2A). In the absence of cognate ligand stimulation, all the AIMs tested (HLA-DR, PD-1, CD25, etc.) were expressed to varying degrees at baseline except for CD137 / 4-1BB (FIG.2A and FIG.2B). The extremely low baseline expression of CD137 / 4-1BB on CD8+ T cells makes it an ideal AIM to identify and isolate even low-frequency reactivities. AIMs that are highly co-expressed with CD137 / 4-1BB+ cells, e.g., CD25, can additionally be used to further enrich antigen-specific T cells. Expectedly, the number of detectable CMV pp65 dextramer+ T cells was reduced after cognate ligand stimulation, presumably due to TCR internalization, but most T cells that were still detectable by dextramers post-stimulation expressed CD137 / 4-1BB (FIG.2B and FIG.2C). Thus, mock stimulated (DMSO treated) cells to collect dextramer+ cells were for all experiments described herein. CMV pp65 epitope-specific dextramer+ and CD137 / 4-1BB+ T cells were only detected in HDs who were both HLA-A*02:01+ and naturally exposed to CMV (FIG.2D). This data, with that shown in WO / 2021067851, supra, show that CD137 / 4-1BB is a specific and sensitive marker for CD8+ T cell epitope reactivity, and may be used in functional assays to provide efficient and similar functional assay results as traditional multimer staining.

[0335] To confirm that the TCR clones found in the CD137 / 4-1BB+ T cell populations were truly antigen-specific, the CMV pp65+ expanded T cells from the HD represented in FIG. 2A and FIG.2B were restimulated with the CMVpp65495-503 peptide, and clones were compared to CMV pp65 dextramer+ cells or MART1 dextramer+ T cells using single cell RNA sequencing (scRNA-SEQ) and single cell TCR sequencing (scTCR-SEQ). Following 24-hour re- stimulation, population size agreement across DMSO-treated dextramer+ and CD137 / 4-1BB+ T cells by flow cytometry was observed (FIG.2E). Consistent with previous studies using PD-1 as an AIM to identify antigen-specific T cells in the circulation (Gros, A. (2016) Nat Med 22: 433- 438; Gros et al. (2019) J Clin Invest 129: 4992-5004), CD137 / 4-1BB+ T cells also expressed PD-1 (FIG.12). However, PD-1 was expressed on T cells even prior to re-stimulation with the CMV pp65 peptide (FIG.2E). scRNA- and scTCR-SEQ were performed on CD8+ T cells expressing CD137 / 4-1BB or PD-1 following re-stimulation, as well as CMV pp65 dextramer+ T cells and MART1 dextramer+ T cells to serve as reference controls (FIG.13A, FIG.13B, FIG. 13C, FIG.13D, FIG.13E, FIG.14A, and FIG.14B). Expanded TCR clones (clone size >=10 cells) overlapped between the dextramer+ and CD137 / 4-1BB+ populations more significantly than between dextramer+ and PD-1+ or PD-1+ and CD137 / 4-1BB+ (FIG.2F). When the 109  overlap among TCR clone sizes > 1 cell was considered, the dextramer+ and CD137 / 4-1BB+ samples also correlated significantly (FIG.2G). Almost no TCR overlap was observed among the MART1 dextramer+ TCRs and CMV pp65-specific TCRs captured by dextramers, PD-1, or CD137 / 41-BB. These experiments show that the same epitope-specific TCR clones can be found using CD137 / 4-1BB and dextramer sorting. See also, WO / 2021067851, supra.

[0336] Having established that CD137 / 4-1BB+ T cell populations are enriched epitope- specific TCRs following antigen re-exposure, it was confirmed that RAPTER using an AIM, e.g., CD137 / 4-1BB, could recover multiple antigen-specific populations at their respective starting ratios. See, e.g., WO / 2021067851, supra. After a 10-day peptide (CMVpp65, EBV BMLF1, EBV LMP2A, Influenza M)-specific expansion and a 24-hour re-exposure, see WO / 2021067851, supra, the expanded PBMC sample was tested in the RAPTER assay on hashed and pooled T cells, using CD137 / 4-1BB+ signal as the selection marker. Of the 6,474 total CD137 / 4-1BB+ CD8+ T cells sequenced using a RAPTER assay, DEMUX revealed 5 viral antigen-associated populations that retained the relative frequencies established by both ELISpot and flow cytometry (Pearson R = 0.94, p-value = 2.1 x 107). Agreement between scRNA- and CITE-SEQ gene expression for these virus-specific T cells was also seen, see, e.g., WO / 2021067851, supra. These experiments demonstrated that the relative frequencies of different reactivities were maintained during both expansion and re-stimulation during the RAPTER assay.

[0337] WO / 2021067851, supra, and this example confirm RAPTER as a functional T cell assay system that uses primary, autologous immune cells. It may be used to screen 10s-100s of antigen reactivities simultaneously and takes advantage of T cell AIM expression to select antigen-specific cells.

[0338] In the following Examples, it is shown that RAPTER may be used to identify specific reactivities to viral and tumor antigens at sensitivities as low as 0.15% of total CD8+ T cells, and deconvolute low-frequency circulating HPV16-specific T cell clones from a cervical cancer patient. Additionally, the following Examples show the specificities of TCRs identified by RAPTER for MART1, EBV, and influenza epitopes may be functionally confirmed in vitro. In summary, RAPTER identifies low-frequency T cell reactivities using primary cells from low blood volumes, and the resulting paired TCR: ligand information allows for immunogenic 110  antigen selection for vaccine epitope inclusion, antigen-specific TCR tracking, and TCR cloning for further therapeutic development. Example 2 – RAPTER Sensitivity test

[0339] RAPTER’s quantitative limit of detection was determined. By understanding the lower limits of positive population detection in the assay, the number of simultaneous reactivities that can be queried for a given sample may be more accurately approximated. For this proof-of- concept experiment, an epitope associated with very few antigen-specific T cells at baseline, ELAGIGILTV (SEQ ID NO: 1284) from the MART1 protein, was the focus. At baseline, the percent of MART1 dextramer+ T cells comprised 0.018% of total CD8+ T cells in the healthy donor (HD), but after a 10-day peptide-specific expansion, 8.48% of T cells were MART1 dextramer+ (FIG.3A). A dilution series was then performed using autologous non-expanded cells to dilute the antigen-specific target population (FIG.3B). Cells from each dilution point were re-stimulated with MART1 ELAGIGILTV (SEQ ID NO: 1284). After 24 hours, the cells were hashed, pooled, sorted using CD137 / 4-1BB signal and submitted to scRNA / TCR-SEQ. Additionally, expanded DMSO-stimulated T cells were stained with MART1 dextramers, sorted, and underwent scRNA / TCR-SEQ to provide positive controls with which to compare RAPTER- enriched TCRs (FIG.4A, FIG.4B, and FIG.4C). For TCR clones found in >=2 cells, MART1 CD137 / 4-1BB+ TCRs were robustly detected in samples with as low as 0.15% dextramer+ of total CD8+ T cells and 0.07% dextramer+ of total CD3+ T cells (FIG.3C). RAPTER TCRs were cross-referenced to their corresponding dextramer+ TCRs to confirm specificity, and were highly correlated.

[0340] UMAP clustering using scRNA-SEQ data from all MART1 sorted T cells was performed. It appeared dextramer+ and RAPTER+ T cells clustered separately, probably due to the lack of re-stimulation for the dextramer sorted cells (FIG.3D). Unsupervised clustering identified 5 dextramer-sorted clusters (FIG.3D) and 2 RAPTER-sorted clusters expressed phenotypic markers consistent with T cell activation following antigen restimulation, including high levels of CD137 / 4-1BB, GZMB, IFNG, CCL4, TNFRSF4 (OX40), and TNFRSF18 (GITR), and low levels of ZNF683 (HOBIT) and SELL (FIG.3E). However, the RAPTER clusters differed from each other in their functional profiles. Cluster 2 was characterized by high expression of XCL1 / 2, CD28, IL2RA, and TFRC (CD71). Cluster 3 was characterized by 111  KLRD1, GNLY, and ENTPD1 (CD39) expression, as well as T cell activation markers including PD-1, TIGIT, and KLRD1. Example 3 – Functional Validation of MART1 TCRs identified by RAPTER

[0341] Although most MART1 TCRs were found in both the RAPTER and dextramer- stained samples, some TCRs were identified only by dextramer and, conversely, a few TCRs were present in the RAPTER assay but did not stain with dextramer. Therefore, TCRs from all categories were cloned into a TCR-deficient Jurkat T cell line engineered to expressed luciferase under the control of an AP-1 promoter (FIG.3F, Table 1) and tested for their ability to functionally respond to MART1 ELAGIGILTV (SEQ ID NO: 1284) peptide loaded on moDC derived from HLA-A*02:01+ healthy donor PBMCs. All MART1 TCRs that were identified by the RAPTER or by both the RAPTER and dextramer assays, and 3 of the 4 tested MART1 TCRs identified by the dextramer assay, functionally responded to restimulation with the MART1 peptide (FIG.3G, Table 2). A non-specific background TCR showed no functional activity against any peptide condition. Antigen restimulation of one TCR did not lead to T cell activation despite its ability to bind the MART1 dextramer (FIG.15A, FIG.15B, FIG.15C, FIG.15D, FIG.15E, FIG.15F, FIG.15G, FIG.15H, FIG.15I, and FIG.15J). Table 1. MART1 TCR sequences from TCR validation. MART1 TCR ID Median 41BB Q G 2) Q112  DR5 ID NO: 1200) TRBV27*01:TRBD2*01:TRBJ2- 1) IF 4) F 69) Q 5) ) YF 3)Table 2. Pool name Source Peptide name Peptide Sequence 8))0) 1) 2)113  HPV16 E6 HPV16 E677 YSKISEYRHYCYSLY (SEQ ID NO: 1293) HPV16 E6 HPV16 E681SEYRHYCYSLYGTTL (SEQ ID NO: 1294)5)6)7) )))0) 1) 2)3)4) 5) 6)07)8) 9) )1)2) 3) 4)5)6) 7) )114  CMVpp65 CMVpp65_NLV NLVPMVATV (SEQ ID NO: 1283) EBV LMP2A EBV LMP2A CLGCLGGLLTMV (SEQ ID NO: 1319)

[0342] To determine the baseline diversity of antigen positive T cells, a previously developed pooled oligo-labeled dextramer (dCODE) screening pipeline for human sample analysis was used. Zhang (2021) Sci Adv 7. Using a panel of 23 custom dCODE dextramers that included multiple HLA alleles and both virus- and cancer-associated epitopes (Table 3), T cells from an HLA-A*02:01+, A*29:02+, B*35:01+, and B*57:01+donor were stained with each dextramer individually (FIG.5A and FIG.5B) and as a pooled dCODE dextramer screen (FIG. 6A and FIG.6B) with a scSEQ read-out to understand the population frequencies and identify antigen-specific TCR sequences.50 million PBMC were used for these tests, yet many dextramer+T cell populations were present at such low frequencies that they would not be sortable using a single dextramer approach from the available PBMC. Table 3. HLA Source Gene Peptide restriction HTO barcode n n n n n n n n n115  LMP2A FLYALALLL (SEQ ID NO: 1329) HLA-A*02:01 hTag_42_regn EBNA 3B LLDFVRFMGV (SEQ ID NO: 1330) HLA-A*02:01 hTag 46 regn n n n nnnnnnn

[0343] Having evaluated the effects of peptide pre-expansion on TCR repertoire and established that our culture conditions maintained pre-existing antigen-specific memory T cells, although preferentially expanded T cell clones comprised of > = 2 cells prior to expansion (FIG. 16A, FIG.16B, FIG.16C, FIG.16D, FIG.16E, and FIG.16F), a 7-day T cell expansion culture protocol, which was previously shown to maintain pre-existing antigen-specific memory T cells, was performed with the 21 non-control peptides listed in Table 3. Expanded samples were used to test pooled dCODE dextramer and RAPTER assays in parallel (FIG.7A and FIG. 7B). TCR sequences identified in the pre- versus post-expansion dCODE dextramer screens were compared. Significant overlap in clones that stained for dextramers, particularly for TCR clone sizes >1 and >10 was observed (FIG.7C). Out of the 23 dextramers tested, T cells specific for three haplotype-matched reactivities (CMV pp65, EBV BMLF1, and Influenza M) represented most of the signal in each assay and provided sufficient TCRs to perform correlative analyses. For each reactivity, more unique T cell clones were detected by dextramers than by RAPTER, but when the dextramer+and RAPTER+TCR were correlated by clone size, significant overlap among shared TCR clones >= 5 cells was observed (FIG.7D). These experiments show that 116  RAPTER can recapitulate the major clones detectable with pooled dextramer screens at a fraction of the cost of dextramer reagents. Example 5 - Identification of HPV16-specific T cell reactivity using RAPTER

[0344] The immunosuppressive tumor microenvironment can make detecting human papilloma virus (HPV)-specific T cells in the circulation challenging. To test whether the ability to detect and functionally characterize tumor antigen-specific T cells from patients with HPV16-driven cancer could be improved by RAPTER, the HPV16 IFNγ ELISpot assay was compared to RAPTER. PBMC were collected from an HLA A*02:01+ patient with early-stage cervical cancer at the time of tumor resection but prior to systemic therapy. To determine whether any HPV16 epitope-specific T cells could be detected in this sample, a direct ex vivo IFNγ ELISPOT was performed using three pools of overlapping 15 amino acid-length synthetic long peptides (SLPs) encoding the HPV16 E6, E7, and L1 proteins (Table 2). A low-positive HPV16 peptide-specific IFNγ ELISPOT signal was detected (~10 SFC / 2x105 PBMC), which appeared to be isolated to the E6 peptide pool (FIG.8). A second IFNγ ELISPOT using 23 arrayed E6 SLPs identified a single low-reactive signal against the HPV16 E6101-115 (KPLCDLLIRCINCQK; SEQ ID NO: 1285) peptide (FIG.9A, Table 4). However, this reactivity was too low (~5 SFC / 2 x 105PBMC) to qualify as a true positive. Table 4. Source Peptide name Peptide sequence Length117  HPV16 E6_97 QQYNKPLCDLLIRCI (SEQ ID NO: 1298) 15 HPV16 E6 101 KPLCDLLIRCINCQK (SEQ ID NO: 1285) 15

[0345] To assess if the RAPTER assay could provide a stronger signal and greater specificity resolution than the HPV IFNγ ELISPOT, the HPV16+ PBMC sample was tested using 15 HPV16 E6 and E7 SLPs, and 5 individual 9 amino acid CEF peptides that comprised the positive control peptide pool (Table 5). Table 5. Gene Peptide name Peptide sequence Length HTO n n n118  HPV16 E6_73 CLKFYSKISEYRHYC (SEQ ID NO: 1292) 15 hTag_46_regn HPV16 E6 77YSKISEYRHYCYSLY (SEQ ID NO: 1293)15 hTag 53 regnn nnn n n n n n n n n n n n

[0346] RAPTER revealed distinct, expanded CD8+ T cell clones that reacted to the HPV16 E6101-115 (KPLCDLLIRCINCQK; SEQ ID NO: 1285) SLP, but no other HPV peptide- specific T cells were identified (FIG.9C). Additionally, CEF control peptide reactivities were predominantly comprised of CD8+ T cell reactivities against EBV LMP2A, EBV BMLF1, and Influenza M antigens.

[0347] The phenotypic signatures of the total CD8+ T cell population and CD137 / 4-1BB RAPTER sorted subset were compared. scRNA-SEQ data was used to cluster total CD8+ T cells and RAPTER+ T cells (FIG.9B). RAPTER+ T cells segregated transcriptionally into clusters that were dominated by cytotoxic (IFNG, GZMA / B) and activation-associated (41BB, HLA-DR, LAG3) gene programs (FIG.9D). Surprisingly, the AIM+ HPV and EBV TCR clones clustered separately from each other within these transcript-based functional clusters (FIG.9E and FIG. 119  9F). Cells with the four most abundant reactivities corresponding to HPV16_E6_101, EBV BMLF1, EBV LMP2A, and Influenza M were selected for differential gene expression (DEG) analysis (FIG.9G). Consistent with an immunosuppressive tumor microenvironment, the HPV16_E6_101-specific T cells exp...

Claims

CLAIMS 1. A T cell receptor (TCR), or a variable domain thereof, comprising: (i) a TCR ^ variable (TCR V ^) domain comprising a TCR ^ complementarity determining region ( ^CDR) 1, an ^CDR2, and / or an ^CDR3 that is 90% identical to an αCDR1, αCDR2 and / or αCDR3 amino acid sequence set forth in Table 9; and / or (ii) a TCR ^ variable (TCR V ^) domain comprising a TCR ^ complementarity determining region ( ^CDR) 1, a ^CDR2, and / or a ^CDR3 that is 90% identical to a βCDR1, βCDR2 and / or βCDR3 amino acid sequence set forth in Table 9, wherein the TCR or variable domain thereof specifically binds to an HLA presented peptide, and optionally wherein the TCR, or variable domain thereof, has been identified using a Rapid TCR:Epitope Ranker (RAPTER) assay method.

2. The TCR, or variable domain thereof, of claim 1, comprising: (i) an ^CDR3 comprising an amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence of a TCR V ^ domain as set forth in Table 9; and / or (ii) a ^CDR3 comprising an amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence of a TCR V ^ domain as set forth in Table 9.

3. The TCR, or variable domain thereof, of claim 1 or claim 2, comprising: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ domain as set forth in Table 9; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ domain as set forth in Table 9.

4. The TCR, or variable domain thereof, of any one of the preceding claims, comprising: (i) a TCR V ^ domain comprising an amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence as set forth in Table 9; and / or 211  (ii) a TCR V ^ domain comprising an amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence as set forth in Table 9.

5. The TCR, or variable domain thereof, of any one of the preceding claims, comprising: (i) an ^CDR3 comprising an amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9; and (ii) a ^CDR3 comprising an amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence of the TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9.

6. The TCR, or variable domain thereof, of any one of the preceding claims, comprising: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ domain as set forth in Table 9; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ domain as set forth in Table 9.

7. The TCR, or variable domain thereof, of any one of the preceding claims, comprising: (i) a TCR V ^ domain comprising an amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9; and (ii) a TCR V ^ domain comprising an amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence of the TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9.

8. The TCR, or variable domain thereof, of claim 1, comprising: (i) an ^CDR3 comprising an ^CDR3 amino acid sequence of a TCR V ^ domain as set forth in Table 9; and / or (ii) a ^CDR3 comprising a ^CDR3 amino acid sequence of a TCR V ^ domain as set forth in Table 9. 212  9. The TCR, or variable domain thereof, of claim 8, comprising: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ domain as set forth in Table 9, respectively; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ domain as set forth in Table 9, respectively.

10. The TCR, or variable domain thereof, of claim 8 or claim 9, comprising: (i) a TCR V ^ domain comprising a TCR V ^ domain amino acid sequence as set forth in Table 9; and / or (ii) a TCR V ^ domain comprising a TCR V ^ domain amino acid sequence as set forth in Table 9.

11. The TCR, or variable domain thereof, of any one of claims 8-10, comprising: (i) an ^CDR3 comprising a ^CDR3 amino acid sequence of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9; and (ii) a ^CDR3 comprising a ^CDR3 amino acid sequence of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9.

12. The TCR, or variable domain thereof, of any one of claims 8-11, comprising: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9.

13. The TCR, or variable domain thereof, of any one of claims 8-12, comprising: (i) a TCR V ^ amino acid sequence of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9; and (ii) a TCR V ^ amino acid sequence of a TCR V ^ ^V ^ amino acid sequence pair as set forth in Table 9. 213  14. The TCR, or variable domain thereof, of any one of claims 1-13, wherein the HLA presented peptide comprises an HPV16-peptide.

15. The TCR, or variable domain thereof, of claim 14, comprising: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 133, 149, 165, 181, 197, and 213; and / or (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 141, 157, 173, 189, 205, and 221.

16. The TCR, or variable domain thereof, of claim 14 or claim 15, comprising: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 129-131-133; 145- 147-149; 161-163-165; 177-179-181; 193-195-197; and 209-211-213; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 137-139-141; 153- 155-157; 169-171-173; 185-187-189; 201-203-205; and 217-219-221.

17. The TCR, or variable domain thereof, of any one of claims 14-16, comprising: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 135, 151, 167, 183, 199, and 215; and / or (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 143, 159, 175, 191, 207, and 223.

18. The TCR, or variable domain thereof, of any one of claims 14-17, comprising: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 133, 149, 165, 181, 197, and 213; and 214  (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 141, 157, 173, 189, 205, and 221.

19. The TCR, or variable domain thereof, of any one of claims 14-18, comprising an ^CDR3 / ^CDR3 amino acid sequence pair at least 95% identical to an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 133 / 141, 149 / 157, 165 / 173, 181 / 189, 197 / 205, and 213 / 221.

20. The TCR, or variable domain thereof, of any one of claims 14-19, comprising an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 133 / 141, 149 / 157, 165 / 173, 181 / 189, 197 / 205, and 213 / 221.

21. The TCR, or variable domain thereof, of any one of claims 14-19, comprising: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 129-131-133; 145- 147-149; 161-163-165; 177-179-181; 193-195-197; and 209-211-213; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 137-139-141; 153- 155-157; 169-171-173; 185-187-189; 201-203-205; and 217-219-221.

22. The TCR, or variable domain thereof, of claim 21, comprising an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 129-131-133-137-139-141; 145-147-149-153-155-157; 161-163-165-169-171-173; 177-179-181-185-187-189; 193-195-197-201-203-205; and 209-211- 213-217-219-221.

23. The TCR, or variable domain thereof, of claim 22, comprising an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting 215  of SEQ ID NOs: 129-131-133-137-139-141; 145-147-149-153-155-157; 161-163-165-169-171- 173; 177-179-181-185-187-189; 193-195-197-201-203-205; and 209-211-213-217-219-221.

24. The TCR, or variable domain thereof, of any one of claims 14-19, comprising: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 135, 151, 167, 183, 199, and 215; and (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 143, 159, 175, 191, 207, and 223.

25. The TCR, or variable domain thereof, of claim 24, comprising a TCR V ^ ^V ^ amino acid sequence pair at least 95% identical to a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 135 / 143; 151 / 159; 167 / 175; 183 / 191; 199 / 207; and 215 / 223.

26. The TCR, or variable domain thereof, of claim 25, comprising a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 135 / 143; 151 / 159; 167 / 175; 183 / 191; 199 / 207; and 215 / 223.

27. The TCR, or variable domain thereof, of any one of claims 1-13, wherein the HLA presented peptide comprises a MART1-peptide.

28. The TCR, or variable domain thereof, of claim 27, comprising: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 965, 981, 997, 1013, 1029, 1045, 1061, 1077, 1093, 1109, and 1125; and / or (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 973, 989, 1005, 1021, 1037, 1053, 1069, 1085, 1101, 1117, and 1133.

29. The TCR, or variable domain thereof, of claim 27 or claim 28, comprising: 216  (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 961-963-965; 977- 979-981; 993-995-997; 1009-1011-1013; 1025-1027-1029; 1041-1043-1045; 1057-1059-1061; 1073-1075-1077; 1089-1091-1093; 1105-1107-1109; and 1121-1123-1125; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 969-971-973; 985- 987-989; 1001-1003-1005; 1017-1019-1021; 1033-1035-1037; 1049-1051-1053; 1065-1067- 1069; 1081-1083-1085; 1097-1099-1101; 1113-1115-1117; and 1129-1131-1133.

30. The TCR, or variable domain thereof, of any one of claims 27-29, comprising: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111, and 1127; and / or (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119, and 1135.

31. The TCR, or variable domain thereof, of any one of claims 27-30, comprising: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 965, 981, 997, 1013, 1029, 1045, 1061, 1077, 1093, 1109, and 1125; and (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 973, 989, 1005, 1021, 1037, 1053, 1069, 1085, 1101, 1117, and 1133.

32. The TCR, or variable domain thereof, of any one of claims 27-31, comprising an ^CDR3 / ^CDR3 amino acid sequence pair at least 95% identical to an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 965 / 973, 981 / 989, 997 / 1005, 1013 / 1021, 1029 / 1037, 1045 / 1053, 1061 / 1069, 1077 / 1085, 1093 / 1101, 1109 / 1117, and 1125 / 1133. 217  33. The TCR, or variable domain thereof, of any one of claims 27-32, comprising a ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 965 / 973, 981 / 989, 997 / 1005, 1013 / 1021, 1029 / 1037, 1045 / 1053, 1061 / 1069, 1077 / 1085, 1093 / 1101, 1109 / 1117, and 1125 / 1133.

34. The TCR, or variable domain thereof, of any one of claims 27-32, comprising: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 961-963-965; 977- 979-981; 993-995-997; 1009-1011-1013; 1025-1027-1029; 1041-1043-1045; 1057-1059-1061; 1073-1075-1077; 1089-1091-1093; 1105-1107-1109; and 1121-1123-1125; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 969-971-973; 985- 987-989; 1001-1003-1005; 1017-1019-1021; 1033-1035-1037; 1049-1051-1053; 1065-1067- 1069; 1081-1083-1085; 1097-1099-1101; 1113-1115-1117; and 1129-1131-1133.

35. The TCR, or variable domain thereof, of claim 34, comprising an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 961-963-965-969-971-973; 977-979-981-985-987-989; 993-995-997-1001-1003-1005; 1009-1011-1013-1017-1019-1021; 1025-1027-1029-1033-1035- 1037; 1041-1043-1045-1049-1051-1053; 1057-1059-1061-1065-1067-1069; 1073-1075-1077- 1081-1083-1085; 1089-1091-1093-1097-1099-1101; 1105-1107-1109-1113-1115-1117; and 1121-1123-1125-1129-1131-1133.

36. The TCR, or variable domain thereof, of claim 35, comprising an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 961-963-965-969-971-973; 977-979-981-985-987-989; 993-995-997-1001- 1003-1005; 1009-1011-1013-1017-1019-1021; 1025-1027-1029-1033-1035-1037; 1041-1043- 1045-1049-1051-1053; 1057-1059-1061-1065-1067-1069; 1073-1075-1077-1081-1083-1085; 1089-1091-1093-1097-1099-1101; 1105-1107-1109-1113-1115-1117; and 1121-1123-1125- 1129-1131-1133. 218  37. The TCR, or variable domain thereof, of any one of claims 27-36, comprising: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111, and 1127; and (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119, and 1135.

38. The TCR, or variable domain thereof, of claim 37, comprising a TCR V ^ ^V ^ amino acid sequence pair at least 95% identical to a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 967 / 975, 983 / 991, 999 / 1007, 1015 / 1023, 1031 / 1039, 1047 / 1055, 1063 / 1071, 1079 / 1087, 1095 / 1103, 1111 / 1119, and 1127 / 1135.

39. The TCR, or variable domain thereof, of claim 38, comprising a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 967 / 975, 983 / 991, 999 / 1007, 1015 / 1023, 1031 / 1039, 1047 / 1055, 1063 / 1071, 1079 / 1087, 1095 / 1103, 1111 / 1119, and 1127 / 1135.

40. The TCR, or variable domain thereof, of any one of claims 1-13, wherein the HLA presented peptide comprises a CMV-peptide.

41. The TCR, or variable domain thereof, of claim 40, comprising: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 21, 37, 53, 69, 85, 101, and 117; and / or (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 29, 45, 61, 77, 93, 109, and 125.

42. The TCR, or variable domain thereof, of claim 40 or claim 41, comprising: 219  (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 1-3-5; 17-19-21; 33-35-37; 49-51-53; 65-67-69; 81-83-85; 97-99-101; and 113-115-117; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 9-11-13; 25-27-29; 41-43-45; 57-59-61; 73-75-77; 89-91-93; 105-107-109; and 121-123-125.

43. The TCR, or variable domain thereof, of any one of claims 40-42, comprising: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 23, 39, 55, 71, 87, 103, and 119; and / or (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 15, 31, 47, 63, 79, 95, 111, and 127.

44. The TCR, or variable domain thereof, of any one of claims 40-43, comprising: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 21, 37, 53, 69, 85, 101, and 117; and (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 29, 45, 61, 77, 93, 109, and 125.

45. The TCR, or variable domain thereof, of any one of claims 40-44, comprising an ^CDR3 / ^CDR3 amino acid sequence pair at least 95% identical to an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 5 / 13, 21 / 29, 37 / 45, 53 / 61, 69 / 77, 85 / 93, 101 / 109, and 117 / 125.

46. The TCR, or variable domain thereof, of any one of claims 40-45, comprising an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 5 / 13, 21 / 29, 37 / 45, 53 / 61, 69 / 77, 85 / 93, 101 / 109, and 117 / 125. 220  47. The TCR, or variable domain thereof, of any one of claims 40-46, comprising: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 1-3-5; 17-19-21; 33-35-37; 49-51-53; 65-67-69; 81-83-85; 97-99-101; and 113-115-117; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 9-11-13; 25-27-29; 41-43-45; 57-59-61; 73-75-77; 89-91-93; 105-107-109; and 121-123-125.

48. The TCR, or variable domain thereof, of claim 47, comprising an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 1-3-5-9-11-13; 17-19-21-25-27-29; 33-35-37-41-43-45; 49-51-53-57-59-61; 65-67-69-73-75-77; 81-83-85-89-91-93; 97-99-101-105-107-109; and 113- 115-117-121-123-125.

49. The TCR, or variable domain thereof, of claim 48, comprising an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 1-3-5-9-11-13; 17-19-21-25-27-29; 33-35-37-41-43-45; 49-51-53-57-59-61; 65- 67-69-73-75-77; 81-83-85-89-91-93; 97-99-101-105-107-109; and 113-115-117-121-123-125.

50. The TCR, or variable domain thereof, of any one of claims 40-45, comprising: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 23, 39, 55, 71, 87, 103, and 119; and (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 15, 31, 47, 63, 79, 95, 111, and 127. 221  51. The TCR, or variable domain thereof, of claim 50, comprising a TCR V ^ ^V ^ amino acid sequence pair at least 95% identical to a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 7 / 15, 23 / 31, 39 / 47, 55 / 63, 71 / 79, 87 / 95, 103 / 111, and 119 / 127.

52. The TCR, or variable domain thereof, of claim 51, comprising a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 7 / 15, 23 / 31, 39 / 47, 55 / 63, 71 / 79, 87 / 95, 103 / 111, and 119 / 127.

53. The TCR, or variable domain thereof, of any one of claims 1-13, wherein the HLA presented peptide comprises an EBV-peptide.

54. The TCR, or variable domain thereof, of claim 53, comprising: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 229, 245, 261, 277, 293, 309, 325, 341, 357, 373, 389, 405, and 421; and / or (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413, and 429.

55. The TCR, or variable domain thereof, of claim 53 or claim 54, comprising: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 225-227-229; 241- 243-245; 257-259-261; 273-275-277; 289-291-293; 305-307-309; 321-323-325; 337-339-341; 353-355-357; 369-371-373; 385-387-389; 401-403-405; and 417-419-421; and / or (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 233-235-237; 249- 251-253; 265-267-269; 281-283-285; 297-299-301; 313-315-317; 329-331-333; 345-347-349; 361-363-365; 377-379-381; 393-395-397; 409-411-413; 425-427-429.

56. The TCR, or variable domain thereof, of any one of claims 53-55, comprising: 222  (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407, and 423; and / or (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415, and 431.

57. The TCR, or variable domain thereof, of any one of claims 53-56, comprising: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 229, 245, 261, 277, 293, 309, 325, 341, 357, 373, 389, 405, and 421; and (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413, and 429.

58. The TCR, or variable domain thereof, of any one of claims 53-57, comprising an ^CDR3 / ^CDR3 amino acid sequence pair at least 95% identical to an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 229 / 237, 245 / 253, 261 / 269, 277 / 285, 293 / 301, 309 / 317, 325 / 333, 341 / 349, 357 / 365, 373 / 381, 389 / 397, 405 / 413, and 421 / 429.

59. The TCR, or variable domain thereof, of any one of claims 53-58, comprising an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 229 / 237, 245 / 253, 261 / 269, 277 / 285, 293 / 301, 309 / 317, 325 / 333, 341 / 349, 357 / 365, 373 / 381, 389 / 397, 405 / 413, and 421 / 429.

60. The TCR, or variable domain thereof, of any one of claims 53-59, comprising: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 225-227-229; 241- 243-245; 257-259-261; 273-275-277; 289-291-293; 305-307-309; 321-323-325; 337-339-341; 353-355-357; 369-371-373; 385-387-389; 401-403-405; and 417-419-421; and 223  (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 233-235-237; 249- 251-253; 265-267-269; 281-283-285; 297-299-301; 313-315-317; 329-331-333; 345-347-349; 361-363-365; 377-379-381; 393-395-397; 409-411-413; and 425-427-429.

61. The TCR, or variable domain thereof, of claim 60, comprising an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 225-227-229-233-235-237; 241-243-245-249-251-253; 257-259-261-265-267-269; 273-275-277-281-283-285; 289-291-293-297-299-301; 305-307- 309-313-315-317; 321-323-325-329-331-333; 337-339-341-345-347-349; 353-355-357-361- 363-365; 369-371-373-377-379-381; 385-387-389-393-395-397; 401-403-405-409-411-413; and 417-419-421-425-427-429.

62. The TCR, or variable domain thereof, of claim 61, comprising an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 225-227-229-233-235-237; 241-243-245-249-251-253; 257-259-261-265-267- 269; 273-275-277-281-283-285; 289-291-293-297-299-301; 305-307-309-313-315-317; 321- 323-325-329-331-333; 337-339-341-345-347-349; 353-355-357-361-363-365; 369-371-373- 377-379-381; 385-387-389-393-395-397; 401-403-405-409-411-413; and 417-419-421-425-427- 429.

63. The TCR, or variable domain thereof, of any one of claims 53-58, comprising: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407, and 423; and (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415, and 431. 224  64. The TCR, or variable domain thereof, of claim 63, comprising a TCR V ^ ^V ^ amino acid sequence pair at least 95% identical to a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 231 / 239, 247 / 255, 263 / 271, 279 / 287, 295 / 303, 311 / 319, 327 / 335, 343 / 351, 359 / 367, 375 / 383, 391 / 399, 407 / 415, and 423 / 431.

65. The TCR, or variable domain thereof, of claim 64, comprising a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 231 / 239, 247 / 255, 263 / 271, 279 / 287, 295 / 303, 311 / 319, 327 / 335, 343 / 351, 359 / 367, 375 / 383, 391 / 399, 407 / 415, and 423 / 431.

66. The TCR, or variable domain thereof, of any one of claims 1-13, wherein the HLA presented peptide comprises an influenza-peptide.

67. The TCR, or variable domain thereof, of claim 66, comprising: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 437, 453, 469, 485, 501, 517, 533, 549, 565, 581, 597, 613, 629, 645, 661, 677, 693, 709, 725, 741, 757, 773, 789, 805, 821, 837, 853, 869, 885, 901, 917, 933, and 949; and / or (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 445, 461, 477, 493, 509, 525, 541, 557, 573, 589, 605, 621, 637, 653, 669, 685, 701, 717, 733, 749, 765, 781, 797, 813, 829, 845, 861, 877, 893, 909, 925, 941, and 957.

68. The TCR, or variable domain thereof, of claim 66 or claim 67, comprising: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 433-435-437; 449- 451-453; 465-467-469; 481-483-485; 497-499-501; 513-515-517; 529-531-533; 545-547-549; 561-563-565; 577-579-581; 593-595-597; 609-611-613; 625-627-629; 641-643-645; 657-659- 661; 673-675-677; 689-691-693; 705-707-709; 721-723-725; 737-739-741; 753-755-757; 769- 771-773; 785-787-789; 801-803-805; 817-819-821; 833-835-837; 849-851-853; 865-867-869; 881-883-885; 897-899-901; 913-915-917; 929-931-933; and 945-947-949; and / or 225  (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 441-443-445; 457- 459-461; 473-475-477; 489-491-493; 505-507-509; 521-523-525; 537-539-541; 553-555-557; 569-571-573; 585-587-589; 601-603-605; 617-619-621; 633-635-637; 649-651-653; 665-667- 669; 681-683-685; 697-699-701; 713-715-717; 729-731-733; 745-747-749; 761-763-765; 777- 779-781; 793-795-797; 809-811-813; 825-827-829; 841-843-845; 857-859-861; 873-875-877; 889-891-893; 905-907-909; 921-923-925; 937-939-941; and 953-955-957.

69. The TCR, or variable domain thereof, of any one of claims 66-68, comprising: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, and 951; and / or (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687, 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943, and 959.

70. The TCR, or variable domain thereof, of any one of claims 66-69, comprising: (i) an ^CDR3 amino acid sequence at least 95% identical to an ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 437, 453, 469, 485, 501, 517, 533, 549, 565, 581, 597, 613, 629, 645, 661, 677, 693, 709, 725, 741, 757, 773, 789, 805, 821, 837, 853, 869, 885, 901, 917, 933, and 949; and (ii) a ^CDR3 amino acid sequence at least 95% identical to a ^CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 445, 461, 477, 493, 509, 525, 541, 557, 573, 589, 605, 621, 637, 653, 669, 685, 701, 717, 733, 749, 765, 781, 797, 813, 829, 845, 861, 877, 893, 909, 925, 941, and 957.

71. The TCR, or variable domain thereof, of any one of claims 66-70, comprising an ^CDR3 / ^CDR3 amino acid sequence pair at least 95% identical to an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 437 / 445, 453 / 461, 226  469 / 477, 485 / 493, 501 / 509, 517 / 525, 533 / 541, 549 / 557, 565 / 573, 581 / 589, 597 / 605, 613 / 621, 629 / 637, 645 / 653, 661 / 669, 677 / 685, 693 / 701, 709 / 717, 725 / 733, 741 / 749, 757 / 765, 773 / 781, 789 / 797, 805 / 813, 821 / 829, 837 / 845, 853 / 861, 869 / 877, 885 / 893, 901 / 909, 917 / 925, 933 / 941, and 949 / 957.

72. The TCR, or variable domain thereof, of any one of claims 66-71, comprising an ^CDR3 / ^CDR3 amino acid sequence pair selected from the group consisting of SEQ ID NOs: 437 / 445, 453 / 461, 469 / 477, 485 / 493, 501 / 509, 517 / 525, 533 / 541, 549 / 557, 565 / 573, 581 / 589, 597 / 605, 613 / 621, 629 / 637, 645 / 653, 661 / 669, 677 / 685, 693 / 701, 709 / 717, 725 / 733, 741 / 749, 757 / 765, 773 / 781, 789 / 797, 805 / 813, 821 / 829, 837 / 845, 853 / 861, 869 / 877, 885 / 893, 901 / 909, 917 / 925, 933 / 941, and 949 / 957.

73. The TCR, or variable domain thereof, of any one of claims 66-71, comprising: (i) an ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 433-435-437; 449- 451-453; 465-467-469; 481-483-485; 497-499-501; 513-515-517; 529-531-533; 545-547-549; 561-563-565; 577-579-581; 593-595-597; 609-611-613; 625-627-629; 641-643-645; 657-659- 661; 673-675-677; 689-691-693; 705-707-709; 721-723-725; 737-739-741; 753-755-757; 769- 771-773; 785-787-789; 801-803-805; 817-819-821; 833-835-837; 849-851-853; 865-867-869; 881-883-885; 897-899-901; 913-915-917; 929-931-933; and 945-947-949; and (ii) a ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to a set of amino acid sequences selected from the group consisting of SEQ ID NOs: 441-443-445; 457- 459-461; 473-475-477; 489-491-493; 505-507-509; 521-523-525; 537-539-541; 553-555-557; 569-571-573; 585-587-589; 601-603-605; 617-619-621; 633-635-637; 649-651-653; 665-667- 669; 681-683-685; 697-699-701; 713-715-717; 729-731-733; 745-747-749; 761-763-765; 777- 779-781; 793-795-797; 809-811-813; 825-827-829; 841-843-845; 857-859-861; 873-875-877; 889-891-893; 905-907-909; 921-923-925; 937-939-941; and 953-955-957.

74. The TCR, or variable domain thereof, of claim 73, comprising an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences at least 95% identical to an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from 227  the group consisting of SEQ ID NOs: 433-435-437-441-443-445; 449-451-453-457-459-461; 465-467-469-473-475-477; 481-483-485-489-491-493; 497-499-501-505-507-509; 513-515- 517-521-523-525; 529-531-533-537-539-541; 545-547-549-553-555-557; 561-563-565-569- 571-573; 577-579-581-585-587-589; 593-595-597-601-603-605; 609-611-613-617-619-621; 625-627-629-633-635-637; 641-643-645-649-651-653; 657-659-661-665-667-669; 673-675- 677-681-683-685; 689-691-693-697-699-701; 705-707-709-713-715-717; 721-723-725-729- 731-733; 737-739-741-745-747-749; 753-755-757-761-763-765; 769-771-773-777-779-781; 785-787-789-793-795-797; 801-803-805-809-811-813; 817-819-821-825-827-829; 833-835- 837-841-843-845; 849-851-853-857-859-861; 865-867-869-873-875-877; 881-883-885-889- 891-893; 897-899-901-905-907-909; 913-915-917-921-923-925; 929-931-933-937-939-941; and 945-947-949-953-955-957.

75. The TCR, or variable domain thereof, of claim 74, comprising an ^CDR1- ^CDR2- ^CDR3- ^CDR1- ^CDR2- ^CDR3 set of amino acid sequences selected from the group consisting of SEQ ID NOs: 433-435-437-441-443-445; 449-451-453-457-459-461; 465-467-469-473-475- 477; 481-483-485-489-491-493; 497-499-501-505-507-509; 513-515-517-521-523-525; 529- 531-533-537-539-541; 545-547-549-553-555-557; 561-563-565-569-571-573; 577-579-581- 585-587-589; 593-595-597-601-603-605; 609-611-613-617-619-621; 625-627-629-633-635- 637; 641-643-645-649-651-653; 657-659-661-665-667-669; 673-675-677-681-683-685; 689- 691-693-697-699-701; 705-707-709-713-715-717; 721-723-725-729-731-733; 737-739-741- 745-747-749; 753-755-757-761-763-765; 769-771-773-777-779-781; 785-787-789-793-795- 797; 801-803-805-809-811-813; 817-819-821-825-827-829; 833-835-837-841-843-845; 849- 851-853-857-859-861; 865-867-869-873-875-877; 881-883-885-889-891-893; 897-899-901- 905-907-909; 913-915-917-921-923-925; 929-931-933-937-939-941; and 945-947-949-953-955- 957.

76. The TCR, or variable domain thereof, of any one of claims 66-71, comprising: (i) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, and 951; and 228  (ii) a TCR V ^ domain amino acid sequence at least 95% identical to a TCR V ^ domain amino acid sequence selected from the group consisting of SEQ ID NOs: 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687, 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943, and 959.

77. The TCR, or variable domain thereof, of claim 76, comprising a TCR V ^ ^V ^ amino acid sequence pair at least 95% identical to a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 439 / 447, 455 / 463, 471 / 479, 487 / 495, 503 / 511, 519 / 527, 535 / 543, 551 / 559, 567 / 575, 583 / 591, 599 / 607, 615 / 623, 631 / 639, 647 / 655, 663 / 671, 679 / 687, 695 / 703, 711 / 719, 727 / 735, 743 / 751, 759 / 767, 775 / 783, 791 / 799, 807 / 815, 823 / 831, 839 / 847, 855 / 863, 871 / 879, 887 / 895, 903 / 911, 919 / 927, 935 / 943, and 951 / 959.

78. The TCR, or variable domain thereof, of claim 77, comprising a TCR V ^ ^V ^ amino acid sequence pair selected from the group consisting of SEQ ID NOs: 439 / 447, 455 / 463, 471 / 479, 487 / 495, 503 / 511, 519 / 527, 535 / 543, 551 / 559, 567 / 575, 583 / 591, 599 / 607, 615 / 623, 631 / 639, 647 / 655, 663 / 671, 679 / 687, 695 / 703, 711 / 719, 727 / 735, 743 / 751, 759 / 767, 775 / 783, 791 / 799, 807 / 815, 823 / 831, 839 / 847, 855 / 863, 871 / 879, 887 / 895, 903 / 911, 919 / 927, 935 / 943, and 951 / 959.

79. A nucleic acid molecule comprising a sequence encoding the TCR, or variable domain thereof, of any one of claims 1-78.

80. A complex comprising: (a) a TCR, or variable domain thereof, of any one of claims 1-78; and (b) a moiety selected from the group consisting of: a ligand, a detectable moiety and a therapeutic moiety.

81. A cell comprising the TCR, or variable domain thereof, of any one of claims 1-78, optionally wherein the cell is a T cell. 229  82. A host cell comprising a nucleic acid comprising a sequence encoding the TCR, or variable domain thereof, of any one of claims 1-78.

83. A pharmaceutical composition comprising: (a) the TCR, or variable domain thereof, of any one of claims 1-78, the nucleic acid molecule of claim 79, the complex of claim 80, the cell of claim 81, or the host cell of claim 82; and (b) a pharmaceutically acceptable excipient.

84. The TCR, or variable domain thereof, of any one of claims 1-78, the nucleic acid molecule of claim 79, the complex of claim 80, the cell of claim 81, the host cell of claim 82, or the pharmaceutical composition of claim 83, for use in the treatment of a HPV16-, MART1-, CMV-, EBV-, or influenza-associated disease or disorder.

85. Use of the TCR, or variable domain thereof, of any one of claims 1-78, the nucleic acid molecule of claim 79, the complex of claim 80, the cell of claim 81, the host cell of claim 82, or the pharmaceutical composition of claim 83, in the manufacture of a medicament for the treatment of a HPV16-, MART1-, CMV-, EBV-, or influenza-associated disease or disorder.

86. A method of treating a HPV16-, MART1-, CMV-, EBV-, or influenza-associated disease or disorder, comprising administering to a subject in need the TCR, or variable domain thereof, of any one of claims 1-78, the nucleic acid molecule of claim 79, the complex of claim 80, the cell of claim 81, the host cell of claim 82, or the pharmaceutical composition of claim 83.

87. The use or method of any one of claims 84-86, wherein the HLA presented peptide is derived from a polypeptide selected from the group consisting of: CMV pp65, HPV16 E6-p1, HPV16 E6-p2, EBV BMLF1, EBV LMP2A, EBV YVL, Influenza M1, Influenza M2, and MART1.

88. A TCR, or variable domain thereof; a nucleic acid comprising a sequence encoding the TCR or variable domain thereof; a complex comprising the TCR or variable domain thereof and 230  one or more moieties, such as a ligand, a detectable moiety, or a therapeutic moiety; a cell presenting the TCR or variable domain thereof, a host cell comprising a nucleic acid encoding the TCR or variable domain thereof; and / or a pharmaceutical composition comprising the same as shown and described herein. 231