Methods and means for the treatment of chronic inflammatory and autoimmune disease

Abstract

The present disclosure relates to a pharmaceutical composition for targeting activated pathogenic T and / or NK cells in a patient with a chronic inflammatory or autoimmune disease. The pharmaceutical composition comprises a first molecule specifically recognizing CD7. The disclosure further describes kits comprising these pharmaceutical compositions. The disclosure further relates a method for targeting activated pathogenic T and / or NK cells in a chronic inflammatory or autoimmune disease in a patient.

Description

[0001] METHODS AND MEANS FOR THE TREATMENT OF CHRONIC INFLAMMATORY AND AUTOIMMUNE DISEASE Field of the Invention The invention relates to the field of immune system related diseases, in particular to novel means and methods for treating these diseases. More in particular the invention provides pharmaceutical compositions comprising an antibody specifically recognizing CD7 for the treatment of chronic inflammatory or autoimmune disease. Typically the invention finds applications in the field of systemic autoimmune diseases, especially systemic sclerosis or Sjögren’s syndrome. Background of the Invention Autoimmune diseases refer to the body's immune response to its own components to produce autoantibodies and / or T-lymphocytes against self-antigens, causing damage and dysfunction of its own tissues or cells. In some conditions pathology is mediated by direct binding of autoantibodies to tissue-restricted antigens, such as in myasthenia gravis, type I diabetes mellitus and autoimmune thyreoiditis. These conditions are termed organ-specific autoimmune diseases. In other conditions autoantibodies bind to antigens that are expressed in non-organ specific structures. The autoimmune responses occur in specific tissues or organs when antigens are abnormally expressed, for example because of infection or tissue or cellular stress, or where circulating immune cells and / or immune complexes accumulate. These are termed systemic autoimmune diseases such as systemic sclerosis (SSc), Sjögren’s syndrome (SS), rheumatoid arthritis (RA), (dermato)myositis (DM) and (systemic ) lupus erythematosus (SLE). Conventional treatments for autoimmune diseases involve administration of drugs which non- specifically suppress the immune response. Examples of such drugs are methotrexate, cyclophosphamide, Imuran (azathioprine) and cyclosporin A. Steroid compound such as prednisone and methylprednisilone are also employed in many instances. These drugs have variable efficacy against both organ-specific and systemic autoimmune diseases. Use of such drugs is limited by virtue of their toxic side effects and also because they induce quite generic immunosuppression in a patient receiving prolonged treatment with the drug, e.g. the normal protective immune response to pathogenic microorganisms is downregulated thereby increasing the risk of infections caused by these pathogens. A further drawback is that there is an increased risk that malignancies will develop in patients receiving prolonged global immunosuppression with certain generic immunosuppressive drugs. Systemic sclerosis (SSc), also known as scleroderma, is an autoimmune disease of unknown aetiology that is characterized by high morbidity and mortality (PMID: 34487318). SSc is a systemic autoimmune disease that is characterized by vasculopathy, inflammation and progressive fibrosis of skin and internal organs (1). Autoimmunity in SSc is directed against nuclear autoantigens, which can be aberrantly presented by endothelial cells and fibroblasts due to hypoxic stress and serve as antigenic targets (2). This is exemplified by the development of a dysregulated Raynaud’s phenomenon as the first and principal disease manifestation. T lymphocytes have been detected in SSc-affected tissues and multiple studies have suggested their potential involvement in the observed fibrosis and vasculopathy through the production of cytokines such as interleukin (IL)-4, IL-13, and IL-17 (3). Unexpectedly, a recent study showed a prominent role for cytotoxic T cells in mediating SSc skin pathology (4). Furthermore, an epigenetic study implicated natural killer (NK) and CD8+ T cells in SSc pathogenesis (5). In chronic inflammatory conditions, T cell activation is restricted to prevent unwarranted inflammatory side-effects. Activation of antigen-specific CD4+ T cells is regulated by professional antigen-presenting cells via major histocompatibility complex (MHC) class II-controlled processes. Regulatory mechanisms are less defined for cytotoxic T and NK cells because these depend on non- MHC class II receptors and these are expressed ubiquitously in inflamed tissue. In chronic infections and malignancies, activation of cytotoxic T and NK cells has been shown to be regulated by an interplay between co-stimulatory and inhibitory receptors (6). Animal models indicate that similar mechanisms may operate in cytotoxic autoimmunity (7). Still, the exact role of T cells in SSc pathogenesis is yet to be defined. On the one hand, genetic studies have proven that human leukocyte antigen genes (HLAs) corresponding to MHC class II confer susceptibility to SSc (8). On the other hand, treatment with the T cell directed drug cytotoxic T-lymphocyte–associated antigen 4 (CTLA-4) immunoglobulin (abatacept) has shown limited clinical efficacy (9). The inventors addressed this controversy and hypothesized that targeting specific co-stimulatory receptors on co-stimulatory molecule expressing cells may represent a selective and potentially safer therapeutic strategy for the treatment of SSc. The present invention seeks to mitigate the above-mentioned problems. Alternatively or additionally, the present invention seeks to provide pharmaceutical compositions and methods for the treatment of chronic inflammatory or autoimmune diseases, for example SSc and SS. Summary of the Invention The inventors of the present invention found that the T and NK cells with upregulated expression of co-stimulatory receptor CD7 are key immune cells driving the pathogenesis of SSc and therefore identified a potential target point for selective treatment. The inventors of the present invention analysed the co-stimulatory profile of the pathogenic cytotoxic immune cells in SSc skin with the aim to specifically block the activation of and / or eliminate these cells. It was surprisingly observed that there was a profound presence of activated cytotoxic T and NK cells that exhibit disease related up- regulation of the CD7 activating receptor, using in depth single-cell transcriptomic analysis of 109 SSc compared to 68 healthy skin biopsies confirmed by multiplex immunohistochemistry. the expression profile of known lymphocyte co-stimulatory receptors in skin was further examined, and further compared to that of healthy cells, showing a consistent and strong upregulation of CD7 on expanded cytotoxic NK cells and proliferating and cytotoxic T cell populations. CD7 upregulation was directly correlated to upregulation of proinflammatory, cytotoxic and profibrotic mediators in the same cells. A disease-relevant contribution of CD7 to pro-fibrotic manifestations was revealed using in vitro models of cytotoxicity and of leucocyte-induced fibroblast contraction. Treatment with compositions comprising anti-CD7 with and without immunotoxin (anti-CD7 and anti-CD7-IT) was investigated, and the result showed functional impairment or effective depletion (with anti-CD7 or anti-CD7-IT) of these subsets. Notably, significantly elimination of CD7+cell subsets in a SSc patient’s blood and skin was already observed one week after administration of pharmaceutical compositions of the present invention. Thus, according to the first aspect of the present invention, it is provided a pharmaceutical composition for targeting activated pathogenic T and / or NK cells in a patient with a chronic inflammatory or autoimmune disease. The pharmaceutical composition of the present invention comprises a first molecule specifically recognizing CD7. Preferably, the first molecule is an antibody, or a fragment of a derivative thereof. For example, the first molecule a monoclonal antibody. Preferably, the first molecule is a IgG2a antibody. For example, the first molecule is an anti-(human) CD7 murine lgG2a monoclonal antibody. Preferably, the first molecule comprises a combination of complementary determining region (CDR) sequences, wherein the CDR sequences comprises a CDR3 sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 17. More preferably, the CDR3 of the first molecule comprises or consists of the amino acid sequence of SEQ ID NO: 17. A preferred example of the first molecule according to the present invention is WT1. The pharmaceutical composition of the present invention may preferably further comprise a second molecule specifically recognizing CD3. Preferably, the second molecule is an antibody, or a fragment of a derivative thereof. For example, the second molecule a monoclonal antibody. Preferably, the second molecule is a IgG2b antibody. For example, the first molecule is an anti-(human)CD3 murine IgG2b monoclonal antibody. Preferably, the second molecule comprises a combination of complementary determining region (CDR) sequences, wherein the CDR sequences comprises a CDR3 sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 7. More preferably, the CDR3 of the second molecule comprises or consists of the amino acid sequence of SEQ ID NO: 7. A preferred example of the second molecule according to the present invention is SPV-T3a . Optionally, the activated pathogenic T and / or NK cells are selected from the group consisting of CD8 cytotoxic T cells, CD4 helper T cells, follicular helper T cells, proliferating T cells, and combinations thereof. For example, the pharmaceutical composition targets activated pathogenic T and / or NK cells by selective depletion of the activated pathogenic T and / or NK cells, or by membrane receptor inhibition, or by intracellular kinase inhibition. Preferably, the chronic inflammatory and autoimmune disease is systemic sclerosis or Sjögren’s syndrome. Preferably, the patient may show symptoms of vasculopathy, fibrosis and / or autoimmune inflammation. Preferably, the activated pathogenic T and / or NK cells comprise activated pathogenic T and / or NK cells in the patient’s blood and / or inflamed tissues. Preferably, the first molecule, or the second molecule, or both, is provided with at least one toxin moiety, preferably a recombinant A chain of ricin (rRTA), for example a recombinant A chain of ricin having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 21. More preferably, rRTA comprises or consists of the amino acid sequence of SEQ ID NO: 21. Preferably, the pharmaceutical composition of the present invention further comprises one or more excipients, carriers, buffer agents, stabilisers, tonicizing adjusting agents, preservatives, or preservatives or anti-oxidants. Preferably, the pharmaceutical composition of the present invention is administered by intravenous, cutaneous or subcutaneous injection. According to a second aspect of the present invention, it is provided a method targeting activated pathogenic T and / or NK cells in a chronic inflammatory or autoimmune disease in a patient. The method comprises administering to the patient an effective amount of a pharmaceutical composition of the present invention as described herein. According to a third aspect, the present invention provides a freeze-dried lyophilised form of the pharmaceutical composition of the present invention. The lyophilised composition may be suitable for reconstitution, e.g., with water or an aqueous solution to form the composition for use in the method of the present invention. According to a fourth aspect, the present invention provides a kit comprising: a container or housing; the container or housing having therein a composition of the present invention; and a label or insert with instructions for use of the composition in the method of treatment of the present invention. In some cases, the container or housing retains sterility, e.g., by means of a seal and / or air-tight closure. It will of course be appreciated that features described in relation to one aspect of the present invention may be incorporated into other aspects of the present invention. For example, the method of the invention may incorporate any of the features described with reference to the apparatus of the invention and vice versa. Description of the Figures Figure 1: Annotation of skin T and NK cell clusters from single cell RNA sequencing dataset GSE195452. A Unsupervised Uniform Manifold Approximation and Projection (UMAP) clustering of 7,187 cells detects 8 transcriptionally distinct cell clusters: tissue-resident memory T cells (Trm), cytotoxic T cells (CTLs), regulatory T cells (Tregs), hypofunctional tissue resident T cells (Thprm), naïve / central memory (Tncm), proliferating T cells (Tprolif) and NK cells (NK) and a cluster containing a mixture of MAIT, INKT CD8+T and γδT cells (T mix). B UMAP showing the cells belonging to healthy individuals (control) or patients (SSc) C Heatmap illustrating the top 5 differentially expressed genes in each distinguished cell cluster: Trm (CD69, ZFP36L2, CXCR4, IL7R), CTLs (GZMK, IFNG, CCL5, CCL4, CD8A), Tregs (CD4, FOXP3, CTLA4, IL2RA), Thprm (NR4A1, CD69, CXCR4, DUSP1), Tncm (TCF7, SELL, IL7R), Tprolif (MKI67), NK (NKG7, FCGR3A, FGFBP2, KLRD1, GZMB, PRF1) and Tmix (CD8A, CCL5, TRGC2, NKG7, GZMB, PRF1, FCGR3A, FGFBP2, KLRD1). D Heatmap demonstrating the top 10 upregulated genes in each of the 5 different clusters of isolated CD8+T cells; naïve (Tn): IL7R, Granzyme K+(GZK+): GZMK, IFNG, CCL4, Granzyme B+(GZB+): PRF1, GNLY, NKG7, GZMB, GZMZ, GZMH, exhausted (Tex): NR4A2, NR4A3, and proliferating (Tprolif): LASP1, TMPO, ANP32B. E UMAP representing positive (red) and negative (grey) gene expression of PDCD1 (PD-1) among CD8+T cell clusters. Figure 2: Single cell RNA sequencing analysis of dataset GSE138669. A Unsupervised Uniform Manifold Approximation and Projection (UMAP) clustering of 2,500 cells determines 7 transcriptionally distinct cell clusters: quiescent tissue resident T cells (Tqcm), cytotoxic T cells (CTLs), regulatory T cells (Tregs), hypofunctional tissue resident T cells (Thprm), naïve / central memory (Tncm), proliferating T cells (Tprolif) and NK cells (NK). UMAP displaying the cells belonging to healthy individuals (control) or patients (SSc) is depicted on the top of this panel. B Heatmap of the top 10 differentially expressed genes in each distinguished cell cluster: Tqcm (CD69, IL7R, TCF7, SELL, ANXA1), CTLs (CD8A, GZMK, GZMA,), Tregs (CD4, CD27, CTLA4, IL2RA), Thprm (NR4A1, DUSP1), Tncm (TCF7, IL7R), Tprolif (MKI67), NK (NKG7, FCGR3A, KLRD1, PRF1). C (left) Gene set enrichment analysis with Wiki pathways as reference dataset. Examples of the most significant pathways distinctive of each cluster are shown. Statistics..(right) Comparison of the enrichment scores of the overview of proinflammatory and profibrotic and lung fibrosis pathways in HD versus SSc skin T and NK cell clusters. Figure 3: A Frequencies of T and NK cell clusters in the skin of (n= 56) Healthy Donors (HD) compared to (n=97) patients with systemic sclerosis (SSc) (GSE195452). B Frequencies of T and NK cell clusters in the skin of (n= 9) HD compared to (n=12) patients with SSc (GSE138669). Abbreviations: tissue-resident memory T cells (Trm), cytotoxic T cells (CTLs), regulatory T cells (Tregs), hypofunctional tissue resident T cells (Thprm), naïve / central memory (Tncm), proliferating T cells (Tprolif), NK cells (NK), quiescent tissue- resident T cells (Tqcm). For both panels A and B, values are represented as variation in cell counts (in %) and statistics were performed with Wilcox-Test, corrected for multiple comparisons. Only the adjusted p-values (q) of the statistically significant comparisons are shown, *q<0.05, **q<0.01. C Representative multicolor immunofluorescence composite image of T helper CD3+CD8- (red), cytotoxic CD8+ (cyan), regulatory FOXP3+ (green) T cells and CD56+CD3- (yellow) NK cells in SSc affected skin. Abbreviations: hair follicle (HF), epidermis (E), blood vessel (BV). Scale 50 µm. D Immunofluorescence composite images of infiltrated cytotoxic CD8+ (cyan) T cells and CD56+CD3- (yellow) NK cells of the non-affected versus the affected skin from a representative SSc patient with early diffuse disease. E Percentages (%) of cytotoxic T (CD3+CD8+) and NK cells (CD56+CD3-) in matched non-affected versus affected SSc skin (n=24 SSc patients). Values are represented as % of CD8+ or CD56+ cells compared to all cells (DAPI+) present in each biopsy (excluding the rich in keratinocytes epidermis layer). Statistics were performed with non-parametric Wilconxon test, ***p<0.001. F (left) Gene set enrichment analysis of skin T and NK cell clusters with Wiki pathways as reference dataset. Examples of top pathways (p <0.001) represented by NK and CTL clusters are shown. Statistics were performed with Kolmogorov-Smirnov (KS) test. (right) Comparison of the enrichment scores of the “Overview of proinflammatory and profibrotic mediators” (q=0.025) and “Lung fibrosis” (q=0.0002) pathways in HD (green) versus SSc (red) skin T and NK cell clusters (here for GSE195452, Supp. Figure 2C for GSE138669). G (left) UMAP displaying 5 transcriptionally different CD8+ T cell clusters in skin of (n=56) HD and (n=97) SSc, n=977 cells. Based on the top differentially expressed genes, clusters were annotated as naïve (T naive), Granzyme K+ (GZMK+), Granzyme B+ (GZMB+), exhausted (Texh) and proliferating (Tprolif). (right) Cell frequency of CD8+ T cell clusters between HD and SSc. H Percentage of Granzyme B (GZMB) expressing CD8+ T cells in peripheral blood of (n=15) HD and (n=30) SSc. Values are represented as % of total live peripheral blood mononuclear cells, *p<0.05. Figure 4: CD7 upregulation associates with activation of cytotoxic T and NK cells in SSc affected skin and lungs. A 2-D dot plots comparing the gene expression of selected activating and inhibitory co- stimulatory receptors in Tprolif, CD8+GZMB+ and NK clusters between HD and SSc (circle size shows the percentage of cells expressing each gene and color intensity depicts average expression while numbers indicate average of normalized counts). B (top) UMAPs representing positive (red) and negative (grey) gene expression of CD7 among CD8+ T cells (left) and CD56+ NK cells (right). (bottom) Intensity of CD7 normalized gene expression between HD and SSc among CD8+ T cells (left) and CD56+ NK cells (right). C Scatter plot with gene expression values highlighting genes that are specifically enriched in skin T and NK cells of patients with SSc compared to HD. D Representative photos of CD7 immunohistochemistry (IHC) staining of the affected and non-affected skin biopsies from a SSc patient, accompanied by quantification of CD7 IHC scores (n=20). Non-parametric sign test, *p<0.05. E Immunofluorescence microscopy showing co-expression of CD7 with CD8+ T and CD56+ NK cells in early dSSc skin. A representative experiment is depicted in scale of 100 µm. F (left) UMAP displaying T and NK cells from control (healthy) (n=6) and SSc (n=7) lung tissues from patients with interstitial lung disease (GSE128169). (middle) Density plots showing gene expression density of CD7, NCAM1 (CD56), CD4 and CD8A. (Right) CD7 gene expression counts (normalized) between control and SSc lung T and NK cells (each dot represents the average CD7 expression per donor). Figure 5: CD3 and CD7 cell staining in SSc lesional versus non lesional skin of patients with systemic sclerosis. CD7 gene expression in skin immune and stromal cells is also depicted. A Representative images of CD3 immunohistochemistry (IHC) staining of the affected and non-affected skin biopsies from one SSc patient. Scale is 100 µm. B Quantification of CD3+ T cells in the affected vs non lesion SSc skin (n=20). Bars are mean ±SD. Non-parametric Wilconxon test, p=0.19. C In SSc affected skin large infiltration of CD7+ cells is found in perivascular areas while in matched non-affected skin, a smaller number of CD7+ cells is present around blood vessels. Scale is 100 µm. Here, representative images of one SSc patient with early diffuse disease are depicted. D 2-D dot plot comparing CD7 gene expression in skin immune and stromal cells. Cell cluster annotations were retrieved from metadata information as have been described in the single-cell RNA sequencing dataset GSE195452. Circle size shows the percentage of cells expressing CD7 and color intensity depicts average expression. Numbers indicate average of normalized counts. Figure 6: CD7 co-stimulation plays an essential role in T and NK cell cytotoxic and pro-fibrotic manifestations. A SECTM1 log normalized gene expression among skin immune and stromal cell subsets (GSE195452). Annotation of the depicted cell clusters were retrieved from Gur et al. (10). B Subgroup analysis of CD7 normalized gene expression among healthy individuals (HD), and systemic sclerosis (SSc) patients with early versus late limited cutaneous SSc (lSSc) or diffuse cutaneous (dSSc) disease. Early disease was defined as ≤3 years from initial diagnosis. One-way ANOVA with Tukey’s multiple comparisons test, *p<0.05, ***p<0.001 C (left) Scatter plot showing correlation of CD7 normalized gene expression with skin score. Each circle represents a single SSc patient. Spearman r=0.34, p=0.07. (right) Normalized CD7 gene expression between SSc patients with low versus high skin scores. The distinction between low and high skin score was as described previously (10). D Normalized CD7 gene expression between SSc patients that were treatment naïve or treated with immunosuppressive medication and between SSc patients with or without the presence of interstitial lung disease (ILD). E Percentage of CD8+CD7+ and CD8+CD7- T cells in peripheral blood of (n=15) HD and (n=30) SSc. Values are represented as % of total CD3+ T cells, *p<0.05. F Expression (Mean Fluorescence Intensity) of Granzyme B (GZMB) and percentage of IL-4+ / IL-13+ cells between HDs and SSc CD8+CD7+ T cells. Expression levels of GZMB are presented as mean fluorescence intensity (MFI) and values of IL-4+ / IL-13+ cells are represented as percentage of positive cells among the CD8+CD7+ T cell compartment. Student’s t-test, *p<0.05. G Cytolytic activity of T and NK cells in a co-culture with K562 target cells was quantified by measuring Lactate dehydrogenase (LDH) release of the target cells. T cells and NK cells were stimulated with anti-CD3 / CD28 and IL-2 / IL-15 respectively and anti-CD7 was added to block CD7 co-stimulation. Unstim refers to control cells that were not stimulated. Statistical comparisons between groups were performed with ordinary one-way ANOVA with Tukey’s multiple comparisons test *p<0.05, **p<0.01, ***p<0.001. H Pair-wise correlation plots between CD7 and XCL1, TGB1, OSM, MMP9 gene expression within the NK or cytotoxic T cell (CTLs) clusters in SSc affected skin (GSE195452). Figure 7: Pairwise correlations of CD7 with pro-fibrotic genes. The Wiki gene pathways lung fibrosis and pro-inflammatory and pro-fibrotic manifestations were merged and potential correlation of CD7 gene expression with the included genes was evaluated separately for the cluster of A cytotoxic T cells (CTLs) and B NK cells. Statistical significance for every comparison was corrected for multiple comparisons and is presented as adjusted p value, *p<0.05, **p<0.01. Figure 8: Targeted immunotoxin mediated depletion of activated CD7+T and NK cells prevents fibroblast contraction and decreases myofibroblast phenotype. A Flow cytometric quantification of CD3 / CD7-IT-induced cell death exhibiting absolute cell counts (cells / µl) of CD2+ T and CD56+ NK cells in PBMCs isolated from (n=5) SSc patients. B Percentage of normalized cell viability of CD3+ T and CD56+ NK cells isolated from SSc (n=3) PBMCs. C Flow cytometric quantification of CD3 / CD7-IT-induced cell death illustrating absolute cell counts (cells / µl) of CD8+GZMB+ T and CD56+GZMB+ NK cells in PBMCs isolated from (n=5) SSc patients. D Flow cytometric quantification of CD3 / CD7-IT-induced cell death towards CD8+ T and CD56+ NK cells in ex vivo skin explants (n=4). Paired t-test, *p<0.05, **p<0.01. E Schematic representation of our in vitro hydrogel collagen contraction assay in the developed 3D model with co-cultured primary skin fibroblasts and PBMCs. The level of contraction was quantified compared to no-cells control and plotted graphically on the right (n=3). Bars are mean ±SD. An image of a representative experiment is depicted on the bottom of this panel. F The percentage of pro-apoptotic cytotoxic T (CD8+7-AAD-Annexin V+) and NK (CD56+7-AAD-Annexin V+) cells in the depicted conditions was measured with flow cytometry of the enzymatically digested collagen plugs (n=5). G IgG or CD3.CD7-IT treated PBMCS were co-cultured with primary dermal fibroblasts in the developed 3D hydrogel collagen co-culture model and fibroblasts were analyzed for expression of genes reflective of a myofibroblast phenotype. Values represent relative gene expression (-ΔCt) as measured with qPCR. GAPDH and RPS27A were used as reference genes. Data represents mean ± SEM. Statistical comparisons between three or more groups were performed with ordinary one-way ANOVA with Tukey’s multiple comparisons test, *p<0.05, **p<0.01, ***p<0.001. Abbreviations: Phytohemagglutinin (PHA), Immunotoxin (IT), Peripheral blood mononuclear cells (PBMCs).Figure 9: CD3 / CD7-IT specifically eliminates only the activated cytotoxic T and NK cells in vitro. AConcentration of IL-2 (pg / ml) was measured in cell supernatant of cells with or without treatment with a-CD3 / CD7-IT B Pie charts illustrating the proportion of effector (CD8+CD45RA+CD27-), memory (CD8+CD45RA-CD27+) and naïve (CD8+CD45RA+CD27+) cells among the CD8+ T cell population in the depicted stimulation and treatment culture conditions (percentages in the pie charts are mean values of n=6 SSc patients). C Response to TCR mediated (PHA) restimulation of cells treated with a-CD3 / CD7- IT was evaluated by intracellular flow cytometry. Values are represented as fold change of the re- stimulated compared to the values before stimulation. D (Bottom) Comparison of absolute counts (cells / µl) of CD19+ B cells after in-vitro treatment with CD3 / CD7-IT compared to non-treated peripheral blood mononuclear cells (n=6). (top) Representative flow cytometry plots of one experiment. E Normalized cell viability, of M2 macrophages and CD19+ B cells that were isolated from SSc patients’ blood for the depicted different culture / treatment conditions. Cycloheximide was used a positive control. F Flow cytometric histograms of one representative experiment exhibiting elevated expression of CD3 and CD7 in CD8+GZMB+ cells and CD7 in CD56+GZMB+ NK cells upon stimulation with phytohemagglutinin (PHA) that is further quantified in G. CD3 and CD7 expression is presented as mean fluorescence intensity (MFI). Statistics were performed with Student’s t-test, **p<0.01, ****p<0.0001 H The percentage of necrotic cytotoxic T (CD8+7-AAD+Annexin V+) and NK (CD56+7- AAD+Annexin V+) cells in the depicted conditions was measured with flow cytometry of the enzymatically digested collagen plugs (n=5). Figure 10. Treatment with a-CD3 / CD7-IT depletes cytotoxic T and NK cells in an early dSSc patient’s blood and skin. Percentage of A CD3+ T and CD56+ NK cells B CD4+ T and CD8+ T cells C CD8+Perforin+ T and CD56+Perforin+ NK cells in SSc patient’s peripheral blood before and after treatment with a- CD3 / CD7-IT. Values are represented as % of total live peripheral blood mononuclear cells (PBMCs). B (right) Ratio of CD4+ / CD8+ T cells before and after treatment. D Representative immunofluorescent images and E quantification of lymphocyte subsets in the patient’s affected skin before versus after treatment. Figure 11. SECTM1-CD7 axis in activation of cytotoxic T and NK cells in SSc affected skin. A Schematic model for the proposed involvement of SECTM1-CD7 axis in cytotoxic T and NK cell activation (Created with BioRender.com). In SSc affected skin, CD7 and IFNG is predominantly expressed in cytotoxic T and NK cells while SECTM1 and IFNGR in antigen presenting cells (APCs) and stromal cells (mainly fibroblasts). This suggests a cytokine-mediated positive feedback loop in the communication between CD7+ cytotoxic immune cells and SECTM1 producing APCs and fibroblasts, with IFN-γ being a key cytokine. B 2-D dot plots comparing expression levels of selected genes in skin immune (myeloid and lymphoid) and stromal cell populations. Cell cluster annotations were retrieved from metadata information as have been described in the single-cell RNA sequencing dataset GSE195452. Circle size shows the percentage of cells expressing each gene and color intensity depicts average expression. Numbers indicate average of normalized counts. C Pair-wise correlation plots in SSc affected skin (GSE195452) show a positive correlation between CD7 / IFNG and SECTM1 / IFNGR1. Abbreviations; TCR: T cell receptor, NKR: NK cell receptor, MHC: major histocompatibility complex, APC: antigen-presenting cell. Figure 12. Fibroblasts co-cultured with CD7+ T and NK cells exhibit increased contractility that is accompanied by an elevated myofibroblast-like phenotype. A Schematic representation of the experimental design in the developed 3D in-vitro collagen contraction fibroblast : immune cell co- culture model. B Flow cytometry gating strategy that was used to sort CD7+ versus CD7- T and NK cell populations from healthy peripheral blood (n=3). First, we gated on the lymphoid cell population based on cell size (FSC) and granularity (SSC). Followingly, we excluded dead cells based on 7-AAD+ staining and we then sorted CD19-CD14- lymphoid cells that were either positive or negative for CD7 expression. C The level of fibroblast contraction was quantified compared to no-cells control and plotted graphically (n=3). Bars are mean ±SD. An image of a representative experiment is depicted on the right part of this panel. D (left) Representative images of Collagen type 1 immunohistochemistry of the collagen plugs that contained only fibroblasts or fibroblasts co-cultured with CD7+ T and NK cells. (right) Quantification of Collagen type 1 positive fibroblasts in control versus fibroblasts that were co-cultured with either CD7- or CD7+ cells (n=3). Bars are mean ±SD. E The percentage of CD45-a-SMA+IL-6+ fibroblasts in the depicted conditions was measured with flow cytometry of the enzymatically digested collagen plugs (n=3). F Expression levels (mean fluorescence intensity-MFI) of a-SMA in CD45-a-SMA+ fibroblasts in the depicted conditions was measured with flow cytometry of the enzymatically digested collagen plugs (n=3). (right) Flow cytometry histograms of one representative experiment exhibiting increased expression of a-SMA in fibroblasts co-cultured with CD7+ compared to CD7- T and NK cells is shown. G CD7+ versus CD7- T and NK cells (n=3) were co-cultured with primary dermal fibroblasts in the developed 3D hydrogel collagen co-culture model and fibroblasts were analyzed for expression of genes reflective of a myofibroblast phenotype such as COL1A1 and ACTA2. Values represent relative gene expression (-ΔCt) as measured with qPCR. GAPDH and RPS27A were used as reference genes. Data represents mean ± SEM. Detailed description of the invention A pharmaceutical composition is defined herein as any composition which can be administered to an individual, be it as one single dose or as a regimen of doses by any viable route, preferably by intravenous administration, optionally containing usual vehicles for administration and / or components of regular treatment of the relevant chronic inflammatory or autoimmune disease. For example, the pharmaceutical composition of the present invention is capable of eliminating or reducing the number of unwanted CD7 positive cells. Unwanted cells are any cells that comprise CD7 (and of course many other) molecules associated with the cell surface, which cells are involved in a pathological condition in an individual. Typically these cells are T-cells or NK-cells or other cells playing a role in chronic inflammatory or autoimmune diseases. Also aberrant cells (T cell leukemias or lymphomas for instance) comprising CD7 can be eliminated or suppressed according to the invention. The pharmaceutical composition of the present invention comprises a first molecule specifically recognizing CD7. Optionally, the pharmaceutical composition of the present invention further comprises a second molecule specifically recognizing CD3. Additionally or alternatively, the pharmaceutical compositions according to the invention may further comprise at least one further molecule specifically recognizing CD5, CD2, CD4, CD8 or an IL-2 receptor. A molecule specifically recognizing CD3 / CD7 or another ligand-receptor, for example another cell- surface antigen, is a term well understood in the art. It means any molecule having a relatively high binding affinity and specificity for CD3, CD7 or other receptors, for example cell surface antigens. In the context of the present invention, CD3, CD7 and any other cell surface antigens mentioned herein are human antigens. It may typically be a ligand for a receptor or an antibody for either CD3, CD7 or another receptor (receptor is defined as any molecule capable of a specific interaction), which antibody may be truncated or humanized or altered in any other way without losing its specificity (such alterations are herein defined as derivatives and / or fragments). Preferably, one or more of the first molecule, the second molecule, and the further molecules according to the present invention is an antibody, or a fragment of a derivative thereof. As used herein with reference to all aspects of the invention, the term "antibody" or "antibody molecule" includes any immunoglobulin whether natural or partly or wholly synthetically produced. The term "antibody" or "antibody molecule" includes monoclonal antibodies (mAb) and polyclonal antibodies (including polyclonal antisera). Antibodies may be intact or fragments derived from full antibodies (see below). Antibodies may be human antibodies, humanised antibodies or antibodies of non-human origin. "Monoclonal antibodies" are homogeneous, highly specific antibody populations directed against a single antigenic site or “determinant” of the target molecule. “Polyclonal antibodies” include heterogeneous antibody populations that are directed against different antigenic determinants of the target molecule. The term “antiserum” or "antisera" refers to blood serum containing antibodies obtained from immunized animals. It has been shown that fragments of a whole antibody can perform the function of binding antigens. Thus reference to antibody herein, and with reference to the methods, arrays and kits of the invention covers a full antibody and also covers any polypeptide or protein comprising an antibody binding fragment. Examples of binding fragments are (i) the Fab fragment consisting of VL, VH, CL and CH1 domains; (ii) the Fd fragment consisting of the VH and CH1 domains; (iii) the Fv fragment consisting of the VL and VH domains of a single antibody; (iv) the dAb fragment which consists of a VH domain; (v) isolated CDR regions; (vi) F(ab')2 fragments, a bivalent fragment comprising two linked Fab fragments (vii) single chain Fv molecules (scFv), wherein a VH domain and a VL domain are linked by a peptide linker which allows the two domains to associate to form an antigen binding site; (viii) bispecific single chain Fv dimers (WO 93 / 11161) and (ix) "diabodies", multivalent or multispecific fragments constructed by gene fusion (WO94 / 13804; 58). Fv, scFv or diabody molecules may be stabilised by the incorporation of disulphide bridges linking the VH and VL domains. Minibodies comprising a scFv joined to a CH3 domain may also be made. As used herein, antibody molecule and immunotoxin are intended to encompass recombinant antibodies and recombinant immunotoxins, respectively (e.g., Fab, scFv or SC mAb linked through a cleavable peptide linker to a recombinant ribosomal inhibiting protein). Additionally or alternatively, the first and second antibody molecules may be provided as a single bispecific (anti-CD3 / anti-CD7) antibody, thereby providing a bispecific immunotoxin such as anti-CD3 / CD7-rRTA. In relation to an antibody molecule, the term "selectively binds" may be used herein to refer to the situation in which one member of a specific binding pair will not show any significant binding to molecules other than its specific binding partner(s). The term is also applicable where e.g. an antigen- binding site is specific for a particular epitope that is carried by a number of antigens, in which case the specific binding member carrying the antigen-binding site will be able to bind to the various antigens carrying the epitope. Preferably, when the first molecule is an antibody, it is a monoclonal antibody, for example a murine monoclonal antibody. In a preferred embodiment, the first molecule comprises a combination of complementary determining regions (CDR). The CDR sequences comprises a CDR3 sequence having at least 95, 96, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO: 17 (ARWAYFYGSSPYFFDY). Most preferably, the CDR3 sequence comprises or consists of the amino acid sequence of SEQ ID NO: 17. Optionally, the CDR sequences further comprises a CDR1 sequence having at least 95, 96, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO: 15 (GYTFTNYG). Preferably, the CDR1 sequence comprises or consists of the amino acid sequence of SEQ ID NO: 15. The CDR sequences may further comprises a CDR2 sequence having at least 95, 96, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO: 16 (INTYTGEP). Preferably, the CDR2 sequence comprises or consists of the amino acid sequence of SEQ ID NO: 16. “Sequence identity” and “sequence similarity” can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar lengths are preferably aligned using global alignment algorithms (e.g. Needleman Wunsch) which align the sequences optimally over the entire length, while sequences of substantially different lengths are preferably aligned using local alignment algorithms (e.g. Smith Waterman). Sequences may then be referred to as "substantially identical” or “essentially similar” when they (when optimally aligned by for example the programs GAP or BESTFIT using default parameters) share at least a certain minimal percentage of sequence identity (as defined below). GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length (full length), maximizing the number of matches and minimizing the number of gaps. A global alignment is suitably used to determine sequence identity when the two sequences have similar lengths. Generally, the GAP default parameters are used, with a gap creation penalty = 50 (nucleotides) / 8 (proteins) and gap extension penalty = 3 (nucleotides) / 2 (proteins). For nucleotides the default scoring matrix used is nwsgapdna and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignments and scores for percentage sequence identity may be determined using computer programs, such as the GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or using open source software, such as the program “needle” (using the global Needleman Wunsch algorithm) or “water” (using the local Smith Waterman algorithm) in EmbossWIN version 2.10.0, using the same parameters as for GAP above, or using the default settings (both for ‘needle’ and for ‘water’ and both for protein and for DNA alignments, the default Gap opening penalty is 10.0 and the default gap extension penalty is 0.5; default scoring matrices are Blossum62 for proteins and DNAFull for DNA). When sequences have a substantially different overall length, local alignments, such as those using the Smith Waterman algorithm, are preferred. Alternatively, percentage similarity or identity may be determined by searching against public databases, using algorithms such as FASTA, BLAST, etc. Thus, the nucleic acid and protein sequences of the present invention can further be used as a “query sequence” to perform a search against public databases to, for example, identify other family members or related sequences. Such searches can be performed using the BLASTn and BLASTx programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403—10. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to oxidoreductase nucleic acid molecules of the invention. BLAST protein searches can be performed with the BLASTx program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res.25(17): 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTx and BLASTn) can be used. See the homepage of the National Center for Biotechnology Information at http: / / www.ncbi.nlm.nih.gov / . Optionally, the first molecule is selected from the group consisting of: - WT1, murine IgG2a (WO9948534A1), - TXU-7 murine IgG1 (CA2292426A1) - RFT2, murine IgG2a (Kirkham et al 1988) - CHT2, SDZCHH380, murine IgG2a (Heinrich et al 1989, Lazarovits et al 1993) - FITC-S9.1, murine IgG2b (Fishwild et al 1992) - 3A1e, murine IgG2b (Vallera et al 1996); and - HB2, murine IgG1 (Flavel et al 2001). Preferably, the first molecule is a monoclonal IgG2a antibody. In some embodiments, the first molecule may comprise a VH domain having at least 95, 96, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO: 13 and / or the a VL domain having at least 95, 96, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO: 14. In certain embodiments, the first molecule may be the WT1 antibody having the heavy chain of SEQ ID NO: 11 and light chain of SEQ ID NO: 12. WT1 WT1 (INN grisnilimab) is a murine IgG2a monoclonal antibody that selectively binds human CD7 (UniProt: P09564), a transmembrane protein which is a member of the immunoglobulin superfamily and is found on thymocytes and mature T cells. WT1 and the production and characterization thereof are described in EP 0945139 A1, Tax et al., Monoclonal antibodies against human thymocytes and T lymphocytes.Protides of the biological fluids, 29th Colloquium, 1981, edited by Peeters H, Pergamon Press, Oxford and New York, 1982, Tax et al., Hamatol Bluttransfus, 1983, Vol. 28, pp. 139-141, and Tax et al., Clin Exp Immunol, 1984, Vol.55, pp.427-436 (the entire contents of all of them are expressly incorporated herein by reference). WT1 is commercially available. For example, the anti-CD7 antibody (clone WT1) is sold by LifeSpan BioSciences, Inc. under catalogue number: LS-C1228851000 (1000µl in PBS, 0.1% sodium azide) for research use, e.g., immunofluorescence and immunohistochemistry. WT1 has a monomer molecular weight of approximately 150 kDa, consisting of two heavy-chains of approximately 50 kDa, and two lambda light-chains of approximately 25 kDa. The amino acid sequence of the WT1 light chain and heavy chain were determined by extracting mRNA from hybridoma cell pellets, RT-PCR was performed and DNA sequenced on an ABI3130x1 Genetic Analyzer. Amino acid sequences were predicted and were corroborated by Mass Spectrometry analysis. The complementarity determining regions (CDRs) are as determined according to the IMGT numbering system (Lefranc, M.-P. et al., Nucleic Acids Research, 1999, Vol.27, pp.209-212, incorporated herein by reference). The amino acid sequences of WT1 heavy chain and light chain, respectively, are shown below. WT1 Heavy Chain: 1 QIQLVQSGPE LKKPGETVKI SCKASGYTFT NYGMNWVKQA PGKGLMWLGW 51 INTYTGEPTY ADDFKGRFAF SLETSASTAY LQINNLKNED TATYFCARWA 101 YFYGSSPYFF DYWGQGTTLT VSSAKTTAPS VYPLAPVCGD TTGSSVTLGC 151 LVKGYFPEPV TLTWNSGSLS SGVHTFPAVL QSDLYTLSSS VTVTSSTWPS 201 QSITCNVAHP ASSTKVDKKI EPRGPTIKPC PPCKCPAPNL LGGPSVFIFP 251 PKIKDVLMIS LSPIVTCVVV DVSEDDPDVQ ISWFVNNVEV HTAQTQTHRE 301 DYNSTLRVVS ALPIQHQDWM SGKEFKCKVN NKDLPAPIER TISKPKGSVR 351 APQVYVLPPP EEEMTKKQVT LTCMVTDFMP EDIYVEWTNN GKTELNYKNT 401 EPVLDSDGSY FMYSKLRVEK KNWVERNSYS CSVVHEGLHN HHTTKSFSRT 451 PGK (SEQ ID NO: 11) VH domain is underlined; CDRH1-H3 are shown in bold and curved underlined. 51 GGTNNRAPGV PARFSGSLIG DKAALTITGA QTEDEAIYFC ALWCSNHLVF 101 GGGTKLTVLG QPKSSPSVTL FPPSSEELET NKATLVCTIT DFYPGVVTVD 151 WKVDGTPVTQ GMETTQPSKQ SNNKYMASSY LTLTARAWER HSSYSCQVTH 201 EGHTVEKSLS RADCS (SEQ ID NO: 12) VL domain is underlined; CDRL1-L3 are shown in bold and curved underlined. WT1-VH: 1 QIQLVQSGPE LKKPGETVKI SCKASGYTFT NYGMNWVKQA PGKGLMWLGW 51 INTYTGEPTY ADDFKGRFAF SLETSASTAY LQINNLKNED TATYFCARWA 101 YFYGSSPYFF DYWGQGTTLT VSS (SEQ ID NO: 13) WT1-VL: 1 QAVVTQESAL TTSPGETVTL TCRSSTGAVT TSNYANWVQE KPDHLFTGLI 51 GGTNNRAPGV PARFSGSLIG DKAALTITGA QTEDEAIYFC ALWCSNHLVF 101 GGGTKLTVL (SEQ ID NO: 14) WT1-CDRH1: GYTFTNYG (SEQ ID NO: 15) WT1-CDRH2: INTYTGEP (SEQ ID NO: 16) WT1-CDRH3: ARWAYFYGSSPYFFDY (SEQ ID NO: 17) WT1-CDRL1: TGAVTTSNY (SEQ ID NO: 18) WT1-CDRL2: GTN (SEQ ID NO: 19) WT1-CDRL3: ALWCSNHLV (SEQ ID NO: 20) The pharmaceutical formulation of the present invention may, optionally or preferably, comprises a second molecule specifically recognizing CD3. Preferably, when the second molecule is an antibody, it is a monoclonal antibody, for example a murine monoclonal antibody. In some embodiments of the present invention, the second molecule is a IgG2b antibody, because this antibody does not fix human complement or bind human Fc-receptors and, thereby, does not induce cytokine release by the targeted T and / or NK cells. In some embodiments, the second molecule is a murine antibody. For example, the second molecule is an anti-(human) CD3 murine IgG 2b monoclonal antibody. In a preferred embodiment, the second molecule comprises a combination of complementary determining regions (CDR). The CDR sequences comprises a CDR3 sequence having at least 95, 96, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO: 7 (ARGSRYDYYGMDY). Most preferably, the CDR3 sequence comprises or consists of the amino acid sequence of SEQ ID NO: 7. Optionally, the CDR sequences further comprises a CDR1 sequence having at least 95, 96, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO: 5 (GYTFTSYT). Preferably, the CDR1 sequence comprises or consists of the amino acid sequence of SEQ ID NO: 15. The CDR sequences may further comprises a CDR2 sequence having at least 95, 96, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO: 6 (INPSSGYT). Preferably, the CDR2 sequence comprises or consists of the amino acid sequence of SEQ ID NO: 6. Optionally, the first molecule is selected from the group consisting of: - SPV-T3a, murine IgG2b (Spits et al 1983) - hOKT3γ4, humanized IgG4 (Richards et al 1999) - Visilizumab, humanized IgG2 Fc-modified (Carpenter et al 2002) - Teplizumab, humanized, Fc-modified (Herald et al 2019) - Otelixizumab, humanized, Fc-modified (Keymeulen et al 2020) In some embodiments, the first molecule may comprise a VH domain having at least 95, 96, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO: 3 and / or the a VL domain having at least 95, 96, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO: 4. In certain embodiments, the second molecule may be the SPV-T3a antibody having the heavy chain of SEQ ID NO: 1 and light chain of SEQ ID NO: 2. SPV-T3a SPV-T3a (INN dafsolimab) is a murine IgG2b monoclonal antibody that selectively binds human CD3, a T cell surface glycoprotein composed of a CD3γ chain (UniProt: P09693), a CD3δ chain (UniProt: P04234), and two CD3ε chains (UniProt: P07766). SPV-T3a and the production and characterization thereof are described in EP 0945139 A1 and Spits et al., Hybridoma, 1983, Vol. 2, pp. 423-437 (the entire content of both of them is expressly incorporated herein by reference). SPV-T3a with a monomer molecular weight of approximately 150 kDa, consisting of two heavy-chains of approximately 50 kDa, and two kappa light-chains of approximately 25 kDa. The amino acid sequence of the SPV-T3a light chain and heavy chain were determined by extracting mRNA from hybridoma cell pellets, RT-PCR was performed and DNA sequenced on an ABI3130x1 Genetic Analyzer. Amino acid sequences were predicted and were corroborated by Mass Spectrometry analysis. The complementarity determining regions (CDRs) are as determined according to the IMGT numbering system (Lefranc, M.-P. et al., Nucleic Acids Research, 1999, Vol.27, pp.209-212, incorporated herein by reference). The amino acid sequences of SPV-T3a heavy chain and light chain, respectively, are shown below. SPV-T3a Heavy Chain: 1 QVQLQQSGAE LARPGASVKM SCKASGYTFT SYTMHWVKQR PGQGLEWIGY 51 INPSSGYTNY IQRFKDKATL TADKSSSTAY MQVSSLTSED SAVYYCARGS 101 RYDYYGMDYW GQGTSVTVSS AKTTPPSVYP LAPGCGDTTG SSVTLGCLVK 151 GYFPESVTVT WNSGSLSSSV HTFPALLQSG LYTMSSSVTV PSSTWPSQTV 201 TCSVAHPASS TTVDKKLEPS GPISTINPCP PCKECHKCPA PNLEGGPSVF 251 IFPPNIKDVL MISLTPKVTC VVVDVSEDDP DVQISWFVNN VEVHTAQTQT 301 HREDYNSTIR VVSTLPIQHQ DWMSGKEFKC KVNNKDLPSP IERTISKIKG 351 LVRAPQVYIL PPPAEQLSRK DVSLTCLVVG FNPGDISVEW TSNGHTEENY 401 KDTAPVLDSD GSYFIYSKLN MKTSKWEKTD SFSCNVRHEG LKNYYLKKTI 451 SRSPGK (SEQ ID NO: 1) VH domain is underlined; CDRH1-H3 are shown in bold and curved underlined. SPV-T3a Light Chain: 1 QIVLTQSPAI MSASPGEKVT MTCSASSSVS YMHWYQQKSG TSPKRWIYDT 51 SKLASGVPAR FSGSGSGTSY SLTISSMEAE DAATYYCQQW SSNPLTFGAG 101 TKLELKRADA APTVSIFPPS SEQLTSGGAS VVCFLNNFYP KDINVKWKID 151 GSERQNGVLN SWTDQDSKDS TYSMSSTLTL TKDEYERHNS YTCEATHKTS 201 TSPIVKSFNR NEC (SEQ ID NO: 2) VL domain is underlined; CDRL1-L3 are shown in bold and curved underlined. SPV-T3a-VH: 1 QVQLQQSGAE LARPGASVKM SCKASGYTFT SYTMHWVKQR PGQGLEWIGY 51 INPSSGYTNY IQRFKDKATL TADKSSSTAY MQVSSLTSED SAVYYCARGS 101 RYDYYGMDYW GQGTSVTVSS (SEQ ID NO: 3) SPV-T3a-VL: 1 QIVLTQSPAI MSASPGEKVT MTCSASSSVS YMHWYQQKSG TSPKRWIYDT 51 SKLASGVPAR FSGSGSGTSY SLTISSMEAE DAATYYCQQW SSNPLTFGAG 101 TKLELKR (SEQ ID NO: 4) SPV-T3a-CDRH1: GYTFTSYT (SEQ ID NO: 5) SPV-T3a-CDRH2: INPSSGYT (SEQ ID NO: 6) SPV-T3a-CDRH3: ARGSRYDYYGMDY (SEQ ID NO: 7) SPV-T3a-CDRL1: SSVSY (SEQ ID NO: 8) SPV-T3a-CDRL2: DTS (SEQ ID NO: 9) SPV-T3a-CDRL3: QQWSSNPLT (SEQ ID NO: 10) Optionally, when the pharmaceutical composition of the present invention comprises the second molecule, the ratio between the first molecule and the second molecule may be in the range from 1:10 to 10:1, from 1:99:1, from 1:8 to 8:1, from 1:7 to 7:1, from 1:6 to 6:1, from 1:5 to 5:1, from 1:4 to 4:1, from 1:3 to 3:1, from 1:2 to 2:1, for example 1:1. Preferably, one or more of the first molecule, the second molecule, and the further molecules according to the present invention is provided with at least one toxin moiety. This may provide higher efficacy, but may also be used to provide higher specificity for groups of cells, also in combination with for instance prodrug regimes. Toxic moieties are basically any and all molecules that lead to toxicity for the target cell be it directly or indirectly, thus including but not limited to lectins, ricin, abrin, PE toxin, diphteria toxin, radio- isotopes, cytostatic drugs such as adriamycin, apoptosis inducing agents and prodrug converting substances together with prodrugs such as the thymidin kinase and gancyclovir combination. The first molecule, the second molecule, or the further molecules according to the present invention may be provided with the same, or different, toxin moiety. Optionally, the toxic moiety may be selected, independently, from the group consisting of ricin, deglycosylated ricin A (dgRTA), and non- glycosylated recombinant ricin A. Deglycosylated ricin A may prevent the binding of ricin A to carbohydrate-receptors expressed by liver cells and therefore may be preferred in some embodiments of the present invention. In prodrug embodiments typically one of the molecules specifically recognizing CD3 or CD7 or a receptor may be provided with the converting agent and the other with the prodrug. CD3 however does not need to be coupled to a toxic moiety to have an effect, since it blocks the interaction of the T cell receptor with APC's. This is one of the advantages of the present invention which are not present in the prior art. In one preferred embodiment of the present invention, the first molecule, for example WT-1, is provided with a recombinant ricin A (rRTA). In yet another preferred embodiment of the present invention, the pharmaceutical composition comprises both the first and the second molecules (for example both WT-1 and SPV-T3a), each provided with a recombinant ricin A (rRTA). For example, the pharmaceutical composition of the present invention comprises WT-1 conjugated to RTA (INN grisnilimab setaritox) and SPV-T3a conjugated with RTA (INN dafsolimab setaritox). The conjugation ratio of toxin (e.g. rRTA) to the molecule (e.g. antibody molecule) may be in the range 0.5:1 to 5:1. In particular, the conjugation ratio of toxin (e.g. rRTA) to the molecule (e.g. antibody molecule) may be in the range 0.5:1 to 2:1, for example in the range 0.75:1 to 2:1, or in the range 0.75:1 to 1.5:1. rRTA RTA stands for Ricin Toxin A-Chain. In its natural form, the plant toxin ricin consists of two disulfide- bonded chains of ~32 kDa each: a protein synthesis inhibiting A-Chain (RTA), and a cell binding and membrane translocation facilitating B-Chain (RTB). For clinical use, RTB is replaced by a cell targeting ligand that is specifically directed against those cells that are to be eliminated, for example mAb SPV-T3a and / or WT1. After being brought into the cell by the mAb, RTA dissociates from the mAb and part of the free RTA is transported to the cytoplasm via the trans-Golgi network and the endoplasmatic reticulum (ER). In the cytoplasm, RTA catalytically inhibits protein synthesis through N-glycosidase activity removing the base of A4324in 28S rRNA, thus preventing the association of elongation factor 1 (EF-1) and EF-2. rRTA according to the present invention may be produced from a recombinant E. coli cell line, which has been constructed for this purpose. The RTA protein, with a monomer molecular weight of 30 kDa, contains 268 amino acids. A preferred example of the rRTA of the present invention may have at least 95, 96, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO: 21. In one preferred embodiment of the present invention, the rRTA comprises or consists of the amino acid sequence of SEQ ID NO: 21. SEQ ID NO: 21 1 MIFPKQYPII NFTTAGATVQ SYTNFIRAVR GRLTTGADVR HDIPVLPNRV 51 GLPINQRFIL VELSNHAELS VTLALDVTNA YVVGYRAGNS AYFFHPDNQE 101 DAEAITHLFT DVQNRYTFAF GGNYDRLEQL AGNLRENIEL GNGPLEEAIS 151 ALYYYSTGGT QLPTLARSFI ICIQMISEAA RFQYIEGEMR TRIRYNRRSA 201 PDPSVITLEN SWGRLSTAIQ ESNQGAFASP IQLQRRNGSK FSVYDVSILI 251 PIIALMVYRC APPPSSQF The toxic moiety may be coupled to the specifically binding molecule using any suitable conjugation or linker chemistry, such as by making a fusion protein by recombinant means, typically including a protease cutting site between binding molecule and toxic (protein) moiety, but for ease of manufacturing and freedom of choice in toxic moieties chemical coupling is preferred, optionally by an acid-labile linker. (Upon internalization a conjugate typically goes through a lysosome. Other linkers that may be suitable for use in the pharmaceutical composition of the present invention may be selected from the group consisting of: cleavable linkers (for example enzymatically-cleavable peptide linkers, acid sensitive hydrazone linkers, and glutathione-sensitive disulfide linkers ) and non-cleavable linkers (for example linkers based on maleimidocaproyl [MC] and 4-maleimidomethyl cyclohexane-1- carboxylate [MCC]). In particular, the conjugation may employ N-succinimydyl 3-(2-pyridyldithio)propionate (SPDP; Pharmacia) or 4-succinimidyloxycarbonyl-alpha-methyl-α(2-pyridyldithio)toluene (SMPT). SMPT is a so called 'second-generation cross-linker', characterized by having a hindered disulfide bond (due to the presence of the phenyl ring). This renders the SMPT-linker less susceptible to extracellular reduction by thiols present in the tissues and blood, and, therefore, results in a prolonged serum half-live of the immunotoxin. Thorpe et al demonstrated in an in vivo mice tumor model that using SPMT instead of the first-generation cross-linker SPDP, strongly improves the anti-tumor effect of their dgRTA-based ITs (WO9948534A1). SMPT contains a disulfide bond which is important for the intracellular dissociation of the molecule and the toxic moiety. The invention also provides a pharmaceutical composition according wherein at least two molecules specifically recognizing different receptors are provided with toxic moieties, which may be the same or different toxic moieties. There is a major advantage to using different toxic moieties when the side effects of the moieties are different, because higher doses can then be given. Typically the pharmaceutical compositions according to the invention may further comprise at least one further molecule specifically recognizing CD5, CD2, CD4, CD8 or an IL-2 receptor, which may also be coupled to a toxic moiety. This may provide higher efficacy, but may also be used to provide higher specificity for groups of cells, also in combination with for instance prodrug regimes. Doses used are given in the detailed description hereof. The limits of doses of immunotoxins in regimens like the invented one are typically dependent on the immunotoxin, both because of the specificity and affinity of the specific binding molecules as well as because of the different tolerated doses for different drugs. Expressed in equivalents of RTA, the limits will be generally within 10 mg RTA equivalents per m2body surface area, preferably within 5 mg RTA equivalents per m2body surface area, more preferably within 2.5 mg RTA equivalents per m2body surface area, for example within 2.0 mg RTA equivalents per m2body surface area. Preferably, the RTA equivalent dose of the pharmaceutical composition of the present invention is between 0.3 -2.0 mg RTA equivalents per m2body surface area, more preferably between 0.5 to 1.5 mg RTA equivalents per m2body surface area, for example between 0.6 to 1.2 mg RTA equivalents per m2body surface area. Typically the compositions according to the invention will be used for the treatment of chronic inflammatory or autoimmune diseases, or other CD7 positive malignancies, in a patient. For example, the composition of the present invention can be used for the treatment of autoimmune diseases selected from the group consisting conditions such as systemic lupus erythematosus, rheumatoid arthritis, systemic sclerosis, localized scleroderma, IgG4 mediated disease, myositis, and Sjögren’s syndrome, primary sclerosing cholangitis, primary biliary cirrhosis, autoimmune hepatitis, vasculitides, nephritides, encaphalomyelitides, neuropathies, (epi-)scleritides; chronic inflammatory diseases, comprising conditions such as axial and peripheral spondylarthritis, psoriatic arthritis, inflammatory bowel disease, psoriasis; and atopic allergic conditions, comprising conditions such as atopic dermatitis, atopic asthma and polyposis nasi. Preferably, the systemic autoimmune disease is systemic sclerosis or Sjögren’s syndrome. The patient subject to the treatment of the present invention may have shown symptoms of vasculopathy, fibrosis and / or autoimmune inflammation. Such a regimen is thus also part of the invention. The composition of the present invention targets activated pathogenic T and / or NK cells in a patient, preferably activated pathogenic T and / or NK cells in the patient’s blood and / or inflamed tissues. Preferably, the present invention targets activated pathogenic T and / or NK cells by selective depletion of the activated pathogenic T and / or NK cells, or by membrane receptor inhibition, or by intracellular kinase inhibition. Optionally, the activated pathogenic T cells are selected from the group consisting of CD8 cytotoxic T cells, CD4 helper T cells, follicular helper T cells, proliferating T cells and combinations thereof. Preferably, the activated pathogenic T cells comprise CD8 cytotoxic T cells. The pharmaceutical composition of the present invention can be administered to patients, preferably humans, through various routes. All modes of administration can be envisaged, for example by oral, rectal or intravenous, cutaneous, intramuscular, subcutaneous, intrauterine or intracerebroventricular injection. Preferably, the pharmaceutical composition of the present invention is administered intravenously, for example by intravenous infusion over a period of, for example up to 6, 4, 2, or 1 hours, or 45min, or 30min. In one embodiment of the present invention, the pharmaceutical composition of the present invention is administered by intravenous infusion over a period of 4 hours. Optionally, the pharmaceutical composition of the present invention may be administered, for example by way of intravenous infusion. When using a full antibody, the dose of the first molecule could be from 1 to 50mg, from 1 to 40mg, from 1 to 30mg, from 1 to 25mg, from 1 to 20 mg, from 1 to 10mg, from 3 to 10 mg, from 3 to 8mg, from 4 to 9mg, from 4 to 8mg, from 5 to 7mg, for example around 6mg, per administration. When using a full antibody-RTA conjugate, the dose could be from 0.01 to 1 mg / kg bodyweight, from 0.05 to 5 mg / kg bodyweight, from 0.05 to 2 mg / kg bodyweight, from 0.05 to 1 mg / kg bodyweight, from 0.05 to 0.5 mg / kg bodyweight, from 0.05 to 0.2 mg / kg bodyweight, for example around 0.1 mg / kg bodyweight. The administration may be performed once a day, once every 2, 3, 4, 5, 6, or 7 days. For example, the administration may be performed once a day for 14 days, once a day on days 0, 2, 4, and 6, or once a day on days 0, 2, 6, 11, 17 and 24. In one preferred embodiment of the present invention, the administration is performed once a day on days 0, 2, 4 and 6. Optionally, the pharmaceutical composition of the present invention further comprises one or more excipients, carriers, buffer agents, stabilisers, tonicizing adjusting agents, preservatives, or preservatives or anti-oxidants. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may depend on the route of administration, e.g., intravenous injection. In a preferred embodiment of the present invention, the composition comprises (i) 0.05 to 0.5 mg / mL, optionally 0.1 to 0.5mg / mL, for example 0.2 mg / mL, of the first molecule; and, optionally one or more of the following: (ii) 0.05 to 0.5 mg / mL, optionally 0.1 to 0.5mg / mL, for example 0.2 mg / mL, of the second molecule; (iii) 5 to 20 mM, optionally 5 to 15mM, for example 10mM, of a citrate buffer, (iv) 50 to 300 mM, optionally 75 to 200 mM, for example 125 mM, of L-arginine or a pharmaceutically acceptable salt thereof, and (v) 0.01 to 0.1 % (w / v), optionally 0.01 to 0.08% (w / v), for example 0.05% (w / v), a polysorbate, for example Tween (RTM) 20, and (vi) 120 to 160 mM maltose. Optionally, the composition is in water. Preferably, the composition has a pH in the range 6 to 7.5, optionally from 6 to 7, for example 6.5. In some embodiments, the composition further comprises at least one agent selected from: 120 to 160 mM maltose; 100 to 150 mM, optionally 125 mM, trehalose; 25 to 75 mM, optionally 50 mM, glycine; and 80 to 120 mM, optionally 100 mM, mannitol. In particular, the composition may comprise 130 to 150 mM, optionally 140 mM, maltose monohydrate. In some embodiments, the composition comprises: (1) 0.2 mg / mL of SPV-T3a-rRTA and 0.2 mg / ml WT1-rRTA; (2) 10 mM sodium citrate / citric acid buffer; (3) 125 mM of L-arginine.HCl; (4) 0.05% (w / v) Tween(RTM) 20; (5) 140 mM maltose monohydrate wherein the composition is in water for injection and has a pH of 6.5. In some embodiments, the composition is sterile. In some embodiments, the composition is suitable for injection. The present invention also provides a method targeting activated pathogenic T cells in a chronic inflammatory or autoimmune disease in a patient. The method comprises administering to the patient an effective amount of a pharmaceutical composition of the present invention as described herein. The method of the present invention may be combined with other immunosuppressive treatments, and / or efficacy and / or safety enhancing agents. Optionally, the method of the present invention may be used as as pre-treatment for tolerogenic therapies, e.g. with cellular therapy of tolerogenic nanoparticles The invention also provides a kit of pharmaceutical compositions for treating chronic inflammatory or autoimmune disease comprising a composition as described herein. The invention leads to a drop in numbers in the population of unwanted cells, for example activated pathogenic T cells, such as CD7+, CD8+ T, CD4+ T or NK cells, to at least 20 % of the original amount, usually even to 5% or less. Typically this number stays low over a prolonged period of time in contrast to what prior art regimes have accomplished. The exemplified composition not only targets T cells, but also NK cells which is another advantage of the present invention. Whilst the present invention has been described and illustrated with reference to particular embodiments, it will be appreciated by those of ordinary skill in the art that the invention lends itself to many different variations not specifically illustrated herein. By way of example only, certain possible variations will now be described. Examples Materials and methods Immunotoxins The anti-CD3 / CD7 combination of immunotoxins (CD3 / CD7-IT) as referred to in this article contains a 1:1 mixture (w / w) of the murine monoclonal antibodies SPV-T3a (anti-CD3) and WT1 (anti-CD7) that are both conjugated to recombinant ricin toxin A as has been previously described (36, 40). Peripheral blood mononuclear cell (PBMC) isolation, cryopreservation and culture PBMCs were isolated from patients’ (n=30) and healthy donors’ (n=15) peripheral blood by Ficoll Pacque PLUS density centrifugation and cultured in complete RPMI medium 1640+ GlutaMAXTM (Gibco, ref 72400-021) supplemented with 1OO IU / ml penicillin, 100 mg / ml streptomycin, 100 mg / L sodium pyruvate and 10% human pooled serum. PBMCs that were not processed immediately were cryopreserved and stored in liquid nitrogen until further use. To generate phytohemagglutinin (PHA)- activated T cells, PBMCs were first seeded in 96-well-u bottom plates (Greiner) at a cell density of 100,000 cells per well and then stimulated with 5 µg / ml PHA (Roche, cat# 11082132001) for 24 hours at 37 °C, 5% CO2. To evaluate production of cytokines, prior to flow cytometric staining, PBMCs were stimulated for 4 hours at 37 °C, 5% CO2, with 12.5 ng / ml phorbol myristate acetate (Sigma), and 500 ng / ml ionomycin (Merck) in the presence of 5 µg / ml brefeldin A (Merck). Immunohistochemistry Immunohistochemical analysis was performed on formalin fixed paraffin embedded (FFPE) skin biopsies of 20 patients with systemic sclerosis. Skin biopsies were obtained from both a affected and non-affected area of the forearm as diagnosed by an expert clinician via surgical excision with a 6-mm ø punch biopsy. In all cutaneous specimens staining for CD3 was used as a marker to evaluate T cell infiltration and CD7 to assess infiltration of activated T lymphocytes and NK cells. For the CD3 staining, slides were deparaffinized with xylol wash and rehydrated with ethanol. Antigen was retrieved in 10 mM sodium citrate buffer (pH 6.0) room temperature (RT). Blocking of the peroxidase activity was conducted by incubation with 3% H202 in or 30 min. Then, sections were incubated with the primary mouse CD3 anti-human monoclonal antibody (1:200 dilution in PBS containing 1% BSA; Clone F7.2.38; Dako; Cat# M7254) overnight at RT. Next, tissues were incubated with secondary antibody (BrightVision Poly-HRP, Immunologic DPVO55HRP) for 60 minutes at RT. 3’3’-diaminobenzene was used to visualize antibodies (bright DAB, Immunologic). Nuclei in all slides were counterstained with hematoxylin and mounted with a cover slip (Permount, Thermo-Fischer, Waltham, MA, USA). CD7 was immunohistochemically evaluated with the use of the Omnis automatic immunostainer (DAKO) according to manufacturer’s standard procedures. In brief, FFPE tissues were deparaffinized, rehydrated and subjected to heat-mediated antigen retrieval (30 min at 97° C). Followingly, endogenous peroxidase was blocked and the primary mouse CD7 anti-human monoclonal antibody (ready to use, diluted in Envision Flex Antibody Diluent, clone CBC.37, DAKO; Cat# GA64361-2) was added for 20 min at RT. Secondary antibody (Envision Flex HRP, DAKO) was then applied for 20 min at RT. Antibody complex was developed with Envision Flex Substrate Working solution (DAKO) and nuclei were counterstained with hematoxylin. Human synovial / tonsil specimens were used as positive controls and skin sections without the primary antibodies as negative controls. Cellular infiltrates were examined through the whole surface of all sections (n=4) mounted per donor and condition and imaged with CaseViewer (v2.3.0.99276). CD3 positive cells were counted by 2 independent observers in four randomly selected fields and total number of positive cells was plotted as mean ± SD. CD7 positive staining was assessed using an arbitrary 0-4 semiquantitative scoring system of positively stained areas. This scoring was performed blindly by 2 independent observers. Expression of collagen type 1 (Goat Anti-Type I Collagen-UNLB, Southern Biotech, cat# 1310-01) in fibroblasts was also evaluated. Staining was performed similarly to CD3 marker with the exception that incubation with a secondary rabbit biotinylated anti-goat IgG antibody (Vector Laboratories, PK-6101) was performed for 30 minutes at room temperature. Values illustrated in the graphs represent mean ± SD. Multiplex immunohistochemistry staining and imaging of SSc skin For multiplex immunofluorescent staining, 5 µm thick sections from matched affected and non- affected skin of 24 SSc patients were included. Slides were stained by an automated platform with the use of Opal 7-color Automation IHC kit (NEL801001KT; PerkinElmer) on the BOND RX IHC & ISH Research platform (Leica Biosystems) as it has been previously described(41). Incubation with primary and secondary antibodies was for 1 hour and 30 min respectively at RT. For the detection of skin lymphocyte cell populations the following antibodies were used; anti-CD56 (Cell Marque, 156R-94, clone MRQ-42) with Opal620, anti-CD8 (Dako, M7103, clone C8 / 144B, 1:200) with Opal690, anti-CD7 (Dako, GA64361-2, clone CBC.37, 1:30) with Opal480, anti-CD3 (Thermo Fisher, RM-9107, clone RM- 9107, 1:200) with Opal520, anti-FOXP3 (eBioscience Affymetrix, 14–4777, clone 236A / E7, 1:100) with Opal570 and anti-CD20 (ThermoFisher, MS-340, clone L26, 1:600) with Opal570. Slides were stained with DAPI for 5 minutes, washed and mounted with Fluoromount-G (SouthernBiotech, 0100–01). Slides were then scanned by the Automated Quantitative Pathology Imaging System (Vectra V.3.0.4, PerkinElmer) with using an overview of 4x magnification. Annotation of multispectral images of skin tissue was performed with Phenochart (V.1.0.9, PerkinElmer) and scanned at 20x magnification. Spectral unmixing of the Opal fluorophores was done by InForm software (V.2.4.2, PerkinElmer) and the multichannel images were then digitally merged. For quantitative analysis, digital scans containing whole skin biopsies (n=3 sections per biopsy per donor and condition) were quantified by QuPath-0.4.4 (42). Single-cell RNA sequencing analysis The single-cell count matrix (Cell by Gene) was obtained from two publicly available datasets, namely GSE195452, GSE138669 and GSE128169. Preprocessing of the data was performed using Seurat (version 4.3.0) (40). Quality control measures were implemented by filtering out cells with a high content of mitochondrial genes (>5%) and cells with gene counts per cell values below 200 or above 2000. Subsequently, CD3+ and / or CD7+ cells were sorted, resulting in the recovery of 2126 and 5061 high-quality cells from both datasets, respectively. Later, the CD8+ subset of cells was sorted from these cells for separate analyses. For primary dimension reduction, non-negative matrix factorization was employed, followed by the application of UMAP: Uniform Manifold Approximation and Projection (43, 44) with Louvain clustering, as previously described by Singh et al. (45). The FindAllMarkers function of Seurat was then utilized to identify differentially expressed genes (DEGs) within each cluster, which were subsequently annotated based on the characteristics of these DEGs. An R package pheatmap (Kolde, R. (2019). pheatmap: Pretty Heatmaps (R package version 1.0.12)) was used to visualize the DEGs across the cell types / groups. To assess DEGs between healthy and diseased individuals, the FindConservedMarker function of Seurat was employed. Additionally, the Wilcox-Test (46) was applied to test for differences in cell frequencies between healthy individuals and those with systemic sclerosis (SSc). Single-Sample Gene Set Enrichment and Correlation analyses To gain insights into the functional characteristics of each cell type, we performed single-sample gene set enrichment analysis (ssGSEA) using the escape R package (47) with WikiPathways from MsigDB (48) as the reference gene set collection. An R function called geom_tile from ggplot2 package (Wickham, H. (2016). ggplot2: Elegant Graphics for Data Analysis (2nd ed.). Springer) was used to visualize the pathways across different cell types / groups. The difference in the distribution of Normalized Enrichment Scores (NES) between control and SSc group was tested using Kolmogorov-Smirnov (KS) test (49). To capture pathways associated with fibrosis and inflammation, we retrieved the gene list related to these processes and further augmented it by including CD7. Performing correlations at the single-cell level can be noisy and biased by technical factors. Hence, we constructed a meta-cell object (from previously described Seurat object) comprising CD3 / CD7+ cells, by employing the WGCNA R package (50). This object contains framework weighted gene co- expression to identify modules of highly correlated genes. Subsequently, from this meta-cell object was used to obtain pairwise correlations and p-values were computed using the Hmisc function from the Hmisc R package (Harrell Jr., F. E., & with contributions from Charles Dupont and many others (2020). Hmisc: Harrell Miscellaneous (R package version 4.8.0)). An R package ComplexHeatmap (Gu, Z. (2016). ComplexHeatmap: Making Complex Heatmaps in R (R package version 2.10.0)) was used to visualize the correlations. Collection and cell culture of primary fibroblasts Half piece of 4 mm diameter skin biopsies were placed in 24 well plates containing 2 ml DMEM Glutamax medium (Gibco, Waltham, MA, USA) that was supplememted with 100 U / ml penicillin, 100 mg / ml streptomycin, 100 mg / L sodium pyruvate and 20% fetal calf serum. Plates were incubated in regular culture conditions (5% CO2, 37 °C, 95% humidity) for 2 weeks in which primary skin fibroblasts spontaneously grow out Medium was refreshed every 3-4 days. After outgrowth, primary fibroblasts were cultured in DMEM Glutamax medium (Gibco) that was supplememted with 100 U / ml penicillin, 100 mg / ml streptomycin, 100 mg / L sodium pyruvate and 10% fetal calf serum and used in experiments after passage 5. Single cell isolation from skin biopsies 6 mm diameter skin punch biopsies from healthy individuals were used to obtain single-cell suspensions containing skin infiltrating lymphocytes for phenotypic characterization and functional assays. Protocol that was used combines mechanical and enzymatic dissociation of the skin tissue and has been extensively described from He et al. (PMID: 27166763). Flow cytometry analysis Per donor, 1 x 106PBMCs were first labeled with ViaKrome 808 fixable viability dye (1.5:1000 in PBS) for 30 min at 4 °C to exclude dead cells and then stained for 20 minutes at RT with fluorescently labeled extracellular antibodies (supplemental table x). For intracellular stainings (supplemental table x), cells were fixed with permeabilized using the Cyto-Fast™ Fix / Perm Buffer Set (Biolegend) according to manufacturer’s guidelines. To facilitate detection of intracellular cytokines, cells were pre-stimulated with 12.5 ng / ml phorbol 12-myristate 13-acetate (PMA), 500ng / ml Ionomycin and 5 µg / ml brefeldin A before staining. Samples were acquired on a Beckman Coulter Cytoflex LX 21-color flow cytometer, immediately after staining. Isolation, culture and cell viability of T cells, B cells and NK cells from SSc peripheral blood Cryopreserved PBMCs from patients with systemic sclerosis were thawed and washed as previously described to isolate specific immune cell populations. CD3+ T cells were isolated with a magnetic negative selection according to the manufacturer’s instructions (MojoSort pan CD3+ T cell isolation kit; Cat# 480021). CD19+ B cells were also isolated with negative selection using the MojoSort TM Human Pan B cell Isolation Kit (cat# 480082). Isolation of untouched CD56+ NK cells from SSc PBMCs was performed by using NK isolation kit (Miltenyi Biotec, cat# 130-092-657), according to manufacturer’s protocol. After isolation, enriched CD3+ T cell, CD19+ B cell and CD56+ NK cell fractions exhibited more than 95% purity as evaluated by flow cytometry staining for CD3, CD19, CD56 markers. The isolated immune cell populations were cultured with XVIVOTM 15 medium (Lonza, cat# 04-418Q) at a density of 50,000 cells / well in 96-well u bottom plates (Greiner). To evaluate cell viability of the cells after different stimulation (24 hours) and treatment conditions (48 hours), the CellTiter-Glo® 2.0 Cell Viability Assay (Promega) was used as per manufacturer’s instructions. Cells were also treated with 5 mM cycloheximide (Sigma, cat# 01810-1G) as positive control. Luminescence was measured with the use of CLARIOstar Plus (BMG LABTECH). For every experimental condition, 4 technical replicates were used and the average of them was used in further analysis. Experimental values were corrected for medium luminescence and were normalized to the control unstimulated and untreated condition. Monocytes isolation and differentiation to M2 macrophages CD14+ monocytes were isolated from PBMCs with positive selection kit (Miltenyi Biotec, cat# 130-050- 201) according to manufacturer’s instructions. Monocytes were then seeded in 6-well plates at a cell density of 1 million cells per well at a volume of 2 ml in XVIVOTM 15 medium that was supplemented with 100 IU / ml penicillin, 100 mg / ml streptomycin and 2% human pooled serum. Differentiation towards M2-likemacrophages was stimulated by adding 20 ng / ml rhM-CSF (R&D Systems, cat# 216- MC) and 10 ng / ml rhIL-4 (Biolegend, cat# 500815). Duration of culture was 7 days and medium with cytokines was refreshed at day 3. Cell viability of M2-like macrophages was evaluated with CellTiter- Glo® 2.0 Cell Viability Assay (Promega) as previously described. Multi-parameter flow cytometric quantification of CD3 / CD7-IT-induced cell death To evaluate the killing efficacy of CD3 / CD7-IT towards activated T and NK cells in vitro, we developed a model in which a 24-hour PHA (Roche) stimulation of PBMCs was used to mimic disease related T cell activation. PHA stimulation was accompanied by elevated surface expression of CD3 (2-fold increase in MFI) and CD7 (3-fold increase in MFI) antigens on cytotoxic CD8+GZMB+ T cells and CD7 (2-fold increase in MFI) on CD56+GZMB+ NK cells (Supp. Figure 6A, B). Non-activated or PHA- activated (5 µg / ml) PBMCs were cultured for 24 hours at 37° C, 5% CO2 before treated with CD3 / CD7-immunotoxin (IT) for 48 hours. Based on previous studies, the in vitro clinically therapeutic concentration was between 1-5 nM. We titrated drug concentration (0-10 nM) based on its killing efficacy towards primary T cells and we chose the lowest concentration exerting maximum killing efficacy. Concentration of the drug that was used in in-vitro experiments was 0.33 nM. Post treatment, cells were collected in 15 ml conical tubes, washed with PBS and processed for flow cytometric staining. Staining protocol for live / dead, extracellular and intracellular markers followed as it was previously described. CD2 was used to identify and characterize T cell populations, instead of CD3, due to possible modulation of the CD3 antigen from the CD3 / CD7-IT treatment. To enable quantification of absolute cell counts, a fixed amount of counting beads (Precision Count BeadsTM, Biolegend, cat# 424902) was added in each sample prior to acquisition. Samples were acquired on a Beckman Coulter Cytoflex LX 21-color flow cytometer immediately after staining. Ex vivo skin culture Full thickness 6 mm diameter skin punch biopsies were obtained from the abdomen of 4 healthy individuals that underwent plastic surgery. All patients signed informed consent that their surgical leftover material will be used for research purposes. From each skin tissue, 4-6 punch biopsies were received and cut in half. To account for a potentially inequal infiltration of immune cells between skin biopsies, all skin pieces were pooled together and then distributed equally in the different experimental conditions. The skin tissue was cultured in 24-well plates in 1 ml of RPMI medium 1640 with 100 IU / ml rhIL-2 (Thermo Fischer, cat# 16-7027-85), 5 ug / ml PHA (Roche), growth supplements and antibiotics. Twenty-four hours later, samples were treated with 0.33 nM a-CD3 / CD7-IT. After 48 hours, the skin pieces of each condition were used to obtain single-cell suspensions containing skin infiltrating lymphocytes for functional assays. Protocol that was used combines mechanical and enzymatic dissociation of the skin tissue and has been extensively described by He et al. (51). Apoptosis assay To distinguish early apoptotic cells from non-apoptotic and cells in late apoptosis / necrosis, PBMCs isolated, cultured and prepared as described before, were first stained extracellularly with monoclonal antibodies of interest (table) for 20 minutes at RT. Cells were then washed twice with cold PBS and resuspended in 100 µl of a buffer containing 5 µl 7-AAD (), 5 µl Annexin V:FITC labeled and 0.15 µl CaCl2 (1 M) in PBS. Samples were incubated in the dark at RT for 10 minutes and were acquired in flow cytometer (Gallios) immediately after staining. Cells being 7-AAD+AnnexinV+ are refered as late apoptotic / necrotic cells while cells being 7-AAD-AnnexinV+ as early apoptotic. Live cells are negative for both 7-AAD and AnnexinV. Cytokine measurements Quantification of human cytokines and chemokines in culture supernatants were measured by Luminex. A BioPlex kit was used following the manufacturer’s instructions. Samples were analyzed with BioPlex Manager 4 software (Bio-Rad Laboratories, Hercules, CA, USA). LDH cytotoxicity assay To assess cytotoxic capacity of cytotoxic T and NK cells, Lactate dehydrogenase (LDH) was measured in PBMC and K562 cell co-culture supernatants using a LDH-cytox kit according to manufacturer’s protocol (Biolegend #426401). PBMCs and K562 cells were seeded into 96-well plates (F-bottom) in a 10:1 ratio, using triplicate wells. To augment cytotoxic function of CD8+ T cells and NK cells, PBMCs were stimulated overnight with a-CD3 / CD28 (1 µg / ml) or IL-2 (500 IU / ml), IL-15 (10 ng / ml) respectively. To evaluate the involvement of CD7 receptor in T and NK cell cytotoxicity 330 nM of anti-CD7 (WT1) blocking antibody was used. Percentage of cytotoxic capacity was calculated according to the formula: %cytotoxicity= (experimental value-low control value) / (high control value-low control value) x 100. Low and high control values correspond to LDH levels of K562 cells alone without or after addition of lysis solution respectively. Fibroblast and immune cell in vitro co-culture collagen contraction assay Primary healthy human fibroblasts were detached with trypsin and were then brought to a cell density of 2 x 106 cells / ml. PBMCs from 5 healthy individuals were thawed and washed as previously described and stimulated / treated with the different experimental conditions mentioned in the results section. Cell suspension containing a mixture of PBMCs and fibroblasts in a 5:1 ratio was then prepared. To create the 3D collagen hydrogels, for every plug, 20 µl Minimal Essential Medium (Sigma-Aldrich, Saint Louis, CA, USA), 10 μL sodium bicarbonate (Gibco, Waltham, MA, USA), 150 μL soluble collagen (PureCol, type 1 collagen) and 90 μL cell suspension were sequentially mixed in a different tube and the respective order. After the suspension was delicately homogenized, 250 µl was added per well of 48-well plates. Thereafter, 750 µl of complete RPMI medium was added and the plugs were incubated under standard conditions for 24 or 48 hours. Spontaneous fibroblast contraction was macroscopically evaluated by scanning plates on a standard office flat-bed scanner. To quantify the area of contraction, generated images were analyzed with Fiji ImageJ. To further study the phenotype and function of this model’s lymphocytes and fibroblasts, after macroscopic evaluation, the collagen plugs were enzymatically digested with a mixture of collagenase D, Dispase and DNase in plain RPMI medium supplemented with 100 U / ml penicillin, 100 mg / ml streptomycin for 1 hour at 37 °C on a roller. Reaction was stopped with the addition of complete RPMI medium containing 10% HPS and single-cell suspensions were then washed twice with PBS and used for flow cytometry analysis. To co-culture fibroblasts with CD7+ or CD7- T and NK cells (Supp. Figure 7) these cells were FACS sorted from PBMCs and seeded in the 3D collagen hydrogels. RNA isolation and quantitative real-time PCR RNA isolation was performed with the use of 500 µl of TRIzol (Sigma-Aldrich), according to the manufacturer’s guidelines. After isolation, RNA concentration was quantified with a Nanodrop photospectrometer (Thermo Scientific, Waltham, MA, USA) and any genomic DNA was removed using DNAse I. Next, a maximum of 1 μg of RNA was reverse-transcribed into cDNA in a single step reverse transcriptase PCR at 37°C with the use of oligo dT primer and 200U M-MLV Reverse transcriptase (All Life Technologies) using a thermocycler. Gene expression in this cDNA was measured using 0.25 mM of validated primers (Biolegio, Nijmegen, the Netherlands: see supp. table 3) and SYBR green master mix (Applied Biosystems, Waltham, MA, USA) in a quantitative real-time polymerase chain reaction (qPCR). The relative gene expression (-ΔCt) was calculated based on the average of the following reference genes: GAPDH and RPS27A. Study design The objective of this study was to delineate the role of co-stimulatory receptors in regulating cytotoxic cell driven pathologic processes in the affected skin of patients with systemic sclerosis (SSc) and examine whether therapeutic targeting of such receptors halts SSc pathology. To address these questions, we performed single-cell RNA sequencing analysis of two separate SSc cohorts (total of n= 109 SSc and n= 65 healthy individuals) containing skin cells from SSc and healthy individuals and used multiplex immunohistochemistry for spatial imaging (n=24) and multi-color flow cytometry for protein level confirmation. We further analyzed the effects of costimulatory modulation in functional assays using (i) stimulation / inhibition of primary lymphocytes from SSc individuals with recombinant proteins, (ii) blocking antibodies in co-cultures of lymphocytes with K562 target cells and (iii) in a fibroblast / immune cell co-culture collagen contraction assay that serves as a disease-relevant in-vitro model to mimic SSc tight and hard skin. Treatment efficacy of a novel combination of bispecific anti- CD3 / CD7 targeting immunotoxin was evaluated (i) in lymphocytes from SSc individuals blood, (ii) ex vivo skin cultures and (iii) in a severely affected SSc patient who was treated on compassionate use with a novel anti-CD3 / 7 immunotoxin (CD3 / CD7-IT) treatment. Functional experiments were performed with multiple biological and technical replicates as mentioned in each figure’s legend and in each assay’s methods description. Patient and public involvement This research incorporated the active participation of patients in its design and execution. Two patient research partners were proactively involved in the design of primary research questions and methods of patient recruitment by structured interviews and regular, interactive discussions. Patient research partners were trained in the context of STAP (“Key To Active Participation”), an initiative of the department of rheumatic diseases of the Radboud University Medical Centre (Nijmegen, the Netherlands) to establish a patient panel within the hospital setting to provide support for rheumatology research (38). The involvement of patients and their families in disseminating the results of this study in patient organizations played a central role in motivating community engagement both during and after the study. Patients Our study was approved by the local research ethics committee of Radboud University Medical Center, the Netherlands (study numbers: NL57997.091.16, NL67672.091.18). All procedures regarding patient participation followed the Declaration of Helsinki principles were performed in accordance with the relevant Dutch legislation regarding reviewal by an accredited research ethics committee, with the file number 2021-8193. All patients (aged >18) that donated whole blood and skin biopsies, were diagnosed with established systemic sclerosis disease according to the ACR 1980 preliminary classification criteria(39). SSc patients with overlapping syndromes were not included in our study. Blood samples from age and sex matched healthy volunteers were collected from Sanquin bloodbank (project number: NVT 0397-02) from individuals that consented on donating blood for medical research. All patients agreed to participate in the study before blood withdrawal or skin biopsy acquisition. For analyses were we examined the relationship between CD7 normalized mean gene expression and selected patient clinical characteristics, SSc patients’ clinical data were received as part of a previous publication (10). Statistics Comparisons for statistical significance between experimental groups were performed with the Prism 7 software (Graphpad 9.0.0, San Diego, CA, USA). The exact statistical tests performed in every experiment are indicated in the figure legends. Code availability The single-cell RNA sequencing analyses presented in this study were performed with standard workflows and open-source R packages and software were utilized (Methods). Some analyses involved the development of custom made codes. All the codes are available here; https: / / github.com / PrashINRA Supplementary materials Table 1: List of antibodies used for cell surface staining Antigen Clone Dilution Fluorochrome Supplier CD4 RPA-T4 1:100 PerCP / Cy5.5 Biolegend CD3 UCHT1 1:100 Alexa700 Biolegend CD8a RPA-T8 1:100 BV510 Biolegend CD7 M-T701 1:20 BUV737 BD Biosciences CD56 N901 1:50 APC Beckman- Coulter CD19 HIB19 1:25 BV605 Biolegend CD2 S5.2 1:100 BUV737 BD Biosciences Table 2: List of antibodies used for intracellular staining Antigen Clone Dilution Fluorochrome Supplier Granzyme B GB11 1:15 FITC Biolegend Perforin Dg9 1:15 FITC ThermoFischer IL-4 MP4-25D2 1:20 PE / Dazzle594 Biolegend IL-13 JES10-5A2 1:20 PE / Cy7 Biolegend Ki-67 B56 1:50 Alexa Fluor 647 BD Biosciences a-SMA 1A4 1:20 Alexa Fluor 700 R&D systems IL-6 MQ2-13A5 1:20 Pacific Blue Biolegend Table 3: List of primer sequences used Gene Forward primer 5’ -3’ Forward primer 5’ -3’ GAPDH ATCTTCTTTTGCGTCGCCAG TTCCCCATGGTGTCTGAGC RPS27A TGGCTGTCCTGAAATATTATAAGGT CCCCAGCACCACATTCATCA COL1A1 AGATCGAGAACATCCGGAG AGTACTCTCCACTCTTCCAG ACTA2 CTGACCCTGAAGTACCCGATA GAGTGGTGCCAGATCTTTTCC FN1 EDA TTCAGACTGCAGTAACCAACAT GGTCACCCTGTACCTGGAAAC PLOD2 AAGACTCCCCTACTCCGGAAA AGCAGTGGATAATAGCCTTCCAA FAP GCTTTGAAAAATATCCAGCTGCC ACCACCATACACTTGAATTAGCA COL3A1 CCTGGAATCTGTGAATCATGCC TGCGAGTCCTCCTACTGCTA Example 1 – Expansion of activated cytotoxic T and NK cells in SSc skin T and NK cell subsets may upregulate co-stimulatory receptors to direct the autoimmune inflammatory process in SSc. To gain a comprehensive iprofiling of skin infiltrating lymphocytes, we analyzed T and NK cell clusters (n=5,061) from a scRNAseq dataset of affected skin and blood of 97 SSc patients compared to 56 healthy individuals, as part of a larger dataset that was published recently (GSE195452)(PMID: 35381199) (Figure 1). In SSc, skin is a predominantly affected tissue and thus studying the immune profiling of skin infiltrating T lymphocytes assists in better understanding disease pathogenesis. To enhance confidence, we comparatively analyzed with a single-cell RNA transcriptome dataset containing 2,500 T cells from 9 healthy and 12 SSc skin biopsies (GSE138669) (PMID: 34031030) (Figure 2). In addition to the sc-RNA sequencing data, we also performed multicolor immunofluorescence stainings in a third cohort of 24 SSc patients to confirm our transcriptomic findings on protein level and further visualize immune cell skin infiltration spatially. First, we analyzed T and NK cells in skin single-cell datasets based on differential gene expression of known lineage-specific genes (GSE195452, GSE138669). Among the transcriptionally distinct cell subtypes that were detected (Figure 1A, 2A), the following three were significantly expanded (q< 0.05 for all comparisons) in SSc compared to healthy skin in both datasets: proliferating T cells, CD8+ cytotoxic T cells, and NK cells (Figure 3A, B). We verified the presence of these T and NK cell subsets at the protein level in SSc affected skin in an additional cohort of 24 SSc patients (Figure 3C). In addition, increased infiltration of cytotoxic CD8+ T and CD56+ NK cells was further apparent in biopsies from the affected compared to matched non-affected skin in 71% and 83% of SSc patients respectively (n=24, p= 0.06 and p< 0.001 respectively) (Figure 3D, E). In the affected SSc skin, cytotoxic T and NK cells were primarily present in perivascular areas while a smaller amount of these cells was infiltrated around blood vessels of the non-affected skin (Figure 3D). Next, we analyzed the potential function of these enriched cell populations in SSc skin. For this, we used gene set enrichment analyses based on each cluster with Wiki pathways as reference dataset. Both the skin cytotoxic T and NK cell clusters from each sc-dataset were not only associated with cell cytolytic pathways, but were also the only clusters from SSc skin that were specifically enriched for gene sets related to lung fibrosis, pro-inflammatory and pro-fibrotic manifestations relative to healthy skin (Figure 3F, Figure 2C). These pathways included pro-fibrotic genes such as TGFB1, XCL1, OSM, CCL4, IL4, IL17, FGF and PDGF (for a complete overview see Figure 7). This indicates that cytotoxic cells are not only involved in cytotoxicity but also in directing pro-fibrotic pathophysiological processes. In recent studies in chronic inflammatory conditions, CD8+ T cells were shown to mainly exert a cytokine mediated function instead of their conventional cytotoxic effects with an important role of granzyme K (12). Therefore, we performed a focused analysis of CD8+ T cells. In skin, at the sc-RNAseq level, the following CD8+ sub-clusters were formed: naïve, proliferating, skin resident exhausted like, granzyme K (GZMK+) and granzyme B (GZMB+) positive effector cells. Of these, only the subset of CD8 effector GZMB+ cells were significantly enriched in SSc skin (Figure 3G, Figure 1D). Flow cytometry analysis in blood also showed increased (2-fold) presence of CD8+GZMB+ cells in SSc compared to healthy donors (Figure 3H). Example 2 – Expanded CD8+T and NK cells in the affected skin and lungs of systemic sclerosis patients characterized by upregulation of the CD7 co-stimulatory molecule The activity of cytotoxic T cells and NK cells is closely regulated by an interplay between activating and inhibitory cell surface receptors. In chronic infection and malignancies, T and NK cell cytotoxic functions have been shown to be restricted by inhibitory receptors (13-15). Therefore, we compared expression of known T and NK cell activating and inhibitory receptors between immune cells of healthy and SSc skin. Of the inhibitory receptors, LAG3 was expressed in a proportion of CD8+GZMB+ T cells in SSc skin. The expression of TIGIT, CTLA4 and HAVCR2 (TIM-3) did not show any significant difference between healthy and SSc skin while PDCD1 (PD-1) was only expressed in a few naïve / central memory CD8+ T cells together with FOXP3 (Figure 1E). Of the activating receptors, CD69 and CD7 were upregulated in CD8+GZMB+ T cells whilst SSc NK cells exhibited elevated expression of CD7, TNFRSF9 (CD137) and CD28. In the cluster of proliferating SSc T cells, CD40LG was downregulated and CD28 expression was decreased in SSc versus healthy skin (Figure 4A). Of these, CD7 was expressed by almost all the cells in these clusters and also showed the strongest upregulation in patients compared to controls (q<0.001) (Figure 4A, B). In a further attempt to identify differences in cytotoxic T and NK cell activation between healthy and SSc individuals, we used an alternative unbiased approach based on the FindConservedMarker function implemented in Seurat. (to find features that are conserved between the groups, i.e- healthy donors and SSc). This approach confirmed enrichment of cytotoxic genes and CD7 in cytotoxic T and NK cells of SSc patients compared to healthy controls. No other activating or inhibitory receptors were enriched in SSc in this analysis (Figure 4C). These observations suggest that CD7 co-stimulation may be involved in SSc skin T and NK cell activation. To validate these results at the protein level, we performed CD7 and CD3 immunohistochemistry in SSc skin tissue. The total amount of CD3+ T cells was higher even though statistically non-significant in the affected SSc skin (mean number of CD3+ T cells: 15.8 affected versus 6.1 in non-affected) (Figure 5A, B). Strikingly, an increased infiltration of CD7+ cells was specifically found in the perivascular areas (Figure 7C) of affected compared to the non-affected SSc skin (Figure 4D). Furthermore, in SSc skin, CD7 was found to be co-expressed with CD8 and CD56 positive cells, while no expression on CD3+CD8- cells could be observed (Figure 4E). Recently, an increased presence of tissue resident cytotoxic T and NK cells was also described in SSc lungs (16). Thus, we next evaluated CD7 expression in SSc lung tissue compared to healthy. In accordance with our data in skin, CD7 was selectively expressed in lung cytotoxic T and NK cells and its expression in SSc CD8+ and CD56+ cells was significantly higher (2-fold increase) compared to healthy counterparts (Figure 4F). In conclusion, CD7 is an activating receptor that is significantly up-regulated in disease related cytotoxic immune cell populations in both the affected skin and lungs of patients with SSc. Example 3 – CD7 co-stimulation in T and NK cell cytotoxic and pro-fibrotic processes CD7 is selectively expressed in skin T and NK cells (Figure 8D). This receptor is upregulated after TCR ligation and activated by its ligand, SECTM1 (17). SECTM1 is a transmembrane protein produced by thymic epithelial cells and fibroblasts and induced by IFN-γ in professional antigen-presenting cells. CD7 activation by SECTM1 has been shown to augment CD4+ and CD8+ T cell effector functions (18). To gain insight on the function of CD7 in SSc, we analyzed expression of SECTM1 in skin stromal and immune cells. In our dataset, SECTM1 as expected was primarily detected in skin myeloid cells including monocytes, macrophages and dendritic cells. Furthermore, SECTM1 was also expressed by cells in the fibroblast cluster characterized by increased expression of PTGDS (Figure 6A). Interestingly, it was previously reported that this fibroblast subtype is marked by high expression of MHC class I genes compared to other skin fibroblast subsets, suggesting that the SECTM1-CD7 axis may be important in T and NK cell activation (Figure 11A). Notably, T and NK cell CD7 expression was positively correlated with IFNG, while expression of its receptor (IFNGR1) positively correlated with SECTM1 in fibroblasts and antigen presenting cells (Figure 11B, C). This suggests an IFN-γ driven SECTM1-CD7 axis in SSc skin. From a clinical perspective, SSc is a heterogeneous disease with various disease subtypes and phases. Thus, we next analyzed CD7 gene expression in subgrouping of SSc patients with limited (lSSc) versus diffuse (dSSc) cutaneous and early (≤ 3 years from first non-Raynaud symptom) versus late disease. We found that CD7 was significantly upregulated in early diffuse SSc compared to late disease (Figure 6B) and CD7 expression was further associated with patients exhibiting increased skin score (p=0.03) (Figure 6C). CD7 skin expression was not associated with the presence of ILD. Furthermore, CD7 expression was similar between treatment naïve and patients that were receiving immunosuppressive medication, suggesting that currently used therapeutic approaches do not seem to directly target this activation axis (Figure 6D). To further explore the function of CD7+ T cells, we analyzed the response to activation of cells purified from blood. In SSc blood, a larger fraction of CD8+CD7+ cells were detected compared to healthy individuals (18% of total CD3+ cells in SSc vs 12% in HD) (Figure 6E). The CD7+CD8+ T cells from SSc patients upon short (t=4 hours) stimulation with phorbol myristate acetate (PMA) and ionomycin produced significantly more granzyme B (MFI: 40000 in SSc vs 34000 in HD). In addition, SSc CD8+CD7+ T cells were also characterized by increased co-expression of the pro-fibrotic cytokines IL-4 and IL-13 (among CD8+ T cells: 2.5% IL-13+ and 40% IL-4+) compared to CD8+CD7+ cells of healthy controls (among CD8+ T cells: 1% IL-13+ and 30% IL-4+) (Figure 6F). Taken together, these data indicate that CD8+ T and NK cells that exhibit cytotoxic and pro-fibrotic properties in SSc, are characterized by increased CD7 expression. To test the involvement of CD7 in T and NK cell cytotoxicity, we co-cultured healthy peripheral blood mononuclear cells (PBMCs) (n=6) with K562 cancer cells and evaluated T and NK cell cytolytic activity by measuring the release of lactate dehydrogenase (LDH) from the damaged target cells. Interestingly, while blockage of the CD7 receptor did not affect the cell viability of T and NK cells, it was accompanied by significant reduction in their cytolytic capacity towards K562 cells (Figure 6G). This observation suggests that CD7 co-stimulation is important for an efficient cytotoxic response. In addition, we observed above that SSc skin cytotoxic T and NK cells showed disease-related enrichment of pathways associated with lung fibrosis and pro-inflammatory / pro-fibrotic manifestations. To explore the potential involvement of CD7 in the observed pro-fibrotic manifestations of the cytotoxic skin cells, we obtained and merged the gene lists associated with those pathways and performed pairwise correlations with CD7 (Figure 7). Notably, CD7 gene expression in SSc affected skin was positively correlated with expression of pro-fibrotic mediators such as XCL1 (19, 20) and CCL3 (21, 22) in cytotoxic lymphocytes (CTLs) and TGFB1 (23, 24) and OSM (25, 26) in NK cells (Figure 6H). From these observations, it is suggested that CD7 co-stimulation regulates both T and NK cell mediated cytotoxicity and fibrosis. Example 4 – In vitro elimination of the expanded and activated CD7+ T and NK cell subsets by targeted immunotoxin treatment halts fibroblast contraction The selective upregulation of CD7 expression in cytotoxic T and NK cells in SSc skin can serve as target for therapeutic modulation but also for selective depletion of these cells. For this, we utilized a combination of anti-CD3 / CD7 immunotoxins (CD3 / CD7-IT) developed to target allo-reactive activated T and NK cells in graft versus host disease (GvHD) (27). In cultured PBMCs isolated from patients’ blood, a significant killing efficacy (>85% cells eliminated) of CD3 / CD7-IT was only observed towards the activated T and NK cells (Figure 8A). The combination of CD3 and CD7 immunotoxins had an additive effect on the killing efficacy towards T cells, while NK cells (CD3-CD56+CD7+) as expected were predominantly targeted by the CD7-IT (Figure 8B). Of note, treatment with CD3 / CD7-IT also effectively depleted the potentially pathogenic CD8+GZMB+ T cells and CD56+GZMB+ NK cells (Figure 8C). IL-2 production was 9-fold decreased upon treatment (Figure 9A), supporting that anti-CD3 / CD7- IT treatment selectively depleted the activated T and NK cells. The surviving CD8+ T cells in the CD3 / CD7-IT treated condition exhibited a clear alteration in their memory / maturation status: decreased CD8 effector and increased memory and naïve phenotype, showing killing specificity towards effector cells (Figure 9B). Additionally, upon post-treatment stimulation with PHA, the CD8+ T cells that survived treatment showed diminished cell proliferation (decreased % CD8+Ki-67+ cells) and production of cytotoxic (GZMB) and pro-fibrotic molecules (IL-4) compared to their non-treated counterparts (Figure 9C). Importantly, treatment with anti-CD3 / CD7-IT had no effect on the number nor on the cell viability of CD19+ B cells and CD14+ M2 monocytes / macrophages (Figure 9D, E). Next, we used ex vivo whole skin cultures and showed that upon treatment with anti-CD3 / CD7-IT, both numbers of CD8+ T and CD56+ NK cells were significantly reduced compared to the untreated condition (Figure 8D). As we achieved specific elimination of the potentially pathogenic CD7+ T and NK cells, we next evaluated whether this depletion exhibits therapeutic relevance. Fibrosis accompanied by skin tightening is the main disease hallmark of SSc, so we developed a novel 3D collagen fibroblast: immune cell co-culture hydrogel model that enables to study fibroblast contractility (Figure 8E). In this model, spontaneous fibroblast contraction happened in the presence of allogeneic PBMCs and the level of contraction was significantly larger in the presence of PHA-activated PBMCs. PHA upregulates CD3 and CD7 expression on T cells and CD7 on NK cells (Figure 9F, G), so this model mimics the effector functions of the potentially pathogenic immune cell subsets on fibroblasts in vitro. Fibroblasts that were co- cultured with sorted CD7+ T and NK cells exhibited increased contractility and a higher expression of IL-6, collagen type 1 and alpha smooth muscle actin (a-SMA) compared to fibroblasts co-cultured with CD7- cells (Figure 12). Next, we pre-treated PHA-activated PBMCs with 0.33 nM a-CD3 / CD7 antibodies or CD3 / CD7-IT and showed that only upon immunotoxin treatment, fibroblast contraction was significantly reduced compared to PHA activated PBMCs (Figure 8E). Under these conditions (24 hrs of co-culture), the percentage of necrotic CD8+ or CD56+ cells was not (yet) significantly affected (Figure 9H). However, we observed a sharp increase in apoptotic CD8+ and CD56+ cells (Figure 8F). Interestingly, fibroblasts that were co-cultured with CD3 / CD7-IT treated PBMCs exhibited a decreased gene expression of COL1A1, FN1 and ACTA2 (Figure 8G), indicating a lowered pro-fibrotic phenotype. Example 5 – Administration of bispecific CD3 / CD7-IT treatment in the first patient with SSc effectively eliminates pathogenic CD7+ cells in blood and skin The pharmaceutical composition consisted of a fixed dose combination containing equal amounts (w / w) of SPV- T3a-rRTA and WT1-rRTA at a concentration of 0.2mg protein / mL and formulated in 10 mM citrate buffer (pH 6.5), supplemented with 2.63% (w / v) Arginine.HCl (125 mM), 5.04% (w / v) Maltose monohydrate (140 mM), and 0.05% (w / v) Tween-20. The pharmaceutical composition was delivered as packs to the hospital pharmacist that had to be stored at -20°C or below. Each pack contained two glass vials with a rubber stopper and an aluminum flip-off cap, containing 2.5mg purified SPV- T3a-rRTA and 2.5mg purified WT1-rRTA in a fill volume of 25mL / vial at a concentration of 0.2mg protein / mL. The pharmaceutical composition was administered to the patient at a dose of 4mg / m2body surface area (BSA). For administration, the pharmaceutical composition was thawed at room temperature and transferred to an infusion syringe that was connected to a central catheter via an extension tube with an 0.2 µm in-line filter. Four intravenous doses were administered at 2-day intervals by means of an automated infusion device, over a period of 4 hours. A 34-year-old male patient with severe dc-SSc showed disease progression following ASCT that did not respond to treatment with mycophenolate mofetil, prednisone and rituximab. Patient had developed severely invalidating diffuse end-stage skin fibrosis (a modified Rodnan skin score of 27), high inflammation parameters with ESR 49 mm / Hour (< 15mm / Hour) and CRP 78 mg / L and joint contractures. He was bedridden with a very poor prognosis and was therefore treated with CD3 / CD7- IT as last resort. Treatment resulted in a depletion of circulating and skin-resident T cells and NK cells, and a normalization of C-reactive protein (CRP) levels from 131 mg / L to 27 mg / L after four weeks, which CRP levels then further decreased to normal after 5 months. His functional status stabilized, with an observed increase in quality of life, yet with a persistent invalidation due to severe skin- tightening and joint contractures that proved irreversible. Patient died 1.5 years after CD3 / CD7-IT treatment from disease complications. Biologic responses to CD3 / CD7-IT treatment was measured with flow cytometry in patient’s blood and multiplex immunofluorescent staining in skin pre- and post- drug administration. Consistent with the expected in vitro effect, treatment with CD3 / CD7-IT directed a profound elimination of circulating T cells and NK cells. The amount of circulating T and NK cells post-treatment is presented as percentage relative to the amount at start of therapy. Already one week after administration, the amount of circulating T cells and NK cells was reduced by 86% and 77% respectively (Figure 10A). CD8+T cells were preferentially targeted by CD3 / CD7-IT compared to CD4+T cells. More specifically, the percentage of CD8+ T cells exhibits a 37-fold decrease while CD4+T cells show an 8-fold reduction. In addition, the CD4 / CD8 ratio is increased from 0.7 at baseline to 3.6 post-treatment (Figure 10B). Since our previous results point towards the expansion and activation of classical cytotoxic CD8+T cells and NK cells in SSc, we further explored the killing efficacy of CD3 / CD7-IT towards effector cytotoxic T cell and NK cell populations. Effector cytotoxic T cells were characterized as CD8+Perforin+and NK cells as CD56+Perforin+. Interestingly, both CD8+Perforin+and CD56+Perforin+cell populations were completely depleted (100%) in this patient’s blood (Figure 10C). The therapeutic effectiveness towards skin- resident T and NK cells was then evaluated with mIF staining of skin biopsies before and after treatment. Post-treatment, skin biopsies showed a remarkable reduction in immune cell infiltration (Figure 10D). More specifically, absolute cell counts of CD3+T cells, CD8+T cells and CD56+NK cells were all considerably reduced post treatment. Importantly, number of CD3+FOXP3+regulatory T cells and CD20+B cells were not affected (Figure 10E). While the treatment outcome was considered positive and clinically meaningful, even greater benefit is to be expected when CD3 / CD7-IT is applied earlier in the course of the disease, when the inflammatory component is more prominent and the fibrotic process not yet irreversible. Conclusion Here, we show that in depth analyses of two separate SSc immune cells publicly single-cell RNA sequencing datasets reveals a significant expansion of proliferating T cells, cytotoxic T cells and NK cells in SSc skin. Among the expanded immune cell clusters, cytotoxic T cells and NK cells exhibit a gene signature that is enriched for pro-fibrotic and pro-inflammatory manifestations. This suggests that SSc skin disease is driven by T cells and NK cells that do not only produce cytotoxic proteins such as GZMB and perforin but are main producers of well described pro-fibrotic mediators such as TGFB1, XCL1 and OSM. We recently illustrated expansion of NK cells and IFN-γ producing effector T cells in SSc skin. Our focused analysis on skin cytotoxic T and NK cells further delineates the heterogeneity of effector T cell response by showing that the disease expanded effector T cells are classical cytotoxic CD8+ T cells that do not only produce IFN-γ but GZMB and perforin as well. These findings are contradictory to recent observations showing that a non-classical CD8+GZMK+ and not GZMB+ cytotoxic population forms the core of effector CD8 response in human inflamed tissues, including RA synovium and inflamed UC colon. Additionally, Maehara et al. used conventional immunohistochemistry techniques to quantify T cell subsets infiltrating SSc skin and surprising to our previous knowledge, they found that SSc skin is predominantly infiltrated by cytotoxic GZMA producing T cells and not by type 2 helper T cells. These findings are also supported by our data since apart from the prevalent cytotoxic signature in SSc skin, little to no production of Th2 cytokines such as IL-4, IL-5 and IL-13 could be observed in the analyzed single cell datasets. We further compared expression of activating and inhibitory receptors in the expanded cytotoxic populations and found that these cells in SSc skin show a strongly activated profile. Interestingly, unbiased transcriptomic analyses verified by confirmation at protein level, showed a pathogenic upregulation of CD7 in T and NK cell activation in SSc skin. This upregulation was accompanied by increased cytotoxic and pro-fibrotic signature. CD7 is an extracellular co-stimulatory molecule that is expressed on human, mature T cells and NK cells but its exact role in functions of T and NK cells is poorly understood. To our knowledge, CD7 expression in SSc has not been described before. Of note, we are the first to report expansion of CD7+cells in SSc lesional skin. The role of CD7 in T cell biology has not been adequately examined. Our findings show that CD7 is significantly increased in effector cytotoxic cells in SSc compared to healthy skin and blood. Thus, CD7 co-stimulation seems to reflect the activated status of cytotoxic T cells that have been most probably activated by presentation of skin auto-antigens. This is in contrast with older studies that utilized limited flow cytometry techniques to characterize CD7 expression on blood CD8 T cells and demonstrated that CD7 is enriched in CD8+ naïve / central memory but has lower expression in CD8+ effector cells. Our findings differ from those of Aandahl et al., likely because their study is focused on PBMCs from healthy donors that lack presence of autoimmunity. The suggestion that CD7 acts as a T cell activation receptor is further supported by the fact that in our data, the highly proliferating T cells (production of MKI67) are all positive for CD7 gene expression. Additionally, blocking of CD7 co-stimulation impairs cytotoxic capacity of T and NK cells and that further illustrates its important role in effector functions of these cells. The notion that CD7 antigen is specifically enriched in the potentially disease relevant cytotoxic T cells and NK cells, supports the development of novel therapeutic approaches for specific targeting of the cells enriched for this antigen. To explore novel treatments that could potentially target the aberrant CD7+ T and NK cell populations, we further tested the killing efficacy of a combination of anti-CD3 / CD7-IT. This drug has been developed to deplete activated alloreactive T and NK cells for the treatment of graft vs host disease and is currently in phase 3 clinical trial. This approach is considered as potentially beneficial in treating patients with SSc as an attempt to target the CD7+ activated auto-reactive T cells in the affected tissues. Interestingly, in vitro treatment of patients’ PBMCs with anti-CD3 / CD7-IT selectively depleted the activated CD7+ cytotoxic T and NK cells, while the resting T and NK cells together with the other immune cell subsets (B cells and macrophages) were not affected. But is this depletion of the CD7+ cytotoxic T and NK cells relevant in halting disease manifestations? To model the tight skin manifestations observed in SSc that are partially caused by increased (myo)fibroblast contraction we developed a fibroblast, immune cell 3D co-culture model to study immune cell mediated fibroblast contraction. This model was first described by Dorst et al., 2022, and in our settings was adopted to also include PBMCs. We showed that by treating activated PBMCs with anti-CD3 / CD7-IT (depleted from the CD7+ cells) fibroblast contraction was prevented. These results suggest that fibroblast contraction seems to be driven by the CD7+ T and NK cells. However, additional research is needed to exclude the possibility that other immune cell subsets like B cells or macrophages do also contribute to this effect. Finally, from a clinical perspective, results from the first SSc patient treated with CD3 / CD7-IT, show that this drug effectively and selectively depleted the activated cytotoxic T and NK cells in blood and skin in vivo. Interestingly, the fact that resting T / NK cells and other immune cell subsets are not affected by this treatment, suggests that such medication might be superior to the existing general immunosuppressive treatments of SSc that are accompanied with many side effects and often render patients vulnerable to opportunistic infections. Since, CD7 expression is augmented in alloimmune reactive T and NK cells, CD7 targeting therapeutic approaches have shown clinical efficacy and safety in kidney transplantation patients. The in vivo depletion of the cytotoxic T cells and NK cells needs to be confirmed in more SSc patients. Interestingly, our data provide evidence to support a proof of concept clinical trial of CD3 / CD7-IT treatment in patients with SSc. In such a clinical trial, disease outcomes such as mRSS, and lung function ought to be closely monitored in order to evaluate the effect of a-CD3 / CD7-IT treatment in improving the main SSc disease manifestations. Here, we show that SSc affected skin contains increased numbers of proliferating T cells, cytotoxic T cells and NK cells. These cells exhibit a cytotoxic, pro-inflammatory and pro-fibrotic gene signature. When focusing on their co-stimulatory and inhibitory molecule expression, these cells express the co- stimulatory molecule CD7 in association with pro-inflammatory and pro-fibrotic genes, especially in recent-onset and severe disease. Furthermore, we show that CD7 regulates cytolytic activity of cytotoxic T and NK cells and that selective depletion of CD7+ cells prevents cytotoxic cell induced fibroblast contraction by halting their pro-fibrotic phenotype. Finally, CD3 / CD7 directed depletive treatment depleted CD7+ cells and stabilized disease manifestations in a severely affected SSc patient. The role of T cells in mediating the pathology of SSc has been a subject of controversy. The importance of the immune system, however, is highlighted by recent observations indicating that in treatment with ASCT, long-term remission of SSc disease manifestations can be achieved (27). CD4+ T cells have been considered as main effector cells since genetic studies indicated that some MHC class II polymorphisms confer a risk of acquiring SSc (5, 8, 28). Recently, however, MHC class II polymorphisms were shown to confer not so much risk on SSc incidence as on the development of disease related autoantibodies that precede development of clinical disease in a proportion of cases (29). Because of its’ fibrotic clinical manifestations, SSc has been considered a T helper type 2 (Th2) mediated disease (30, 31). However, epigenetic studies revealed gene transcription in cytotoxic T and NK cells in SSc patients with disease risk loci (5). Also, SSc skin was found to be predominantly infiltrated by cytotoxic T cells, in proximity to pre-apoptotic endothelial cells (4). Another recent study associated increased infiltration of IFN-γ producing effector T cells and NK cells in SSc skin to fibrotic activation of fibroblast subsets (10). Our study confirms these data, and our functional analyses suggest that SSc skin disease is driven by T and NK cells that produce cytotoxic proteins such as granzyme B and perforin, induce fibroblast contractility and myofibroblastic phenotype, and produce well described pro-fibrotic mediators such as TGFB1, XCL1, CCL3 and OSM. This suggests that increased cytotoxicity in SSc skin may be associated with induction of the fibrotic pathology of the disease. Our study addresses the question how the cytotoxic immune response in SSc is regulated. Cytotoxic T and NK cells are central effector cells in cancer and infections. Their effector response is tightly regulated by the expression of activating and inhibitory surface receptors (32). Here we find that cytotoxic cells in SSc consistently express high levels of CD7. Of interest, interferon-gamma, a key cytokine in cytotoxic immune responses, is the main inducer of SECTM1, the ligand of CD7 (18). This suggests that SECTM1-CD7 interaction is part of an interferon gamma driven feedback loop that enhances cytotoxic responses in SSc skin. The other side of the coin is that in chronic viral infection and cancer cytotoxic cells develop reduced and altered effector functions due to a process termed exhaustion. Exhaustion involves increased expression of inhibitory receptors such as PD-1, LAG-3, TIM-3 and CTLA-4 (33). The extent of exhaustion varies from dysfunction to anergy or clonal deletion and is determined by factors such as antigen abundance and TCR affinity. The mechanisms in autoimmunity are less certain. In a model of autoimmunity activation of autoreactive CD8+ cytotoxic T cells was restrained by LAG-3 (7). T cell exhaustion in patients with systemic autoimmune disease has mainly been investigated and described in peripheral blood samples and not in tissues where autoantigen presentation occurs (34, 35). We found that in SSc skin compared to healthy skin a subset of cytotoxic T cells expressed LAG3, suggesting a restrained phenotype. Only a few cytotoxic T cells expressed PD-1 in conjunction with FOXP3, suggesting they are regulatory T cells. Taken together, cytotoxic lymphocytes in SSc skin are characterized by an activating rather than an exhausted profile. This study reconfirms the importance of autoimmunity in driving SSc pathology. This is clinically relevant since ASCT can cure the disease, but is a high-risk procedure and only applicable to a very restricted group (<10%) of SSc patients (27). Other currently used broad immunosuppressive treatments do not cure the disease and can only slow down fibrosis to a limited extent. Selective targeting of activated lymphocytes may represent a more selective and safer treatment for SSc. Thus, we utilized a novel combination of anti-CD3 / CD7-IT that has been developed to deplete activated alloreactive T and NK cells for the treatment of graft vs host disease (36). We gave proof of concept that treatment with a-CD3 / CD7-IT, can selectively deplete the activated cytotoxic T and NK cells in blood and SSc affected skin. Because of its depletive nature, anti-CD3 / CD7-IT is administered as single treatment and that furthers support its favorable safety profile. In line with this notion, CD7 targeting therapeutic approaches have shown clinical efficacy and safety in kidney transplantation patients (36, 37). Previously, we showed that anti-CD3 / CD7 immunotoxin treatment was well tolerated and increased survival rates in patients with acute GvHD. Similarly to ASCT, a significant increase in the diversity of T cell repertoires that entailed new polyclonal T cell populations was observed, suggesting the efficacy of our treatment approach in rebalancing the immune composition (36). To summarize, we used single-cell transcriptomics data verified by multiplex immunofluorescence and identified strong presence of CD7+ cytotoxic T and NK cells in SSc skin and blood. We further showed that targeted depletion of these cells is accompanied by prevention of myofibroblast contraction. Our results demonstrate for the first time that SSc fibrosis may be prevented by T cell mediated immunotoxin treatment and pave the way for novel approaches in halting tissue fibrosis. It was found that CD7 activation regulates cellular cytotoxicity-driven pathologic processes in SSc. Together the findings imply co-stimulatory molecules as key regulators of cytotoxicity-driven pathology in systemic autoimmune disease, yielding a flag for selective depletion of pathogenic cells.

[0002] SEQ ID NO: 1 1 QVQLQQSGAE LARPGASVKM SCKASGYTFT SYTMHWVKQR PGQGLEWIGY 51 INPSSGYTNY IQRFKDKATL TADKSSSTAY MQVSSLTSED SAVYYCARGS 101 RYDYYGMDYW GQGTSVTVSS AKTTPPSVYP LAPGCGDTTG SSVTLGCLVK 151 GYFPESVTVT WNSGSLSSSV HTFPALLQSG LYTMSSSVTV PSSTWPSQTV 201 TCSVAHPASS TTVDKKLEPS GPISTINPCP PCKECHKCPA PNLEGGPSVF 251 IFPPNIKDVL MISLTPKVTC VVVDVSEDDP DVQISWFVNN VEVHTAQTQT 301 HREDYNSTIR VVSTLPIQHQ DWMSGKEFKC KVNNKDLPSP IERTISKIKG 351 LVRAPQVYIL PPPAEQLSRK DVSLTCLVVG FNPGDISVEW TSNGHTEENY 401 KDTAPVLDSD GSYFIYSKLN MKTSKWEKTD SFSCNVRHEG LKNYYLKKTI 451 SRSPGK SEQ ID NO: 2 1 QIVLTQSPAI MSASPGEKVT MTCSASSSVS YMHWYQQKSG TSPKRWIYDT 51 SKLASGVPAR FSGSGSGTSY SLTISSMEAE DAATYYCQQW SSNPLTFGAG 101 TKLELKRADA APTVSIFPPS SEQLTSGGAS VVCFLNNFYP KDINVKWKID 151 GSERQNGVLN SWTDQDSKDS TYSMSSTLTL TKDEYERHNS YTCEATHKTS 201 TSPIVKSFNR NEC SEQ ID NO: 3 1 QVQLQQSGAE LARPGASVKM SCKASGYTFT SYTMHWVKQR PGQGLEWIGY 51 INPSSGYTNY IQRFKDKATL TADKSSSTAY MQVSSLTSED SAVYYCARGS 101 RYDYYGMDYW GQGTSVTVSS SEQ ID NO: 4 1 QIVLTQSPAI MSASPGEKVT MTCSASSSVS YMHWYQQKSG TSPKRWIYDT 51 SKLASGVPAR FSGSGSGTSY SLTISSMEAE DAATYYCQQW SSNPLTFGAG 101 TKLELKR SEQ ID NO: 5 GYTFTSYT SEQ ID NO: 6 INPSSGYT SEQ ID NO: 7 ARGSRYDYYGMDY SEQ ID NO: 8 SSVSY SEQ ID NO: 9 DTS SEQ ID NO: 10 QQWSSNPLT SEQ ID NO: 11 1 QIQLVQSGPE LKKPGETVKI SCKASGYTFT NYGMNWVKQA PGKGLMWLGW 51 INTYTGEPTY ADDFKGRFAF SLETSASTAY LQINNLKNED TATYFCARWA 101 YFYGSSPYFF DYWGQGTTLT VSSAKTTAPS VYPLAPVCGD TTGSSVTLGC 151 LVKGYFPEPV TLTWNSGSLS SGVHTFPAVL QSDLYTLSSS VTVTSSTWPS 201 QSITCNVAHP ASSTKVDKKI EPRGPTIKPC PPCKCPAPNL LGGPSVFIFP 251 PKIKDVLMIS LSPIVTCVVV DVSEDDPDVQ ISWFVNNVEV HTAQTQTHRE 301 DYNSTLRVVS ALPIQHQDWM SGKEFKCKVN NKDLPAPIER TISKPKGSVR 351 APQVYVLPPP EEEMTKKQVT LTCMVTDFMP EDIYVEWTNN GKTELNYKNT 401 EPVLDSDGSY FMYSKLRVEK KNWVERNSYS CSVVHEGLHN HHTTKSFSRT 451 PGK SEQ ID NO: 12 1 QAVVTQESAL TTSPGETVTL TCRSSTGAVT TSNYANWVQE KPDHLFTGLI 51 GGTNNRAPGV PARFSGSLIG DKAALTITGA QTEDEAIYFC ALWCSNHLVF 101 GGGTKLTVLG QPKSSPSVTL FPPSSEELET NKATLVCTIT DFYPGVVTVD 151 WKVDGTPVTQ GMETTQPSKQ SNNKYMASSY LTLTARAWER HSSYSCQVTH 201 EGHTVEKSLS RADCS SEQ ID NO: 13 1 QIQLVQSGPE LKKPGETVKI SCKASGYTFT NYGMNWVKQA PGKGLMWLGW 51 INTYTGEPTY ADDFKGRFAF SLETSASTAY LQINNLKNED TATYFCARWA 101 YFYGSSPYFF DYWGQGTTLT VSS SEQ ID NO: 14 1 QAVVTQESAL TTSPGETVTL TCRSSTGAVT TSNYANWVQE KPDHLFTGLI 51 GGTNNRAPGV PARFSGSLIG DKAALTITGA QTEDEAIYFC ALWCSNHLVF 101 GGGTKLTVL SEQ ID NO: 15 GYTFTNYG SEQ ID NO: 16 INTYTGEP SEQ ID NO: 17 ARWAYFYGSSPYFFDY SEQ ID NO: 18 TGAVTTSNY SEQ ID NO: 19 GTN SEQ ID NO: 20 ALWCSNHLV SEQ ID NO: 21 1 MIFPKQYPII NFTTAGATVQ SYTNFIRAVR GRLTTGADVR HDIPVLPNRV 51 GLPINQRFIL VELSNHAELS VTLALDVTNA YVVGYRAGNS AYFFHPDNQE 101 DAEAITHLFT DVQNRYTFAF GGNYDRLEQL AGNLRENIEL GNGPLEEAIS 151 ALYYYSTGGT QLPTLARSFI ICIQMISEAA RFQYIEGEMR TRIRYNRRSA 201 PDPSVITLEN SWGRLSTAIQ ESNQGAFASP IQLQRRNGSK FSVYDVSILI 251 PIIALMVYRC APPPSSQF References 1. Truchetet ME, Brembilla NC, Chizzolini C. Current Concepts on the Pathogenesis of Systemic Sclerosis. Clin Rev Allergy Immunol.2021. 2. Benfaremo D, Svegliati Baroni S, Manfredi L, Moroncini G, Gabrielli A. Putative functional pathogenic autoantibodies in systemic sclerosis. Eur J Rheumatol.2020;7(Suppl 3):S181-S6. 3. Papadimitriou TI, van Caam A, van der Kraan PM, Thurlings RM. Therapeutic Options for Systemic Sclerosis: Current and Future Perspectives in Tackling Immune-Mediated Fibrosis. Biomedicines.2022;10(2). 4. Maehara T, Kaneko N, Perugino CA, Mattoo H, Kers J, Allard-Chamard H, et al. Cytotoxic CD4+ T lymphocytes may induce endothelial cell apoptosis in systemic sclerosis. J Clin Invest.2020;130(5):2451-64. 5. Lopez-Isac E, Acosta-Herrera M, Kerick M, Assassi S, Satpathy AT, Granja J, et al. GWAS for systemic sclerosis identifies multiple risk loci and highlights fibrotic and vasculopathy pathways. Nat Commun. 2019;10(1):4955. 6. Schnell A, Bod L, Madi A, Kuchroo VK. The yin and yang of co-inhibitory receptors: toward anti-tumor immunity without autoimmunity. Cell Res.2020;30(4):285-99. 7. Grebinoski S, Zhang Q, Cillo AR, Manne S, Xiao H, Brunazzi EA, et al. Autoreactive CD8(+) T cells are restrained by an exhaustion-like program that is maintained by LAG3. Nat Immunol.2022;23(6):868-77. 8. Ishikawa Y, Terao C. Genetics of systemic sclerosis. J Scleroderma Relat Disord.2020;5(3):192-201. 9. Khanna D, Spino C, Johnson S, Chung L, Whitfield ML, Denton CP, et al. Abatacept in Early Diffuse Cutaneous Systemic Sclerosis: Results of a Phase II Investigator-Initiated, Multicenter, Double-Blind, Randomized, Placebo-Controlled Trial. Arthritis Rheumatol.2020;72(1):125-36. 10. Gur C, Wang SY, Sheban F, Zada M, Li B, Kharouf F, et al. LGR5 expressing skin fibroblasts define a major cellular hub perturbed in scleroderma. Cell.2022;185(8):1373-88 e20. 11. Gaydosik AM, Tabib T, Domsic R, Khanna D, Lafyatis R, Fuschiotti P. Single-cell transcriptome analysis identifies skin-specific T-cell responses in systemic sclerosis. Ann Rheum Dis.2021;80(11):1453-60. 12. Jonsson AH, Zhang F, Dunlap G, Gomez-Rivas E, Watts GFM, Faust HJ, et al. Granzyme K(+) CD8 T cells form a core population in inflamed human tissue. Sci Transl Med.2022;14(649):eabo0686. 13. Buckle I, Guillerey C. Inhibitory Receptors and Immune Checkpoints Regulating Natural Killer Cell Responses to Cancer. Cancers (Basel).2021;13(17). 14. Okwor CIA, Oh JS, Crawley AM, Cooper CL, Lee SH. Expression of Inhibitory Receptors on T and NK Cells Defines Immunological Phenotypes of HCV Patients with Advanced Liver Fibrosis. iScience. 2020;23(9):101513. 15. Xia A, Zhang Y, Xu J, Yin T, Lu XJ. T Cell Dysfunction in Cancer Immunity and Immunotherapy. Front Immunol.2019;10:1719. 16. Padilla CM, Valenzi E, Tabib T, Nazari B, Sembrat J, Rojas M, et al. Increased CD8+ tissue resident memory T cells, regulatory T cells, and activated natural killer cells in systemic sclerosis lungs. Rheumatology (Oxford).2023. 17. Lyman SD, Escobar S, Rousseau AM, Armstrong A, Fanslow WC. Identification of CD7 as a cognate of the human K12 (SECTM1) protein. J Biol Chem.2000;275(5):3431-7. 18. Wang T, Huang C, Lopez-Coral A, Slentz-Kesler KA, Xiao M, Wherry EJ, et al. K12 / SECTM1, an interferon-gamma regulated molecule, synergizes with CD28 to costimulate human T cell proliferation. J Leukoc Biol.2012;91(3):449-59. 19. Buskermolen JK, Roffel S, Gibbs S. Stimulation of oral fibroblast chemokine receptors identifies CCR3 and CCR4 as potential wound healing targets. J Cell Physiol.2017;232(11):2996-3005. 20. Lei Y, Takahama Y. XCL1 and XCR1 in the immune system. Microbes and Infection.2012;14(3):262-7. 21. Heinrichs D, Berres ML, Nellen A, Fischer P, Scholten D, Trautwein C, et al. The chemokine CCL3 promotes experimental liver fibrosis in mice. PLoS One.2013;8(6):e66106. 22. Sahin H, Wasmuth HE. Chemokines in tissue fibrosis. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease.2013;1832(7):1041-8. 23. Frangogiannis NG. Transforming growth factor–β in tissue fibrosis. Journal of Experimental Medicine. 2020;217(3). 24. McCormick LL, Zhang Y, Tootell E, Gilliam AC. Anti-TGF-β Treatment Prevents Skin and Lung Fibrosis in Murine Sclerodermatous Graft-Versus-Host Disease: A Model for Human Scleroderma1. The Journal of Immunology.1999;163(10):5693-9. 25. Matsuda M, Tsurusaki S, Miyata N, Saijou E, Okochi H, Miyajima A, et al. Oncostatin M causes liver fibrosis by regulating cooperation between hepatic stellate cells and macrophages in mice. Hepatology. 2018;67(1):296-312. 26. Stawski L, Trojanowska M. Oncostatin M and its role in fibrosis. Connect Tissue Res.2019;60(1):40-9. 27. van Bijnen S, de Vries-Bouwstra J, van den Ende CH, Boonstra M, Kroft L, Geurts B, et al. Predictive factors for treatment-related mortality and major adverse events after autologous haematopoietic stem cell transplantation for systemic sclerosis: results of a long-term follow-up multicentre study. Ann Rheum Dis. 2020;79(8):1084-9. 28. Acosta-Herrera M, Kerick M, Lopéz-Isac E, Assassi S, Beretta L, Simeón-Aznar CP, et al. Comprehensive analysis of the major histocompatibility complex in systemic sclerosis identifies differential HLA associations by clinical and serological subtypes. Annals of the Rheumatic Diseases.2021;80(8):1040-7. 29. Ota Y, Kuwana M. Updates on genetics in systemic sclerosis. Inflammation and Regeneration. 2021;41(1):17. 30. O’Reilly S, Hügle T, van Laar JM. T cells in systemic sclerosis: a reappraisal. Rheumatology. 2012;51(9):1540-9. 31. Jin W, Zheng Y, Zhu P. T cell abnormalities in systemic sclerosis. Autoimmunity Reviews. 2022;21(11):103185. 32. Collier JL, Weiss SA, Pauken KE, Sen DR, Sharpe AH. Not-so-opposite ends of the spectrum: CD8(+) T cell dysfunction across chronic infection, cancer and autoimmunity. Nat Immunol.2021;22(7):809-19. 33. Huang Y, Jia A, Wang Y, Liu G. CD8(+) T cell exhaustion in anti-tumour immunity: The new insights for cancer immunotherapy. Immunology.2023;168(1):30-48. 34. McKinney EF, Lee JC, Jayne DR, Lyons PA, Smith KG. T-cell exhaustion, co-stimulation and clinical outcome in autoimmunity and infection. Nature.2015;523(7562):612-6. 35. Fleury M, Belkina AC, Proctor EA, Zammitti C, Simms RW, Lauffenburger DA, et al. Increased Expression and Modulated Regulatory Activity of Coinhibitory Receptors PD-1, TIGIT, and TIM-3 in Lymphocytes From Patients With Systemic Sclerosis. Arthritis Rheumatol.2018;70(4):566-77. 36. Groth C, van Groningen LFJ, Matos TR, Bremmers ME, Preijers F, Dolstra H, et al. Phase I / II Trial of a Combination of Anti-CD3 / CD7 Immunotoxins for Steroid-Refractory Acute Graft-versus-Host Disease. Biol Blood Marrow Transplant.2019;25(4):712-9. 37. Lazarovits AI, Rochon J, Banks L, Hollomby DJ, Muirhead N, Jevnikar AM, et al. Human mouse chimeric CD7 monoclonal antibody (SDZCHH380) for the prophylaxis of kidney transplant rejection. Transplant Proc. 1993;25(1 Pt 1):820-2. 38. de Wit MPT, Koenders MI, Neijland Y, van den Hoogen FHJ, van der Kraan PM, van de Loo FAJ, et al. Patient involvement in basic rheumatology research at Nijmegen: a three year’s responsive evaluation of added value, pitfalls and conditions for success. BMC Rheumatology.2022;6(1):66. 39. Preliminary criteria for the classification of systemic sclerosis (scleroderma). Subcommittee for scleroderma criteria of the American Rheumatism Association Diagnostic and Therapeutic Criteria Committee. Arthritis Rheum.1980;23(5):581-90. 40. van Oosterhout YV, van Emst L, Schattenberg AV, Tax WJ, Ruiter DJ, Spits H, et al. A combination of anti-CD3 and anti-CD7 ricin A-immunotoxins for the in vivo treatment of acute graft versus host disease. Blood. 2000;95(12):3693-701. 41. Gorris MAJ, van der Woude LL, Kroeze LI, Bol K, Verrijp K, Amir AL, et al. Paired primary and metastatic lesions of patients with ipilimumab-treated melanoma: high variation in lymphocyte infiltration and HLA-ABC expression whereas tumor mutational load is similar and correlates with clinical outcome. J Immunother Cancer.2022;10(5). 42. Bankhead P, Loughrey MB, Fernández JA, Dombrowski Y, McArt DG, Dunne PD, et al. QuPath: Open source software for digital pathology image analysis. Scientific Reports.2017;7(1):16878. 43. Stuart T, Butler A, Hoffman P, Hafemeister C, Papalexi E, Mauck WM, 3rd, et al. Comprehensive Integration of Single-Cell Data. Cell.2019;177(7):1888-902 e21. 44. Becht E, McInnes L, Healy J, Dutertre CA, Kwok IWH, Ng LG, et al. Dimensionality reduction for visualizing single-cell data using UMAP. Nat Biotechnol.2018. 45. Singh P, Zhai Y. Deciphering Hematopoiesis at single cell level through the lens of reduced dimensions. bioRxiv.2022:2022.06.07.495099. 46. Wilcoxon F. Individual Comparisons by Ranking Methods. Biometrics Bulletin.1945;1(6):80-3. 47. Borcherding N, Vishwakarma A, Voigt AP, Bellizzi A, Kaplan J, Nepple K, et al. Mapping the immune environment in clear cell renal carcinoma by single-cell genomics. Communications Biology.2021;4(1):122. 48. Barbie DA, Tamayo P, Boehm JS, Kim SY, Moody SE, Dunn IF, et al. Systematic RNA interference reveals that oncogenic KRAS-driven cancers require TBK1. Nature.2009;462(7269):108-12. 49. Antoneli F, Passos FM, Lopes LR, Briones MRS. A Kolmogorov-Smirnov test for the molecular clock based on Bayesian ensembles of phylogenies. PLoS One.2018;13(1):e0190826. 50. Langfelder P, Horvath S. WGCNA: an R package for weighted correlation network analysis. BMC Bioinformatics.2008;9(1):559. 51. He X, de Oliveira VL, Keijsers R, Joosten I, Koenen HJ. Lymphocyte Isolation from Human Skin for Phenotypic Analysis and Ex Vivo Cell Culture. J Vis Exp.2016(110):e52564.

Claims

Claims 1. A pharmaceutical composition for targeting activated pathogenic T and / or NK cells in a patient with a chronic inflammatory or autoimmune disease, wherein the pharmaceutical composition comprises a first molecule specifically recognizing CD7.

2. The pharmaceutical composition for use according to claim 1, wherein the activated pathogenic T and / or NK cells are selected from the group consisting of CD8 cytotoxic T cells, CD4 helper T cells, follicular helper T cells, proliferating T cells, and combinations thereof.

3. The pharmaceutical composition for use according to claim 1 or 2, wherein the chronic inflammatory and autoimmune disease is systemic sclerosis or Sjögren’s syndrome.

4. The pharmaceutical composition for use according to any one of claims 1 to 3, wherein the patient shows symptoms of vasculopathy, fibrosis and / or autoimmune inflammation.

5. The pharmaceutical composition for use according to any one of claims 1 to 4, wherein the pharmaceutical composition targets activated pathogenic T and / or NK cells by selective depletion of the activated pathogenic T and / or NK cells, or by membrane receptor inhibition, or by intracellular kinase inhibition.

6. The pharmaceutical composition for use according to any one of claims 1 to 5, wherein the activated pathogenic T and / or NK cells comprise activated pathogenic T and / or NK cells in the patient’s blood and / or inflamed tissues.

7. The pharmaceutical composition for use according to any one of claims 1 to 6, wherein the composition further comprises a second molecule specifically recognizing CD3.

8. The pharmaceutical composition for use according to any one of claims 1 to 7, wherein the first molecule and / or the second molecule is an antibody, or a fragment of a derivative thereof.

9. The pharmaceutical composition for use according to claim 8, wherein the first molecule is a monoclonal antibody, preferably a monoclonal IgG2a antibody, more preferably an anti- (human) CD7 murine lgG2a monoclonal antibody; and / or wherein the second molecule is a monoclonal antibody, preferably a monoclonal IgG2b antibody, more preferably an anti- (human)CD3 murine IgG2b monoclonal antibody.

10. The pharmaceutical composition for use according to claim 8 or 9, a. wherein the first molecule comprises a combination of complementary determining region (CDR) sequences, wherein the CDR sequences comprises a CDR3 sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 17; and / or b. wherein the second molecule comprises a combination of complementary determining region (CDR) sequences, wherein the CDR sequences comprises a CDR3 sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 7.

11. The pharmaceutical composition for use according to any one of claims 1 to 10, wherein the first molecule is WT1; and / or wherein the second molecule is SPV-T3a.

12. The pharmaceutical composition for use according to any one of claims 1 to 11, wherein the first molecule, or the second molecule, or both, is provided with at least one toxin moiety, preferably a recombinant A chain of ricin, for example a recombinant A chain of ricin having at least 95% sequence identity with the amino acid sequence of SEQ ID NO:

21.

13. The pharmaceutical composition for use according to any one of claims 1 to 12, wherein the composition comprises one or more excipients, carriers, buffer agents, stabilisers, tonicizing adjusting agents, preservatives, or preservatives or anti-oxidants.

14. The pharmaceutical composition for use according to any one of claims 1 to 12, wherein the pharmaceutical composition is administered by intravenous, cutaneous or subcutaneous injection.

15. A method targeting activated pathogenic T and / or NK cells in a chronic inflammatory or autoimmune disease in a patient, comprising administering to the patient an effective amount of a pharmaceutical composition comprising a first molecule specifically recognizing CD7.

Images