Aav purification method

Abstract

Provided herein are methods for obtaining an AAV full capsid from an AAV starting preparation comprising the full capsid and an empty capsid. In some embodiments, the AAV starting preparation is applied to an anion exchange chromatography (AEX) column, an elution buffer comprising a divalent cation salt is applied to the AEX column, and an eluted fraction that comprises the AAV full capsid in a greater proportion than the AAV empty capsid is collected from the anion exchange chromatography column. In particular embodiments, a wash buffer comprising a monovalent cation salt is applied to the AEX column before the divalent cation salt elution buffer, and a wash fraction that comprises the AAV empty capsid in a greater proportion than the AAV full capsid is eluted from the AEX column.

Description

AAV PURIFICATION METHODFIELD OF THE INVENTION

[0001] The present disclosure provides compositions and methods related to obtaining an adeno-associated virus (AAV) full capsid, such as methods of separating an AAV full capsid from an AAV starting preparation comprising the AAV full capsid, such as using column chromatography techniques.CROSS REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority to United States Provisional Application No. 63 / 468,965, filed May 25, 2023, which is incorporated by reference in its entirety.SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on April 30, 2024, is named 01277-0039-00PCT and is 6,592 bytes in size.INTRODUCTION

[0004] The use of adeno-associated viruses (AAVs), such as recombinant adeno-associated viruses (rAAVs) for a variety of gene therapy and vaccine approaches has been described. However, efficient, scalable methods for purification of AAVs are lacking.

[0005] Adeno-associated virus (AAV), a member of the Parvovirus family, is a small, nonenveloped virus. AAV particles comprise an AAV capsid composed of 60 capsid protein subunits that are each made up of VP1, VP2, and VP3 proteins. The VP1, VP2, and VP3 proteins are present in a predicted ratio of about 1 : 1 :10 and have icosahedral symmetry. The AAV capsid encloses a small, single-stranded DNA (ssDNA) genome of about 4.8 kilobases (kb). The ssDNA AAV genome includes two open reading frames, Rep and Cap, flanked by two 145-base inverted terminal repeats (ITRs). These ITRs base pair to allow for synthesis of the complementary DNA strand. Rep and Cap are translated to produce multiple distinct proteins (Rep78, Rep68, Rep52, Rep40, which play important roles in the AAV life cycle; and the VP1, VP2, and VP3 capsid proteins).

[0006] Generally, individual AAV particles package only one DNA molecule strand (either the plus or minus strand). The AAV life cycle includes a latent phase and an infectious phase,and particles containing either strand can be infectious. Replication occurs by conversion of the linear single stranded DNA genome to a duplex form followed by amplification. Progeny single strands are subsequently rescued, replicated, and packaged into capsids in the presence of helper molecules. The properties of non-pathogenicity, broad host range of infectivity (including in non-dividing cells), and integration make AAV an attractive delivery vehicle, such as for therapeutic applications.

[0007] Recombinant AAV particles are produced in permissive (packaging) host cell cultures. Replication and packaging of the recombinant genome into the viral particle requires co-expression of helper virus AAV replication (Rep) and AAV capsid (Cap) genes, such as from a transfer plasmid. When constructing an AAV transfer plasmid, a transgene may be placed between the two ITRs, and Rep and Cap can be supplied in trans. Genes necessary for genome replication, capsid formation, and genome packaging can be expressed from transfected plasmids, integrated into the host cell genome, or introduced to the host cells using recombinant viruses. For example, a transfer plasmid comprising Rep / Cap, and a helper plasmid comprising E4, E2a, and VA, may be transfected into host cells containing the adenovirus gene E1+, to produce infectious AAV particles.

[0008] Generally, host cells are lysed to release infectious AAV particles, such as infectious rAAV particles, and to maximize recovery yield. However, the cell lysate contains various cellular components, such as host cell DNA, host cell proteins, media components, and in some instances, helper virus or helper virus plasmid DNA, which must be separated from the AAV vector before it is suitable for use, such as for delivery of a therapeutic nucleic acid of interest in vivo. Advances in AAV production include the use of non-adherent cell suspension processes in stirred tank bioreactors and production conditions whereby AAV particles (such as rAAVs) are released into the media or supernatant, reducing the concentration of host cellular components present in the production material but still resulting in appreciable amounts of in-process impurities. Therefore, AAV particles (such as rAAVs) may be collected from the media and / or cell lysate and further purified.

[0009] However, industry standard purification methods, such as standard chromatography purification techniques, rarely achieve efficient separation of pharmacologically active (full) AAV capsids from empty capsids, partially empty capsids, and / or other impurities present in the media and / or cell lysate. Accordingly, the present disclosure presents improved methods for obtaining an AAV full capsid, such as an AAV (such as a rAAV) full capsid comprising a therapeutic nucleic acid of interest, from an AAV starting preparation comprising the AAVfull capsid, genome-deficient intermediates (i.e., an AAV empty capsid and / or an AAV partially empty capsid), and / or other impurities.SUMMARY

[0010] Methods of obtaining an AAV full capsid from an AAV starting preparation comprising the AAV full capsid and an AAV empty capsid (and / or an AAV partially empty capsid) are provided. In some embodiments, the AAV starting preparation is applied to an anion exchange chromatography (AEX) column. In such embodiments, an elution buffer comprising a salt comprising a divalent cation (i.e., a divalent cation salt elution buffer) is applied to the column, and an eluted fraction that comprises the AAV full capsid in a greater proportion than the AAV empty capsid is collected from the AEX column. In some embodiments, the elution buffer does not comprise a monovalent cation salt (such as NaCl) prior to being applied to the column.

[0011] In some embodiments, a wash buffer comprising a salt comprising a monovalent cation (i.e., a monovalent cation salt wash buffer) is applied to the AEX column before the divalent cation salt elution buffer, wherein applying the monovalent cation salt wash buffer elutes from the AEX column a wash fraction that comprises the AAV empty capsid in a greater proportion than the AAV full capsid. In particular embodiments, the monovalent cation salt wash buffer does not comprise a divalent cation salt.

[0012] The following exemplary embodiments are provided.

[0013] Embodiment l is a method of obtaining an adeno-associated virus (AAV) full capsid from an AAV starting preparation comprising the AAV full capsid and an AAV empty capsid, the method comprising:(a) applying the AAV starting preparation to an anion exchange chromatography column; and(b) applying a divalent cation salt elution buffer comprising a divalent cation salt to the anion exchange chromatography column, wherein the divalent cation salt elution buffer does not comprise a monovalent cation salt, and wherein applying the divalent cation salt elution buffer elutes from the anion exchange chromatography column an eluted fraction that comprises the AAV full capsid in a greater proportion than the AAV empty capsid.

[0014] Embodiment 2 is the method of any one of the preceding embodiments, wherein the eluted fraction comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% of the AAV full capsid from the AAV starting preparation.

[0015] Embodiment 3 is the method of any one of the preceding embodiments, wherein the proportion of AAV full capsid compared to total AAV capsid in the eluted fraction is at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, or at least 60%.

[0016] Embodiment 4 is the method of any one of the preceding embodiments, wherein a ratio of AAV full capsid to AAV empty capsid in the eluted fraction is at least 1.5 to 1, at least 1.6 to 1, at least 1.7 to 1, at least 1.8 to 1, at least 1.9 to 1, at least 2 to 1, at least 2.25 to 1, at least 2.5 to 1, at least 2.75 to 1, at least 3 to 1, at least 4 to 1, at least 5 to 1, at least 10 to 1, at least 20 to 1, at least 30 to 1, at least 40 to 1, at least 50 to 1, or at least 100 to 1.

[0017] Embodiment 5 is the method of any one of the preceding embodiments, wherein at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV full capsid is eluted from the anion exchange chromatography column before the AAV empty capsid.

[0018] Embodiment 6 is the method of any one of the preceding embodiments, wherein the eluted fraction comprises no more than 70%, no more than 65%, no more than 60%, no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, or no more than 2%, or no more than 1% AAV empty capsid.

[0019] Embodiment 7 is the method of any one of the preceding embodiments, wherein the divalent cation salt elution buffer is applied to the anion exchange chromatography column under conditions whereby at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or substantially all of the AAV full capsid is eluted from the column and at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV empty capsid remains bound to the column.

[0020] Embodiment 8 is the method of any one of embodiments 1-7, wherein the divalent cation salt elution buffer is applied at a constant concentration.

[0021] Embodiment 9 is the method of any one of embodiments 1-7, wherein the divalent cation salt elution buffer is applied in a linear gradient.

[0022] Embodiment 10 is the method of any one of embodiments 1-9, wherein the eluted fraction is a first eluted fraction and a second eluted fraction is eluted after the first eluted fraction.

[0023] Embodiment 11 is the method of embodiment 10, wherein the second eluted fraction comprises a greater proportion of the AAV empty capsid than the first eluted fraction.

[0024] Embodiment 12 is the method of any one of embodiment 10 or embodiment 11, wherein the second eluted fraction comprises no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, or no more than 2%, or no more than 1% AAV full capsid.

[0025] Embodiment 13 is the method of any one of the preceding embodiments, further comprising applying a monovalent cation salt wash buffer comprising a monovalent cation salt to the column before applying the divalent cation salt elution buffer, wherein the monovalent cation salt wash buffer does not comprise a divalent cation salt, and wherein applying the monovalent cation salt buffer elutes from the anion exchange chromatography column a wash fraction that comprises the AAV empty capsid in greater proportion than the AAV full capsid.

[0026] Embodiment 14 is the method of embodiment 13, wherein the monovalent cation salt wash buffer is applied at a constant concentration.

[0027] Embodiment 15 is the method of embodiment 13, wherein the monovalent cation salt wash buffer is applied in a linear gradient.

[0028] Embodiment 16 is a method of obtaining an adeno-associated virus (AAV) full capsid from an AAV starting preparation comprising the AAV full capsid and an AAV empty capsid, the method comprising:(a) applying the AAV starting preparation to an anion exchange chromatography column;(b) applying a monovalent cation salt wash buffer to the column, thereby(c) eluting from the anion exchange chromatography column a wash fraction that comprises the AAV empty capsid in greater proportion than the AAV full capsid; and(d) applying a divalent cation salt elution buffer to the anion exchange chromatography column, thereby eluting from the anion exchange chromatography column an eluted fraction that comprises the AAV full capsid in a greater proportion than the AAV empty capsid.

[0029] Embodiment 17 is the method of embodiment 16, wherein the eluted fraction comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% of the AAV full capsid from the AAV starting preparation.

[0030] Embodiment 18 is the method of embodiment 16 or embodiment 17, wherein the proportion of AAV full capsid compared to total AAV capsid in the eluted fraction is at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, or at least 60%.

[0031] Embodiment 19 is the method of any one of embodiments 16-18, wherein a ratio of AAV full capsid to AAV empty capsid in the eluted fraction is at least 1.5 to 1, at least 1.6 to 1, at least 1.7 to 1, at least 1.8 to 1, at least 1.9 to 1, at least 2 to 1, at least 2.25 to 1, at least 2.5 to 1, at least 2.75 to 1, at least 3 to 1, at least 4 to 1, at least 5 to 1, at least 10 to 1, at least 20 to 1, at least 30 to 1, at least 40 to 1, at least 50 to 1, or at least 100 to 1.

[0032] Embodiment 20 is the method of any one of embodiments 16-19, wherein the wash fraction comprises at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or substantially 100% empty capsid.

[0033] Embodiment 21 is the method of any one of embodiments 16-20, wherein the eluted fraction comprises no more than 70%, no more than 65%, no more than 60%, no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, or no more than 2%, or no more than 1% AAV empty capsid.

[0034] Embodiment 22 is the method of any one of embodiments 13-21, wherein at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV empty capsid is eluted from the anion exchange chromatography column before the AAV full capsid.

[0035] Embodiment 23 is the method of any one of embodiments 13-22, wherein the monovalent cation salt wash buffer is applied to the anion exchange chromatography column under conditions whereby at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV empty capsid is eluted from the column and at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV full capsid remains bound to the column.

[0036] Embodiment 24 is the method of any one of the preceding embodiments, wherein the divalent cation salt elution buffer does not comprise NaCl.

[0037] Embodiment 25 is the method of any one of the preceding embodiments, wherein the divalent cation salt elution buffer comprises 50-150 mM, 50-100 mM, 70-120 mM, 80-110 mM, or 100 mM divalent cation salt.

[0038] Embodiment 26 is the method of any one of the preceding embodiments, wherein the divalent cation salt comprises a divalent cation selected from Mg2+, Ca2+, or Sr2+.

[0039] Embodiment 27 is the method of any one of the preceding embodiments, wherein the divalent cation salt is magnesium chloride (MgC12), calcium chloride (CaC12), magnesiumsulfate (MgS04), magnesium phosphate (MgP04), calcium acetate (Ca^HsCE)?), calcium sulfate (CaSO4), magnesium acetate (Mg^HsCE)?), or magnesium citrate (MgC6H6O7).

[0040] Embodiment 28 is the method of any one of the preceding embodiments, wherein the divalent cation salt is MgC12, CaC12, or MgSO4.

[0041] Embodiment 29 is the method of any one of the preceding embodiments, wherein the divalent cation salt elution buffer comprises:(a) 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, or 50 mM MgC12;(b) 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, or 50 mM CaC12; or(c) 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, or 50 mM MgSO4.

[0042] Embodiment 30 is the method of any one of the preceding embodiments, wherein the divalent cation salt elution buffer comprises a buffering agent.

[0043] Embodiment 31 is the method of any one of the preceding embodiments, wherein the divalent cation salt elution buffer comprises 5-100 mM, 10-100 mM, 10-50 mM, 10-40 mM, 10-30 mM, 20-30 mM, or 25 mM buffering agent.

[0044] Embodiment 32 is the method of embodiment 30 or embodiment 31, wherein the buffering agent is selected from Tris, Bis-Tris propane, CHES (N-cyclohexyl-2- aminoethanesulfonic acid), or AMPSO (N-(l,l-dimethyl-2-hydroxyethyl)-3-amino-2- hydroxypropanesulfonic acid).

[0045] Embodiment 33 is the method of any one of the preceding embodiments, wherein the divalent cation salt elution buffer comprises a stabilizing agent.

[0046] Embodiment 34 is the method of embodiment 33, wherein the stabilizing agent is selected from poloxamer, polysorbate 80 (PS-80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose.

[0047] Embodiment 35 is the method of any one of the preceding embodiments, wherein the divalent cation salt elution buffer is about pH 7-10, about 8.5-9.5, or about pH 9.

[0048] Embodiment 36 is the method of any one of the preceding embodiments, wherein the divalent cation salt elution buffer comprises(a) 25 mM Tris, 100 mM divalent cation salt, and 0.001% poloxamer, and is about pH 9;(b) 25 mM Tris, 38 mM divalent cation salt, and 0.001% poloxamer, and is about pH 9; or(c) 25 mM Tris, 33 mM divalent cation salt, and 0.001% poloxamer, and is about pH 9.

[0049] Embodiment 37 is the method of any one of embodiments 13-36, wherein the monovalent cation salt wash buffer comprises 5-300 mM, 5-250 mM, 5-200 mM, 50-150 mM, 50-100 mM, 70-120 mM, 80-110 mM, or 100 mM monovalent cation salt.

[0050] Embodiment 38 is the method of any one of embodiments 13-37, wherein the monovalent cation salt is NaCl, Na2SO4, Na3PO4, or CEECOONa.

[0051] Embodiment 39 is the method of any one of embodiments 13-38, wherein the monovalent cation salt wash buffer comprises(a) 50-200 mM, 50-150 mM, 100-200 mM, 125-175 mM, or 150 mM NaCl;(b) 15-125 mM, 15-100 mM, 25-100 mM, 25-75 mM, or 50 mM Na2SO4;(c) 10-225 mM, 10-200 mM, 25-175 mM, 25-150 mM, 50-125 mM, 100-200 mM, 125- 175 mM, 15-125 mM, 15-100 mM, 25-100 mM, or 25-75 mM Na3PO4; or(d) 10-225 mM, 10-200 mM, 25-175 mM, 25-150 mM, 50-125 mM, 100-200 mM, 125- 175 mM, 15-125 mM, 15-100 mM, 25-100 mM, or 25-75 mM CJLCOONa.

[0052] Embodiment 40 is the method of any one of embodiments 13-39, wherein the monovalent cation salt wash buffer comprises a buffering agent.

[0053] Embodiment 41 is the method of any one of embodiments 13-40, wherein the monovalent cation salt wash buffer comprises 5-100 mM, 10-100 mM, 10-50 mM, 10-40 mM, 10-30 mM, 20-30 mM, or 25 mM buffering agent.

[0054] Embodiment 42 is the method of embodiment 40 or 41, wherein the buffering agent is selected from Tris, Bis-Tris propane, CHES (N-cyclohexyl-2-aminoethanesulfonic acid), or AMPSO (N-(l, l-dimethyl-2-hydroxyethyl)-3-amino-2-hydroxypropanesulfonic acid).

[0055] Embodiment 43 is the method of embodiments 13-42, wherein the monovalent cation salt wash buffer comprises a stabilizing agent.

[0056] Embodiment 44 is the method of embodiment 43, wherein the stabilizing agent is selected from poloxamer, polysorbate 80 (PS-80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose.

[0057] Embodiment 45 is the method of any one of embodiments 13-44, wherein the monovalent cation salt wash buffer is about pH 7.0-10.0, about pH 8.5-9.5, or about pH 9.

[0058] Embodiment 46 is the method of any one of embodiments 13-45, wherein the monovalent cation salt wash buffer comprises 25 mM Tris, 150 mM NaCl, and 0.001% poloxamer, and is about pH 9.

[0059] Embodiment 47 is the method of any one of embodiments 13-45, wherein the monovalent cation salt wash buffer comprises 25 mM Tris, 50 mM Na2SO4, and 0.001% poloxamer, and is about pH 9.

[0060] Embodiment 48 is the method of any one of embodiments 9-47, wherein the linear gradient is from 0%-100% divalent cation salt elution buffer.

[0061] Embodiment 49 is the method of any one of the preceding embodiments, wherein prior to applying the divalent cation salt elution buffer to the anion exchange chromatography column, the anion exchange chromatography column is washed with a flush buffer, wherein the flush buffer does not comprise a monovalent cation salt or does not comprise a divalent cation salt.

[0062] Embodiment 50 is the method of any one of embodiments 9-49, wherein the linear gradient is formed with a flush buffer and the divalent cation salt elution buffer, wherein the flush buffer does not comprise a monovalent cation salt or does not comprise a divalent cation salt.

[0063] Embodiment 51 is the method of embodiment 50, wherein the linear gradient is from 100%-0% flush buffer.

[0064] Embodiment 52 is the method of any one of embodiments 49-51, wherein the flush buffer comprises a buffering agent selected from Tris, Bis-Tris propane, CHES (N- cyclohexyl-2-aminoethanesulfonic acid), or AMPSO (N-(l,l-dimethyl-2-hydroxyethyl)-3- amino-2-hydroxypropanesulfonic acid).

[0065] Embodiment 53 is the method of any one of embodiments 49-52, wherein the flush buffer comprises 5-100 mM, 10-100 mM, 10-50 mM, 10-40 mM, 10-30 mM, 20-30 mM, or 25 mM buffering agent.

[0066] Embodiment 54 is the method of any one of embodiments 49-53, wherein the flush buffer comprises a stabilizing agent.

[0067] Embodiment 55 is the method of embodiment 54, wherein the stabilizing agent is selected from poloxamer, polysorbate 80 (PS-80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose.

[0068] Embodiment 56 is the method of any one of embodiments 49-55, wherein the flush buffer is about pH 7.0-10.0, about pH 8.5-9.5, or about pH 9.

[0069] Embodiment 57 is the method of any one of embodiments 49-56, wherein the flush buffer comprises 25 mM Tris and 0.001% poloxamer, and is about pH 9.

[0070] Embodiment 58 is the method of any one of the preceding embodiments, wherein prior to applying the divalent cation salt elution buffer to the anion exchange chromatography column, the anion exchange chromatography column is washed with an equilibration buffer comprising 10-100 mM monovalent cation salt.

[0071] Embodiment 59 is the method of embodiment 58, wherein the equilibration buffer is applied to the anion exchange chromatography column after the monovalent cation salt wash buffer is applied to the anion exchange chromatography column.

[0072] Embodiment 60 is the method of embodiment 58 or embodiment 59, wherein the equilibration buffer comprises the monovalent cation salt at a concentration of 10-80 mM, 20-80 mM, 25-75 mM, 30-70 mM, 40-60 mM, 50 mM, or 60 mM.

[0073] Embodiment 61 is the method of any one of embodiments 58-60, wherein the monovalent cation salt is selected from NaCl, Na2SO4, Na3PO4, CEhCOONa, or sodium citrate.

[0074] Embodiment 62 is the method of embodiment 61, wherein the sodium citrate is monosodium citrate (NaC6H7O7), disodium citrate (Na2C6H6O7), or trisodium citrate (Na3C6H5O7).

[0075] Embodiment 63 is the method of any one of embodiments 58-62, wherein the equilibration buffer comprises a buffering agent.

[0076] Embodiment 64 is the method of embodiment 63, wherein the equilibration buffer comprises 5-100 mM, 10-100 mM, 10-50 mM, 10-40 mM, 10-30 mM, 20-30 mM, or 25 mM buffering agent.

[0077] Embodiment 65 is the method of embodiment 63 or embodiment 64, wherein the buffering agent is selected from Tris, Bis-Tris propane, CHES (N-cyclohexyl-2- aminoethanesulfonic acid), or AMPSO (N-(l,l-dimethyl-2-hydroxyethyl)-3-amino-2- hydroxypropanesulfonic acid).

[0078] Embodiment 66 is the method of any one of embodiments 58-65, wherein the equilibration buffer comprises a stabilizing agent.

[0079] Embodiment 67 is the method of embodiment 66, wherein the stabilizing agent is selected from poloxamer, polysorbate 80 (PS-80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose.

[0080] Embodiment 68 is the method of any one of embodiments 58-68, wherein the equilibration buffer is about pH 7.0-10.0, about pH 8.5-9.5, or about pH 9.

[0081] Embodiment 69 is the method of any one of embodiments 58-70, wherein the equilibration buffer comprises 25 mM Tris, 60 mM NaCl, and 0.001% poloxamer, and is about pH 9.

[0082] Embodiment 70 is the method of any one of embodiments 58-70, wherein the equilibration buffer comprises 25 mM Tris, 20 mM Na2SO4, and 0.001% poloxamer, and is about pH 9.

[0083] Embodiment 71 is the method of any one of the preceding embodiments, wherein the anion exchange chromatography column comprises a matrix comprising a functional ligand selected from a mixed amine, a quaternary amine, trimethylammoniumethyl (TMAE),dimethylaminopropyl, diethylaminoethyl (DEAE), dimethylaminoethyl (DMAE), polyethyleneimine (PI), or guanidinium.

[0084] Embodiment 72 is the method of embodiment 71, wherein the mixed amine comprises polyethyleneimine.

[0085] Embodiment 73 is the method of embodiment 72, wherein the quaternary amine comprises quatemized polyethyleneimine.

[0086] Embodiment 74 is the method of any one of the preceding embodiments, wherein the AAV starting preparation is applied to the anion exchange chromatography column under conditions whereby the AAV full capsid and the AAV empty capsid bind the column.

[0087] Embodiment 75 is the method of any one of embodiments 9-74, wherein the AAV full capsid elutes from the anion exchange chromatography column between 10% and 90%, 15% and 85%, 20% and 80%, or 30% and 70% divalent cation salt elution buffer in the linear gradient of the divalent cation salt elution buffer.

[0088] Embodiment 76 is the method of any one of the preceding embodiments, wherein the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12.

[0089] Embodiment 77 is the method of any one of the preceding embodiments, wherein the AAV is AAV6.

[0090] Embodiment 78 is the method of any one of the preceding embodiments, wherein the AAV capsid comprises an AAV capsid protein, and wherein the AAV capsid protein is a chimeric capsid, engineered capsid, or natural capsid.

[0091] Embodiment 79 is the method of any one of the preceding embodiments, wherein the AAV is a recombinant AAV.

[0092] Embodiment 80 is the method of any one of the preceding embodiments, wherein the AAV is a pseudotyped AAV.

[0093] Embodiment 81 is the method of embodiment 80, wherein the pseudotyped AAV is AAV2 / 5, AAV2 / 8, or AAV2 / 7.

[0094] Embodiment 82 is the method of any one of the preceding embodiments, wherein the AAV is a self-complementary AAV.

[0095] Embodiment 83 is the method of any one of the preceding embodiments, wherein the AAV full capsid comprises a nucleic acid molecule of interest.

[0096] Embodiment 84 is the method of the immediately preceding embodiment, wherein the nucleic acid molecule of interest encodes a chimeric antigen receptor (CAR) or T cell receptor (TCR).

[0097] Embodiment 85 is the method of any one of the preceding embodiments, further comprising culturing an AAV packaging cell in media that allows production of AAV particles, wherein the AAV particles comprise an AAV capsid protein and a nucleic acid molecule that comprises an AAV 5’ inverted terminal repeat (ITR), a nucleic acid molecule of interest to be packaged into the AAV capsid, and a 3’ ITR, and wherein the cell comprises (i) the at least one nucleic acid of interest to be packaged into the AAV capsid, (ii) a nucleic acid molecule encoding the AAV capsid protein under control of one or more sequences that direct its expression in the packaging cell, (iii) a nucleic acid molecule encoding an AAV rep protein that expresses the AAV rep protein in the cell to permit packaging of the nucleic acid of interest into the AAV capsid, and (iv) one or more helper functions required for packaging the nucleic acid molecule of interest into the AAV capsid.

[0098] Embodiment 86 is the method of embodiment 85, further comprising harvesting the AAV particles from the AAV packaging cell and / or from the media, wherein the harvesting comprises cell disruption or wherein the harvesting substantially does not comprise cell disruption, thereby providing the AAV starting preparation.

[0099] Embodiment 87 is the method of embodiment 86, wherein the cell disruption comprises cell lysis, thereby providing a cell lysate.

[0100] Embodiment 88 is the method of any one of embodiments 85-87, wherein the AAV starting preparation comprises the media and / or the cell lysate.

[0101] Embodiment 89 is the method of any one of embodiments 85-88, wherein the harvesting the AAV particles from the cell and / or the media comprises collecting the media substantially without cell disruption.

[0102] Embodiment 90 is the method of any one of embodiments 85-89, wherein the AAV packaging cell is stably transformed with one or more nucleic acid molecules encoding the one or more helper functions.

[0103] Embodiment 91 is the method of any one of embodiments 86-91, wherein the one or more helper functions are expressed under an activatable or inducible promoter.

[0104] Embodiment 92 is the method of any one of embodiments 85-91, wherein the AAV packaging cell is stably transformed with the nucleic acid molecule encoding the AAV rep protein and / or the nucleic acid molecule encoding the AAV capsid protein.

[0105] Embodiment 93 is the method of any one of embodiments 85-92, wherein the AAV rep protein and / or the AAV capsid protein are expressed under direction of an activatable or inducible promoter.

[0106] Embodiment 94 is the method of any one of embodiments 85-93, wherein the AAV packaging cell is stably transformed with the nucleic acid molecule of interest.BRIEF DESCRIPTION OF THE DRAWINGS

[0107] FIG. 1 illustrates a chromatogram of an AAV6 preparation separated using an industry standard method, as described in Example 1. A260 (line extending lowest at empty vector), A280 (line extending second highest at empty vector), and conductivity (line extending from Y axis beginning at approximately 3.5 mAU) profiles are shown. Absorbance intensity (milli-absorbance units, mAU) is shown on the y axis (far left). Run volume (mL) is shown as solid line beneath the x axis while buffer is indicated on the x axis above the run volume. The major peaks (labeled “empty” and “full”) are indicated. The peak fraction pool boundaries are indicated by vertical dotted lines on the x axis and the percent recovery of AAV full capsid in each peak fraction pool are indicated separately in Table 2.

[0108] FIG. 2 illustrates a chromatogram of an exemplary AAV6 preparation separated using a MgCh gradient, as described in Example 2. A260 (line extending lowest at empty vector), A280 (line extending second highest at empty vector), and conductivity (line extending fromY axis beginning at approximately 5 mAU) profiles are shown. Absorbance intensity (mAU) is shown on the y axis. Run volume (mL) is shown as solid line beneath the x axis while buffer is indicated on the x axis above the run volume. The major peaks (labeled “full vector,” “empty+full vector,” and “empty vector”) are indicated. The peak fraction pool boundaries are indicated by vertical dotted lines on the x axis and the percent recovery of AAV full capsid in each peak fraction pool are indicated separately in Table 4.

[0109] FIG. 3 illustrates a chromatogram of an exemplary AAV6 preparation separated using a CaCh gradient, as described in Example 3. A260 (line extending lowest at empty vector), A280 (line extending second highest at empty vector), and conductivity (line extending fromY axis beginning at approximately -12 mAU) profiles are shown. Absorbance intensity (mAU) is shown on the y axis. Run volume (mL) is shown as solid line beneath the x axis while buffer is indicated on the x axis above the run volume. The major peaks (labeled “full vector” and “empty vector”) are indicated. The peak fraction pool boundaries are indicated by vertical dotted lines on the x axis and the percent recovery of AAV full capsid in each peak fraction pool are indicated separately in Table 6

[0110] FIG. 4 illustrates a chromatogram of an exemplary AAV6 preparation separated using a NaCl wash step and a MgCh gradient, as described in Example 4. A260 (line extending lowest at empty vector), A280 (line extending second highest at empty vector), andconductivity (line extending from Y axis beginning at approximately 12 mAU) profiles are shown. Absorbance intensity (mAU) is shown on the y axis. Run volume (mL) is shown as solid line beneath the x axis while buffer is indicated on the x axis above the run volume. The major peaks (labeled “empty vector,” “full vector,” and “second “full” peak”) are indicated. The peak fraction pool boundaries are indicated by vertical dotted lines on the x axis and the percent recovery of AAV full capsid in each peak fraction pool are indicated separately in Table 8.

[0111] FIG. 5 illustrates a chromatogram of an exemplary AAV6 preparation separated using a Na2SO4 wash step and a MgSCh gradient, as described in Example 5. A260 (line extending lowest at empty vector), A280 (line extending second highest at empty vector), and conductivity (line extending from Y axis beginning at approximately 12 mAU) profiles are shown. Absorbance intensity (mAU) is shown on the y axis. Run volume (mL) is shown as solid line beneath the x axis while buffer is indicated on the x axis above the run volume. The major peaks (labeled “empty capsid,” “full capsid,” and “second full capsid peak”) are indicated. The peak fraction pool boundaries are indicated by vertical dotted lines on the x axis and the percent recovery of AAV full capsid in each peak fraction pool are indicated separately in Table 10.

[0112] FIG. 6 illustrates a chromatogram of an exemplary AAV6 preparation comprising an exemplary transgene A, separated using a Na2SO4 wash step and a MgSCh isocratic elution, as described in Example 6. A260 (line extending lowest in peak on the left), A280 (line extending highest in peak on the left), and conductivity (line extending from y axis beginning at approximately 50 mAu) profiles are shown. Absorbance intensity (mAU) is shown on the left y axis and Conductivity (mS / cm) is shown on the right y axis. Column volumes (CVs) are shown on the x axis. The major peaks (labeled “full vector” and “empty vector”) are indicated. The peak fraction pool boundaries are indicated by vertical dotted lines on the x axis and the percent recovery of AAV full capsid in each peak fraction pool is indicated separately in Table 12.

[0113] FIG. 7 illustrates a chromatogram of an exemplary AAV6 preparation comprising an exemplary transgene B, separated using a Na2SO4 wash step and a MgSCh isocratic elution, as described in Example 7. A260 (line extending lowest in peak on the left), A280 (line extending highest in peak on the left), and conductivity (line extending from y axis beginning at approximately 50 mAu) profiles are shown. Absorbance intensity (mAU) is shown on the left y axis and Conductivity (mS / cm) is shown on the right y axis. Column volumes (CVs) are shown on the x axis. The major peaks (labeled “full vector” and “empty vector”) areindicated. The peak fraction pool boundaries are indicated by vertical dotted lines on the x axis and the percent recovery of AAV full capsid in each peak fraction pool is indicated separately in Table 14.

[0114] FIG. 8 illustrates a chromatogram of an exemplary AAV6 preparation comprising an exemplary transgene B, separated using a smaller volume column (a 4 mL column as compared to a 40 mL column in FIGS. 6 and 7) with a Na2SO4 wash step and a MgSCh isocratic elution, as described in Example 8. A260 (line extending lowest in peak on the left), A280 (line extending highest in peak on the left), and conductivity (line extending from y axis beginning at approximately 50 mAu) profiles are shown. Absorbance intensity (mAU) is shown on the left y axis and Conductivity (mS / cm) is shown on the right y axis. Column volumes (CVs) are shown on the x axis. The major peaks (labeled “full vector” and “empty vector”) are indicated. The peak fraction pool boundaries are indicated by vertical dotted lines on the x axis and the percent recovery of AAV full capsid in each peak fraction pool is indicated separately in Table 16.DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

[0115] Reference will now be made in detail to certain embodiments of the invention. While the invention will be described in conjunction with such embodiments, it will be understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the invention as defined by the appended claims.

[0116] Before describing the present teachings in detail, it is to be understood that the disclosure is not limited to specific compositions or process steps, as such may vary. It should be noted that, as used in this specification and the appended claims, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, reference to “an AAV full capsid” includes a plurality of AAV full capsids, reference to “a packaging cell” includes a plurality of packaging cells, and the like.

[0117] Numeric ranges are inclusive of the numbers defining the range. Measured and measurable values are understood to be approximate, taking into account significant digits and the error associated with the measurement. Also, the use of “comprise”, “comprises”, “comprising”, “contain”, “contains”, “containing”, “include”, “includes”, and “including” are not intended to be limiting. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the teachings.

[0118] Unless specifically noted in the above specification, embodiments in the specification that recite “comprising” various components are also contemplated as “consisting of’ or “consisting essentially of’ the recited components; embodiments in the specification that recite “consisting of’ various components are also contemplated as “comprising” or “consisting essentially of’ the recited components; and embodiments in the specification that recite “consisting essentially of’ various components are also contemplated as “consisting of’ or “comprising” the recited components (this interchangeability does not apply to the use of these terms in the claims).

[0119] The section headings used herein are for organizational purposes and are not to be construed as limiting the disclosed subject matter in any way. In the event that any document or other material incorporated by reference contradicts any explicit content of this specification, including definitions, this specification controls.I. Definitions

[0120] As used herein, “or” is used in the inclusive sense, i.e., equivalent to “and / or,” unless the context requires otherwise.

[0121] As used herein, “adeno-associated virus” or “AAV” refers to an adeno-associated virus vector, including any AAV serotype or variant, including but not limited to an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrhlO (see, e.g, SEQ ID NO: 81 of US 9,790,472), AAVrh74 (see, e.g., SEQ ID NO: 1 of US 2015 / 0111955), AAV9, AAV9P also known as AAVMYO (see, e.g., Weinmann et al., Nature Communications, 2020, 11 : 5432), AAV11, AAV 12, and Myo- AAV (as described, for example, in Tabebordbar et al., 2021, Cell, 184: 1-20 (e.g., MyoAAV 1A, 2A, 3A, 4A, 4C, or 4E)), and chimeras thereof (such as those listed in Viney et. Al, J Virol. 2021, 95(7): e02023-20), wherein the number following AAV indicates the AAV serotype. The term “AAV” can also refer to any known AAV (vector) system. In some embodiments, the AAV vector is a single-stranded AAV (ssAAV). In some embodiments, the AAV vector is a double-stranded AAV (dsAAV). Any variant of an AAV vector or serotype thereof, such as a self-complementary AAV (scAAV) vector, is encompassed within the general terms AAV vector, AAV6 vector, etc. See, e.g., McCarty et al., Gene Ther. 2001; 8: 1248-54, Naso et al., BioDrugs. 2017; 31 :317-334, and references cited therein for detailed discussion of various AAV vectors. Structurally, AAVs are small (~25 nm), single-stranded DNA, non-enveloped viruses with an icosahedral capsid. As used herein, “AAV” can refer to naturally occurring or engineered AAV serotypes and recombinant AAVs (rAAVs) and variants that can differ in the composition and structure oftheir capsid protein, and can have varying tropism, i.e., ability to transduce different cell types. When combined with active promoters, this tropism defines the site of gene expression, e.g., in a host.

[0122] As used herein, “recombinant AAV” refers to an AAV with a capsid having packaged therein a heterologous nucleic acid molecule comprising an expression cassette for a desired product, such as a gene product. Such an expression cassette may contain an AAV 5’ and / or 3’ inverted terminal repeat sequence flanking a nucleic acid of interest, such as a gene sequence, in which the nucleic acid of interest is operably linked to expression control sequences.

[0123] As used herein, “AAV6 capsid” refers to an AAV capsid having an amino acid sequence at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the AAV capsid encoded by the exemplary AAV6 genome of GenBank Accession No: AF028704.1, which is incorporated by reference herein and reproduced in SEQ ID NO: 1.

[0124] SEQ ID NO: 1 :TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGG TCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCA GAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGGAGGGGTGGAGTCGTGA CGTGAATTACGTCATAGGGTTAGGGAGGTCCTGTATTAGAGGTCACGTGAGTGTT TTGCGACATTTTGCGACACCATGTGGTCACGCTGGGTATTTAAGCCCGAGTGAGC ACGCAGGGTCTCCATTTTGAAGCGGGAGGTTTGAACGCGCAGCGCCATGCCGGG GTTTTACGAGATTGTGATTAAGGTCCCCAGCGACCTTGACGAGCATCTGCCCGGC ATTTCTGACAGCTTTGTGAACTGGGTGGCCGAGAAGGAATGGGAGTTGCCGCCA GATTCTGACATGGATCTGAATCTGATTGAGCAGGCACCCCTGACCGTGGCCGAG AAGCTGCAGCGCGACTTCCTGGTCCAGTGGCGCCGCGTGAGTAAGGCCCCGGAG GCCCTCTTCTTTGTTCAGTTCGAGAAGGGCGAGTCCTACTTCCACCTCCATATTCT GGTGGAGACCACGGGGGTCAAATCCATGGTGCTGGGCCGCTTCCTGAGTCAGAT TAGGGACAAGCTGGTGCAGACCATCTACCGCGGGATCGAGCCGACCCTGCCCAA CTGGTTCGCGGTGACCAAGACGCGTAATGGCGCCGGAGGGGGGAACAAGGTGGT GGACGAGTGCTACATCCCCAACTACCTCCTGCCCAAGACTCAGCCCGAGCTGCA GTGGGCGTGGACTAACATGGAGGAGTATATAAGCGCGTGTTTAAACCTGGCCGA GCGCAAACGGCTCGTGGCGCACGACCTGACCCACGTCAGCCAGACCCAGGAGCA GAACAAGGAGAATCTGAACCCCAATTCTGACGCGCCTGTCATCCGGTCAAAAAC CTCCGCACGCTACATGGAGCTGGTCGGGTGGCTGGTGGACCGGGGCATCACCTCCGAGAAGCAGTGGATCCAGGAGGACCAGGCCTCGTACATCTCCTTCAACGCCGCCTCCAACTCGCGGTCCCAGATCAAGGCCGCTCTGGACAATGCCGGCAAGATCATGGCGCTGACCAAATCCGCGCCCGACTACCTGGTAGGCCCCGCTCCGCCCGCCGACATTAAAACCAACCGCATTTACCGCATCCTGGAGCTGAACGGCTACGACCCTGCCTACGCCGGCTCCGTCTTTCTCGGCTGGGCCCAGAAAAGGTTCGGAAAACGCAACACCATCTGGCTGTTTGGGCCGGCCACCACGGGCAAGACCAACATCGCGGAAGCCATCGCCCACGCCGTGCCCTTCTACGGCTGCGTCAACTGGACCAATGAGAACTTTCCCTTCAACGATTGCGTCGACAAGATGGTGATCTGGTGGGAGGAGGGCAAGATGACGGCCAAGGTCGTGGAGTCCGCCAAGGCCATTCTCGGCGGCAGCAAGGTGCGCGTGGACCAAAAGTGCAAGTCGTCCGCCCAGATCGATCCCACCCCCGTGATCGTCACCTCCAACACCAACATGTGCGCCGTGATTGACGGGAACAGCACCACCTTCGAGCACCAGCAGCCGTTGCAGGACCGGATGTTCAAATTTGAACTCACCCGCCGTCTGGAGCATGACTTTGGCAAGGTGACAAAGCAGGAAGTCAAAGAGTTCTTCCGCTGGGCGCAGGATCACGTGACCGAGGTGGCGCATGAGTTCTACGTCAGAAAGGGTGGAGCCAACAAGAGACCCGCCCCCGATGACGCGGATAAAAGCGAGCCCAAGCGGGCCTGCCCCTCAGTCGCGGATCCATCGACGTCAGACGCGGAAGGAGCTCCGGTGGACTTTGCCGACAGGTACCAAAACAAATGTTCTCGTCACGCGGGCATGCTTCAGATGCTGTTTCCCTGCAAAACATGCGAGAGAATGAATCAGAATTTCAACATTTGCTTCACGCACGGGACCAGAGACTGTTCAGAATGTTTCCCCGGCGTGTCAGAATCTCAACCGGTCGTCAGAAAGAGGACGTATCGGAAACTCTGTGCCATTCATCATCTGCTGGGGCGGGCTCCCGAGATTGCTTGCTCGGCCTGCGATCTGGTCAACGTGGATCTGGATGACTGTGTTTCTGAGCAATAAATGACTTAAACCAGGTATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCGCGAGTGGTGGGACTTGAAACCTGGAGCCCCGAAACCCAAAGCCAACCAGCAAAAGCAGGACGACGGCCGGGGTCTGGTGCTTCCTGGCTACAAGTACCTCGGACCCTTCAACGGACTCGACAAGGGGGAGCCCGTCAACGCGGCGGATGCAGCGGCCCTCGAGCACGACAAGGCCTACGACCAGCAGCTCAAAGCGGGTGACAATCCGTACCTGCGGTATAACCACGCCGACGCCGAGTTTCAGGAGCGTCTGCAAGAAGATACGTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGAAGAGGGTTCTCGAACCTTTTGGTCTGGTTGAGGAAGGTGCTAAGACGGCTCCTGGAAAGAAACGTCCGGTAGAGCAGTCGCCACAAGAGCCAGACTCCTCCTCGGGCATTGGCAAGACAGGCCAGCAGCCCGCTAAAAAGAGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGTCCCCGACCCACAACCTCTCGGAGAACCTCCAGCAACCCCCGCTGCTGTGGGACCTACTACAATGGCTTCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGGCGCCGACGGAGTGGGTAATGCCTCAGGAAATTGGCATTGCGATTCCACATGGCTGGGCGACAGAGTCATCACCACCAGCACCCGAACATGGGCCTTGCCCACCTATAACAACCACCTCTACAAGCAAATCTCCAGTGCTTCAACGGGGGCCAGCAACGACAACCACTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGATTTCAACAGATTCCACTGCCATTTCTCACCACGTGACTGGCAGCGACTCATCAACAACAATTGGGGATTCCGGCCCAAGAGACTCAACTTCAAGCTCTTCAACATCCAAGTCAAGGAGGTCACGACGAATGATGGCGTCACGACCATCGCTAATAACCTTACCAGCACGGTTCAAGTCTTCTCGGACTCGGAGTACCAGTTGCCGTACGTCCTCGGCTCTGCGCACCAGGGCTGCCTCCCTCCGTTCCCGGCGGACGTGTTCATGATTCCGCAGTACGGCTACCTAACGCTCAACAATGGCAGCCAGGCAGTGGGACGGTCATCCTTTTACTGCCTGGAATATTTCCCATCGCAGATGCTGAGAACGGGCAATAACTTTACCTTCAGCTACACCTTCGAGGACGTGCCTTTCCACAGCAGCTACGCGCACAGCCAGAGCCTGGACCGGCTGATGAATCCTCTCATCGACCAGTACCTGTATTACCTGAACAGAACTCAGAATCAGTCCGGAAGTGCCCAAAACAAGGACTTGCTGTTTAGCCGGGGGTCTCCAGCTGGCATGTCTGTTCAGCCCAAAAACTGGCTACCTGGACCCTGTTACCGGCAGCAGCGCGTTTCTAAAACAAAAACAGACAACAACAACAGCAACTTTACCTGGACTGGTGCTTCAAAATATAACCTTAATGGGCGTGAATCTATAATCAACCCTGGCACTGCTATGGCCTCACACAAAGACGACAAAGACAAGTTCTTTCCCATGAGCGGTGTCATGATTTTTGGAAAGGAGAGCGCCGGAGCTTCAAACACTGCATTGGACAATGTCATGATCACAGACGAAGAGGAAATCAAAGCCACTAACCCCGTGGCCACCGAAAGATTTGGGACTGTGGCAGTCAATCTCCAGAGCAGCAGCACAGACCCTGCGACCGGAGATGTGCATGTTATGGGAGCCTTACCTGGAATGGTGTGGCAAGACAGAGACGTATACCTGCAGGGTCCTATTTGGGCCAAAATTCCTCACACGGATGGACACTTTCACCCGTCTCCTCTCATGGGCGGCTTTGGACTTAAGCACCCGCCTCCTCAGATCCTCATCAAAAACACGCCTGTTCCTGCGAATCCTCCGGCAGAGTTTTCGGCTACAAAGTTTGCTTCATTCATCACCCAGTATTCCACAGGACAAGTGAGCGTGGAGATTGAATGGGAGCTGCAGAAAGAAAACAGCAAACGCTGGAATCCCGAAGTGCAGTATACATCTAACTATGCAAAATCTGCCAACGTTGATTTCACTGTGGACAACAATGGACTTTATACTGAGCCTCGCCCCATTGGCACCCGTTACCTCACCCGTCCCCTGTAATTGTGTGTTAATCAATAAACCGGTTAATTCGTGTCAGTTGAACTTTGGTCTCATGTCGTTATTATCTTATCTGGTCACCATAGCAACCGGTTACACATTAACTGCTTAGTTGCGCTTCGCGAATACCCCTAGTGATGGAGTTGCCCACTCCCTCTATGCGCGCTCGCTCGCTCGGTGGGGCCGGCAGAGCAGAGCTCTGCCGTCTGCGGACCTTTGGTCCGCAGGCCCCACCGAGCGAGCGAGCGCGCATAGAGGGAGTG GGCAA

[0125] In some embodiments, the methods provided herein are used to obtain an AAV6 or another AAV having a capsid highly related to an AAV6 capsid. In some embodiments, AAVs having capsid sequences having about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO: 1 may be purified using the methods described herein. In some embodiments, the methods provided herein may be used to purify an AAV having a capsid sequence that is a variant of the capsid encoded by the AAV6 genome of SEQ ID NO: 1. Methods of generating the capsid, coding sequences for the capsid, and methods for production of rAAV viral vectors have been described. See, e.g., Gao, et al, Proc. Natl. Acad. Sci. U.S.A. 100 (10), 6081-6086 (2003), U.S. Pat. Nos. 6,759,237, 7,105,345, 7,186,552, and US Patent Publication 2013 / 0045186A1.

[0126] As used herein, “adeno-associated virus full capsid” or “AAV full capsid” refers to a capsid having packaged therein a nucleic acid molecule comprising an expression cassette that comprises a nucleic acid molecule of interest (e.g., a nucleic acid molecule encoding a desired gene product, such as a chimeric antigen receptor (CAR) or T cell receptor (TCR)). Such an expression cassette can contain an AAV 5' and / or 3' inverted terminal repeat (ITR) sequence flanking a gene sequence, in which the gene sequence is operably linked to one or more expression control sequences. These and other suitable elements of an expression cassette, such as those described herein, may alternatively be referred to herein as transgene genomic sequences. Such an AAV viral particle is termed “pharmacologically active” when it can deliver the transgene to a host cell that is capable of expressing the desired gene product carried by the expression cassette. An AAV full capsid may be, for example, an rAAV full capsid.

[0127] As used herein, “AAV empty capsid” refers to an assembled AAV capsid that lacks genomic sequences packaged therein. An “AAV partially empty capsid” as referred to herein contains only partial genomic sequences that are insufficient to express the complete gene product. AAV empty capsids and AAV partially empty capsids are non-functional to transfer the complete gene of interest to a host cell. AAV empty capsids and AAV partially empty capsids are also referred to herein as “AAV intermediaries” or “AAV intermediate capsids.”

[0128] As used herein, “adeno-associated virus starting preparation” or “AAV starting preparation” refers to a mixture comprising AAV full capsids (such as rAAV full capsids) and genome-deficient AAV intermediaries, such as AAV empty capsids and / or AAV partially empty capsids. An AAV starting preparation can include media collected from an AAV packaging cell culture and / or components of a packaging cell lysate. Thus, an AAV starting preparation can further comprise impurities present in the packaging cell mediaand / or packaging cell lysate, such as various cellular components, such as packaging cell DNA, packaging cell proteins, media components, and in some instances, helper virus or helper virus plasmid DNA.

[0129] As used herein, “purify,” “purified,” or “purifying” refers to separation of a biological component (such as AAV full capsids) from some or all other components of a mixture (such as an AAV starting preparation comprising the AAV full capsids, AAV partially empty capsids, AAV empty capsids, cell culture media, whole cells, cellular materials, and / or cell lysate). A biological component (such as AAV, full capsids) need not be completely separated from other components of the mixture to be “purified,” but may be separated from at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of other components of the mixture (such as other components of the AAV starting preparation).

[0130] As used herein, “substantially all” refers to at least 90%. Substantially does not require 100% (such as exactly 100% of the AAV full capsids of an AAV starting preparation), but can include an amount greater than 90%, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% (such as 90%-100% of the AAV full capsids of an AAV starting preparation).II. Exemplary Methods of Obtaining an AAV Full CapsidA. Overview

[0131] Methods for obtaining an AAV comprising a full capsid (AAV full capsids) for use in a variety of gene transfer and / or other applications are provided. The disclosed methods separate (purify) AAV full capsids from other components of an AAV starting preparation, such as AAV empty capsids and / or AAV partially empty capsids, production culture contaminants such as helper virus, helper virus proteins, plasmids, cellular proteins and nucleic acids, media components, serum proteins, AAV rep proteins, unassembled AAV VP1, VP2, and VP3 proteins, and similar. In some embodiments of the disclosed methods, the AAV is an AAV6, such as an rAAV6. In certain embodiments, the AAV full capsid comprises a nucleic acid molecule encoding a chimeric antigen receptor (CAR) or T cell receptor (TCR)).

[0132] Some embodiments of the disclosed methods of obtaining an AAV full capsid from an AAV starting preparation comprising the AAV full capsid and an AAV empty capsid comprise applying the AAV starting preparation to an anion exchange chromatography(AEX) column, such as using a suitable liquid chromatography method, such as but not limited to HPLC. Anion exchange chromatography is a form of ion exchange chromatography wherein a negatively charged molecule (such as an AAV full capsid) binds to a positively charged resin. More specifically, AEX uses a positively charged ion exchange resin with an affinity for molecules having net negative surface charges. The net surface charge of a given protein (such as an AAV capsid protein) changes with pH in a manner that is related to the protein’s isoelectric point (pl). A protein carries no net charge at a pl equal to its pH, carries a net positive charge at a pH below its pl, and carries a net negative charge at a pH above its pl. A protein’s pl may be calculated from its primary amino acid sequence. A buffer can then be chosen that provides a known net charge for the protein in the buffer. A positively charged anion exchange resin can thus be of use when the protein carries a net negative charge at the working pH. Proteins with different pl values will have varying degrees of charge at a given pH and thus will have different affinities for the positively charged surface groups on the particles of the anion exchange media. Accordingly, different proteins will bind a given AEX resin with different strengths, facilitating their separation, such as in the methods disclosed herein.

[0133] Generally, at a particular loading buffer pH, most (such as at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) or substantially all appropriately charged proteins will bind the resin. For example, if an anion exchange resin is used at a pH of 7.5, in general, proteins that have a pl <7.5 will carry a net negative charge and will bind the positively charged resin. A buffer comprising a salt (such as a salt gradient) can then be used to separate the protein of interest (such as the AAV full capsid) from other bound proteins. When the buffer comprising the salt is applied, proteins are typically eluted from the AEX column in an order depending on their net surface charge. In the example above, proteins with pl values closer to 7.5 will elute at a lower ionic strength, and proteins with very low pl values will elute at a high salt concentration.

[0134] In a standard AEX AAV purification method, such as methods that include buffers comprising NaCl, AAV empty capsids elute ahead of AAV full capsids (such as shown in FIG. 1 and Example 1). The present inventors surprisingly found that by exchanging a monovalent cation salt for a divalent cation salt in the elution buffer, the order of species elution may be reversed. In other words, at the same pH and using the same AAV and column resin, but using a divalent cation salt in place of a monovalent cation salt in theelution buffer, the AAV full capsids may elute from the column before the AAV empty capsids.

[0135] In some embodiments, the AAV starting preparation is applied to an anion exchange chromatography (AEX) column to which an elution buffer is then applied, wherein applying the elution buffer elutes from the AEX column an eluted fraction that comprises the AAV full capsid in a greater proportion than the AAV empty capsid. In particular embodiments, the AAV starting preparation further comprises an AAV partially empty capsid. The AAV starting preparation comprising the AAV full, empty and / or partially empty capsids may be suspended in a suitable loading buffer and applied to the AEX resin. The AAV particles and intermediaries bind to the resin while other components are carried out in the buffer. In one embodiment, the total flow rate of the buffer is kept constant, and in another embodiment, however, the proportion of the elution buffer is gradually increased from 0% to 100% according to a programmed change in concentration (the “gradient”).

[0136] In particular embodiments, the AAV starting preparation is subjected to one or more processing steps prior to loading onto the AEX resin, such as one or more processing steps disclosed herein (e.g., a clarifying treatment (such as filtration and / or centrifugation), one or more nucleases and / or proteases (to digest contaminating nucleic acids and / or proteins), an additionally chromatography step (such as affinity chromatography), and / or a concentrating step). In some embodiments, the AAV starting preparation comprising AAV full capsids and AAV empty capsids (and / or AAV partially empty capsids) contains less than about 10% contamination from non- AAV viral and cellular proteinaceous and nucleic acid materials, or less than about 5% contaminants, or less than about 1% contaminating viral and cellular proteinaceous and nucleic acid materials. Thus, in some embodiments, the AAV starting preparation loaded onto the AEX resin is about 80%, about 85%, about 95%, to about 99% free of contaminants.

[0137] In some embodiments, the elution buffer is a divalent cation salt elution buffer. In some particular embodiments, the elution buffer is applied to an AEX column at a constant concentration (an “isocratic” elution). In other particular embodiments, the elution buffer is applied to the AEX column in a linear gradient that ranges from 0% to 100% elution buffer. In some embodiments, an isocratic cationic salt elution exhibits an advantage over a gradient divalent cationic salt elution in that in an isocratic divalent cationic salt elution, AAV full capsids are eluted without, or substantially without, empty capsid (such as empty capsid observed in later peaks under a gradient elution, such as shown in the Examples provided herein). A monovalent salt isocratic wash followed by a divalent salt isocratic elution canthus enable upfront removal of a population of empty capsids then elution of full capsids that avoids (or substantially avoids) copurification of full capsids with remaining empty capsids that were not removed during the first wash. The AAV starting preparation is applied to the AEX column under conditions whereby all or a portion of the AAV full capsid present in the AAV starting preparation binds the column. In certain embodiments, the AAV full capsid elutes from the AEX column between 10% and 90%, 15% and 85%, 20% and 80%, or 30% and 70% elution buffer (such as divalent cation salt elution buffer) in the linear gradient of the elution buffer.

[0138] In some embodiments, the AEX column-bound AAV full capsids and AAV empty capsids (and / or AAV partially empty capsids) are subjected to a monovalent cation salt wash buffer before the divalent cation salt elution buffer, wherein applying the monovalent cation salt buffer elutes from the AEX column a wash fraction that comprises the AAV empty capsid in greater proportion than the AAV full capsid. In particular embodiments, the monovalent cation salt wash buffer does not comprise a divalent cation salt.

[0139] In some embodiments, the methods for obtaining AAV full capsids from an AAV starting preparation comprising the AAV full capsids and AAV empty capsids (and / or AAV partially empty capsids) includes subjecting the AAV starting preparation to a suitable liquid chromatography process, such as described herein (e.g., high performance liquid chromatography (HPLC)), wherein the AAV full capsids and AAV empty capsids (and / or AAV partially empty capsids) are bound to an anion exchange resin and subjected to a cation salt elution buffer (such as a divalent cation salt buffer), while eluate is monitored for ultraviolet absorbance at about 260 nm and about 280 nm, such as using a detector.

[0140] As provided above, some embodiments of the disclosed methods comprise a divalent cation salt elution buffer and optionally a monovalent cation salt wash buffer, such as the divalent cation salts and monovalent cation salts specified herein. However, it will be understood that another divalent cation salt or another monovalent cation salt of an equivalent ionic strength; another divalent cation salt or another monovalent cation salt having a different ionic strength, but its concentration adjusted to an equivalent ionic strength; or a combination of such salts, may be substituted therefor. The formula for ionic strength is well known to those of skill in the art:where Ci is the molar concentration of ion i (M, mol / L), zi is the charge number of that ion, and the sum is taken over all ions in the solution. For a 1 : 1 electrolyte such as sodiumchloride (NaCl), potassium chloride (KC1), formate (HCO2 ), or acetate (CH2CO2 ) (e.g., CafC^fhCh or Mg^HsCh)?), the ionic strength is equal to the concentration. However, for a sulfate (SO42), the ionic strength is four times higher. Thus, where reference is made to a specific concentration of a divalent cation salt or a monovalent cation salt disclosed herein, or a range of concentrations, one of skill in the art can substitute another divalent cation salt or another monovalent cation salt, or a mixture of suitable salts, adjusted to the appropriate concentration to provide an ionic strength equivalent to that provided for the particular divalent cation salt or the particular monovalent cation salt. As used herein this this may be termed a “salt equivalent”, e.g., “NaCl or equivalent.” This will be understood to include both a single salt, a mixture of, e.g., NaCl with other salts, or a mixture of salts which do not include, e.g., NaCl, but which are compatible with the apparatus and processes (e.g., anion exchange resin processes) described herein.

[0141] At different points during the disclosed methods, as described herein, the AEX resinbound AAV6 full, empty, and / or partially empty capsids dissociate from the resin and appear in column effluent. The effluent passes through detectors, such as detectors measuring salt concentration (by conductivity) and protein concentration (by absorption of ultraviolet light at a predetermined wavelength). However, other suitable detection means may be used. As each AAV particle is eluted it appears in the effluent as a “peak” in protein concentration and can be collected for further use.

[0142] As described herein, the fractions under the 260 nm elution peak containing the AAV full capsid are collected and processed for further use. In one embodiment, the resulting AAV stock contains a ratio of particles to vector genomes of 1. Optionally, the collected AAVs are placed in a suspension having a pH closer to a neutral pH which will be used for long-term storage and / or delivery to a subject. Such a pH may be in the range of about 6.5 to about 8, or about 7 to about 7.5.

[0143] One of ordinary skill will understand that pH values are approximate, and may be rounded up or down to the nearest significant figure and may vary somewhat depending upon the instrumentation used for the measurement and its calibration. In some instances, a provided pH value is an average, such as if pH measurements are taken more than once and then averaged. In some instances, a pH value is rounded to the nearest significant figure.

[0144] In one embodiment, the average yield of AAV full capsid from the AAV starting preparation loaded on the column is at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%. This may be calculated by determining titer (genome copies) inthe preparation loaded onto the column and the amount present in the final elutions. Further, these may be determined based on quantitative PCR (qPCR) analysis, droplet digital PCR analysis, SDS-PAGE techniques, light scattering methods, combinations of static or dynamic light scattering with UV, analytical ultracentrifugation, HPLC, CryoTEM, nano tracking analysis, enzyme-linked immunosorbent assays (ELISA), or other any other assay capable of quantifying viral titer and / or distinguishing empty AAV from Full AAV, such as those methods described herein or those that have been described in the art.

[0145] Generally, methods for assaying for AAV empty capsids and AAV full capsids are known in the art. See, e.g., Grimm et al., Gene Therapy (1999) 6: 1322-1330; Sommer et al., Molec. Ther. (2003) 7: 122-128. Methods to test for capsid include subjecting an AAV- containing preparation to SDS-polyacrylamide gel electrophoresis, using any gel capable of separating the three capsid proteins, for example, a gradient gel containing 3-8% Tris-acetate in the buffer, then running the gel until sample material is separated, and finally blotting the gel onto nylon or nitrocellulose membranes, preferably nylon. Anti-AAV capsid antibodies are then used as the primary antibodies that bind to denatured capsid proteins. A secondary antibody is then used that binds to the primary antibody and contains a means for detecting binding with the primary antibody. A method for detecting binding is used to semi- quantitatively determine binding between the primary and secondary antibodies, such as a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, such as a chemiluminescence detection kit.

[0146] In one embodiment, the concentration of AAV vector genomes (vg) in eluted fractions can be measured by qPCR. Samples can be diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA, and can optionally be further treated with proteinase K (or another suitable proteinase). After inactivation of the nuclease, samples can be further diluted and amplified using primers and a probe (e.g., a TagMan™ fluorogenic probe) specific for the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample using a suitable detection system. Plasmid DNA containing identical sequences to that contained in the AAV vector is employed to generate a standard curve in the qPCR reaction. The Ct values obtained from the samples are used to determine vector genome titer by normalizing them to the Ct value of the plasmid standard curve. End-point assays based on the digital PCR can also be used. In some embodiments, qPCR may be combined with ELISA for AAV analysis.

[0147] Additionally, or alternatively, droplet digital PCR (ddPCR) may be used. For example, methods for determining single-stranded and self-complementary AAV vector genome titers by ddPCR have been described. See, e.g., M. Lock et al, Hu Gene Therapy Methods, 2014, 25(2): 15-25.

[0148] In another embodiment, a combination of UV absorbance and light scattering is used to determine the percentage of AAV full capsids in a chromatogram peak (e.g., in an eluted fraction), such as the percentage of AAV full capsids in a chromatogram peak shown in FIGS. 1-5. In particular embodiments, a Stunner instrument (Unchained Labs) is used in the method, wherein capsid particle counts are obtained via dynamic and static light scattering (DLS and SLS) followed by measurement of UV absorbance at 260 nm and 280 nm wavelengths. These measurements, along with the sequence of the gene of interest, are used to determine what portion of the particle population contains the gene of interest.B. Anion Exchange Chromatography Methods

[0149] Embodiments of the disclosed methods of obtaining an AAV full capsid from an AAV starting preparation comprising the AAV full capsid and an AAV empty capsid comprise applying the AAV starting preparation to an anion exchange chromatography (AEX) column, such as using a suitable liquid chromatography method, such as but not limited to HPLC. In some embodiments, the AAV starting preparation also comprises an AAV partially empty capsid. In some embodiments, the AAV starting preparation is applied to an AEX column to which an elution buffer is then applied, wherein applying the elution buffer elutes from the AEX column an eluted fraction that comprises the AAV full capsid in a greater proportion than the AAV empty capsid. In some embodiments, the elution buffer is a divalent cation salt elution buffer that does not comprise a monovalent cation salt. In some embodiments, the elution buffer is applied at a constant concentration of divalent cation salt (also referred to herein as an “isocratic” elution). In some embodiments, the elution buffer is applied in a linear gradient concentration of divalent cation salt.

[0150] In some embodiments, following loading of the AAV starting preparation onto the column, a wash buffer is applied to the column before the elution buffer, and applying the wash buffer elutes from the AEX column a wash fraction that comprises the AAV empty capsid (and / or the AAV partially empty capsid) in a greater proportion than the AAV full capsid. In particular embodiments, the wash buffer is a monovalent cation salt wash buffer that does not comprise a divalent cation salt. In some embodiments, the wash buffer is applied at a constant concentration of monovalent cation salt. In some embodiments, the wash buffer is applied in a linear gradient concentration of monovalent cation salt. In aspecific, non-limiting embodiment, a monovalent cation salt wash buffer is applied to the column before a divalent cation salt elution buffer, wherein the monovalent cation salt wash buffer does not comprise a divalent cation salt and applying the monovalent cation salt buffer elutes from the AEX column a wash fraction that comprises the AAV empty capsid in greater proportion than the AAV full capsid.

[0151] In a particular embodiment, the method of obtaining an AAV full capsid from an AAV starting preparation comprising the AAV full capsid and an AAV empty capsid (and / or an AAV partially empty capsid) comprises (a) applying the AAV starting preparation to an AEX column; (b) applying a monovalent cation salt wash buffer to the column, thereby eluting from the AEX column a wash fraction that comprises the AAV empty capsid in greater proportion than the AAV full capsid; and (c) applying a divalent cation salt elution buffer to the AEX column, thereby eluting from the AEX column an eluted fraction that comprises the AAV full capsid in a greater proportion than the AAV empty capsid (and / or the AAV partially empty capsid). In some embodiments, the wash buffer is applied at a constant concentration of monovalent cation salt. In some embodiments, the wash buffer is applied in a linear gradient concentration of monovalent cation salt. In some embodiments, the elution buffer is applied at a constant concentration of divalent cation salt. In some embodiments, the elution buffer is applied in a linear gradient concentration of divalent cation salt. In some embodiments, the wash buffer is applied at a constant concentration of monovalent cation salt and the elution buffer is applied at a constant concentration of divalent cation salt. In some embodiments, the wash buffer is applied at a constant concentration of monovalent cation salt and the elution buffer is applied in a linear gradient concentration of divalent cation salt. In some embodiments, the wash buffer is applied in a linear gradient concentration of monovalent cation salt and the elution buffer is applied at a constant concentration of divalent cation salt. In some embodiments, the wash buffer is applied in a linear gradient concentration of monovalent cation salt and the elution buffer is applied in a linear gradient concentration of divalent cation salt.

[0152] In some embodiments, the eluted fraction comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the AAV full capsid from the AAV starting preparation. In some embodiments, the proportion of AAV full capsid compared to total AAV capsid in the eluted fraction is least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, or at least 60%. In certain embodiments, the ratio of AAV full capsid to AAV emptycapsid (and / or AAV partially empty capsid) in the eluted fraction is at least 1.5 to 1, at least 1.6 to 1, at least 1.7 to 1, at least 1.8 to 1, at least 1.9 to 1, at least 2 to 1, at least 2.25 to 1, at least 2.5 to 1, at least 2.75 to 1, at least 3 to 1, at least 4 to 1, at least 5 to 1, at least 10 to 1, at least 20 to 1, at least 30 to 1, at least 40 to 1, at least 50 to 1, or at least 100 to 1. In some embodiments, the eluted fraction comprises no more than 70%, no more than 65%, no more than 60%, no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, or no more than 2%, or no more than 1% AAV empty capsid (and / or AAV partially empty capsid).

[0153] In some embodiments wherein a wash buffer (such as a monovalent cation salt wash buffer) is not applied to the column prior to the elution buffer (such as a divalent cation salt elution buffer), at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV full capsid is eluted from the AEX column before the AAV empty capsid (and / or the AAV partially empty capsid). In certain embodiments, the elution buffer (such as the divalent cation salt elution buffer) is applied to the AEX column under conditions whereby at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or substantially all of the AAV full capsid is eluted from the column and at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV empty capsid (and / or the AAV partially empty capsid) remains bound to the column.

[0154] In some embodiments wherein a wash buffer (such as a monovalent cation salt wash buffer) is applied to the column prior to the elution buffer (such as a divalent cation salt elution buffer), at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV empty capsid (and / or the AAV partially empty capsid) is eluted from the AEX column before the AAV full capsid. In certain embodiments, the wash buffer (such as the monovalent cation salt wash buffer) is applied to the AEX column under conditions whereby at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV empty capsid (and / or the AAV partially empty capsid) is eluted from the column and at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV full capsid remains bound to the column. In some embodiments, the wash fraction comprises at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or substantially 100% AAV empty capsid (and / or AAV partially empty capsid).

[0155] In particular embodiments, the eluted fraction is a first eluted fraction and a second eluted fraction is eluted after the first eluted fraction. In such embodiments, the second elutedfraction can comprise a greater proportion of the AAV empty capsid (and / or the AAV partially empty capsid) than the first eluted fraction. In certain embodiments, the second eluted fraction comprises no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, or no more than 2%, or no more than 1% AAV full capsid. In certain embodiments, the second eluted fraction comprises at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% AAV full capsid.1. Elution Buffers

[0156] In some embodiments of the disclosed methods, the divalent cation salt elution buffer comprises 5-300 mM, 5-250 mM, 5-200 mM, 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, 50-150 mM, 50-100 mM, 70-120 mM, 80-120 mM, 80-110 mM, 100 mM, or 50 mM divalent cation salt. In some embodiments, the divalent cation salt elution buffer is applied at a constant concentration. In other embodiments, the divalent cation salt elution buffer is applied in a linear gradient. In particular embodiments, the linear gradient ranges from 0% to 100% divalent cation salt elution buffer. In certain embodiments, the AAV full capsid elutes from the AEX column between 10% and 90%, 15% and 85%, 20% and 80%, or 30% and 70% divalent cation salt elution buffer in the linear gradient of the elution buffer.

[0157] In particular embodiments, the divalent cation salt comprises a divalent cation selected from Mg2+, Ca2+, or Sr2+. In one embodiment, the divalent cation is Mg2+. In another embodiment, the divalent cation is Ca2+. In yet another embodiment, the divalent cation is Sr2+. In some embodiments, the divalent cation salt is magnesium chloride (MgCh), calcium chloride (CaCh), magnesium sulfate (MgSCh), magnesium phosphate (MgPCh), calcium acetate (Ca^ILCh)?), calcium sulfate (CaSCh), magnesium acetate (Mg / C^thChh), magnesium citrate (ChfhMgCh), strontium chloride (SrCh), or strontium acetate (ChPLChSr). In particular embodiments, the divalent cation salt is MgCh, CaCh, or MgSCh. In some embodiments, the divalent cation salt elution buffer comprises 5-300 mM, 5-250 mM, 5-200 mM, 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, 50-150 mM, 50-100 mM, 70-120 mM, 80-120 mM, 80-110 mM, 100 mM, or 50 mM MgCh. In some embodiments, the divalent cation salt elution buffer comprises 5-300 mM, 5-250 mM, 5-200 mM, 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, 50-150 mM, 50-100 mM, 70-120 mM, 80-120 mM, 80- 110 mM, 100 mM, or 50 mM CaCh. In some embodiments, the divalent cation salt elution buffer comprises 5-300 mM, 5-250 mM, 5-200 mM, 25-175 mM, 25-150 mM, 25-100 mM,25-75 mM, 50-150 mM, 50-100 mM, 70-120 mM, 80-120 mM, 80-110 mM, 100 mM, or 50 mM MgSCh.

[0158] In particular embodiments, the divalent cation salt elution buffer does not comprise a monovalent cation salt. In certain embodiments, the divalent cation salt elution buffer does not comprise NaCl. In other embodiments, the divalent cation elution buffer comprises a monovalent cation salt at a concentration no greater than 100 mM, no greater than 90 mM, no greater than 80 mM, no greater than 70 mM, no greater than 60 mM, no greater than 50 mM, no greater than 40 mM, no greater than 30 mM, no greater than 25 mM, no greater than 20 mM, no greater than 15 mM, no greater than 10 mM, or no greater than 5 mM.

[0159] In some embodiments, the divalent cation salt elution buffer comprises a buffering agent. In some embodiments, the divalent cation salt elution buffer comprises 5-100 mM, 10- 100 mM, 10-50 mM, 10-40 mM, 10-30 mM, 20-30 mM, or 25 mM buffering agent. Suitable buffers include, e.g., N-methylpiperazine; piperazine; Bis-Tris; Bis-Tris propane; CHES (N- cyclohexyl-2-aminoethanesulfonic acid); AMPSO (N-(l,l-dimethyl-2-hydroxyethyl)-3- amino-2-hydroxypropanesulfonic acid); MES; Hepes; N-methyldiethanolamine; 1,3- diaminopropane; ethanolamine; acetic acid and the like. Such buffers may be used at a pH between 8.5 and 10.0 (e.g., about pH 8.5 to about pH 9.5, about pH 9.0 to about pH 10.0, about pH 9.0 to about pH 9.5, or about pH 9.0). In particular embodiments, the buffering agent of the divalent cation salt elution buffer is Tris, Bis-Tris propane, CHES (N- cyclohexyl-2-aminoethanesulfonic acid), or AMPSO (N-(l,l-dimethyl-2-hydroxyethyl)-3- amino-2-hydroxypropanesulfonic acid).

[0160] In certain embodiments, the divalent cation salt elution buffer comprises a stabilizing agent, such as a surfactant. In particular embodiments, the stabilizing agent is poloxamer, polysorbate 80 (PS-80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose.

[0161] In some embodiments, the divalent cation salt elution buffer has a pH of about 7-10, about 8.5-9.5, or about pH 9. In a specific, non-limiting embodiment, the divalent cation salt elution buffer comprises 25 mM Tris, 100 mM divalent cation salt, and 0.001% poloxamer, and is about pH 9. In another specific, non-limiting embodiment, the divalent cation salt elution buffer comprises 25 mM Tris, 100 mM MgCh, and 0.001% poloxamer, and is about pH 9. In another specific, non-limiting embodiment, the divalent cation salt elution buffer comprises 25 mM Tris, 100 mM CaCh, and 0.001% poloxamer, and is about pH 9. In another specific, non-limiting embodiment, the divalent cation salt elution buffer comprises 25 mM Tris, 100 mM MgSCh, and 0.001% poloxamer, and is about pH 9. In another specific, nonlimiting embodiment, the divalent cation salt elution buffer comprises 25 mM Tris, 38 mMMgSCN, and 0.001% poloxamer, and is about pH 9. In another specific, non-limiting embodiment, the divalent cation salt elution buffer comprises 25 mM Tris, 33 mM MgSCh, and 0.001% poloxamer, and is about pH 9.2. Wash Buffers

[0162] In some embodiments of the disclosed methods, the monovalent cation salt wash buffer comprises 5-300 mM, 5-250 mM, 5-200 mM, 10-225 mM, 10-200 mM, 15-125 mM, 15-100 mM, 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, 50-200 mM, 50-150 mM, 50- 100 mM, 50-125 mM, 70-120 mM, 80-110 mM, 100-200 mM, 125-175 mM, 150 mM, or 100 mM monovalent cation salt. In some embodiments, the monovalent cation salt wash buffer is applied at a constant concentration. In other embodiments, the monovalent cation salt wash buffer is applied in a linear gradient. In particular embodiments, the linear gradient ranges from 0% to 100% monovalent cation salt wash buffer.

[0163] In some embodiments, the monovalent cation salt wash buffer comprises NaCl, Na2SO4, NasPCh, or CHsCOONa. In particular embodiments, the monovalent cation salt wash buffer comprises about 50-250 mM NaCl, about 15-150 mM Na2SO4, about 10-250 mM NasPCh, or about 10-250 mM CHsCOONa. In some embodiments, the monovalent cation salt wash buffer comprises 5-300 mM, 5-250 mM, 5-200 mM, 10-225 mM, 10-200 mM, 15-125 mM, 15-100 mM, 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, 50-200 mM, 50-150 mM, 50-100 mM, 50-125 mM, 70-120 mM, 80-110 mM, 100-200 mM, 125-175 mM, 150 mM, or 100 mM NaCl. In some embodiments, the monovalent cation salt wash buffer comprises 5-300 mM, 5-250 mM, 5-200 mM, 10-225 mM, 10-200 mM, 15-125 mM, 15-100 mM, 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, 50-200 mM, 50-150 mM, 50- 100 mM, 50-125 mM, 70-120 mM, 80-110 mM, 100-200 mM, 125-175 mM, 150 mM, or 100 mM Na2SO4. In some embodiments, the monovalent cation salt wash buffer comprises 5- 300 mM, 5-250 mM, 5-200 mM, 10-225 mM, 10-200 mM, 15-125 mM, 15-100 mM, 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, 50-200 mM, 50-150 mM, 50-100 mM, 50-125 mM, 70-120 mM, 80-110 mM, 100-200 mM, 125-175 mM, 150 mM, or 100 mM Na3PO4. In some embodiments, the monovalent cation salt wash buffer comprises 5-300 mM, 5-250 mM, 5-200 mM, 10-225 mM, 10-200 mM, 15-125 mM, 15-100 mM, 25-175 mM, 25-150 mM, 25- 100 mM, 25-75 mM, 50-200 mM, 50-150 mM, 50-100 mM, 50-125 mM, 70-120 mM, 80- 110 mM, 100-200 mM, 125-175 mM, 150 mM, or 100 mM CH3COONa. In a specific, nonlimiting embodiment, the monovalent cation salt wash buffer comprises 75-250 mM NaCl or 25-150 mM Na2SO4.

[0164] In particular embodiments, the monovalent cation salt wash buffer does not comprise a divalent cation salt. In other embodiments, the monovalent cation salt wash buffer comprises a divalent cation salt at a concentration no greater than 100 mM, no greater than 90 mM, no greater than 80 mM, no greater than 70 mM, no greater than 60 mM, no greater than 50 mM, no greater than 40 mM, no greater than 30 mM, no greater than 25 mM, no greater than 20 mM, no greater than 15 mM, no greater than 10 mM, or no greater than 5 mM.

[0165] In some embodiments, the monovalent cation salt wash buffer comprises a buffering agent. In some embodiments, the monovalent cation salt wash buffer comprises 5-100 mM, 10-100 mM, 10-50 mM, 10-40 mM, 10-30 mM, 20-30 mM, or 25 mM buffering agent. Suitable buffers may include N-methylpiperazine; piperazine; Bis-Tris; Bis-Tris propane; CHES (N-cyclohexyl-2-aminoethanesulfonic acid); AMPSO (N-(l,l-dimethyl-2- hydroxyethyl)-3-amino-2-hydroxypropanesulfonic acid); MES; Hepes; N- methyldiethanolamine; 1,3 -diaminopropane; ethanolamine; acetic acid and the like. Such buffers may be used at a pH between 8.5 and 10.0 (e.g., about pH 8.5 to about pH 9.5, about pH 9.0 to about pH 10.0, about pH 9.0 to about pH 9.5, or about pH 9.0). In particular embodiments, the buffering agent of the monovalent cation salt wash buffer is Tris, Bis-Tris propane, CHES (N-cyclohexyl-2-aminoethanesulfonic acid), or AMPSO (N-( 1,1 -dimethylshydroxy ethyl)-3-amino-2-hydroxypropanesulfonic acid).

[0166] In certain embodiments, the monovalent cation salt wash buffer comprises a stabilizing agent, such as a surfactant. In particular embodiments, the stabilizing agent is poloxamer, polysorbate 80 (PS-80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose.

[0167] In some embodiments, the monovalent cation salt wash buffer has a pH of 7.0-10.0, about pH 8.5-9.5, or about pH 9. In a specific, non-limiting embodiment, the monovalent cation salt wash buffer comprises 25 mM Tris, 150 mM NaCl, and 0.001% poloxamer, and is about pH 9. In another specific, non-limiting embodiment, the monovalent cation salt wash buffer comprises 25 mM Tris, 53 mM Na2SO4, and 0.001% poloxamer, and is about pH 9.

[0168] In a specific, non-limiting embodiment, the monovalent cation salt wash buffer comprises 10-100 mM Tris (such as 25 mM Tris), 150 mM NaCl, and 0.001% poloxamer, and is about pH 9. In another specific, non-limiting embodiment, the monovalent cation salt wash buffer comprises 25 mM Tris, 53 mM Na2SO4, and 0.001% poloxamer, and is about pH 9. In a specific, non-limiting embodiment comprising both a divalent cation salt elution buffer and a monovalent cation salt wash buffer, the divalent cation salt elution buffer comprises 10-100 mM Tris (such as 25 mM Tris), 100 mM MgCh, and 0.001% poloxamer, and is about pH 9, and the monovalent cation salt wash buffer comprises 10-100 mM Tris(such as 25 mM Tris), 150 mM NaCl, and 0.001% poloxamer, and is about pH 9. In another specific, non-limiting embodiment comprising both a divalent cation salt elution buffer and a monovalent cation salt wash buffer, the divalent cation salt elution buffer comprises 25 mM Tris, 100 mM MgSCh, and 0.001% poloxamer, and is about pH 9, and the monovalent cation salt wash buffer comprises 25 mM Tris, 50 mM Na2SO4, and 0.001% poloxamer, and is about pH 9.3. Flush Buffers

[0169] In some embodiments, prior to applying the elution buffer, the column is washed with a flush buffer. In particular embodiments, the flush buffer does not comprise a monovalent cation salt or a divalent cation salt. In other particular embodiments, the flush buffer comprises a monovalent cation salt. In certain embodiments wherein the elution buffer is applied to the column in a linear gradient, the linear gradient is formed with the flush buffer and the elution buffer. In some embodiments, the linear gradient is from 100%-0% flush buffer.

[0170] In some embodiments, the monovalent cation salt of the flush buffer is NaCl, Na2SO4, NasPCri, CHsCOONa, or sodium citrate (such as monosodium citrate (NaCeHvO?), disodium citrate (Na2C6HeO7.), or trisodium citrate (NasCeHsCh)).

[0171] In some embodiments, the flush buffer comprises a buffering agent. In some embodiments, the flush buffer comprises 5-100 mM, 10-100 mM, 10-50 mM, 10-40 mM, 10- 30 mM, 20-30 mM, or 25 mM buffering agent. Suitable buffers may include e.g., N- methylpiperazine; piperazine; Bis-Tris; Bis-Tris propane; CHES (N-cyclohexyl-2- aminoethanesulfonic acid); AMPSO (N-(l,l-dimethyl-2-hydroxyethyl)-3-amino-2- hydroxypropanesulfonic acid MES; Hepes; N-methyldiethanolamine; 1,3-diaminopropane; ethanolamine; acetic acid and the like. Such buffers may be used at a pH between 8.5 and 10.0 (e.g., about pH 8.5 to about pH 9.5, about pH 9.0 to about pH 10.0, about pH 9.0 to about pH 9.5, or about pH 9.0). In particular embodiments, the buffering agent of the monovalent cation salt wash buffer is Tris, Bis-Tris propane, CHES (N-cyclohexyl-2- aminoethanesulfonic acid), or AMPSO (N-(l,l-dimethyl-2-hydroxyethyl)-3-amino-2- hydroxypropanesulfonic acid).

[0172] In certain embodiments, the flush buffer comprises a stabilizing agent, such as a surfactant. In particular embodiments, the stabilizing agent is poloxamer, polysorbate 80 (PS- 80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose.

[0173] In some embodiments, the flush buffer has a pH of 7.0-10.0, about pH 8.5-9.5, or about pH 9. In a specific, non-limiting embodiment, the flush buffer comprises 25 mM Tris, 60 mM NaCl, and 0.001% poloxamer, and is about pH 9. In another specific, non-limiting embodiment, the flush buffer comprises 25 mM Tris, 20 mM Na2SO4, and 0.001% poloxamer, and is about pH 9.

[0174] In some embodiments, a second flush buffer is applied to the AEX column following application of a monovalent cation salt wash buffer and prior to application of a divalent cation salt elution buffer disclosed herein. In some embodiments, the second flush buffer does not comprise a monovalent cation salt or a divalent cation salt. In particular embodiments, the second flush buffer comprises a buffering agent, such as any suitable buffering agent (such as those disclosed herein), such as Tris. In some embodiments, the flush buffer comprises 5-100 mM, 10-100 mM, 10-50 mM, 10-40 mM, 10-30 mM, 20-30 mM, or 25 mM buffering agent. In some embodiments, the second flush buffer comprises a stabilizing agent, such as a surfactant. In particular embodiments, the stabilizing agent is poloxamer, polysorbate 80 (PS-80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose. In a specific, non-limiting embodiment, the second flush buffer comprises 25 mM Tris, and 0.001% poloxamer, and is about pH 9.4. Equilibration Buffers

[0175] In some embodiments, prior to applying the divalent cation salt elution buffer, the anion exchange chromatography column is washed with an equilibration buffer. In some embodiments, the equilibration buffer is applied to the column after a monovalent cation salt wash buffer. In some embodiments, the equilibration buffer is applied to the column after a flush buffer. In certain embodiments, the equilibration buffer comprises 10-100 mM monovalent cation salt, such as 10-80 mM, 20-80 mM, 25-75 mM, 30-70 mM, 40-60 mM, 50 mM, or 60 mM monovalent cation salt. In particular embodiments, a pre-equilibration solution is applied to the column following application of the flush buffer and prior to application of the equilibration buffer. In some embodiments, the pre-equilibration solution comprises a monovalent cation salt, such as 1000-3000 mM monovalent cation salt, such as 1250-2750 mM, 1500-2500 mM, 1750-2250 mM, 1900-2100, or 2000 mM monovalent cation salt. In particular embodiments, the monovalent cation salt of the pre-equilibration buffer is NaCl .

[0176] In some embodiments, the monovalent cation salt of the equilibration buffer is NaCl, Na2SO4, NasPO-t, CHsCOONa, or sodium citrate (such as monosodium citrate (NaCeHvO?), disodium citrate (IS^CeHeO?), or trisodium citrate (NasCeHsCh)).

[0177] In some embodiments, the equilibration buffer comprises a buffering agent. In some embodiments, the equilibration buffer comprises 5-100 mM, 10-100 mM, 10-50 mM, 10-40 mM, 10-30 mM, 20-30 mM, or 25 mM buffering agent. Suitable buffers may include, e.g., N- methylpiperazine; piperazine; Bis-Tris; Bis-Tris propane; CHES (N-cyclohexyl-2- aminoethanesulfonic acid); AMPSO (N-(l,l-dimethyl-2-hydroxyethyl)-3-amino-2- hydroxypropanesulfonic acid); MES; Hepes; N-methyldiethanolamine; 1,3 -diaminopropane; ethanolamine; acetic acid and the like. Such buffers may be used at a pH between 8.5 and 10.0 (e.g., about pH 8.5 to about pH 9.5, about pH 9.0 to about pH 10.0, about pH 9.0 to about pH 9.5, or about pH 9.0). In particular embodiments, the buffering agent of the monovalent cation salt wash buffer is Tris, Bis-Tris propane, CHES (N-cyclohexyl-2- aminoethanesulfonic acid), or AMPSO (N-(l,l-dimethyl-2-hydroxyethyl)-3-amino-2- hydroxypropanesulfonic acid).

[0178] In certain embodiments, the equilibration buffer comprises a stabilizing agent, such as a surfactant. In particular embodiments, the stabilizing agent is poloxamer, polysorbate 80 (PS-80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose.

[0179] In some embodiments, the equilibration buffer has a pH of 7.0-10.0, about pH 8.5-9.5, or about pH 9. In a specific, non-limiting embodiment, the equilibration buffer comprises 25 mM Tris, 60 mM NaCl, and 0.001% poloxamer, and is about pH 9. In another specific, nonlimiting embodiment, the equilibration buffer comprises 25 mM Tris, 20 mM Na2SO4, and 0.001% poloxamer, and is about pH 9.5. AEX Columns, Column Volumes, Flow Rates

[0180] Any suitable AEX column and resin known in the art (such as commercially available AEX columns and resins) may be used in embodiments of the disclosed methods. The net charge of a protein to be separated (such as of an AAV full capsid to be separated from other components of an AAV starting preparation) determines resin choice. Proteins are zwitterionic and thus can carry either a net positive or a net negative charge. Buffer pH will dictate a given protein’s net charge (such as the net surface charge of an AAV full capsid), and in theory, a protein could be purified using either cation or anion exchange. However, a protein is generally not stable at every pH, and a pH that would render a protein positively charged might also denature the protein. Thus, protein stability and buffer choice can dictateresin choice for ion exchange chromatography-based protein separations. In particular embodiments of the disclosed methods, a positively charged anion exchange resin is chosen to capture negatively charged AAV full capsids.

[0181] An anion exchange resin of use herein is an insoluble matrix or solid support (e.g., beads) capable of having a surface ionization over a pH range of about 1 to about 14. In one embodiment, a strong anion exchange resin is a solid support having a surface coated with a functionalized ligand, such as a mixed amine, a quaternary amine, trimethylammoniumethyl (TMAE), dimethylaminopropyl, diethylaminoethyl (DEAE), dimethylaminoethyl (DMAE), polyethyleneimine (PI), or guanidinium. In some embodiments, the anion exchange resin is a mixed amine ion exchange resin, such as polyethyleneimine. In some embodiments, the anion exchange resin is a quaternary amine ion exchange resin, such as quaternized polyethyleneimine. In a further embodiment, the anion exchange resin comprises trimethylamine and a support matrix comprising poly(glycidyl methacrylate-co-ethylene dimethacrylate). However, other suitable anion exchange resins may be selected. Examples of strong anionic exchange resins are those of the CIMultus QA™ column and the POROS HQ™ column. The resins for these and other suitable columns can be obtained commercially, such as from Amersham / Pharmacia (Piscataway, N.J.), PerSeptive Biosystems (Foster City, Calif.), TosoHaas (Montgomeryville, Pa.) and other suppliers.

[0182] The anion exchange material may be in the form of a monolith column, a traditional bead-based column, a membrane, a filter, a fiber (such as a nano-fiber), or another convective medium. In some embodiments, the ion exchange material is in a column having a capacity of 0 to 0.5 mL or 1 mL. In some embodiments, the ion exchange material is in a column having a capacity of 1 mL to 8 mL, such as 1, 2, 3, 4, 5, 6, 7, or 8 mL. In some embodiments, the ion exchange material is in a column having a capacity of 8 mL to 140 L, such as 8-100 mL, 8-250 mL, 8-500 mL, 8-750 mL, 8-1000 mL (IL), 1-140 L, 1-120 L, 1-100 L, 1-80 L, 1- 60 L, 1-40 L, 1-20 L, 1-10 L, or 1-5 L. In some embodiments, the column is at least an 8 mL column, at least a 10 mL column, at least a 20 mL column, at least a 30 mL column, at least a 40 mL column, at least a 50 mL column, at least a 100 mL column, at least a 200 mL column, at least a 300 mL column, at least a 400 mL column, at least a 500 mL column, at least a 600 mL column, at least a 700 mL column, at least an 800 mL column, at least a 900 mL column, at least a 1000 mL (IL) column, at least a 2000 mL (2L) column, at least a 10 L column, at least a 20 L column, at least a 30 L column, at least a 40 L column, at least a 50 L column, at least a 60 L column, at least a 70 L column, at least an 80 L column, at least a 90 L column, at least a 100L column, at least a 140 L column, or a column with a capacity greater than 140L as well as any other column with a capacity between the volumes listed above. Alternatively, another vessel type may be used to contain the anion exchange resin solid support.

[0183] Suitable liquid chromatography methods of use herein are known in the art and include but are not limited to high performance liquid chromatography (HPLC) and fast protein liquid chromatography (FPLC). HPLC and FPLC are forms of liquid chromatography that can be used to analyze or purify mixtures of proteins. HPLC systems are known in the art and commonly include a pump, injector, column, detector, and computer. As in other forms of chromatography, separation is possible because the different components of a mixture have different affinities for two materials, a moving fluid (the “mobile phase”) and a porous solid (the stationary phase). In the present invention, the mobile phase is an aqueous solution, or “buffer”. The buffer flow rate may be controlled by gravity or a pump (e.g., a positivedisplacement pump) and can be kept constant or varied. Suitably, the composition of the buffer can be varied by drawing fluids in different proportions from two or more external reservoirs. In particular embodiments of the disclosed methods, a stationary phase is an anion exchange resin (such as a strong anion exchange resin), typically composed of beads. These beads may be packed into a vessel, e.g., a cylindrical glass or plastic column, or another suitable vessel.

[0184] HPLC UV-visible light detectors (such as tunable detectors and photodiode array (PDA) detectors) operate by passing visible and UV light through a sample (such as in a flow cell), and measuring the absorption of the different wavelengths that pass through the sample. The amount of light absorbed provides information about certain properties of the sample. AAV capsids having some (partially empty) or no (empty) genomic sequences packaged therein have 260 / 280 absorbance ratios less than 1. Peaks that exhibit an area under the 280 nm curve that is larger than a corresponding area under the 260 curve indicate fractions more highly enriched in AAV empty capsids. Similarly, peaks having an area under the 260 nm curve that is larger than a corresponding area under the 280 curve (wherein the A260 / 280 ratio is >1) generally indicate fractions more highly enriched in AAV full capsids. AAV full capsids can be collected from a fraction that is eluted when the peak for A260 crosses over and exceeds the peak for A280 (i.e., reaches an inflection point).

[0185] As provided herein, volumes of a mobile phase e.g., a loading buffer comprising an AAV starting preparation, or an elution buffer, wash buffer, flush buffer, or equilibration buffer described herein) are described as “column volumes” (CV). These volumes may be extrapolated to other vessel shapes and designs. In some embodiments, a disclosed methodcomprises applying 1-20 CV of a flush buffer described herein, such as 1-15, 5-20, 5-15, 8- 12, or 10 CV of the flush buffer, to an AEX column. In some embodiments, a disclosed method comprises applying 1-20 CV of a pre-equilibration buffer described herein, such as 1- 15, 5-20, 5-15, 8-12, or 10 CV of the pre-equilibration buffer, to an AEX column. In some embodiments, a disclosed method comprises applying 1-20 CV of an equilibration buffer described herein, such as 1-15, 5-20, 5-15, 8-12, or 10 CV of the equlibration buffer, to an AEX column. In some embodiments, a disclosed method comprises applying 1-20 CV of a monovalent cation salt wash buffer described herein, such as 1-15, 5-20, 5-15, 8-12, or 10 CV of the monovalent cation salt wash buffer, to an AEX column. In some embodiments, a disclosed method comprises applying 1-20 CV of a monovalent cation salt wash buffer described herein, such as 1-15, 5-20, 5-15, 8-12, 7, 10, or 12 CV of the monovalent cation salt wash buffer, to an AEX column. In some embodiments, a disclosed method comprises applying 1-20 CV of a second flush buffer described herein, such as 1-15, 5-20, 5-15, 8-12, or 10 CV of the second flush buffer, to an AEX column. In some embodiments, a disclosed method comprises applying 2-100 CV of a divalent cation salt elution buffer described herein, such as 2-90, 2-80, 2-70, 2-60, 2-50, 2-40, 2-30, 2-20, 2-10, 2-9, 2-8, 2-7, 3-10, 3-9, 3-8, 3-7, 4-8, 5-7, 10-90, 20-100, 20-90, 20-80, 30-70, 40-80, 50-70, 55-65, or 60 CV of the divalent cation salt elution buffer, to an AEX column. In some embodiments, the AAV starting preparation is loaded onto the column in a total of 5-60 CV, such as 5-50, 5-40, 5-30, 5-20, 5-10, 10-50, 20-60, 10-45, 15-45, 20-40, 25-35, 30, 33, 33.33, 8, 8.03, 16, 16.3, 22, or 22.8 CV, such as following application of an equilibration buffer and prior to application of a divalent cation salt elution buffer (and optionally prior to application of a monovalent cation salt wash buffer).

[0186] Regulation of the loading and flow rate of (such as of a mobile phase) through a column, such as a flow rate of any of the buffers described herein, or of an AAV starting preparation described herein, can enhance separation of AAV full and empty capsids. In one embodiment, the sample loading flow rate is less than or equal to the elution flow rate. For example, the loading flow rate (such as the loading flow rate of an AAV starting preparation onto a column) may be in the range of about 10 mL / min to about 60 mL / min, about 15 mL / min to about 50 mL / min, about 30 mL to about 50 mL, about 35 mL to about 45 mL, or about 20 mL / min to about 45 mL / min, about 10 mL / min, about 20 mL / min, about 30 mL / min, about 40 mL / min, or about 50 mL / min, for an 8 mL monolith column, or in the range of about 2 mL / min to about 15 mL / min for a 1 mL monolith column, such as in the range of about 3 mL / min to about 10 mL / min, about 3 mL / min to about 8 mL / min, about 3mL / min to about 7 mL / min, about 4 mL / min to about 6 mL / min, or about 3 mL / min, about 4 mL / min, about 5 mL / min, about 6 mL / min, or about 7 mL / min. Suitable flow rates may be extrapolated for a non-monolith column.C. AAV Starting Preparations

[0187] In some embodiments, obtaining an AAV starting preparation comprises culturing an AAV packaging cell in media that allows production of the AAV. Accordingly, in some embodiments an AAV starting preparation comprises an AAV full capsid (such as an AAV6 full capsid) and other components, such as media collected from a packaging cell culture and / or components of a packaging cell lysate. An AAV starting preparation can comprise impurities present in the packaging cell media and / or packaging cell lysate, such as various cellular components, such as packaging cell DNA, packaging cell proteins, media components, and in some instances, helper virus or helper virus plasmid DNA.

[0188] A variety of suitable cells and cell lines have been described for use in production of AAV. A packaging cell useful in the present disclosure can be a eukaryotic cell, a fungal cell, an insect cell, a prokaryotic cell (e.g, bacterial or archaeal cell), or a cell from a multicellular organism (e.g., a cell line) cultured as a unicellular entity, and include the progeny of the original cell if such cell has been transformed by the nucleic acid. In some embodiments, the cell is a eukaryotic cell, such as a 293T cell (such as a HEK293T cell). Exemplary mammalian cells include without limitation, A549, WEHI, 3T3, 10T1 / 2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO, WI38, HeLa, HEK 293 (which express functional adenoviral El), Saos, C2C12, L cells, HT1080, HepG2 cells, and primary fibroblast, hepatocyte, and myoblast cells derived from mammals including human, monkey, mouse, rat, rabbit, and hamster. In certain embodiments, the cells are suspension-adapted cells. The selection of the mammalian species providing the cells is not a limitation of this invention; nor is the type of mammalian cell, ie., fibroblast, hepatocyte, tumor cell, etc.

[0189] In other embodiments, the cell is a fungal cell, such as a yeast cell, such as a yeast cell of species Saccharomyces (such as Saccharomyces cerevisiae). In other embodiments, the cell is an insect cell (e.g., for use in baculovirus-based AAV production systems), such as an Sf9 cell. A “recombinant packaging cell” (also referred to as a “genetically modified packaging cell”) is a packaging cell into which has been introduced a heterologous nucleic acid, e.g., an expression vector. For example, a bacterial packaging cell is a genetically modified bacterial packaging cell by virtue of introduction of an exogenous nucleic acid (e.g., a plasmid or recombinant expression vector) into a suitable bacterial packaging cell, and a eukaryotic packaging cell is a genetically modified eukaryotic packaging cell (e.g, amammalian cell), by virtue of introduction of an exogenous nucleic acid into a suitable eukaryotic packaging cell.

[0190] In certain embodiments, the disclosed methods comprise culturing an AAV packaging cell in media that allows production of the AAV. Methods of culturing an AAV packaging cell to produce an AAV are known in the art. In certain embodiments, the disclosed methods comprise culturing an AAV packaging cell in media that allows production of the AAV. Methods of culturing an AAV packaging cell to produce an AAV are known in the art, and exemplary methods are discussed herein. Suitable media known in the art may be used for AAV production including, without limitation, media produced by Hyclone Laboratories and JRH including Modified Eagle Medium (MEM), Dulbecco's Modified Eagle Medium (DMEM), custom formulations such as those described in U.S. Pat. No. 6,566,118, and Sf- 900 II SFM media as described in U.S. Pat. No. 6,723,551.

[0191] AAV production culture media may be supplemented with serum or serum-derived recombinant proteins, e.g., at a level of 0.5%-20% (v / v or w / v). Alternatively, as is known in the art, AAV vectors may be produced in serum-free conditions which may also be referred to as media with no animal-derived products. Commercial or custom media designed to support production of AAVs may also be supplemented with one or more cell culture components know in the art, including without limitation, glucose, vitamins, amino acids, and / or growth factors, in order to increase the titer or yield of AAV in production cultures.

[0192] AAV production cultures can be grown under a variety of conditions (over a wide temperature range, for varying lengths of time, and the like) suitable to the particular host cell being utilized. As is known in the art, AAV production cultures include attachmentdependent cultures that can be cultured in suitable attachment-dependent vessels such as, for example, roller bottles, hollow fiber filters, microcarriers, and packed-bed or fluidized-bed bioreactors. AAV vector production cultures may also include suspension-adapted host cells such as HeLa, 293, and SF-9 cells that can be cultured in a variety of attachment-independent vessels including, for example, spinner flasks, stirred tank bioreactors, batch bioreactors, fed batch bioreactors, continuous culture bioreactors (e.g., perfusion bioreactors), and disposable systems such as the Wave bag system.

[0193] In some embodiments, the AAV is harvested from the AAV packaging cell and / or from the media, thereby providing an AAV starting preparation. The harvesting may comprise cell disruption (such as cell lysis) or may substantially not comprise cell disruption (such as in embodiments wherein the AAV is harvested from cell culture media (e.g., supernatant)). Thus, AAVs of the invention may be harvested from AAV production culturesby lysis of the packaging cells of the production culture or by harvest of the media (“spent” media) from the production culture, provided the cells are cultured under conditions known in the art to cause release of AAV particles into the media from intact cells (such as described more fully in U.S. Pat. No. 6,566,118). Suitable methods of lysing cells are also known in the art and include for example multiple freeze / thaw cycles, sonication, microfluidization, and treatment with chemicals, such as detergents and / or proteases.

[0194] On its own, AAV does not possess the ability to efficiently replicate its genetic material, and thus typically requires the presence of a helper virus. Three helper viruses are commonly used for AAV production: adenovirus (Ad), herpes simplex virus (HSV), and baculovirus (Bac). Ad and HSV helper AAV production methods use mammalian cell lines while the Bac system uses insect cells. Unlike the HSV and Bac systems, the Ad-based system genes required for helper function have been identified and can be expressed via a plasmid, thus eliminating the need for actual Ad to be produced. An exemplary “helper free” system can use three plasmids: one containing the Ad E2A, E4, and VA RNA helper genes, a second expressing the AAV rep and cap genes, and third, a nucleic acid of interest (such as described elsewhere herein) flanked by AAV inverted terminal repeats (ITRs). Accordingly, an AAV production system useful in the disclosed methods may be helper free.

[0195] In some embodiments of the disclosed methods, the AAV full capsid (such as an AAV6 full capsid) obtained from an AAV starting preparation comprises an AAV capsid protein and a nucleic acid molecule that comprises an AAV 5’ inverted terminal repeat (ITR), a nucleic acid molecule of interest to be packaged into the AAV capsid, and a 3’ ITR. In such embodiments, the packaging cell can thus comprise (i) the at least one nucleic acid of interest to be packaged into the AAV capsid, (ii) a nucleic acid molecule encoding the AAV capsid protein under control of one or more sequences that direct its expression in the packaging cell, (iii) a nucleic acid molecule encoding an AAV Rep protein that expresses the AAV Rep protein in the cell to permit packaging of the nucleic acid of interest into the AAV capsid, and / or (iv) one or more helper functions required for packaging the nucleic acid molecule of interest into the AAV capsid. In certain embodiments, the nucleic acid molecule of interest encodes a chimeric antigen receptor (CAR) or T cell receptor (TCR)).

[0196] The preparation of a packaging cell suitable for use in the disclosed methods involves techniques such as assembly of selected DNA sequences. This assembly may be accomplished utilizing conventional techniques. Such techniques include cDNA and genomic cloning, which are well known and are described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., includingpolymerase chain reaction, synthetic methods, and any other suitable methods which provide the desired nucleotide sequence.

[0197] A cell (such as an AAV packaging cell) has been transformed by exogenous DNA, e.g., a recombinant expression vector, when such DNA has been introduced inside the cell. The presence of exogenous DNA can result in permanent or transient genetic change. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. A cell wherein transforming DNA has been integrated into the genome of the cell is “stably transformed.” In particular embodiments, the AAV packaging cell is stably transformed with one or more of (i) one or more nucleic acid molecules encoding one or more helper functions, (ii) a nucleic acid molecule encoding the AAV Rep protein; (iii) a nucleic acid molecule encoding the AAV capsid protein; (iv) and a nucleic acid molecule of interest. In some embodiments, the AAV packaging cell is stably transformed with each of (i) one or more nucleic acid molecules encoding one or more helper functions, (ii) a nucleic acid molecule encoding the AAV Rep protein; (iii) a nucleic acid molecule encoding the AAV capsid protein; (iv) and a nucleic acid molecule of interest. In some embodiments, the one or more helper functions, the AAV Rep protein, the AAV capsid protein, and / or the nucleic acid molecule of interest, is expressed under an activatable or inducible promoter. In certain embodiments, the nucleic acid molecule of interest encodes a chimeric antigen receptor (CAR) or T cell receptor (TCR)).

[0198] In any of the embodiments described herein, the nucleic acid of interest to be packaged into the AAV capsid may encode a chimeric antigen receptor (CAR) or T cell receptor (TCR)). In certain embodiments, the CAR comprises an antigen-binding domain and an intracellular signaling region comprising an intracellular signaling domain. In certain embodiments, the antigen-binding domain is or comprises an antibody or an antibody fragment thereof, which optionally is a single chain fragment. In certain embodiments, the fragment comprises an scFv. The intracellular signaling domain can comprise a primary signaling domain, a signaling domain that is capable of inducing a primary activation signal in a T cell, a signaling domain of a T cell receptor (TCR) component, and / or a signaling domain comprising an immunoreceptor tyrosine-based activation motif. In certain embodiments, the intracellular signaling domain is or comprises an intracellular signaling domain of a CD3 chain, optionally a CD3-zeta chain, or a signaling portion thereof. The CAR can comprise a transmembrane domain disposed between the extracellular domain and the intracellular signaling region, which can further comprise a costimulatory signaling domain. The costimulatory signaling domain can comprise an intracellular signaling domainof a T cell costimulatory molecule or a signaling portion thereof, such as an intracellular signaling domain of a CD28, a 4- IBB or an ICOS or a signaling portion thereof. In certain embodiments, the costimulatory signaling domain is between the transmembrane domain and the intracellular signaling domain. In certain embodiments, the TCR comprises an alpha chain containing a variable alpha (Va) region and a beta chain containing a variable beta (VP) region, wherein the TCR is capable of binding to or recognizing a peptide epitope in the context of an MHC molecule, such as HLA-A2.

[0199] An AAV starting preparation useful in the disclosed methods can be an AAV production culture harvest without further processing, or can be treated prior to loading on an AEX column using one or more of a clarifying treatment (such as filtration and / or centrifugation), one or more nucleases and / or proteases (to digest contaminating nucleic acids and / or proteins), an additionally chromatography step (such as affinity chromatography), a concentrating step, and the like. At harvest, an AAV starting preparation of the present disclosure may contain one or more of the following: packaging cell materials (such as packaging cell proteins and / or DNA); plasmid DNA; helper virus; helper virus proteins; helper virus DNA; and media components including, for example, serum proteins, amino acids, transferrins, and other low molecular weight proteins. In some embodiments, prior to separating the AAV from the other components of the AAV starting preparation, the AAV starting preparation is clarified to remove packaging cell debris. In some embodiments, the production culture harvest is clarified by filtration through a series of depth filters including, for example, a grade DOHC Millipore Millistak+HC Pod Filter, a grade A1HC Millipore Millistak+HC Pod Filter, and / or a 0.2 pm Filter Opticap XL 10 Millipore Express SHC Hydrophilic Membrane filter. Clarification can also be achieved by a variety of other standard techniques known in the art, such as, centrifugation or filtration through any suitable filter (such as any suitable cellulose acetate filter of 0.2 pm or greater pore size) known in the art. Still other suitable depth filters, e.g., in the range of about 0.045 pm to about 0.2 pm, or other filtration techniques may be used.

[0200] The AAV starting preparation can be treated with a nuclease, or a combination of nucleases, to digest any contaminating high molecular weight nucleic acid present in the production culture. Suitable nucleases include but are not limited to a DNAse, e.g., Benzonase® digestion performed under standard conditions known in the art. For example, a final concentration of 1 unit / mL to 2.5 units / mL of Benzonase® is used at a temperature ranging from ambient temperature to 37°C for a period of 30 minutes to several hours, or about 2 hours. In another example, a turbonuclease is used. However, one of skill in the artmay utilize another suitable nuclease, or a mixture of nucleases. Exonucleases may also be used to remove contaminating nucleic acids. Such nucleases may be selected to degrade single stranded DNA and / or double-stranded DNA, and RNA. Such steps may contain a single nuclease, or mixtures of nucleases directed to different targets, and may be endonucleases or exonucleases.

[0201] AAVs of the AAV starting preparation may be isolated or purified prior to loading onto an AEX resin using one or more of the following steps: tangential flow filtration (TFF) for concentrating the AAV particles, heat inactivation of helper virus, AAV capture by hydrophobic interaction chromatography, affinity capture chromatography to remove production system contaminants, buffer exchange by size exclusion chromatography (SEC), and / or nanofiltration. These steps may be used alone, in various combinations, or in different orders. In some embodiments, the method comprises all the steps in the order.

[0202] In some embodiments, a nuclease (e.g., Benzonase®)-treated mixture is concentrated via TFF. Large scale concentration of viruses using TFF ultrafiltration has been described by R. Paul et al., Human Gene Therapy, 4:609-615 (1993). TFF concentration of the AAV starting preparation enables a technically manageable volume of the preparation to be subjected to the methods of the present disclosure and allows for more reasonable sizing of a solid support (such as beads, such as in a column). In some embodiments, the AAV starting preparation is concentrated between at least two-fold or at least ten-fold. In some embodiments, the AAV starting preparation is concentrated between at least ten-fold and at least twenty-fold, such as at least 10-fold, at least 11 -fold, at least 12-fold, at least 13 -fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19- fold, or at least 20-fold. In some embodiments, the AAV starting preparation is concentrated between at least twenty-fold and at least fifty-fold. One of ordinary skill in the art will also recognize that TFF can also be used at any step in the disclosed methods where it is desirable to exchange buffers before performing the next step in the method.

[0203] In one embodiment, AAVs of the AAV starting preparation have been separated from contaminants (e.g., packaging cell, viral, and other nucleic acid or proteinaceous materials which are present in the production culture or are by-products thereof) present from the production system. In some embodiments, the AAV starting preparation comprising AAV full capsids and AAV empty capsids (and / or AAV partially empty capsids) contains less than about 10% contamination from non- AAV viral and cellular proteinaceous and nucleic acid materials, or less than about 5% contaminants, or less than about 1% contaminating viral and cellular proteinaceous and nucleic acid materials. Thus, in some embodiments, the AAVstarting preparation loaded onto the AEX resin is about 95% to about 99% free of contaminants.

[0204] In some embodiments, affinity capture chromatography may be used to separate AAVs of an AAV starting preparation from production system contaminants. This affinity capture can be performed using an antibody-capture affinity resin. In one embodiment, the solid support is a cross-linked poly(styrene-divinylbenzene) having an average particle size of about 50 pm and having an AAV-specific antibody. An example of one such commercially available affinity resin is POROS™ high performance affinity resin commercially available from Thermo Fisher Scientific. The resin contains ligands created by a proprietary technology based on camelid-derived single-domain antibody fragments coupled to the resin via carbonyldiimidazole (CDI). The ligand is a 13-kDa single-domain fragment that comprises the 3 CDRs that form the antigen binding domain and is efficiently produced by the yeast Saccharomyces cerevisiae in a production process free of animal components. Other suitable affinity resins may be selected or designed which contain an AAV-specific antibody, AAV6 specific antibody, or other immunoglobulin construct which is an AAV-specific ligand. Such solid supports may be any suitable polymeric matrix material, e.g., agarose, sepharose, sephadex, amongst others.

[0205] In some embodiments, an AAV starting preparation (such as an AAV starting preparation that has undergone one or more processing steps as described herein) is diluted, such as in a buffer, prior to loading onto an AEX resin. In particular embodiments, the AAV starting preparation (such as an AAV starting preparation that has undergone one or more processing steps as described herein) is diluted, such as in a buffer, between 2X and 50X, such as between 2X and 40X, between 2X and 3 OX, between 2X and 20X, between 2X and 10X, between 2X and 5X, between 3X and 7X, between 4X and 6X, or 5X prior to loading onto the AEX resin. In particular embodiments, the buffer in which the AAV starting preparation is diluted comprises Tris buffer or BTP buffer, such as 30-70 mM Tris or BTP, 35-65 mM Tris or BTP, 40-60 mM Tris or BTP, 45-55 mM Tris or BTP, or 50 mM Tris or BTP, such as at a pH of between 8 and 10, such as between pH 8.5 and 9.5, such as pH 9.0. In other particular embodiments, the buffer in which the AAV starting preparation is diluted and subsequently loaded onto the column comprises one or more of 20-100 mM Tris, 1-10 mM citrate, 10-100 mM NaCl, and 0.0001-0.01% poloxamer, such as at a pH of between 8 and 10, such as between pH 8.5 and 9.5, such as pH 9.0. In a specific, non-limiting example, the buffer in which the AAV starting preparation is diluted and subsequently loaded onto thecolumn comprises 50 mM Tris, 4 mM citrate, 40 mM NaCl, and 0.001% Poloxamer, at a pH of 9.0.

[0206] Suitable loading amounts may be in the range of about 2 to about 5* 1012GC / mL resin, or less. Equivalent amounts may be calculated for other sized columns or other vessels. At this point prior to anion exchange resin separation as described herein, the term “genome copy” refers to the full capsids in a mixture of both AAV full capsid and AAV6 intermediaries.

[0207] An AAV packaging cell culture may yield a mixture of AAV full capsids, AAV empty capsids, and / or AAV partially empty capsids. In some embodiments, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% of the AAV capsids collected from a culture are empty and / or partially empty capsids. In other embodiments, more or less of the capsids are empty and / or partially empty capsids. In some embodiments, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% of the AAV capsids collected from a culture are full capsids. In other embodiments, more or less of the capsids are full capsids.

[0208] In particular embodiments, the AAV starting preparation comprises at least 1%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 20%, at least 25%, or at least 30% AAV full capsid (such as AAV6 full capsid). In particular embodiments, the AAV starting preparation comprises 1-40% AAV full capsid, such as 1-30%, 1-20%, 1-19%, 1-18%, 1- 17%, 1-16%, 1-15%, 1-14%, 1-13%, 1-12%, 2-40%, 3-40%, 4-40%, 5-40%, 5-30%, 5-20%, 5-15%, 10-40%, 10-30%, 10-20%, or 10-15% AAV full capsid (such as AAV6 full capsid).III. Additional Features of Certain Disclosed MethodsA. Adeno-associated Viruses (AAVs)

[0209] In embodiments of the present disclosure, an AAV full capsid is separated (purified) from AAV intermediaries (AAV empty capsids and / or AAV partially empty capsids), production culture contaminants such as helper virus, helper virus proteins, plasmids, cellular proteins and nucleic acids, media components, serum proteins, AAV rep proteins, unassembled AAV VP1, VP2, and VP3 proteins, and similar, comprised in an AAV starting preparation that also comprises the AAV. In some embodiments, the AAV is a recombinant or engineered AAV. In some embodiments, the AAV is a pseudotyped AAV. Use of a recombinant or engineered AAV enables insertion, deletion, or substitution of target DNA sequences into the genomes of mammalian cells. AAV comprises a protein capsid surrounding and protecting a single-stranded DNA genome of approximately 4.8 kilobases(kb). Naso et aL, BioDrugs. 2017; 31(4): 317-334. AAV belongs to the parvovirus family and is dependent on co-infection with other viruses, mainly adenoviruses, in order to replicate. Its single-stranded genome contains three genes, Rep (Replication), Cap (Capsid), and aap (Assembly). These three genes give rise to at least nine gene products through the use of three promoters, alternative translation start sites, and differential splicing. These coding sequences are flanked by inverted terminal repeats (ITRs) that are required for genome replication and packaging. The Rep gene encodes four proteins (Rep78, Rep68, Rep52, and Rep40), which are required for viral genome replication and packaging, while Cap expression gives rise to the viral capsid proteins (VP; VP1 / VP2 / VP3), which form the outer capsid shell that protects the viral genome, and is involved in cell binding and internalization. The viral capsid is comprised of approximately 60 proteins arranged into an icosahedral structure with the capsid proteins in a molar ratio of 1 : 1 : 10 (VP1 :VP2:VP3). The aap gene encodes the assembly-activating protein (AAP) in an alternate reading frame overlapping the cap gene. This nuclear protein is thought to provide a scaffolding function for capsid assembly, but may be nonessential in certain AAV serotypes.

[0210] Recombinant AAV (rAAV), which lacks viral DNA, is a protein-based nanoparticle engineered to traverse the cell membrane, where it can ultimately traffic and deliver a DNA cargo (comprised within the viral capsid) into the nucleus of a cell. Naso et al., BioDrugs. 2017; 31(4): 317-334. In the absence of Rep proteins, ITR-flanked transgenes encoded within rAAV can form circular concatemers that persist as episomes in the nucleus of a transduced cell. Because recombinant episomal DNA does not integrate into host genomes, it will eventually be diluted over time as the cell undergoes repeated rounds of replication. This will eventually result in the loss of the transgene and transgene expression, with the rate of transgene loss dependent on the turnover rate of the transduced cell. These characteristics make rAAV appealing for certain gene therapy applications.

[0211] In some embodiments, the AAV that is purified using the disclosed methods is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrhlO, AAVrh74, AAV9, AAV9P, AAV10, AAV11, AAV12, or Myo-AAV, or novel chimeras thereof. In particular embodiments, the AAV is AAV6. AAV6 has been shown to have enhanced capsid-associated tropism in tissues, such as the lungs, cardiac muscle, and skeletal muscle (Halbert et al., J Virol. 2001; 75(14):6615-24; Rengo et al., Circulation. 2009; 119(l):89-98; Bortolanza et al. Mol Ther. 2011; 19(11):2055-64; ). Like other AAVs, AAV6 can transduce non-dividing cells (Halbert et al., J Virol. 2001; 75(14):6615-24). In some embodiments, the AAV6 is less than 5 kb from ITR to ITR in size, inclusive of both ITRs. In particular embodiments, theAAV6 is less than 4.9 kb from ITR to ITR in size, inclusive of both ITRs. In further embodiments, the AAV6 is less than 4.85 kb from ITR to ITR in size, inclusive of both ITRs. In further embodiments, the AAV6 is less than 4.8 kb from ITR to ITR in size, inclusive of both ITRs. In further embodiments, the AAV6 is less than 4.75 kb from ITR to ITR in size, inclusive of both ITRs. In further embodiments, the AAV6 is less than 4.7 kb from ITR to ITR in size, inclusive of both ITRs. In some embodiments, the AAV6 is 3.9-5 kb, 4-5 kb, 4.2-5 kb, 4.4-5 kb, 4.6-5 kb, 4.7-5 kb, 3.9-4.9 kb, 4.2-4.9 kb, 4.4-4.9 kb, 4.7-4.9 kb, 3.9-4.85 kb, 4.2-4.85 kb, 4.4-4.85 kb, 4.6-4.85 kb, 4.7-4.85 kb, 4.7-4.9 kb, 3.9-4.8 kb, 4.2-4.8 kb, 4.4- 4.8 kb or 4.6-4.8 kb from ITR to ITR in size, inclusive of both ITRs. In some embodiments, the vector is 4.4-4.85 kb from ITR to ITR in size, inclusive of both ITRs.

[0212] In some embodiments, an AAV6 has a capsid comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence of the AAV6 capsid encoded by the AAV6 genome of SEQ ID NO: 1. In some embodiments, the amino acid sequence of the AAV6 capsid protein consists of SEQ ID NO: 1. In addition, the methods provided herein may be used to purify other AAV having a capsid highly related to the AAV6 capsid. For example, AAVs having sequences having about 95%, about 96%, about 97%, about 98%, or about 99% identity to the referenced amino acid sequence in SEQ ID NO: 1 may be obtained (e.g., isolated) using the methods described herein, provided that the integrity of the peptide binding site is maintained. Methods of generating the capsid, coding sequences for the capsid, and methods for production of rAAV viral vectors have been described. See, e.g., Gao, et al., Proc. Natl. Acad. Sci. U.S.A. 100 (10), 6081-6086 (2003), U.S. Pat. Nos. 6,759,237, 7,105,345, and 7,186,552, and US Patent Publication 2013 / 0045186A1. In some embodiments, the AAV capsid is a chimeric capsid, an engineered capsid, or a natural capsid.

[0213] In some embodiments, the AAV comprises a nucleic acid molecule of interest (i.e., enclosed within the fully assembled AAV capsid), such as a nucleic acid molecule that encodes a therapeutic molecule, such as a therapeutic protein or RNA molecule. A nucleic acid molecule of interest can be operably linked to one or more regulatory elements, such as a promoter, such as a tissue-specific specific promoter. The term “operably linked” means that the nucleic acid molecule of interest is linked to regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence. AAVs obtained using the disclosed methods can include any AAV comprising a tissue-specific promoter in facilitating administration of gene therapy, which can include any known gene editing system in the art. A promoter as described herein can also be “cell specific,” meaning that the particularpromoter selected for the AAV can direct expression of the selected transgene / nucleotide sequence of interest in a particular cell or cell type.

[0214] An exemplary promoter useful in the present disclosure can be a constitutively active promoter (i.e., a promoter that is constitutively in an active / “ON” state), an inducible promoter (i.e., a promoter whose state, active / “ON” or inactive / “OFF”, is controlled by an external stimulus, e.g., the presence of a particular temperature, compound, or protein), a spatially restricted promoter (i.e., transcriptional control element, enhancer, etc., e.g., a tissue specific promoter, a cell type specific promoter, etc.), or a temporally restricted promoter (i.e., the promoter is in the “ON” state or “OFF” state during specific stages of embryonic development or during specific stages of a biological process).

[0215] Suitable promoters can be derived from viruses (viral promoters), or they can be derived from any organism, including prokaryotic or eukaryotic organisms. Suitable promoters can be used to drive expression by any RNA polymerase (e.g., pol I, pol II, pol III). Exemplary promoters include, but are not limited to the SV40 early promoter, mouse mammary tumor virus long terminal repeat (LTR) promoter; adenovirus major late promoter (Ad MLP); a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), a Rous sarcoma virus (RSV) promoter, a human U6 small nuclear promoter (U6) (Miyagishi et al.. Nature Biotechnology. 20: 497-500; 2002), an enhanced U6 promoter (e.g., Xia et al., Nucleic Acids Res. Sep 1(31): 17; 2003), a human Hl promoter (Hl), and the like.

[0216] Nucleic acids of interest useful herein can also include other regulatory elements, i.e., transcriptional and translational control sequences, such as enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, that provide for and / or regulate transcription of a non-coding sequence (e.g., guide RNA) or a coding sequence (e.g., site- directed modifying polypeptide, or Cas9 polypeptide) and / or regulate translation of an encoded polypeptide. Exemplary regulatory sequences are known in the art and are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology. Vol. 185, Academic Press, San Diego, CA (1990).

[0217] All patents, patent applications, websites, other publications or documents, accession numbers and the like cited herein are incorporated by reference in their entirety for all purposes to the same extent as if each individual item were specifically and individually indicated to be so incorporated by reference. If different versions of a sequence are associated with an accession number at different times, the version associated with the accession numberat the effective filing date of this application is meant. The effective filing date means the earlier of the actual filing date or filing date of a priority application referring to the accession number, if applicable. Likewise, if different versions of a publication, website or the like are published at different times, the version most recently published at the effective filing date of the application is meant, unless otherwise indicated.EXAMPLES

[0218] The Examples below demonstrated a surprising progression for obtaining full AAV capsid by chromatography. An industry-standard monovalent cationic salt wash under linear gradient conditions eluted empty capsids followed by full capsids. This was observed across different monovalent cations. Surprisingly, as shown in Examples 1-5 herein, it was discovered that a divalent cationic salt under gradient conditions eluted full capsids followed by empty capsids. This was observed across different divalent cations. Without being bound by a particular theory, these results demonstrated a valency-dependent elution pattern. Examples 1-5 combined (1) an isocratic monovalent cationic salt wash to take advantage of the empty -then-full capsid elution order with (2) a gradient divalent cationic salt elution to take advantage of the full-then-empty capsid elution order (only eluting full capsid at this stage, as empty capsids were eluted during the wash). Examples 6-8 combined (1) an isocratic monovalent cation salt wash to take advantage of the empty-then-full capsid elution order with (2) an isocratic divalent cation salt elution to take advantage of the full-then-empty capsid elution order (only eluting full capsid at this stage, as empty capsids were eluted during the wash), in a fully isocratic process. These experiments illustrated exploiting the surprising valence dependency across a range of process operational modes. These approaches addressed the challenging problem of inherently low chromatographic resolution between empty and full capsids.Example 1: Separation of an AAV6 preparation using an industry standard method

[0219] This example describes separation of an AAV6 preparation using an industry standard method. The workflow described in this example is illustrated in Table 1, and results are shown in FIG. 1.

[0220] The AAV6 preparation process comprised lysis of the HEK293 packaging cell culture and subsequent clarification of the lysate using depth filtration. Additional AAV6 concentration and purification methods included tangential flow filtration and affinity chromatography prior to the described AEX chromatography method. The separation wasperformed on an AKTA Avantl50 HPLC system (Cytiva, Massachusetts, USA) using a CIMmultus® QA monolithic anion exchange chromatography column, which was first flushed with 10 CVs of 25 mM Bis Tris Propane (BTP) buffer (pH 9) containing 15 mM HC1, 60 mM NaCl, and 0.001% poloxamer. The column was pre-equilibrated with 10 CVs of 2000 mM NaCl, and was then equilibrated with 10 CVs of 25 mM Bis Tris Propane (BTP) buffer (pH 9) containing 15 mM HC1, 60 mM NaCl, and 0.001% poloxamer. The AAV6 preparation was diluted 5X in 50 mM BTP (pH 9.0), then filtered through a 0.2 um filter and loaded onto the column in 3.33 CVs (at approximately 1.5xl012viral genomes / mL and IxlO13capsids / mL). The column was again equilibrated with 10 CVs of 25 mM BTP buffer (pH 9) containing 15 mM HC1, 60 mM NaCl, and 0.001% poloxamer (Buffer A). Buffer B contained 25 mM BTP buffer (pH 9) comprising 15 mM HC1, 382.5 mM NaCl, and 0.001% poloxamer. A 40 CV linear salt gradient from 0-100% Buffer B was used to elute the AAV full capsid. The flow rate was maintained at 5 mL / min throughout the run.Table 1. AAV6 preparation separation using industry standard conditions

[0221] As shown in FIG. 1, the empty capsid peak appeared before the full capsid peak in the chromatogram, indicating that at least a portion of the empty capsid eluted prior to at least a portion of the full capsid. The smaller peaks that appeared after the full capsid peak may comprise AAV full capsid, AAV intermediaries, or any combination thereof. The method resulted in a recovery yield of approximately 59% of the AAV full capsid present in the AAV starting preparation loaded onto the column (Table 2). Table 2 values were calculated based on capsid particle counts obtained via dynamic and static light scattering followed bymeasurement of UV absorbance at 260 and 280nm wavelengths. These measurements indicated that the AAV9 full capsid peak comprised 20% AAV9 full capsid and 80% AAV9 empty / partially empty capsid, and further that the AAV9 full capsid peak comprised 59% of the total full capsid that was loaded onto the column in the AAV starting preparation. Notably, the additional peaks following the full capsid peak were not fully separated (resolved), resulting in co-elution of AAV full capsid with some amount of AAV intermediaries.Table 2. AAV6 capsid recoveries for Example 1. The 4% of full vector in the empty vector peak is likely due to the sub-par performance of the industry standard AEX method.Example 2: Separation of an AAV6 preparation using a MgCh gradient

[0222] This example describes separation of an AAV6 preparation using a MgCh gradient. The workflow described in this example is illustrated in Table 3, and results are shown in FIG. 2.

[0223] The AAV6 preparation process comprised lysis of the HEK293 packaging cell culture and subsequent clarification of the lysate using depth filtration. Additional AAV6 concentration and purification methods included tangential flow filtration and affinity chromatography prior to the described AEX chromatography method. The separation was performed on an AKTA Avantl50 HPLC system (Cytiva, Massachusetts, USA) The separation was performed on a an AKTA Avantl50 HPLC system (Cytiva, Massachusetts, USA) using a CIMmultus® QA monolithic anion exchange chromatography column, which was first flushed with 10 CVs of 25 mM Tris buffer (pH 9) containing 60 mM NaCl and 0.001% poloxamer. The column was pre-equilibrated with 10 CVs of 2000 mM NaCl, and was then equilibrated with 10 CVs of 25 mM Tris buffer (pH 9) containing 60 mM NaCl and 0.001% poloxamer. The AAV6 preparation was diluted 5X in 50 mM Tris (pH 9.0), then filtered through a 0.2 um filter and loaded onto the column in 33.33 CVs(at approximately 1.5xl012viral genomes / mL and IxlO13capsids / mL). The column was again equilibrated with 10 CVs of 25 mM Tris buffer (pH 9) containing 60 mM NaCl and 0.001% poloxamer, and then flushed with 2 CVs of 25 mM Tris buffer (pH 9) containing 0.001% poloxamer (Buffer A). Buffer B contained 25 mM Tris buffer (pH 9) containing 100 mM MgCh and 0.001%pol oxamer. A 60 CV linear salt gradient from 0-100% Buffer B was used to elute the AAV full capsid. The flow rate was maintained at 5 mL / min throughout the run.Table 3, AAV6 preparation separation using a MgCh gradient

[0224] As shown in FIG. 2, the full capsid peak (comprising approximately 37% AAV full capsid) appeared before the empty+full capsid peak in the chromatogram, indicating that at least a portion of the full capsid eluted prior to at least a portion of the peak comprising AAV full capsids and empty and / or partially empty capsids. The method resulted in a recovery yield of approximately 87% of the AAV full capsid present in the AAV starting preparation loaded onto the column (Table 4). Table 4 values were calculated based on capsid particle counts obtained via dynamic and static light scattering followed by measurement of UV absorbance at 260 and 280nm wavelengths. These measurements indicated that the AAV9 full capsid peak comprised 27% AAV9 full capsid and 73% AAV9 empty / partially empty capsid, and further that the AAV9 full capsid peak comprised 87% of the total full capsid that was loaded onto the column in the AAV starting preparation. Notably, the full capsid peak and the subsequent peak were more separated (resolved) than were the peaks in Example 1, resulting in relatively reduced co-elution of AAV intermediaries with the AAV full capsid. Further, AAV6 full capsid and AAV6 empty capsid peak elution order was switched as compared to Example 1. Accordingly, AAV empty capsids that were not washed off in the first wash (and that were thus still bound to the column resin), remained bound to the column resin and were not eluted during the elution step.Table 4. AAV6 capsid recoveries for Example 2.Example 3: Separation of an AAV6 preparation using a CaCh gradient

[0225] This example describes separation of an AAV6 preparation using a CaCh gradient. The workflow described in this example is illustrated in Table 5, and results are shown in FIG. 3.

[0226] The AAV6 preparation process comprised lysis of the HEK293 packaging cell culture and subsequent clarification of the lysate using depth filtration. Additional AAV6 concentration and purification methods included tangential flow filtration and affinity chromatography prior to the described AEX chromatography method. The separation was performed on an AKTA Avantl50 HPLC system using a CIMmultus® QA monolithic anion exchange chromatography column, which was first flushed with 10 CVs of 25 mM Tris buffer (pH 9) containing 60 mM NaCl and 0.001% poloxamer. The column was preequilibrated with 10 CVs of 2000 mM NaCl, and was then equilibrated with 10 CVs of 25 mM Tris buffer (pH 9) containing 60 mM NaCl and 0.001% poloxamer. The AAV6 preparation was diluted 5X in 50 mM Tris (pH 9.0), then filtered through a 0.2 um filter and loaded onto the column in 6.67 CVs (at approximately 1.5xl012viral genomes / mL and IxlO13capsids / mL). The column was again equilibrated with 10 CVs of 25 mM Tris buffer (pH 9) containing 60 mM NaCl and 0.001% poloxamer, and then flushed with 2 CVs of 25 mM Tris buffer (pH 9) containing 0.001% poloxamer (Buffer A). Buffer B contained 25 mM Tris buffer (pH 9) containing 100 mM CaCh and 0.001% poloxamer. A 60 CV linear salt gradient from 0-100% Buffer B was used to elute the AAV full capsid. The flow rate was maintained at 5 mL / min throughout the run.Table 5, AAV6 preparation separation using a CaCh gradient

[0227] As shown in FIG. 3, the full capsid peak (comprising approximately 30-35% AAV full capsid) appeared before the empty capsid peak in the chromatogram, indicating that at least a portion of the full capsid eluted prior to at least a portion of the peak comprising AAV full capsids and empty and / or partially empty capsids. The method resulted in an estimated recovery yield of approximately 60-70% of the AAV full capsid present in the AAV starting preparation loaded onto the column (Table 6). Table 6 values were calculated based on the area of the full peak (260 nm UV absorbance) and the ratio of A260 nm to A280 nm. These measurements indicated that the AAV9 full capsid peak comprised 30-35% AAV9 full capsid and 65-70% AAV9 empty / partially empty capsid, and further that the AAV9 full capsid peak comprised 60-70% of the total full capsid that was loaded onto the column in the AAV starting preparation. The full capsid and empty capsid peaks were more separated (resolved) than the full capsid and empty capsid peaks in Example 1, resulting in relatively reduced coelution of AAV intermediaries with the AAV full capsid. Notably, AAV6 full capsid and AAV6 empty capsid peak elution order was switched as compared to Example 1. Accordingly, AAV empty capsids that were not washed off in the first wash (and that were thus still bound to the column resin), remained bound to the column resin and were not eluted during the elution step.Table 6. AAV capsid recoveries for Example 3.Example 4: Separation of an AAV6 preparation using a NaCl wash step and a MgCh gradient

[0228] This example describes separation of an AAV6 preparation using a NaCl wash step and a MgCh gradient. The workflow described in this example is illustrated in Table 7, and results are shown in FIG. 4.

[0229] The AAV6 preparation process comprised lysis of the HEK293 packaging cell culture and subsequent clarification of the lysate using depth filtration. Additional AAV6 concentration and purification methods included tangential flow filtration and affinity chromatography prior to the described AEX chromatography method. The separation was performed on an AKTA Avantl50 HPLC system (Cytiva, Massachusetts, USA) using a CIMmultus® QA monolithic anion exchange chromatography column, which was first flushed with 10 CVs of 25 mM Tris buffer (pH 9) containing 60 mM NaCl and 0.001% pol oxamer. The column was pre-equilibrated with 10 CVs of 2000 mM NaCl, and was then equilibrated with 10 CVs of 25 mM Tris buffer (pH 9) containing 60 mM NaCl and 0.001% poloxamer. The AAV6 preparation was diluted 5X in 50 mM Tris (pH 9.0), then filtered through a 0.2 um filter and loaded onto the column in 33.33 CVs (at approximately 1.5xl012viral genomes / mL and IxlO13capsids / mL). The column was again equilibrated with 10 CVs of 25 mM Tris buffer (pH 9) containing 60 mM NaCl and 0.001% poloxamer. The column was then washed with 7 CV of a 150mM NaCl wash (50% Buffer Al and 50% Buffer Bl, where Buffer Al contained 25 mM Tris buffer (pH 9) containing 0.001% poloxamer and Buffer Bl contained 25 mM Tris buffer (pH 9) containing 300 mM NaCl and 0.001% poloxamer). The column was flushed with 2 CVs of 25 mM Tris buffer (pH 9) containing 0.001% poloxamer (Buffer A2). Buffer B2 contained 25 mM Tris buffer (pH 9) containing 100 mM MgCh and 0.001% poloxamer. A 60 CV linear salt gradient from 0-100% Buffer B2 was used to elute the AAV full capsid. The flow rate was maintained at 5 mL / min throughout the run.Table 7, AAV6 preparation separation using a NaCl wash step and a MgCh gradient

[0230] As shown in FIG. 4, a majority of AAV empty capsid was eluted from the column during the 50% Buffer Bl wash. A first full capsid peak (comprising approximately 60% AAV full capsid) appeared before a second full capsid peak during the 0-100% Buffer B2 linear salt gradient, indicating that at least a portion of the full capsids eluted prior to at least a portion of a second peak comprising full capsids. The method resulted in a recovery yield (from the first full capsid peak) of approximately 46% of the AAV full capsid present in the AAV starting preparation loaded onto the column (Table 8). Table 8 values were calculated based on capsid particle counts obtained via dynamic and static light scattering followed by measurement of UV absorbance at 260 and 280nm wavelengths. These measurements indicated that the AAV9 full capsid peak comprised 46% AAV9 full capsid and 54% AAV9 empty / partially empty capsid, and further that the AAV9 full capsid peak comprised 46% of the total full capsid that was loaded onto the column in the AAV starting preparation.Notably, and at least partly because a majority of the empty capsids was washed from the column prior to the elution gradient, the full capsid and empty capsid peaks were more separated (resolved) than the full capsid and empty capsid peaks in Example 1, resulting in relatively reduced co-elution of AAV full capsid with some amount of AAV intermediaries. Further, AAV6 full capsid and AAV6 empty capsid peak elution order was switched as compared to Example 1. Accordingly, AAV empty capsids that were not washed off in the first wash (and that were thus still bound to the column resin), remained bound to the column resin and were not eluted during the elution step.Table 8. AAV6 capsid recoveries for Example 4Example 5: Separation of an AAV6 preparation using a NaiSC wash step and a MgSC>4 gradient

[0231] This example describes separation of an AAV6 preparation using a Na2SO4 wash step and a MgSCh gradient. The workflow described in this example is illustrated in Table 9, and results are shown in FIG. 5.

[0232] The AAV6 preparation process comprised lysis of the packaging cell culture and subsequent clarification of the lysate using depth filtration. Additional AAV6 concentration and purification methods included tangential flow filtration and affinity chromatography prior to the described AEX chromatography method. The separation was performed on an AKTA Avantl50 HPLC system (Cytiva, Massachusetts, USA) using a CIMmultus® QA monolithic anion exchange chromatography column, which was first flushed with 10 CVs of 25 mM Tris buffer (pH 9) containing 20 mM Na2SO4 and 0.001% poloxamer. The column was preequilibrated with 10 CVs of 2000 mM NaCl, and was then equilibrated with 10 CVs of 25 mM Tris buffer (pH 9) containing 20 mM Na2SO4 and 0.001% poloxamer. The AAV6 preparation was diluted 5X in 50 mM Tris (pH 9.0), then filtered through a 0.2 um filter and loaded onto the column in 33.33 CVs (at approximately 1.5xl012viral genomes / mL and IxlO13capsids / mL), which was chased with 10 CVs of 25 mM Tris buffer (pH 9) containing 20 mM Na2SO4 and 0.001% poloxamer. The column was then washed with 12 CV of 53.2% Buffer Bl, where Buffer Al contained 25 mM Tris buffer (pH 9) containing 0.001% poloxamer and Buffer Bl contained 25 mM Tris buffer (pH 9) containing 100 mM Na2SO4 and 0.001% poloxamer. The column was flushed with 10 CVs of 25 mM Tris buffer (pH 9) containing 0.001% poloxamer (Buffer A2). Buffer B2 contained 25 mM Tris buffer (pH 9) containing 100 mM MgSCh and 0.001% poloxamer. A 60 CV linear salt gradient from 0- 100% Buffer B2 was used to elute the AAV full capsid. The flow rate was maintained at 5 mL / min throughout the run.

[0233] As shown in FIG. 5, a majority of AAV empty capsid was eluted from the column during the 53.2% Buffer Bl wash. A first full capsid peak (comprising approximately 54% AAV full vector) appeared before a second full capsid peak during the 0-100% Buffer B2 linear salt gradient, indicating that at least a portion of the full capsids eluted prior to at least a portion of a second peak comprising full capsids. The method resulted in a recovery yield (from the first full capsid peak) of approximately 73% of the AAV full capsid present in the AAV starting preparation loaded onto the column (Table 10). Table 10 values were calculated based on capsid particle counts obtained via dynamic and static light scattering followed by measurement of UV absorbance at 260 and 280nm wavelengths. These measurements indicated that the AAV9 full capsid peak comprised 45% AAV9 full capsid and 55% AAV9 empty / partially empty capsid, and further that the AAV9 full capsid peak comprised 73% of the total full capsid that was loaded onto the column in the AAV starting preparation. Notably, and at least partly because a majority of the empty capsids was washed from the column prior to the elution gradient, the full capsid and empty capsid peaks were more separated (resolved) than the full capsid and empty capsid peaks in Example 1, resulting in relatively reduced co-elution of AAV full capsid with some amount of AAV intermediaries. Further, AAV6 full capsid and AAV6 empty capsid peak elution order was switched as compared to Example 1. Accordingly, AAV empty capsids that were not washed off in the first wash (and that were thus still bound to the column resin), remained bound to the column resin and were not eluted during the elution step.Table 10. AAV6 capsid recoveries for Example 5.Example 6: Separation of an AAV6 preparation using a NaiSC wash step and aMgSC>4 isocratic elution

[0234] This example describes separation of an AAV6 preparation using a Na2SO4 wash step and a MgSCh elution buffer at a constant concentration. The workflow described in thisexample is illustrated in Table 11, and results are shown in FIG. 6. The AAV6 in this example comprised transgene “A.”

[0235] The AAV6 preparation process comprised lysis of the packaging cell culture and subsequent clarification of the lysate using depth filtration. Additional AAV6 concentration and purification methods included tangential flow filtration and affinity chromatography prior to the described AEX chromatography method. The separation was performed on an AKTA Pilot 600 HPLC system (Cytiva, Massachusetts, USA) using a CIMmultus® QA monolithic anion exchange chromatography column (40 mL), which was first flushed with 5 CVs of 25 mM Tris buffer (pH 9.0) containing 20 mM Na2SO4 and 0.001% poloxamer. The column was pre-equilibrated with 5 CVs of 2000 mM NaCl, and was then equilibrated with 5 CVs of buffer (pH 9.0) containing 25 mM Tris, 20 mM Na2SO4 and 0.001% poloxamer. The AAV6 preparation was diluted 5X in 50 mM Tris (pH 9.0), then filtered through a 0.2 um filter and loaded onto the column in 8.03 CVs, which was chased with 5 CVs of buffer (pH 9.0) containing 25 mM Tris, 20 mM Na2SO4 and 0.001% poloxamer. The column was then washed with 5 CVs of buffer (pH 9.0) containing 25mM Tris, 53 mM Na2SO4 and 0.001% poloxamer. The column was flushed with 5 CVs of buffer (pH 9.0) containing 25 mM Tris, 20mM Na2SO4 and 0.001% poloxamer. A constant concentration of an elution buffer (pH 9.0) containing 25 mM Tris, 38 mM MgSCh, and 0.001% poloxamer was used to elute the AAV full capsid in 7 CVs.Table 11. AAV6 preparation separation of using a Na2SO4 wash step and a MgSCh isocratic elution

[0236] As shown in FIG. 6 the monovalent cationic salt isocratic wash followed by divalent cationic salt isocratic elution resulted in the empty capsid peak appearing before the full capsid peak in the chromatogram Empty capsid was washed off first by the isocratic monovalent wash, then full capsid was eluted by the divalent isocratic elution. Isocratic divalent elution exhibited an advantage over gradient divalent elution in that in the isocratic divalent elution, the full capsid was eluted without the additional empty capsid seen in later peaks under a gradient elution, such as in FIG. 4. A monovalent isocratic wash followed by a divalent isocratic elution enabled upfront removal of a population of empty capsids then elution of full capsids that avoided the copurification of full capsids with remaining empty capsids that were not removed during the first wash.

[0237] The percentage of full capsid was measured before and after purification (i.e., the percentage of full capsid in the AAV starting preparation and the percentage of full capsid in the eluted AAV peak comprising full AAV capsid) and is shown in Table 12. The method resulted in an estimated recovery yield of approximately 80-91% of the AAV full capsid present in the AAV starting preparation loaded onto the column (Table 12). Table 12, column 2 values were calculated based on capsid particle counts obtained via dynamic and static light scattering followed by measurement of UV absorbance at 260 and 280nm wavelengths using a Stunner instrument (Unchained Labs). By these methods, the AAV full capsid peak comprised 50% full capsid, as compared to the starting AAV preparation, which comprised only 21% full capsid.

[0238] In parallel, as shown in Table 12, column 3, the concentration of AAV vector genomes in the eluted AAV full capsid fraction was measured using qPCR and ELISA. Samples were diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA, and further treated with proteinase K (or another suitable proteinase). After inactivation of the nuclease, samples were diluted and amplified using primers and a probe (e.g., a TagMan™ fluorogenic probe) specific for the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) was measured using a suitable detection system. Plasmid DNA containing identical sequences to that contained in the AAV vector was employed to generate a standard curve in the qPCR reaction. The Ct values obtained from the samples were used to determine vector genome titer by normalizing them to the Ct value of the plasmid standard curve. qPCR was combined with ELISA to detect AAV capsids containing transgene A. By these methods, the AAV full capsid peak comprised 100% full capsid, as compared to the starting AAV preparation, which comprised only 40% full capsid.Table 12. AAV6 capsid recoveries for Example 6.Example 7: Separation of an AAV6 preparation using a NaiSC wash step and a MgSC>4 isocratic elution with a 40-mL anion exchange chromatography column

[0239] This example describes separation of an AAV6 preparation using a Na2SO4 wash step and a MgSCh elution buffer at a constant concentration. The workflow described in this example is illustrated in Table 13, and results are shown in FIG. 7. The AAV6 in this example comprised transgene “B ”

[0240] The AAV6 preparation process comprised lysis of the packaging cell culture and subsequent clarification of the lysate using depth filtration. Additional AAV6 concentration and purification methods included tangential flow filtration and affinity chromatography prior to the described AEX chromatography method. The separation was performed on an AKTA Avant Pilot 600 HPLC system (Cytiva, Massachusetts, USA) using a CIMmultus® QA monolithic anion exchange chromatography column (40 mL), which was first flushed with 5 CVs of buffer (pH 9.0) containing 25 mM Tris, 20 mM Na2SO4 and 0.001% poloxamer. The column was pre-equilibrated with 5 CVs of 2000 mM NaCl, and was then equilibrated with 5 CVs of buffer (pH 9.0) containing 25 mM Tris, 20 mM Na2SO4 and 0.001% poloxamer. The AAV6 preparation was diluted 5X in 50 mM Tris (pH 9.0), then filtered through a 0.2 um filter and loaded onto the column in 16.3 CVs, which was chased with 5 CVs of buffer (pH 9.0) containing 25 mM Tris, 20 mM Na2SO4 and 0.001% poloxamer. The column was then washed with 5 CVs of buffer (pH 9.0) containing 25mM Tris, 53 mM Na2SO4 and 0.001% poloxamer. The column was flushed with 5 CVs of buffer (pH 9.0) containing 25 mM Tris, 20mM Na2SO4 and 0.001% poloxamer. A constant concentration of an elution buffer (pH 9.0) containing 25 mM Tris, 38 mM MgSCh, and 0.001% poloxamer was used to elute the AAV full capsid in 7 CVs.Table 13. AAV6 preparation separation of Transgene B using a Na2SO4 wash step and a MgSCh isocratic elution

[0241] As shown in FIG. 7, the monovalent cationic salt isocratic wash followed by divalent cationic salt isocratic elution resulted in the empty capsid peak appearing before the full capsid peak in the chromatogram. Similar to Example 6 but with a different transgene, empty capsid was washed off first by the isocratic monovalent wash, then full capsid was eluted by the divalent isocratic elution. Isocratic divalent elution exhibited an advantage over a gradient divalent elution in that in the isocratic divalent elution, the full capsid was eluted without the additional empty capsid seen in later peaks under a gradient elution, such as in FIG. 4. A monovalent isocratic wash followed by a divalent isocratic elution enabled upfront removal of a population of empty capsids then elution of full capsids that avoided the copurification of full capsids with remaining empty capsids that were not removed during the first wash.

[0242] The percentage of full capsid was measured before and after purification (i.e., the percentage of full capsid in the AAV starting preparation and the percentage of full capsid in the eluted AAV peak comprising full AAV capsid) and is shown in Table 14. The method resulted in an estimated recovery yield of approximately 54-59% of the AAV full capsid present in the AAV starting preparation loaded onto the column (Table 12). Table 14, column 2 values were calculated based on capsid particle counts obtained via dynamic and static light scattering followed by measurement of UV absorbance at 260 and 280nm wavelengths using a Stunner instrument (Unchained Labs). By these methods, the AAV full capsid peak comprised 37% full capsid, as compared to the starting AAV preparation, which comprised only 14% full capsid.

[0243] In parallel, as shown in Table 14, column 3, the concentration of AAV vector genomes in the eluted AAV full capsid fraction was measured using qPCR and ELISA. Samples were diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA, and further treated with proteinase K (or another suitable proteinase). After inactivation of the nuclease, samples were diluted and amplified using primers and a probe (e.g., a TagMan™ fluorogenic probe) specific for the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) was measured using a suitable detection system. Plasmid DNA containing identical sequences to that contained in the AAV vector was employed to generate a standard curve in the qPCR reaction. The Ct values obtained from the samples were used to determine vector genome titer by normalizing them to the Ct value of the plasmid standard curve. qPCR was combined with ELISA to detect AAV capsids containing transgene A. By these methods, the AAV full capsid peak comprised 76% full capsid, as compared to the starting AAV preparation, which comprised only 27% full capsid.Table 14. AAV6 capsid recoveries for Example 7.Example 8: Separation of an AAV6 preparation using a NaiSC wash step and a MgSC>4 isocratic elution with a 4-mL anion exchange chromatography column

[0244] This example describes separation of an AAV6 preparation using a Na2SO4 wash step and a MgSCh elution buffer at a constant concentration. The workflow described in this example is illustrated in Table 15, and results are shown in FIG. 8. The AAV6 in this example comprised transgene “B ”

[0245] The AAV6 preparation process comprised lysis of the packaging cell culture and subsequent clarification of the lysate using depth filtration. Additional AAV6 concentration and purification methods included tangential flow filtration and affinity chromatography prior to the described AEX chromatography method. The separation was performed on an AKTA Avantl50 HPLC system (Cytiva, Massachusetts, USA) using a CIMmultus® QA monolithicanion exchange chromatography column (4 mL), which was first flushed with 5 CVs of buffer (pH 9.0) containing 25 mM Tris, 20 mM Na2SO4 and 0.001% poloxamer. The column was pre-equilibrated with 5 CVs of 2000 mM NaCl, and was then equilibrated with 5 CVs of buffer (pH 9.0) containing 25 mM Tris, 20 mM Na2SO4 and 0.001% poloxamer. The AAV6 preparation was diluted 5X in 50 mM Tris (pH 9.0), then filtered through a 0.2 um filter and loaded onto the column in 16.3 CVs, which was chased with 5 CVs of buffer (pH 9.0) containing 25 mM Tris, 20 mM Na2SO4 and 0.001% poloxamer. The column was then washed with 5 CVs of buffer (pH 9.0) containing 25mM Tris, 54 mM Na2SO4 and 0.001% poloxamer. The column was flushed with 5 CVs of buffer (pH 9.0) containing 25 mM Tris, 20mM Na2SO4 and 0.001% poloxamer. A constant concentration of an elution buffer (pH 9.0) containing 25 mM Tris, 33 mM MgSCh, and 0.001% poloxamer was used to elute the AAV full capsid in 7 CVs.Table 15. AAV6 preparation separation of Transgene B using a Na2SO4 wash step and aMgSCh isocratic elution

[0246] As shown in FIG. 8, the monovalent cation salt isocratic wash followed by divalent cation salt isocratic elution resulted in the empty capsid peak appearing before the full capsid peak in the chromatogram. Similar to Example 7 but at a different scale, empty capsid was washed off first by the isocratic monovalent wash, then full capsid was eluted by the divalent isocratic elution. Isocratic divalent elution exhibited an advantage over gradient divalent elution in that in the isocratic divalent elution, the full capsid was eluted without the additional empty capsid seen in later peaks under a gradient elution, such as in FIG. 4. Amonovalent isocratic wash followed by a divalent isocratic elution enabled upfront removal of a population of empty capsids then elution of full capsids that avoided the copurification of full capsids with remaining empty capsids that were not removed during the first wash.

[0247] The percentage of full capsid was measured before and after purification (i.e., the percentage of full capsid in the AAV starting preparation and the percentage of full capsid in the eluted AAV peak comprising full AAV capsid) and is shown in Table 16. The method resulted in an estimated recovery yield of approximately 83% of the AAV full capsid present in the AAV starting preparation loaded onto the column (Table 16). Table 16 values were calculated based on capsid particle counts obtained via dynamic and static light scattering followed by measurement of UV absorbance at 260 and 280nm wavelengths using a Stunner instrument (Unchained Labs). By these methods, the AAV full capsid peak comprised 34% full capsid, as compared to the starting AAV preparation, which comprised only 8% full capsid.Table 16. AAV6 capsid recoveries for Example 8.

Claims

What is claimed is:

1. A method of obtaining an adeno-associated virus (AAV) full capsid from an AAV starting preparation comprising the AAV full capsid and an AAV empty capsid, the method comprising: a) applying the AAV starting preparation to an anion exchange chromatography column; and b) applying a divalent cation salt elution buffer comprising a divalent cation salt to the anion exchange chromatography column, wherein the divalent cation salt elution buffer does not comprise a monovalent cation salt, and wherein applying the divalent cation salt elution buffer elutes from the anion exchange chromatography column an eluted fraction that comprises the AAV full capsid in a greater proportion than the AAV empty capsid.

2. The method of claim 1, wherein the eluted fraction comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% of the AAV full capsid from the AAV starting preparation.

3. The method of any one of the preceding claims, wherein the proportion of AAV full capsid compared to total AAV capsid in the eluted fraction is at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, or at least 60%.

4. The method of any one of the preceding claims, wherein a ratio of AAV full capsid to AAV empty capsid in the eluted fraction is at least 1.5 to 1, at least 1.6 to 1, at least 1.7 to 1, at least 1.8 to 1, at least 1.9 to 1, at least 2 to 1, at least 2.25 to 1, at least 2.5 to 1, at least 2.75 to 1, at least 3 to 1, at least 4 to 1, at least 5 to 1, at least 10 to 1, at least 20 to 1, at least 30 to 1, at least 40 to 1, at least 50 to 1, or at least 100 to 1.

5. The method of any one of the preceding claims, wherein at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV full capsid is eluted from the anion exchange chromatography column before the AAV empty capsid.

6. The method of any one of the preceding claims, wherein the eluted fraction comprises no more than 70%, no more than 65%, no more than 60%, no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, or no more than 2%, or no more than 1% AAV empty capsid.

7. The method of any one of the preceding claims, wherein the divalent cation salt elution buffer is applied to the anion exchange chromatography column under conditions whereby at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or substantially all of the AAV full capsid is eluted from the column and at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV empty capsid remains bound to the column.

8. The method of any one of claims 1-7, wherein the divalent cation salt elution buffer is applied at a constant concentration.

9. The method of any one of claims 1-7, wherein the divalent cation salt elution buffer is applied in a linear gradient.

10. The method of any one of claims 1-9, wherein the eluted fraction is a first eluted fraction and a second eluted fraction is eluted after the first eluted fraction.

11. The method of claim 10, wherein the second eluted fraction comprises a greater proportion of the AAV empty capsid than the first eluted fraction.

12. The method of any one of claim 10 or claim 11, wherein the second eluted fraction comprises no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, or no more than 2%, or no more than 1% AAV full capsid.

13. The method of any one of the preceding claims, further comprising applying a monovalent cation salt wash buffer comprising a monovalent cation salt to the column before applying the divalent cation salt elution buffer, wherein the monovalent cationsalt wash buffer does not comprise a divalent cation salt, and wherein applying the monovalent cation salt buffer elutes from the anion exchange chromatography column a wash fraction that comprises the AAV empty capsid in greater proportion than the AAV full capsid.

14. The method of claim 13, wherein the monovalent cation salt wash buffer is applied at a constant concentration.

15. The method of claim 13, wherein the monovalent cation salt wash buffer is applied in a linear gradient.

16. A method of obtaining an adeno-associated virus (AAV) full capsid from an AAV starting preparation comprising the AAV full capsid and an AAV empty capsid, the method comprising: a) applying the AAV starting preparation to an anion exchange chromatography column; b) applying a monovalent cation salt wash buffer to the column, thereby eluting from the anion exchange chromatography column a wash fraction that comprises the AAV empty capsid in greater proportion than the AAV full capsid; and c) applying a divalent cation salt elution buffer to the anion exchange chromatography column, thereby eluting from the anion exchange chromatography column an eluted fraction that comprises the AAV full capsid in a greater proportion than the AAV empty capsid.

17. The method of claim 16, wherein the eluted fraction comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% of the AAV full capsid from the AAV starting preparation.

18. The method of claim 16 or claim 17, wherein the proportion of AAV full capsid compared to total AAV capsid in the eluted fraction is at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, or at least 60%.

19. The method of any one of claims 16-18, wherein a ratio of AAV full capsid to AAV empty capsid in the eluted fraction is at least 1.5 to 1, at least 1.6 to 1, at least 1.7 to 1, at least 1.8 to 1, at least 1.9 to 1, at least 2 to 1, at least 2.25 to 1, at least 2.5 to 1, at least 2.75 to 1, at least 3 to 1, at least 4 to 1, at least 5 to 1, at least 10 to 1, at least 20 to 1, at least 30 to 1, at least 40 to 1, at least 50 to 1, or at least 100 to 1.

20. The method of any one of claims 16-19, wherein the wash fraction comprises at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or substantially 100% empty capsid.

21. The method of any one of claims 16-20, wherein the eluted fraction comprises no more than 70%, no more than 65%, no more than 60%, no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, or no more than 2%, or no more than 1% AAV empty capsid.

22. The method of any one of claims 13-21, wherein at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV empty capsid is eluted from the anion exchange chromatography column before the AAV full capsid.

23. The method of any one of claims 13-22, wherein the monovalent cation salt wash buffer is applied to the anion exchange chromatography column under conditions whereby at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV empty capsid is eluted from the column and at least 60%, at least 70%, at least 80%, at least 90%, or substantially all of the AAV full capsid remains bound to the column.

24. The method of any one of the preceding claims, wherein the divalent cation salt elution buffer does not comprise NaCl.

25. The method of any one of the preceding claims, wherein the divalent cation salt elution buffer comprises 50-150 mM, 50-100 mM, 70-120 mM, 80-110 mM, or 100 mM divalent cation salt.

26. The method of any one of the preceding claims, wherein the divalent cation salt comprises a divalent cation selected from Mg2+, Ca2+, or Sr2+.

27. The method of any one of the preceding claims, wherein the divalent cation salt is magnesium chloride (MgCh), calcium chloride (CaCh), magnesium sulfate (MgSCh), magnesium phosphate (MgPCh), calcium acetate (Ca^HsCh)?), calcium sulfate (CaSCh), magnesium acetate (Mg^HsCh)?), or magnesium citrate (MgCeHeCh).

28. The method of any one of the preceding claims, wherein the divalent cation salt is MgCh, CaCh, or MgSC .

29. The method of any one of the preceding claims, wherein the divalent cation salt elution buffer comprises:(a) 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, or 50 mM MgCh;(b) 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, or 50 mM CaCh; or(c) 25-175 mM, 25-150 mM, 25-100 mM, 25-75 mM, or 50 mM MgSO4.

30. The method of any one of the preceding claims, wherein the divalent cation salt elution buffer comprises a buffering agent.

31. The method of any one of the preceding claims, wherein the divalent cation salt elution buffer comprises 5-100 mM, 10-100 mM, 10-50 mM, 10-40 mM, 10-30 mM, 20-30 mM, or 25 mM buffering agent.

32. The method of claim 30 or claim 31, wherein the buffering agent is selected from Tris, Bis-Tris propane, CHES (N-cyclohexyl-2-aminoethanesulfonic acid), or AMPSO (N-(l, l-dimethyl-2-hydroxyethyl)-3-amino-2-hydroxypropanesulfonic acid).

33. The method of any one of the preceding claims, wherein the divalent cation salt elution buffer comprises a stabilizing agent.

34. The method of claim 33, wherein the stabilizing agent is selected from poloxamer, polysorbate 80 (PS-80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose.

35. The method of any one of the preceding claims, wherein the divalent cation salt elution buffer is about pH 7-10, about 8.5-9.5, or about pH 9.

36. The method of any one of the preceding claims, wherein the divalent cation salt elution buffer comprises(a) 25 mM Tris, 100 mM divalent cation salt, and 0.001% poloxamer, and is about pH 9;(b) 25 mM Tris, 38 mM divalent cation salt, and 0.001% poloxamer, and is about pH 9; or(c) 25 mM Tris, 33 mM divalent cation salt, and 0.001% poloxamer, and is about pH 9.

37. The method of any one of claims 13-36, wherein the monovalent cation salt wash buffer comprises 5-300 mM, 5-250 mM, 5-200 mM, 50-150 mM, 50-100 mM, 70-120 mM, 80-110 mM, or 100 mM monovalent cation salt.

38. The method of any one of claims 13-37, wherein the monovalent cation salt is NaCl, Na2SO4, Na3PO4, or CTLCOONa.

39. The method of any one of claims 13-38, wherein the monovalent cation salt wash buffer comprises(a) 50-200 mM, 50-150 mM, 100-200 mM, 125-175 mM, or 150 mM NaCl;(b) 15-125 mM, 15-100 mM, 25-100 mM, 25-75 mM, or 50 mM Na2SO4;(c) 10-225 mM, 10-200 mM, 25-175 mM, 25-150 mM, 50-125 mM, 100-200 mM, 125-175 mM, 15-125 mM, 15-100 mM, 25-100 mM, or 25-75 mM Na3PO4; or(d) 10-225 mM, 10-200 mM, 25-175 mM, 25-150 mM, 50-125 mM, 100-200 mM, 125-175 mM, 15-125 mM, 15-100 mM, 25-100 mM, or 25-75 mM CTLCOONa.

40. The method of any one of claims 13-39, wherein the monovalent cation salt wash buffer comprises a buffering agent.

41. The method of any one of claims 13-40, wherein the monovalent cation salt wash buffer comprises 5-100 mM, 10-100 mM, 10-50 mM, 10-40 mM, 10-30 mM, 20-30 mM, or 25 mM buffering agent.

42. The method of claim 40 or 41, wherein the buffering agent is selected from Tris, BisTris propane, CHES (N-cyclohexyl-2-aminoethanesulfonic acid), or AMPSO (N-(l,l- dimethyl-2-hydroxyethyl)-3-amino-2-hydroxypropanesulfonic acid).

43. The method of claims 13-42, wherein the monovalent cation salt wash buffer comprises a stabilizing agent.

44. The method of claim 43, wherein the stabilizing agent is selected from poloxamer, polysorbate 80 (PS-80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose.

45. The method of any one of claims 13-44, wherein the monovalent cation salt wash buffer is about pH 7.0-10.0, about pH 8.5-9.5, or about pH 9.

46. The method of any one of claims 13-45, wherein the monovalent cation salt wash buffer comprises 25 mM Tris, 150 mM NaCl, and 0.001% poloxamer, and is about pH 9.

47. The method of any one of claims 13-45, wherein the monovalent cation salt wash buffer comprises 25 mM Tris, 50 mM Na2SO4, and 0.001% poloxamer, and is about pH 9.

48. The method of any one of claims 9-47, wherein the linear gradient is from 0%-100% divalent cation salt elution buffer.

49. The method of any one of the preceding claims, wherein prior to applying the divalent cation salt elution buffer to the anion exchange chromatography column, the anion exchange chromatography column is washed with a flush buffer, wherein the flush buffer does not comprise a monovalent cation salt or does not comprise a divalent cation salt.

50. The method of any one of claims 9-49, wherein the linear gradient is formed with a flush buffer and the divalent cation salt elution buffer, wherein the flush buffer does not comprise a monovalent cation salt or does not comprise a divalent cation salt.

51. The method of claim 50, wherein the linear gradient is from 100%-0% flush buffer.

52. The method of any one of claims 49-51, wherein the flush buffer comprises a buffering agent selected from Tris, Bis-Tris propane, CHES (N-cyclohexyl-2- aminoethanesulfonic acid), or AMPSO (N-(l,l-dimethyl-2-hydroxyethyl)-3-amino-2- hydroxypropanesulfonic acid).

53. The method of any one of claims 49-52, wherein the flush buffer comprises 5-100 mM, 10-100 mM, 10-50 mM, 10-40 mM, 10-30 mM, 20-30 mM, or 25 mM buffering agent.

54. The method of any one of claims 49-53, wherein the flush buffer comprises a stabilizing agent.

55. The method of claim 54, wherein the stabilizing agent is selected from poloxamer, polysorbate 80 (PS-80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose.

56. The method of any one of claims 49-55, wherein the flush buffer is about pH 7.0- 10.0, about pH 8.5-9.5, or about pH 9.

57. The method of any one of claims 49-56, wherein the flush buffer comprises 25 mM Tris and 0.001% poloxamer, and is about pH 9.

58. The method of any one of the preceding claims, wherein prior to applying the divalent cation salt elution buffer to the anion exchange chromatography column, the anion exchange chromatography column is washed with an equilibration buffer comprising 10-100 mM monovalent cation salt.

59. The method of claim 58, wherein the equilibration buffer is applied to the anion exchange chromatography column after the monovalent cation salt wash buffer is applied to the anion exchange chromatography column.

60. The method of claim 58 or claim 59, wherein the equilibration buffer comprises the monovalent cation salt at a concentration of 10-80 mM, 20-80 mM, 25-75 mM, 30-70 mM, 40-60 mM, 50 mM, or 60 mM.

61. The method of any one of claims 58-60, wherein the monovalent cation salt is selected from NaCl, Na2SO4, NasPCh, CHsCOONa, or sodium citrate.

62. The method of claim 61, wherein the sodium citrate is monosodium citrate (NaCeHjO?), disodium citrate (IS^CeHeO?), or trisodium citrate (NasCeHsCh).

63. The method of any one of claims 58-62, wherein the equilibration buffer comprises a buffering agent.

64. The method of claim 63, wherein the equilibration buffer comprises 5-100 mM, 10- 100 mM, 10-50 mM, 10-40 mM, 10-30 mM, 20-30 mM, or 25 mM buffering agent.

65. The method of claim 63 or claim 64, wherein the buffering agent is selected from Tris, Bis-Tris propane, CHES (N-cyclohexyl-2-aminoethanesulfonic acid), or AMPSO (N-(l, l-dimethyl-2-hydroxyethyl)-3-amino-2-hydroxypropanesulfonic acid).

66. The method of any one of claims 58-65, wherein the equilibration buffer comprises a stabilizing agent.

67. The method of claim 66, wherein the stabilizing agent is selected from poloxamer, polysorbate 80 (PS-80), polysorbate 20 (PS-20), sorbitol, sucrose, or trehalose.

68. The method of any one of claims 58-68, wherein the equilibration buffer is about pH 7.0-10.0, about pH 8.5-9.5, or about pH 9.

69. The method of any one of claims 58-70, wherein the equilibration buffer comprises 25 mM Tris, 60 mM NaCl, and 0.001% poloxamer, and is about pH 9.

70. The method of any one of claims 58-70, wherein the equilibration buffer comprises 25 mM Tris, 20 mM Na2SO4, and 0.001% poloxamer, and is about pH 9.

71. The method of any one of the preceding claims, wherein the anion exchange chromatography column comprises a matrix comprising a functional ligand selected from a mixed amine, a quaternary amine, trimethylammoniumethyl (TMAE), dimethylaminopropyl, diethylaminoethyl (DEAE), dimethylaminoethyl (DMAE), polyethyleneimine (PI), or guanidinium72. The method of claim 71, wherein the mixed amine comprises polyethyleneimine.

73. The method of claim 72, wherein the quaternary amine comprises quaternized polyethyleneimine.

74. The method of any one of the preceding claims, wherein the AAV starting preparation is applied to the anion exchange chromatography column under conditions whereby the AAV full capsid and the AAV empty capsid bind the column.

75. The method of any one of claims 9-74, wherein the AAV full capsid elutes from the anion exchange chromatography column between 10% and 90%, 15% and 85%, 20% and 80%, or 30% and 70% divalent cation salt elution buffer in the linear gradient of the divalent cation salt elution buffer.

76. The method of any one of the preceding claims, wherein the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12.

77. The method of any one of the preceding claims, wherein the AAV is AAV6.

78. The method of any one of the preceding claims, wherein the AAV capsid comprises an AAV capsid protein, and wherein the AAV capsid protein is a chimeric capsid, engineered capsid, or natural capsid.

79. The method of any one of the preceding claims, wherein the AAV is a recombinant AAV.

80. The method of any one of the preceding claims, wherein the AAV is a pseudotyped AAV.

81. The method of claim 80, wherein the pseudotyped AAV is AAV2 / 5, AAV2 / 8, or AAV2 / 7.

82. The method of any one of the preceding claims, wherein the AAV is a self- complementary AAV.

83. The method of any one of the preceding claims, wherein the AAV full capsid comprises a nucleic acid molecule of interest.

84. The method of the immediately preceding claim, wherein the nucleic acid molecule of interest encodes a chimeric antigen receptor (CAR) or T cell receptor (TCR).

85. The method of any one of the preceding claims, further comprising culturing an AAV packaging cell in media that allows production of AAV particles, wherein the AAV particles comprise an AAV capsid protein and a nucleic acid molecule that comprises an AAV 5’ inverted terminal repeat (ITR), a nucleic acid molecule of interest to be packaged into the AAV capsid, and a 3’ ITR, and wherein the cell comprises (i) the at least one nucleic acid of interest to be packaged into the AAV capsid, (ii) a nucleic acid molecule encoding the AAV capsid protein under control of one or more sequences that direct its expression in the packaging cell, (iii) a nucleic acid molecule encoding an AAV rep protein that expresses the AAV rep protein in the cell to permit packaging of the nucleic acid of interest into the AAV capsid, and (iv) one or more helper functions required for packaging the nucleic acid molecule of interest into the AAV capsid.

86. The method of claim 85, further comprising harvesting the AAV particles from the AAV packaging cell and / or from the media, wherein the harvesting comprises celldisruption or wherein the harvesting substantially does not comprise cell disruption, thereby providing the AAV starting preparation.

87. The method of claim 86, wherein the cell disruption comprises cell lysis, thereby providing a cell lysate.

88. The method of any one of claims 85-87, wherein the AAV starting preparation comprises the media and / or the cell lysate.

89. The method of any one of claims 85-88, wherein the harvesting the AAV particles from the cell and / or the media comprises collecting the media substantially without cell disruption.

90. The method of any one of claims 85-89, wherein the AAV packaging cell is stably transformed with one or more nucleic acid molecules encoding the one or more helper functions.

91. The method of any one of claims 86-90, wherein the one or more helper functions are expressed under an activatable or inducible promoter.

92. The method of any one of claims 85-91, wherein the AAV packaging cell is stably transformed with the nucleic acid molecule encoding the AAV rep protein and / or the nucleic acid molecule encoding the AAV capsid protein.

93. The method of any one of claims 85-92, wherein the AAV rep protein and / or the AAV capsid protein are expressed under direction of an activatable or inducible promoter.

94. The method of any one of claims 85-93, wherein the AAV packaging cell is stably transformed with the nucleic acid molecule of interest.

Images