Bacterial associations with gingivitis and periodontitis in animal, for example yorkshire terriers

EP4728100A1Pending Publication Date: 2026-04-22MARS INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
MARS INC
Filing Date
2024-06-14
Publication Date
2026-04-22

AI Technical Summary

Technical Problem

Diagnosing periodontal disease in dogs, particularly in Yorkshire Terriers, is challenging due to the complexity of canine oral microbiota, which differs significantly from humans, and existing studies have focused on mixed-breed dogs rather than breed-specific microbiota changes, necessitating a breed-specific approach for effective diagnostic and prognostic tools.

Method used

The method involves quantifying specific microbial taxa such as Peptostreptococcaceae, Lachnospiraceae, and Treponema species in oral samples using PCR, qPCR, or shotgun metagenomics sequencing to determine oral health status and predict periodontal health or disease in dogs, including Yorkshire Terriers, enabling targeted oral health monitoring and supplementation.

Benefits of technology

This approach allows for accurate assessment of oral health in dogs, identifying specific bacterial associations with gingivitis and periodontitis, enabling effective preventative and management strategies tailored to the breed, thereby improving oral health outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024033963_19122024_PF_FP_ABST
    Figure US2024033963_19122024_PF_FP_ABST
Patent Text Reader

Abstract

Methods for determining the oral health status of an animal through the compositional analysis of the oral microbiome are disclosed herein. The abundance or relative abundance of one or more microbial taxa is assayed using quantitative PCR and DNA sequencing. Bacterial taxa whose abundance is a marker for periodontitis and / or gingivitis are identified.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] BACTERIAL ASSOCIATIONS WITH GINGIVITIS AND PERIODONTITIS IN YORKSHIRE TERRIERS

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to United States Provisional Application No. 63 / 508,817, filed June 16, 2023, the content of which is hereby incorporated by reference in its entirety herein, and to which priority is claimed.

[0004] SEQUENCE LISTINGS

[0005] The instant application contains a Sequence Listing which has been submitted herewith and is hereby incorporated by reference in its entirety. Said .xml copy, created on June 07, 2024 is named 0692690690, and is 36,653 bytes in size.

[0006] FIELD

[0007] The presently disclosed subject matter relates to the compositional analysis of the canine oral microbiome. The presently disclosed subject matter further relates to the compositional analysis of the canine oral microbiome as a monitoring and diagnostic tool for canine periodontal disease.

[0008] BACKGROUND

[0009] Periodontal disease is one of the most common disorders in dogs but can be challenging to diagnose in first opinion practice. The disease is initiated by the formation of plaque biofilms on the tooth surface, resulting in host-mediated inflammation. Initially the inflammation is limited to the gingiva (gingivitis) but, without effective treatment, this can progress into the tissues that support the tooth (periodontium) resulting in pocket formation, gingival recession and alveolar bone loss (periodontitis). Periodontitis can lead to the development of oronasal fistula, ocular problems, perio-endo lesions, pathologic jaw fractures or spontaneous tooth exfoliation. The onset of some systemic conditions has also been associated with periodontal disease.

[0010] The microbial communities in dental plaque are complex. Early culture-based studies of the canine oral microbiota were limited with most confined to investigating bacterial species associated with human oral health or late-stage periodontal disease. However, subsequent cloning and sequencing studies showed that 80% of bacteria in canine plaque were novel with only 16.4% previously identified in the human oral cavity. More recently, high-throughput sequencing has enabled larger-scale studies and identification of more of the bacterial species within microbial communities. This has led to further research which indicates microbial profiles differ according to whether the dog has healthy gingiva or periodontal disease. These studies also confirmed the early findings that, despite some similarities, the plaque microbiota of dogs substantially differs to that of humans.

[0011] Most canine oral microbiota studies have been based on analysis of samples from populations of mixed breed dogs collected at a specific point in time. A recent study of miniature schnauzers explored shifts in bacterial community composition during the development of canine periodontal disease. The findings were consistent with previous suggestions that periodontal disease progression is associated with an increase in taxa with a previously low abundance concomitant with a reduction in taxa with a previously high abundance, rather than the appearance of previously undetected bacterial species.

[0012] There is need to investigate changes in the microbiota composition of subgingival plaque with gingivitis and periodontitis in Yorkshire terriers, a breed of dog highly predisposed to the disease. The elucidation of oral microbiota associations with periodontal disease will enable the development of diagnostic and prognostic tests and oral health monitoring tools which can be used to drive awareness and support recommendations for effective home-care regimes to help prevent or slow disease progression.

[0013] SUMMARY OF THE INVENTION

[0014] The presently disclosed subject matter provides methods for determining the oral health status of an animal comprising: quantifying one or more microbial taxa from a sample to determine abundance or relative abundance of the one or more microbial taxa; and determining the oral health status of the animal; wherein the one or more microbial taxa is selected from the group consisting of Peptostreptococcaceae COT-307 / FOT-060, Peptostreptococcaceae COT-077, Lachnospiraceae COT-099, Erysipelotrichaceae COT- 381, Frigovirgula sp. COT-032, Porphyromonas canoris. Pasteurellaceae COT-080, Treponema sp. COT-355, Novel Treponema 7, Novel Treponema 2, Synergistales bacterium COT-244, Peptostreptococcaceae bacterium COT- 129, Peptostreptococcaceae bacterium COT-021, Moraxella sp. FOT-087, and combinations thereof. In certain embodiments, the one or more microbial taxa is measured using PCR, qPCR, DNA sequencing, or shotgun metagenomics sequencing. In certain embodiments, the abundance, presence, or relative abundance of the one or more microbial taxa is determined by amplifying or sequencing 16S rRNA, 16S rDNA.

[0015] In certain embodiments, the animal is a domestic animal. In certain embodiments, the domestic animal is a dog, cat, horse, cow, ferret, rabbit, pig, rat, mouse, gerbil, hamster, or goat. In certain embodiments, the animal is a wild animal. In certain embodiments, the wild animal is a wolf, bison, elk, deer, lion, or tiger. In certain embodiments, the animal is a toy / extra-small dog breed. In certain embodiments, the toy / extra-small dog breed is Yorkshire Terrier.

[0016] In certain embodiments, the one or more microbial taxa is associated with periodontal health or periodontal disease. In certain embodiments, the method further comprises extracting nucleic acid from the sample. In certain embodiments, the nucleic acid is DNA. In certain embodiments, the nucleic acid is RNA. In certain embodiments, the sample is one or more of a gingival margin sample, a subgingival area sample, a supragingival area sample, a saliva sample, a tongue sample, a buccal sample, or a combination thereof. In certain embodiments, the sample is obtained from a conscious animal or from an unconscious animal. In certain embodiments, the animal has or is suspected to have gingivitis and / or periodontitis. In certain embodiments, the oral health status comprises periodontal health or periodontal disease. In certain embodiments, the one or more microbial taxa is present in a sample.

[0017] The presently disclosed subject matter provides methods of improving or maintaining the oral health of an animal, comprising determining the oral health status of an animal using the disclosed method, wherein the health status is predicted to be “not health” or “periodontitis”. The presently disclosed subject matter provides methods of improving or maintaining the oral health of an animal, comprising determining the oral health status of a canine animal using the disclosed method, wherein the health status is “health” or “not periodontitis”. In certain embodiments, the method further comprises providing to the animal a foodstuff or supplement which is formulated to improve the oral health status. In certain embodiments, the method further comprises determining the oral health status of the animal on at least two time points. In certain embodiments, the two time points are at least 6 months or 1 year apart. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The following figures are included to illustrate certain aspects of the present disclosure and should not be viewed as exclusive embodiments. The subject matter disclosed is capable of considerable modifications, alterations, combinations, and equivalents in form and function, without departing from the scope of this disclosure.

[0019] Figures 1 A-1B show changes in Shannon diversity index. Figure 1 A shows changes in Shannon diversity index versus increasing proportion of periodontitis teeth in the mouth. Figure IB shows changes in Shannon diversity index versus mean gingivitis mouth score. Open circles represent the data, bold line the estimated relationship and shaded area 95% confidence region.

[0020] Figures 2A-2B show non-metric multidimensional scaling dimensions 1 (Diml) and 2 (Dim2). Figure 2A compares the proportion of periodontitis teeth in the mouth. Figure 2B compares the mean gingivitis mouth score.

[0021] Figure 3 illustrates bacterial species (left) that showed significant associations with mean gingivitis mouth score. The size of the circles represents the estimated proportion.

[0022] Figure 4 illustrates bacterial species that showed significant changes with proportion of periodontitis teeth. The size of the circles represents the estimated proportion.

[0023] DETAILED DESCRIPTION

[0024] The presently disclosed subject matter relates to methods for sampling the oral microbiome and assessing or monitoring oral health in animals. The presently disclosed subject matter is particularly suited for sampling the oral microbiome of a companion animal, e.g., a domestic dog.

[0025] For purposes of clarity of disclosure and not by way of limitation, the detailed description is divided into the following subsections:

[0026] 1. Definitions;

[0027] 2. Microorganisms in the Oral Microbiome;

[0028] 3. Companion Animals; and

[0029] 4. Methods.

[0030] 1. Definitions

[0031] The terms used in this specification generally have their ordinary meanings in the art, within the context of this disclosure and in the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner in describing the compositions and methods of the disclosure and how to make and use them.

[0032] References to a percentage sequence identity between two nucleotide sequences mean that, when aligned, that percentage of nucleotides are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using any suitable software programs. For example, those described in section 7.7.18 of reference

[0013] , In one embodiment, an alignment is determined using the BLAST algorithm or the Smith-Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2, BLOSUM matrix of 62. The Smith-Waterman homology search algorithm is disclosed in reference

[0014] , The alignment can be over the entire reference sequence, i.e., it can be over 100% length of the sequences disclosed herein.

[0033] As used herein, the use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification can mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” Still further, the terms “having,” “including,” “containing” and “comprising” are interchangeable and one of skill in the art is cognizant that these terms are open ended terms. Further, the term “comprising” encompasses “including” as well as “consisting,” e.g., a composition “comprising” X can consist exclusively of X or can include something additional, e.g., X + Y.

[0034] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 3 or more than 3 standard deviations, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2- fold, of a value.

[0035] The term “taxa” refers to taxonomical groups, for example, kingdom, phylum, class, order, family, genus, and species. The term “abundance” can refer to an absolute amount (including presence or absence) of given bacterial taxa present within a sample. For example, an abundance can refer to the count of bacterial sequences of bacterial taxa after appropriate amplification of nucleic acid e.g, 16S ribosomal DNA (rDNA) or 16S ribosomal RNA (rRNA). The term “relative abundance” can refer to a percentage composition of a particular bacterial taxa (e.g., species) relative to the total number of bacteria in the sample. It can be calculated by determining the number of sequences of given bacterial taxa divided by the total number of all bacterial sequences which is then multiplied by 100. For example, the relative abundance can refer to the relative amounts of nucleic acid present in a sample after appropriate amplification or sequencing of 16S rDNA. In certain embodiments, the relative abundance can refer to a binary classification of bacteria taxa. For example, without any limitation, binary classification can include detected versus undetected taxa or presence versus absence of taxa. In certain embodiments, the relative abundance is calculated as odds ratio. As used herein, odds ratio can be a fold change, i.e., it is a measure of how much higher or lower the abundance or relative abundance is when comparing one group to another group. In certain embodiments, the 16S rRNA comprises or consists of one of the sequences provided in Table 1.

[0036] Table 1. 16S rRNA sequences.

[0037] The term “animal” as used in accordance with the present disclosure refers to a wide variety of animals, such as quadrupeds, primates, and other mammals. For example, the term “animal” can refer to domestic animals including, but not limited to, dogs, cats, horses, cows, ferrets, rabbits, pigs, rats, mice, gerbils, hamsters, goats, and the like. The term “animal” can also refer to wild animals including, but not limited to, wolf, bison, elk, deer, lion, tiger, and the like. In some embodiments, the animal is a companion animal. In certain instances, the animal is a dog or a cat. In certain embodiments, the animal is a toy / extra-small dog breed. The term “nucleic acid molecule” and “nucleotide sequence,” as used herein, refers to a single or double stranded covalently-linked sequence of nucleotides in which the 3’ and 5’ ends on each nucleotide are joined by phosphodiester bonds. The nucleic acid molecule can include deoxyribonucleotide bases or ribonucleotide bases, and can be manufactured synthetically in vitro or isolated from natural sources. As used herein, the term “oral disease or disorder,” refers to a disease or disorder that occurs in an oral cavity of a subject (e.g., an animal) and that is caused by or is associated with one or more bacteria. For example, the disease or disorder can affect the teeth, structures that support the teeth such as periodontal ligament, alveolar bone, or the gums of the subject. Exemplary oral diseases or disorders of the present disclosure include, but are not limited to, periodontal disease, gingival stomatitis, odontoclastic resorptive lesions, and oral malodor.

[0038] As used herein, the term “periodontal disease,” also known as gum disease, refers to an inflammation or infection that affect the tissues surrounding the teeth. Periodontal disease can range in severity, e.g., from gingivitis (e.g., dental plaque-induced inflammation) to periodontitis (e.g. inflammation and destruction of the periodontium, the specialised tissues that surround and support the teeth). An example of the range is found on http s : / / avdc . org / avdc-nomencl ature / .

[0039] The terms “isolated” or “purified”, used interchangeably herein, refers to a nucleic acid, a polypeptide, or other biological moiety that is removed from components with which it is naturally associated. The term “isolated” can refer to a polypeptide that is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macromolecules of the same type. The term “isolated” with respect to a polynucleotide can refer to a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated from the chromosome.

[0040] As used herein, the term “biomarker” can refer to a characteristic that is objectively measured and evaluated as an indicator of physiological biological processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention. In certain non-limiting embodiments, the term “biomarker” can refer to any substance, structure, or process that can be measured in the body or its products and influence or predict the incidence of outcome or disease.

[0041] As used herein, and as well-understood in the art, “treatment” is an approach for obtaining beneficial or desired results, including clinical results. For purposes of this subject matter, beneficial or desired clinical results include, but are not limited to, alleviation or amelioration of one or more symptoms, diminishment of extent of a disorder, stabilized (i.e., not worsening) state of a disorder, prevention of a disorder, delay or slowing of the progression of a disorder, and / or amelioration or palliation of a state of a disorder. In certain embodiments, the decrease can be an about 0.01%, about 0.1%, about 1%, about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98% or about 99% decrease in severity of complications or symptoms. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment.

[0042] The term “effective treatment” or “effective amount” of a substance means the treatment or the amount of a substance that is sufficient to effect beneficial or desired results, including clinical results, and, as such, an “effective treatment” or an “effective amount” depends upon the context in which it is being applied. In the context of administering a composition (e.g., a dietary change, a functional food, a supplement, a nutraceutical composition, or a pharmaceutical composition) to change the composition of a microbiome having an unhealthy microbiome, the effective amount is an amount sufficient to bring the health status of the microbiome back to a healthy state, which is determined according to one of the methods disclosed herein. In certain embodiments, an effective treatment, as described herein, can also include administering a treatment in an amount sufficient to decrease any symptoms associated with an unhealthy microbiome. The decrease can be an about 0.01%, about 0.1%, about 1%, about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98% or about 99% decrease in severity of symptoms of an unhealthy microbiome. An effective amount can be administered in one or more administrations. A likelihood of an effective treatment described herein is a probability of a treatment being effective, i.e., sufficient to alter the microbiome, or treat or ameliorate a disorder and / or inflammation, as well as decrease the symptoms.

[0043] The word “substantially” does not exclude “completely” e.g. a composition which is “substantially free” from Y can be completely free from Y. Where necessary, the word “substantially” can be omitted from the definition of the present disclosure.

[0044] 2. Microorganisms in the Oral Microbiome

[0045] The present disclosure relates to, inter alia, kits and related methods for detecting one or more microbial taxa (e.g., bacteria) in an oral microbiome of an animal. The one or more microbial taxa (e.g., bacteria) can be associated with an oral disease or disorder, e.g., periodontal disease, or with good oral health. The animal can be a companion animal, such as a dog or a cat. In certain embodiments, the toy / extra-small dog breed is Yorkshire Terrier.

[0046] In certain embodiments, the one or more microbial taxa are one or more bacteria. In some embodiments, the one or more bacteria associated with periodontal disease is selected from the group consisting of Peptostreptococcaceae COT-307 / FOT-060, Peptostreptococcaceae COT-077, Lachnospiraceae COT-099, Erysipelotrichaceae COT- 381, Frigovirgula sp. COT-032, Porphyromonas canoris. Pasteurellaceae COT-080, Treponema sp. COT-355, Novel Treponema 7, Novel Treponema 2, Synergistales bacterium COT-244, Peptostreptococcaceae bacterium COT- 129, Peptostreptococcaceae bacterium COT-021, and Moraxella sp. FOT-087.

[0047] Bacterial community profiles within an oral microbiome of an animal can vary depending on the source of a sample taken from the animal. For example, three discrete oral niches can include soft tissue surfaces, such as the lip, cheek, and tongue; hard tissue surfaces, such as the teeth; and saliva. In some embodiments, the oral niche is from a hard tissue surface, such as one or more teeth. In some embodiments, the oral niche includes the gingival margin, subgingival area, or supragingival surface. In some embodiments, the sample is obtained from a conscious animal or from an unconscious animal. The methods and kits of the disclosed subject matter can be used to detect bacteria in the oral microbiome of a wide variety of animals, such as quadrupeds, primates, and other mammals. The methods and kits of the disclosed subject matter are particularly well suited for use with companion animals, such as dogs, cats, and other domesticated animals.

[0048] 3. Companion Animals

[0049] The presently disclosed subject matter focuses on the health assessment of companion animals. In specific embodiments, the companion animal is a domestic dog.

[0050] Dog Breeds

[0051] The present disclosure relates to, inter alia, methods for assessing health and wellbeing of animals. Characteristics of companion animals can vary, including by size, sex, breed, and species. However, for the most common member within this category, dogs, can in general provide an indication of the efficacy of a method when applied to other animals.

[0052] As used herein, the expression “size category” refers to the definition of the animal (e.g., dogs, cats, etc.) in terms of the average weight of the particular animal breed. Animals (e.g., dogs, cats, etc.) of the same breed can have relatively uniform physical characteristics, such as size, coat color, physiology, and behavior, as compared to animals of a different breed. It is noted that the discussion below is focused on dogs, however, other companion animals and wild animals are intended to be covered by the scope of this disclosure and the present disclosure is not intended to be limited to dogs. The dog can be any breed of dog, including toy / extra-small, small, medium-small, medium, medium-large, large or extra-1 arge / gi ant breeds. Non-limiting examples of toy / extra-small breeds include Affenpinscher, Australian Silky Terrier, Bichon Frise, Bolognese, Cavalier King Charles Spaniel, Chihuahua, Chinese Crested, Coton De Tulear, English Toy Terrier, Griffon Bruxellois, Havanese, Italian Greyhound, Japanese Chin, King Charles Spaniel Lowchen (Little Lion Dog), Maltese, Miniature Pinscher, Papillon, Pekingese, Pomeranian, Pug, Russian Toy, and Yorkshire Terrier. Examples of small breeds include, but are not limited to, French Bulldog, Beagle, Dachshund, Pembroke Welsh Corgi, Miniature Schnauzer, Cavalier King Charles Spaniel, Shih Tzu, and Boston Terrier. Examples of medium dog breeds include, but are not limited to, Bulldog, Cocker Spaniel, Shetland Sheepdog, Border Collie, Basset Hound, Siberian Husky, and Dalmatian. Examples of large breed dogs include, but are not limited to, Great Dane, Neapolitan mastiff, Scottish Deerhound, Dogue de Bordeaux, Newfoundland, English mastiff, Saint Bernard, Leonberger, and Irish Wolfhound. Other non-limiting examples of breeds include those listed in Wallis et al. (2021). Cross-breeds can generally be categorized as toy / extra- small, small, medium-small, medium, medium-large, large, and extra-large / giant dogs depending on their body weight. In certain embodiments, the dog is a toy / extra-small breed. In certain embodiments, the dog is a small, medium-small, medium, medium-large, large or extra-large / giant breed. In some embodiments, the dog is a mix of two or more breeds. In such instances, the mixed-breed dog can still be categorized by size depending on their body weight and can exhibit traits (e.g., behavioral traits, genetic traits, etc.) associated with each of the two or more breeds found in the dog.

[0053] The Federation Cynologique Internationale currently recognizes 346 pure dog breeds. The breed of a dog can be identified, for example, either by observing its physical traits or by genetic analysis. A pedigree dog is the offspring of two dogs of the same breed, which is eligible for registration with a recognized club or society that maintain a register for dogs of that description. There are a number of pedigree dog registration schemes, of which the Kennel Club is the most well-known.

[0054] Table 2. A list of dog size categories.

[0055] In certain embodiments, the dog size categories are selected according to Salt et aL 2017 (Table 2). In other embodiments, the dog size categories are selected according to alternative designations. A small breed can correspond with animals that have an average body weight of from about 6.5 kilograms to about 9 kilograms. A medium breed can correspond with an animal that has an average body weight between about 9 kilograms and about 30 kilograms. A large breed can correspond with an animal that has an average body weight of between about 30 kilograms and about 40 kilograms. A giant breed can correspond with an animal that has an average body weight of between over about 40 kilograms.

[0056] 4. Methods

[0057] The disclosed subject matter can include performing an assay on the sample to measure an amount of a microbial nucleic acid. In certain embodiments, the microbial nucleic acid can be a microbial DNA or RNA, e.g., a 16S ribosomal DNA (rDNA) or 16S ribosomal RNA (rRNA). Various assays for identifying the presence of bacteria, or other markers associated with an oral disease or disorder (e.g., periodontal disease) or good oral health are known in the art. In an embodiment, the assay is polymerase chain reaction (PCR). In an embodiment, the assay is quantitative polymerase chain reaction (qPCR). In an embodiment, the assay includes DNA sequencing. In an embodiment, the assay includes shotgun metagenomics sequencing.

[0058] For purposes of example, any of the disclosed methods can include performing an assay for testing for the presence and / or relative amounts of any bacteria, disclosed herein. In certain embodiments, the bacteria are Peptostreptococcaeceae sp. and / or volatile organic compound producing bacteria, or any other periodontal bacterium, such as but not limited to Peptostreptococcaceae COT-307 / FOT-060, Peptostreptococcaceae COT-077, Lachnospiraceae COT-099, Erysipelotrichaceae COT-381, Frigovirgula sp. COT-032, Porphyromonas canoris. Pasteurellaceae COT-080, Treponema sp. COT-355, Novel Treponema 7, Novel Treponema 2, Synergistales bacterium COT-244, Peptostreptococcaceae bacterium COT- 129, Peptostreptococcaceae bacterium COT-021, Moraxella sp. FOT-087, and combinations thereof.

[0059] The present invention provides methods for determining the oral health status of an animal comprising: (a) quantifying one or more microbial taxa from a sample to determine abundance or relative abundance of the one or more microbial taxa, and (b) determining the oral health status of the animal; wherein the one or more microbial taxa is selected from the group consisting of Peptostreptococcaceae COT-307 / FOT-060, Peptostreptococcaceae COT-077, Lachnospiraceae COT-099, Erysipelotrichaceae COT-381, Frigovirgula sp. COT-032, Porphyromonas canoris, Pasteurellaceae COT-080, Treponema sp. COT-355, Novel Treponema 1, Novel Treponema 2, Synergistales bacterium COT-244, Peptostreptococcaceae bacterium COT- 129, Peptostreptococcaceae bacterium COT-021, Moraxella sp. FOT-087, and combinations thereof. In certain embodiments, the microbial taxa comprise bacteria.

[0060] In certain embodiments, the disclosed methods can include performing an assay for testing for the presence and / or relative amounts of 1 or more microbial taxa, 2 or more microbial taxa, 3 or more microbial taxa, 4 or more microbial taxa, 5 or more microbial taxa, 6 or more microbial taxa, 7 or more microbial taxa, 8 or more microbial taxa, 9 or more microbial taxa, 10 or more microbial taxa, 11 or more microbial taxa, 12 or more microbial taxa, 13 or more microbial taxa, 14 or more microbial taxa, or 15 or more microbial taxa. In certain embodiments, the microbial taxa comprise volatile organic compound producing bacteria. In certain embodiments, the microbial taxa comprise periodontal bacteria. In certain embodiments, the microbial taxa comprise Peptostreptococcaceae COT-307 / FOT-060. In certain embodiments, the microbial taxa comprise Peptostreptococcaceae COT-077. In certain embodiments, the microbial taxa comprise Lachnospiraceae COT-099. In certain embodiments, the microbial taxa comprise Erysipelotrichaceae COT-381. In certain embodiments, the microbial taxa comprise Frigovirgula sp. COT-032. In certain embodiments, the microbial taxa comprise Porphyromonas canoris. In certain embodiments, the microbial taxa comprise Pasteurellaceae COT-080. In certain embodiments, the microbial taxa comprise Treponema sp. COT-355. In certain embodiments, the microbial taxa comprise Novel Treponema 1. In certain embodiments, the microbial taxa comprise Novel Treponema 2. In certain embodiments, the microbial taxa comprise Synergistales bacterium COT-244. In certain embodiments, the microbial taxa comprise Peptostreptococcaceae bacterium COT-129. In certain embodiments, the microbial taxa comprise Peptostreptococcaceae bacterium COT- 021. In certain embodiments, the microbial taxa comprise Moraxella sp. FOT-087.

[0061] In certain embodiments, the disclosed methods can include performing an assay for testing for the presence and / or relative amounts of one or more microbial taxa selected from the group consisting of Peptostreptococcaceae COT-307 / FOT-060, Peptostreptococcaceae COT-077, Lachnospiraceae COT-099, Erysipelotrichaceae COT-381, Frigovirgula sp. COT-032, Porphyromonas canoris. Pasteurellaceae COT-080, and combinations thereof. In certain embodiments, the microbial taxa comprise Peptostreptococcaceae COT-307 / FOT- 060, Peptostreptococcaceae COT-077, Lachnospiraceae COT-099, Erysipelotrichaceae COT-381, Frigovirgula sp. COT-032, Porphyromonas canoris, and Pasteurellaceae COT- 080.

[0062] In certain embodiments, the disclosed methods can include performing an assay for testing for the presence and / or relative amounts of one or more microbial taxa selected from the group consisting of Treponema sp. COT-355, Novel Treponema 7, Novel Treponema 2, Synergistales bacterium COT-244, Peptostreptococcaceae bacterium COT-129, Peptostreptococcaceae bacterium COT-021, Moraxella sp. FOT-087, and combinations thereof. In certain embodiments, the microbial taxa comprise Treponema sp. COT-355, Novel Treponema 7, Novel Treponema 2, Synergistales bacterium COT-244, Peptostreptococcaceae bacterium COT- 129, Peptostreptococcaceae bacterium COT-021, and Moraxella sp. FOT-087.

[0063] Additionally or alternatively, any of the disclosed methods can include performing a universal PCR assay which detects the presence of bacterial DNA in the oral microbiome. Universal primers, and how to create them, are known to skilled people in the art. Examples of methods relating to universal primers include those described in Ott et al., J. Clin. Microbiol. 2004 Jun; 42(6): 2566 -2572. Doi: 10.1128 / JCM.42.6.2566- 2572.2004[WCl] [HL2], the contents of which is incorporated by reference in its entirety. Methods for performing PCR assays and DNA sequencing are known in the art.

[0064] The methods can also include a step of extracting a nucleic acid from a sample, e.g., performing a DNA or RNA extraction, according to methods known in the art prior to performing the PCR assay. Generally, a DNA extraction can be performed by lysing the cells containing the DNA and precipitating and purifying the DNA. In certain embodiments, the sample is one or more of a gingival margin sample, a subgingival area sample, a supragingival area sample, a saliva sample, a tongue sample, a buccal sample, or a combination thereof, the sample is obtained from a conscious animal or from an unconscious animal.

[0065] Additionally or alternatively, any of the disclosed methods can include detecting bacteria by testing the sample for the presence of bacteria. In certain embodiments, testing the sample can include for presence and / or relative abundance of one or more of the bacteria disclosed herein, e.g., bacteria associated with an oral disease or disorder (e.g., periodontal disease), bacteria associated with good oral health, or both. In certain embodiments, testing the sample can include detecting the abundance or increased relative abundance compared to a training data set (e.g., bacteria associated with good oral health, bacteria associated with an oral disease or disorder, bacteria not associated with good oral health or oral disease or disorder, and combinations thereof). Detecting a presence or relative increased abundance of one or more of the bacteria disclosed herein can, for instance, indicate that the animal has or is susceptible to developing an oral disease or disorder.

[0066] Additionally or alternatively, any of the disclosed methods can include detecting bacteria by testing the sample for an absence or relatively low abundance of bacteria. In certain embodiments, testing the sample can include for the absence or relatively low abundance of one or more of the bacteria disclosed herein, e.g., bacteria associated with an oral disease or disorder (e.g., periodontal disease). In certain embodiments, testing the sample can include detecting the decreased abundance or decreased relative abundance compared to a training data set. Detecting the absence or relatively low abundance of the one or more of the bacteria associated with the oral disease can, for instance, indicate that the animal does not have an oral disease or disorder or is less likely to develop an oral disease or disorder.

[0067] The present invention provides methods for determining oral health status of an animal comprising: (a) quantifying one or more microbial taxa from a sample to determine abundance or relative abundance of the one or more microbial taxa, and (b) determining the oral health status of the animal; wherein the one or more microbial taxa is selected from the group consisting of Peptostreptococcaceae COT-307 / FOT-060, Peptostreptococcaceae COT-077, Lachnospiraceae COT-099, Erysipelotrichaceae COT-381, Frigovirgula sp. COT-032, Porphyromonas canoris. Pasteurellaceae COT-080, Treponema sp. COT-355, Novel Treponema 7, Novel Treponema 2, Synergistales bacterium COT-244, Peptostreptococcaceae bacterium COT- 129, Peptostreptococcaceae bacterium COT-021, Moraxella sp. FOT-087, and combinations thereof. In certain embodiments, the animal is a domestic animal. In certain embodiments, the domestic animal is a dog, cat, horse, cow, ferret, rabbit, pig, rat, mouse, gerbil, hamster, or goat. In certain embodiments, the animal is a wild animal. In certain embodiments, the wild animal is a wolf, bison, elk, deer, lion, or tiger. In certain embodiments, the animal is a canine animal. In certain embodiments, the animal is a toy / extra-small dog breed. In certain embodiments, the toy / extra-small dog breed is Yorkshire Terrier. In certain embodiments, the health status is predicted to be “not health” or “periodontitis”. In certain embodiments, the oral health status of the animal is “health” or “not periodontitis”.

[0068] In certain embodiments, the one or more microbial taxa is measured using PCR, qPCR, DNA sequencing, or shotgun metagenomics sequencing. In certain embodiments, the method comprises extracting nucleic acid from the sample. In certain embodiments, the nucleic acid is DNA. In certain embodiments, the nucleic acid is RNA. In certain embodiments, the abundance, presence, or relative abundance of the one or more microbial taxa is determined by amplifying or sequencing 16S rRNA, 16S rDNA. In certain embodiments, the one or more microbial taxa is associated with periodontal health or periodontal disease. In certain embodiments, the animal has or is suspected to have gingivitis and / or periodontitis. In certain embodiments, the oral health status comprises periodontal health or periodontal disease. In certain embodiments, the one or more microbial taxa is present in a sample. Additionally or alternatively, the disclosed methods of using the kits of the disclosed subject matter can include testing the sample for the presence and / or relative amounts of microbes associated with oral health. In an embodiment, the testing includes for the presence and / or relative amounts of a bacterial nucleic acid (e.g., DNA or RNA).

[0069] In any of the methods disclosed herein, the detection of the presence of bacteria or other markers can include measuring the amounts of bacteria or other markers, and the amounts can be compared to a scale that correlates the amount of bacteria or other markers to the likelihood that the animal has oral disease or disorder (e.g., periodontal disease) or poor oral health. The likelihood can be indicated as a percentage. For purpose of example and not limitation, the Cq (cycle quantitation) score of a qPCR test that detects the nucleic acid (e.g. DNA or RNA) of bacteria associated with oral disease or disorder (e.g., periodontal disease) can be used to create the scale for calculating the likelihood that the animal has oral disease or disorder (e.g., periodontal disease). A lower Cq score can indicate the presence of higher levels of the bacteria associated with oral disease or disorder (e.g., periodontal disease) and therefore the likelihood that the animal has oral disease or disorder (e.g., periodontal disease) can be higher than the animal with a higher Cq score.

[0070] In certain exemplary embodiments, all qPCR data can be normalized to the level of a universal assay for each sample; this adjusts the data for differences in the overall amount of total bacterial DNA in each sample, i.e., yield the abundance relative to the total bacterial population. The data can be then linearised, such that the final qPCR data outputs are relative proportions (2'( Cq Test'Cq Total)). In certain embodiments, Cq.Test refers to the Cq score associated with a microbial species. In certain embodiments, Cq.Test refers to the Cq score associated with a canine oral taxon (COT). Samples with Cq.Test values outside of the reliable range of the assay (where Cq>21) can be assumed to have undetectable amounts of DNA and therefore those relative proportions can be imputed as the limit of quantification or 0. Cq and Ct (cycle threshold) can be used interchangeably.

[0071] For purpose of example and not limitation, a report can be generated summarizing the results of sample testing. In certain embodiments, electronic communications can be used to communicate the report. For example, a personalized report can be generated and sent to communicate the animal’s oral health status. In other embodiments, the report can be provided as a hard copy. The personalized report can, for example, include an indicator system such as a traffic light system, e.g., green, yellow, red, to communicate the oral health status of the animal. The personalized report can also include a representation of the scale as reference above and an indication of where the animal’s oral health falls on the scale, e.g., 0% is indicative of no disease and 100% is indicative of severe disease.

[0072] The present invention also provides a method of improving or maintaining the oral health of an animal, the method comprising monitoring the oral health status of a canine animal using the assay according to the invention and providing to the animal a foodstuff or supplement which is formulated to improve or maintain oral health, depending on the oral health status that has been determined by way of the assay. Such food products are known in the art, such as those containing active ingredients to improve oral health or those designed to remove plaque by abrasion, analogous to regular tooth-brushing. Also included are food supplements such as liquids or additives to water. The amount or frequency of the foodstuff or supplement can be determined depending on the result of the assay. The predicted future health of the animal can also be taken into account when determining how often such oral care foodstuffs should be provided. The oral health status may be monitored two times, three times, four times, five times, six times, seven times, or any other suitable number of times. The process can be repeated one week, two weeks, three weeks, one month, two months, three months, four months, five months, six months, 12 months, 18 months, 24 months, 30 months, 36 months, or more than 36 months apart or at least one week, two weeks, three weeks, one month, two months, three months, four months, five months, six months, 12 months, 18 months, 24 months, 30 months, 36 months, or any other suitable number of months apart. In certain embodiments, two time points are at least 6 months or 1 year apart.

[0073] In certain embodiments, the oral health status of the animal is predicted to be “not health” or “periodontitis”. In certain embodiments, the oral health status of the animal is “health” or “not periodontitis”. In certain embodiments, the animal has or is suspected to have gingivitis and / or periodontitis. In certain embodiments, the oral health status comprises periodontal disease or periodontal health. In certain embodiments, the method comprises providing to the animal a foodstuff or supplement which is formulated to improve the oral health status. In certain embodiments, the method comprises providing to the animal a foodstuff or supplement, which is formulated to improve the oral health status, when the oral health status of the animal is predicted to be “not health” or “periodontitis”. In certain embodiments, the method comprises providing to the animal a foodstuff or supplement, which is formulated to maintain the oral health status, when the oral health status of the animal is predicted to be “health” or “not periodontitis”.

[0074] EXAMPLES

[0075] The present disclosure will be better understood by reference to the following Examples, which are provided as exemplary of the presently disclosed subject matter, and not by way of limitation.

[0076] EXAMPLE 1: Identification of Oral Microbiota associated with Periodontal Disease

[0077] Analysis of 42 subgingival plaque samples (1 to 4 samples per dog) by 454 pyrosequencing of the VI -V3 region of the 16S rRNA gene resulted in 796,091 filtered sequence reads which were assigned to 286 operational taxonomic units (excluding those deemed noise). Statistical analysis showed that health and mild gingivitis were associated with higher relative abundance of taxa belonging to the phylum Proteobacteria (e.g., Moraxella and Pasteurellaceae). In moderate gingivitis there was increased representation of taxa belonging to the phylum Firmicutes (e.g., Peptostreptococcaceae, Lachnospiraceae, Erysipelotrichaceae and Frigovirgula) and Bacteroidetes (Porphyromonas canoris). Periodontitis was also associated with an increased representation of some taxa belonging to the phylum Firmicutes (e.g., Peptosteptococcaceae), Spirochaetea (e.g., Treponema) and Synergistetes (e.g., Synergistales). This elucidates bacterial changes associated with early periodontal disease which can be leveraged to improve disease diagnosis, drive awareness and support recommendations for effective preventative and management strategies.

[0078] Methods

[0079] Study cohort and sample collection. Bacterial plaque samples were collected in parallel with a study undertaken to determine the extent of gingivitis and periodontitis in Yorkshire terriers. All dogs were housed at the Waltham Petcare Science Institute and received regular dental assessments under general anaesthesia during which the levels of gingivitis (time to bleeding on probing) and periodontitis (clinical attachment loss based on probing depth, gingival recession and furcation exposure) were assessed. Gingivitis and periodontitis were assessed on 4 aspects of every tooth in the mouth by people trained for consistency by a Diplomate of the European Veterinary Dental College. Dogs were assessed every eight weeks (+ / - 1 week) from 37 weeks up to a maximum of 61 weeks of age.

[0080] Subgingival plaque was collected from every tooth in the mouth whilst the level of gingivitis was being assessed. A total of 24 Yorkshire terriers (5 litters) were included with sampling based on the duration they were on the clinical trial: 21 dogs were sampled at 37 weeks of age, 15 at 45 weeks, 5 at 53 weeks and 1 at 61 weeks resulting in 1 to 4 samples per dog. Subgingival plaque collection involved placing a sterile periodontal probe under the gingival margin and sweeping it along the base of the crown of the tooth. The probe was placed into a 0.5 ml Eppendorf tube containing 300 pl TE buffer (lOmM Tris-HCL, 1 mM disodium EDTA, pH8.0; Sigma-Aldrich) and agitated to remove the plaque. This resulted in one whole mouth plaque sample per dog at each sampling occasion. Samples were stored on dry ice for a maximum of 30 minutes prior to storage at -80°C.

[0081] DNA extraction. DNA was extracted using the Masterpure™ Gram positive DNA purification kit (Epicentre, #MGP04100) according to the manufacturer’s instructions but with an additional overnight lysis. After centrifugation of the plaque samples at 5000 x g for 10 minutes the cell pellet was resuspended in 150 pl of TE buffer and 1 pl Ready - Lyse™ Lysozyme Solution added. The lysis mix was incubated at 37°C for 18 hrs. Following DNA extraction, the DNA pellet was suspended in TE buffer. The quantity and the purity of the DNA was determined using a NanoDrop ND 1000 spectrophotometer (NanoDrop Technologies Inc).

[0082] Amplification and sequencing of 16S rDNA, The VI -V3 region of the 16S rRNA gene was amplified using universal primers and the Extensor Hi-Fidelity PCR Master Mix (#AB-0792, Thermo Scientific) according to the manufacturer’s instructions. Forward primers were a mix of FLX_27FYM (5’- CG7XTCGCCTCCCTCGCGCG4TG4GAGAGTTTGATYMTGGCTCAG-3’) (SEQ ID NO.: 15) used at 9.5pmol / pl and FLX_27F_Bif (5’- CG7XTCGCCTCCCTCGCGCG4TG4GAGGGTTCGATTCTGGCTCAG-3’) (SEQ ID NO.: 16) used at 0.5pmol / pl. The forward primers comprised, from the 5’ end, the 454- sequencing adapter A (italicised letters) and the 16S rRNA gene primer sequences (bold letters). Primer FLX_27F_Bif was included to ensure representation of the genus Bifidobacter, a lower concentration was chosen due to the low representation of this genus in previous studies of canine plaque. The reverse primer was used at 10 pmol / pl (5’- CTATGCGCCTTGCCAGCCCGCTCAG (SEQ ID NO.: 17) XXXXXXXTYACCGCGGCTGCTGG-3’ (SEQ ID NO.: 18)). This comprised from the 5’ end, 454 sequencing adapter B (italicised letters), 7 base pair MID tag (denoted by X) and rRNA specific sequence I533r (bold text).

[0083] For each PCR reaction, 5 pl of template DNA was used and the PCR cycling conditions were as follows; 94°C for 3 minutes, 10 cycles of 94°C for 45 seconds(s), 55°C for 30 s and 72°C for 1 minute, followed by a further 20 cycles of 94°C for 45 s, 55°C for 30 s and 72°C for 90 s and a final extension of 72°C for 5 minutes 30 s. Amplicon size and abundance was ascertained using agarose gel electrophoresis.

[0084] Library preparation, emulsion PCR and sequencing of the VI -V3 region of the 16S rDNA were conducted according to the GS FLX Titanium Series amplicon library protocol by Eurofins Genomics. Libraries were sequenced on a Roche Genome Sequencer FLX Titanium System™. Only the FLX Titanium B primer was utilised resulting in unidirectional sequences.

[0085] Sequencing data processing. The standard flowgram files were initially filtered by selecting reads with at least 360 flows and truncating long reads to 720 flows. Reads were filtered and denoised using the AmpliconNoise software (version VI.21). For the initial filtering step, reads were truncated when flow signals dropped below 0.7, indicative of poor quality. Subsequently, reads were denoised in three stages; 1) Pyronoise to remove noise from flowgrams resulting from 454 sequencing errors (PyronoiseM parameters -s 60, -c 0.01), 2) Seqnoise to remove errors resulting from PCR amplification (SeqNoiseM parameters -s 25, -c 0.08), 3) Perseus to detect and remove chimeras resulting from PCR recombination. The denoised sequences were then clustered at >98% identity using the script pick otus.py within QIIME, which utilises the Uclust software program. Uclust was run with modified parameters, with gap opening penalty set to 2.0 and gap extension penalty set to 1.0 and -A flag to ensure optimum alignment. The most abundant sequence in each OTU was selected as the representative.

[0086] The representative sequences were annotated using biastail 2.2.25 and the Silva database (version 138). The Silva database contains full-length 16S rRNA sequences to previously identified canine oral taxa (COT) and feline oral taxa (FOT). These were deposited in GenBank and received accession numbers JN713151-JN713566 and KM461942-KM462187. OTUs present in fewer than two samples or with an average relative abundance <0.05% were grouped together and deemed noise. This cut-off was defined based on false positive / negative species identification based on analysis of mock communities.

[0087] Statistical analysis. The Shannon diversity index was calculated for each sample using all OTUs prior to removal of OTUs classified as noise. Linear changes in Shannon diversity with proportion of periodontitis teeth in the mouth or mean gingivitis score (as continuous fixed effects) were investigated using linear mixed models, using dog nested in litter as the random effects. nMDS was performed using a Bray Curtis distance matrix calculated from the non- rare OTU proportions (count of OTU out of the total number of sequences) to determine whether there was any association of the bacterial composition with mean gingivitis score or proportion of periodontitis teeth.

[0088] The individual OTUs (excluding those classified as noise) were analysed using GLM for proportions (the count for the OTU out of the total sequence depth for the sample), using a binomial distribution and logit link. Initially GLM were explored to account for correlations within a dog and litter, however the resulting models were found to have convergence and variance estimation problems. Thus, the final models dropped the random terms but included an overdispersion parameter to adjust the estimation for inflated variance at low proportions. Two counts were added to each OTU count and four counts were added to the total sequence depth for each sample prior to analyses to enable better estimation with many zeros. Cumulative proportion of periodontitis teeth in the mouth or mean gingivitis scores were investigated separately as continuous fixed effects. Mean gingivitis was calculated as the mean score for each tooth and then the mean of all teeth in the mouth. The odds ratio for the associated effects were estimated with 95% confidence intervals and the associated p-values adjusted for multiplicity by Benjamani -Hochberg to maintain a false discovery rate of 5%.

[0089] Statistical analyses were performed in R v3.2.4 statistical software using the vegan library.

[0090] Results

[0091] Sequence quality. A total of 42 subgingival plaque samples from 24 Yorkshire terriers (1 to 4 samples per dog) were analysed by 454 pyrosequencing of the V1-V3 region of the 16S rRNA gene. This resulted in the generation of 999,761 sequence reads that passed the initial quality filter. Following amplicon noise filtering 796,091 sequence reads were retained. The number of sequence reads per sample ranged from 8,525 to 16,314. Clustering of the sequence reads at >98% identity, resulted in the identification of 4,056 operational taxonomic units (OTU), reduced to 286 following removal of the OTUs deemed noise. The removed OTUs accounted for 2.3% of sequence reads.

[0092] Bacterial community composition. Taxonomic assignment of the 286 OTUs from the Yorkshire terrier samples resulted in 58.3% mapping with >98% identity to taxa previously identified in the oral cavity of dogs or cats. A further 31.2% mapped to other sequences within the Silva database with >98% identity. The remaining 10.5% of sequences shared between 86.7% and 97.7% identity to sequences within the Silva database. These findings are representative of previous studies of the canine plaque microbiota.

[0093] The majority of OTUs identified were assigned to 7 phyla: Firmicutes (31.8%), Proteobacteria (17.8%), Bacteroidetes (17.1%), Spirochaetae (11.2%), Actinobacteria (9.1%), Fusobacteria (4.5%) and TM7 (3.1%). There were a further 7 phyla that each represented less than 1.5% of the OTU assignments: SRI, Chlorobi, Synergistetes, Chloroflexi, BD1-5, Tenericutes, Elusimicrobia. The 20 most abundant OTUs in subgingival plaque from Yorkshire terriers represented 39.2% of the sequence reads (Table 3). The most abundant bacterial species was Porphyromonas cangingivalis . Table 3. The 20 most abundant bacterial species observed in subgingival plaque of Yorkshire terriers. COT / FOT depict previously identified canine / feline oral taxa.

[0094] Species Proportion of total sequence reads

[0095] Porphyromonas cangingivalis 5.29%

[0096] Parvimonas sp. COT-035 4.31%

[0097] Moraxella sp. COT-017 3.82%

[0098] Aquaspirillum sp. FOT-079 3.15%

[0099] Actinobacteria COT-406 2.39%

[0100] Leptotrichia sp. COT-345 1.88%

[0101] Granulicatella sp. COT-095 1.54%

[0102] Actinomyces COT-404 1.46%

[0103] Treponema 1.39%

[0104] Bergeyella 1.38%

[0105] Fusobacterium 1.35%

[0106] Euzebya 1.34%

[0107] Corynebacterium mustelae 1.30%

[0108] Fusobacterium 1.30%

[0109] Abiotrophia 1.30%

[0110] Fusobacterium 1.26%

[0111] Neisseria 1.24%

[0112] Treponema sp. COT-359 1.20%

[0113] Campylobacter sp. FOT-lOO / COT-i 1 1.19%

[0114] Actinomyces sp. FOT-320 / COT-O8i 1.11%

[0115] Bacterial diversity. There was no statistically significant relationship between bacterial diversity and periodontal health status of the Yorkshire terriers. On average there was an increase in Shannon diversity of 0.03 [-0.45, 0.52] when comparing 0% to 75% periodontitis teeth in the mouth (p = 0.895) (Figure 1 A). With respect to gingivitis, there was an average increase of 0.24 [-0.23, 0.71] in Shannon diversity with an increase in average gingivitis score of 1 (p = 0.31) (Figure IB).

[0116] Bacterial associations with gingivitis and periodontitis. An exploratory non-metric multidimensional scaling (nMDS) showed no discrete clustering of plaque microbiota by proportion of periodontitis teeth in the mouth (Figure 2A) or mean gingivitis mouth score (Figure 2B). However, analysis of the individual OTUs using Generalised Linear Models (GLM) identified several that were significantly associated with the proportion of periodontitis teeth in the mouth and mean gingivitis mouth score.

[0117] Of the 286 individual OTUs, 7 showed a significant association with gingivitis when comparing a mean gingivitis mouth score of 2 to a mean gingivitis mouth score of 1. Of these, 6 OTUs had a higher relative abundance when the statistically estimated mean gingivitis mouth score was 2 (Table 4, Figure 3). Five belonged to the phylum Firmicutes (Peptostreptococcaceae COT-307 / FOT-060, Peptostreptococcaceae COT-077, Lachnospiraceae COT-099, Erysipelotrichaceae COT-381 and Frigovirgula sp. COT-032) and one to the phylum Bacteroidetes (Porphyromonas canoris). There was 1 OTU, Pasteurellaceae COT-080 a member of the phylum Proteobacteria, with a higher relative abundance when the statistically estimated mean gingivitis mouth score of 1.

[0118] Table 4. Estimated odds ratio (OR.Estimate) with 95% confidence intervals (OR.lwr, OR.upr) and the associated / ?-values adjusted for multiplicity by Benjamani -Hochberg of the OTUs significantly associated with gingivitis when comparing a mean mouth gingivitis score of 2 to a mean mouth gingivitis score of 1.

[0119] Exploration of the bacterial association with periodontitis in Yorkshire terriers identified 10 OTUs that significantly differed in their relative abundance when comparing 0% to 75% periodontitis teeth in the mouth (Table 5, Figure 4). Of these, three had greater than 80% of samples with zero abundance so were not considered further. Six of the remaining OTUs were significantly associated with periodontitis; two from the phylum Firmicutes (Peptosteptococcaceae COT-129 and Peptosteptococcaceae COT-021), three from the phylum Spirochaetae (2 novel species of Treponema and Treponema sp. COT- 355) and one from the phylum Synergistetes (Synergistales bacterium COT-244). One OTU from the phylum Proteobacteria (Moraxella sp. FOT-087) was significantly associated with periodontal health.

[0120] Table 5. Estimated odds ratio (OR.Estimate) with 95% confidence intervals (OR.lwr, OR.upr) and the associated / ?-values adjusted for multiplicity by Benjamani -Hochberg of the OTUs significantly associated with periodontitis when comparing 0% to 75% periodontitis teeth in the mouth.

[0121] Discussion

[0122] This study of periodontal disease in Yorkshire terriers provided a unique opportunity to investigate the bacterial associations with gingivitis and periodontitis in a highly predisposed breed of dog. Analysis of subgingival plaque samples by 454 pyrosequencing identified taxa significantly associated with gingivitis and the proportion of periodontitis teeth in the mouth. The increased relative abundance of taxa belonging to the phyla Proteobacteria in periodontal health and the shifts to increased relative abundance of the phyla Firmicutes and Spirochaetes in moderate gingivitis and periodontitis observed in this study of Yorkshire terriers concurs with findings from previous cross-sectional studies.

[0123] The findings of the current study also support those from a one-year longitudinal study of miniature schnauzers which showed that periodontitis and gingivitis were characterised by an increase in abundance of species belonging to the phylum Firmicutes, particularly bacterial species belonging to the family Peptostreptococcaceae. Periodontal health was also associated with a greater proportion of species belonging to the phyla Bacteroidetes (particularly Bergeyella zoohelcum) and Proteobacteria (particularly Moraxella sp. COT-017 and members of the Pasteurellaceae family). Although, there were many similarities between the Yorkshire terrier and miniature schnauzer studies, Yorkshire terrier microbiota showed some distinct differences, mainly in the association of bacterial species belonging to the genus Treponema with periodontitis. The increased abundance of Treponema in Yorkshire terriers might be explained by the fact they had a greater number of teeth that progressed to periodontitis (47% of teeth assessed) compared to the miniature schnauzers (27%). This finding is supported by a recent publication that proposed Treponema denticola as a prognostic biomarker for diagnosis of canine periodontitis.

[0124] This study showed a small increase in bacterial diversity with periodontal disease progression although this was not statistically significant. The literature pertaining to changes in species richness and diversity is controversial with some supporting the findings of this study and others indicating a significant increase in diversity in dogs with periodontal disease versus those with healthy gingiva. The Yorkshire terriers in this study were only exhibiting early stages of the disease (gingivitis and <25% attachment loss, PD2) and, if the dogs were allowed to continue to develop into the later stages of disease, the changes in bacterial diversity may have been greater.

[0125] Studies designed to investigate the development of periodontal disease in breeds of dog with differing susceptibilities to periodontal disease have provided a unique opportunity to gain preliminary insights as to whether host genetics (dog breed) or clinical status of the periodontium had the greatest impact on the bacterial community composition of canine subgingival plaque. The Yorkshire terrier cohort investigated in this study had the highest prevalence of periodontitis teeth (47% of teeth assessed progressed to periodontitis over a 10-month period) compared to miniature schnauzers (26.8% of teeth assessed progressed to periodontitis over approximately 14 months). These studies are not directly comparable due to differences in sampling approaches (single teeth versus whole mouth collections), DNA extraction methods (Nucleospin 96 Tissue kit, Macherey-Nagel versus Masterpure™ Gram positive DNA purification kit, Epicentre) and the proportions of periodontitis teeth. However, the consistency in bacterial changes observed across the studies support the theory that clinical status of the periodontium is the principal determinant of plaque microbiota composition.

[0126] * * *

[0127] While several embodiments have been provided in the present disclosure, it should be understood that the disclosed systems and methods might be embodied in many other specific forms without departing from the spirit or scope of the present disclosure. The present examples are to be considered as illustrative and not restrictive, and the intention is not to be limited to the details given herein. For example, the various elements or components can be combined or integrated in another system or certain features can be omitted, or not implemented.

[0128] In addition, techniques, systems, subsystems, and methods described and illustrated in the various embodiments as discrete or separate can be combined or integrated with other systems, modules, techniques, or methods without departing from the scope of the present disclosure. Other items shown or discussed as coupled or directly coupled or communicating with each other can be indirectly coupled or communicating through some interface, device, or intermediate component whether electrically, mechanically, or otherwise. Other examples of changes, substitutions, and alterations are ascertainable by one skilled in the art and could be made without departing from the spirit and scope disclosed herein.

Claims

WHAT IS CLAIMED IS:

1. A method for determining oral health status of an animal comprising:(a) quantifying one or more microbial taxa from a sample to determine abundance or relative abundance of the one or more microbial taxa, and(b) determining the oral health status of the animal; wherein the one or more microbial taxa is selected from the group consisting of Peptostreptococcaceae COT-307 / FOT-060, Peptostreptococcaceae COT-077, Lachnospiraceae COT-099, Erysipelotrichaceae COT-381, Frigovirgula sp. COT- 032, Porphyromonas canoris. Pasteurellaceae COT-080, Treponema sp. COT-355, Novel Treponema 7, Novel Treponema 2, Synergistales bacterium COT-244, Peptostreptococcaceae bacterium COT-129, Peptostreptococcaceae bacterium COT- 021, Moraxella sp. FOT-087, and combinations thereof.

2. The method of claim 1, wherein the one or more microbial taxa is measured using PCR, qPCR, DNA sequencing, or shotgun metagenomics sequencing.

3. The method of claims 1 or 2, wherein the abundance, presence, or relative abundance of the one or more microbial taxa is determined by amplifying or sequencing 16S rRNA, 16S rDNA.

4. The method of any one of claims 1-3, wherein the animal is a domestic animal.

5. The method of claim 4, wherein the domestic animal is a dog, cat, horse, cow, ferret, rabbit, pig, rat, mouse, gerbil, hamster, or goat.

6. The method of any one of claims 1-3, wherein the animal is a wild animal.

7. The method of claim 6, wherein the wild animal is a wolf, bison, elk, deer, lion, or tiger.

8. The method of any one of claims 1-3, wherein the animal is a toy / extra-small dog breed.

9. The method of claim 8, wherein the toy / extra-small dog breed is Yorkshire Terrier.

10. The method of any one of claims 1-9, wherein the one or more microbial taxa is associated with periodontal health or periodontal disease.

11. The method of any one of claims 1-10, further comprising extracting nucleic acid from the sample.

12. The method of claim 11, wherein the nucleic acid is DNA.

13. The method of claim 11, wherein the nucleic acid is RNA.

14. The method of any one of claims 1-13, wherein the sample is one or more of a gingival margin sample, a subgingival area sample, a supragingival area sample, a saliva sample, a tongue sample, a buccal sample, or a combination thereof.

15. The method of any one of claims 1-14, wherein the sample is obtained from a conscious animal or from an unconscious animal.

16. The method of any one of claims 1-15, wherein the animal has or is suspected to have gingivitis and / or periodontitis.

17. The method of any one of claims 1-16, wherein the oral health status comprises periodontal health or periodontal disease.

18. The method of any one of claims 1-17, wherein the one or more microbial taxa is present in a sample.

19. A method of improving or maintaining the oral health of an animal, comprising determining the oral health status of an animal using the assay according to any one of claims 1-18, wherein the health status is predicted to be “not health” or “periodontitis”.

20. A method of improving or maintaining the oral health of an animal, comprising determining the oral health status of a canine animal using the assay according to any one of claims 1-18, wherein the health status is “health” or “not periodontitis”.

21. The method of claim 19 or 20, further comprising providing to the animal a foodstuff or supplement which is formulated to improve the oral health status.

22. The method of any one of claims 19-21, further comprising determining the oral health status of the animal on at least two time points.

23. The method of claim 22, wherein the two time points are at least 6 months or 1 year apart.