Nucleic acid synthesis on reusable support
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- DNA SCRIPT SAS
- Filing Date
- 2024-06-28
- Publication Date
- 2026-05-06
AI Technical Summary
Current methods for oligonucleotide synthesis on CMOS chips are hindered by high costs and inefficiencies due to the need for multiple packaging steps and the lack of cost-effectiveness and ease of use, leading to a performance gap between DNA writing and reading.
A method for synthesizing polynucleotides on reusable CMOS chips, allowing for multiple cycles of synthesis by immobilizing anchor nucleic acids and using initiator nucleic acids with free 3’-OH ends to hybridize and elongate, followed by denaturing conditions to disrupt hybridization and recover synthesized polynucleotides, enabling chip reusability and reducing waste.
This approach significantly decreases synthesis costs, increases workflow efficiency, and reduces waste by allowing multiple reuse cycles of the chips, thereby improving the cost-effectiveness and throughput of oligonucleotide synthesis.
Smart Images

Figure EP2024068301_02012025_PF_FP_ABST
Abstract
Description
[0001] NUCLEIC ACID SYNTHESIS ON REUSABLE SUPPORT
[0002] FIELD OF THE INVENTION
[0003] The present invention relates to methods for synthesizing polynucleotides, particularly on a reusable solid surface. The present invention also relates to a kit for use with said methods, and to methods for storing information.
[0004] BACKGROUND
[0005] Over the past decades, remarkable progress has been achieved in oligonucleotide synthesis, enabling numerous novel applications. Among them, oligonucleotide pool production and DNA data storage offer striking perspectives. However, there is a performance gap, today, between DNA reading and DNA writing. Hence, to make oligonucleotide pool production and DNA data storage feasible in practice, vast improvements need to be done in the synthesis of DNA, particularly in terms of cost, speed and throughput. The cost of using CMOS chips, especially, is an obstacle to the performances of high-throughput DNA synthesis. While taped-out CMOS chips can be produced in large amounts inexpensively, additional steps are required to make the chip ready for use, such as die packaging to protect the die, and connection to a PCB board. To prevent liquid damage, further packaging is also required to isolate the chip surface from the electronic interconnects. These steps add cost and reduce ease of use of the chips for oligonucleotide synthesis.
[0006] The high-throughput capacity of CMOS chips could be exploited more advantageously in oligonucleotide synthesis if the cost-effectiveness and efficiency of the technology could be improved.
[0007] SUMMARY OF THE INVENTION
[0008] The present inventors have developed improved methods for synthesizing polynucleotides. These methods allow to use a synthesis support such as a CMOS chip, for several repeated cycles of synthesis. The reusability of the chips drastically decreases the cost of synthesis and considerably increases the synthesis workflow. By making possible to reuse a chip, the method also provides important waste reductions in the oligonucleotide process.
[0009] One aspect of the invention therefore relates to a method for synthesizing polynucleotides, comprising:
[0010] (i) providing at least one anchor nucleic acid immobilized to a solid surface; and
[0011] (ii) repeating cycles of: (a) contacting the anchor nucleic acid with at least one initiator nucleic acid comprising a free 3’-OH end, under conditions such that the initiator nucleic acid and the anchor nucleic acid hybridize over at least a part of their nucleotide sequences;
[0012] (b) elongating the 3’-OH end of said initiator nucleic acid, to produce a synthesized polynucleotide bound to the initiator nucleic acid;
[0013] (c) disrupting the hybridization of the initiator nucleic acid to the anchor nucleic acid; and
[0014] (d) optionally recovering the synthesized polynucleotide.
[0015] In some embodiments, the initiator nucleic acid hybridizes to the anchor nucleic acid by complementary sequences of nucleotides respectively located at the 5’-end of initiator nucleic acid and anchor nucleic acid. Said complementary sequence of nucleotide within the initiator nucleic acid may comprise the sequence GCTGTTTCGCGTGACAT (SEQ ID NO:11). In preferred embodiments, only a part of the initiator nucleic acid is hybridized to the anchor nucleic acid. In other words, the initiator nucleic acid comprises a first portion, preferably at its 5’-end, which hybridizes to the anchor nucleic acid and a second portion, preferably at its 3’-end, which does not hybridize to the anchor nucleic acid. For instance, said second portion is not complementary to the anchor nucleic acid. In particular, the initiator nucleic acid comprises at least 1 , more particularly at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 non-hybridized nucleotides, at its end the most distal from the solid support, preferably at its 3’-terminus.
[0016] In some embodiments, step (c) comprises applying denaturing conditions to disrupt the hybridization between the initiator nucleic acid and the anchor nucleic acid, wherein said denaturing conditions comprise the application of at least one denaturing agent, a pH change and / or heat. The denaturing agent may be selected from formamide, an alkyl-substituted amide, urea or a urea-based denaturant, thiourea, guanidine, sodium salicylate, dimethyl sulfoxide (DMSO), propylene glycol and their mixtures. Preferably, said pH change is generated by application of an electric potential or current at an electrode in the presence of one or more redox agent. In some embodiments, said initiator nucleic acid comprises at least one cleavable group, and step (c) comprises cleaving the cleavable group within the initiator nucleic acid, thereby breaking the initiator nucleic acid into two or more nucleic acid fragments. In some embodiments, said cleavable group is located within the portion of the initiator nucleic acid which hybridizes to the anchor nucleic acid. Said cleavable group may be selected from a chemically-cleavable group, a photocleavable group and an enzymatically-cleavable group. It is preferably a photocleavable group. In some embodiments, the method further comprises applying denaturing conditions during and / or after the cleavage step to disrupt the hybridization of the cleaved initiator nucleic acid to the anchor nucleic acid.
[0017] In some embodiments, step (c) comprises contacting the anchor nucleic acid with a displacement nucleic acid, under conditions such that said displacement nucleic acid hybridizes to the anchor nucleic acid, thereby disrupting the hybridization of the displacement nucleic acid to the anchor nucleic acid. In some embodiments, said displacement nucleic acid and said anchor nucleic acid comprises complementary sequences of nucleotides, wherein the sequence complementarity between the displacement nucleic acid and the anchor nucleic acid is higher than the sequence complementarity between the initiator nucleic acid and the anchor nucleic acid. In some embodiments, the displacement nucleic acid is further used as initiator nucleic acid for a next cycle of steps (a) to (d). In some embodiments, the method further comprises a step of hybridizing a bridging nucleic acid to the displacement nucleic acid, wherein the bridging nucleic acid is used as anchor nucleic acid for a next cycle of steps (a) to (d).
[0018] In some embodiments, the anchor nucleic acid is immobilized by attachment of a 3’- or 5’- end of the anchor nucleic acid to the solid surface, preferably through a linker selected from a thio-containing linker, an amino-containing linker, an amide-containing linker or an isourea-containing linker.
[0019] Preferably, the linker comprises a spacer between the solid surface and the linker functionality. The spacer may be included to avoid steric hindrance during the linking process and / or during performance of the polynucleotide synthesis method. Typically, the spacer is a short, flexible group, for instance an optionally substituted C1-C20 alkyl, optionally substituted C3-C20 heterocyclyl or an optionally substituted C5-20 aryl. In some embodiments, the initiator nucleic acid is attached to the solid surface by covalent attachment to a functionalized surface of the solid surface selected from a cyanogen bromide (CNBr)-functionalized surface, a N-hydroxysuccinimide (NHS)-functionalized surface and a glyoxal- functionalized surface.
[0020] In some embodiments, the anchor nucleic acid is a single-stranded oligonucleotide and has its 3’- end attached to the solid surface. In some embodiments, the anchor nucleic acid is a single-stranded oligonucleotide immobilized by hybridization to an intermediate nucleic acid attached by its 5’-end to the solid surface. In some embodiments, the anchor nucleic acid is a hairpin nucleic acid attached to the solid surface.
[0021] In some embodiments, the anchor nucleic acid is a hairpin nucleic acid comprising a 5’-end immobilized to the solid surface, at least one free 5’-end and at least one free 3’-end, wherein at step (c), the initiator nucleic acid hybridizes to the free 5’-end of the hairpin nucleic acid.
[0022] A further initiator nucleic acid may bind to the hairpin nucleic acid, through hybridization to a spacer nucleic acid hybridized to the free 3’-end of the hairpin nucleic acid.
[0023] At step (b) the initiator nucleic acid may be elongated via a template-free elongation reaction.
[0024] In particular, the initiator nucleic acid may be elongated via an enzyme-driven elongation reaction, preferably through the activity of a template-free polymerase such as a terminal deoxynucleotidyl transferase. In some embodiments, step (b) comprises repeating cycles of (i) contacting under elongation conditions the initiator or elongated fragments having a free 3'-0-hydroxyls with a 3'-O- blocked nucleoside triphosphate and a template-free polymerase, such as a terminal deoxynucleotidyl transferase (TdT) so that the initiator or elongated fragments are elongated by incorporation of a 3'-0-blocked nucleoside triphosphate to form 3'-0-blocked elongated fragments, and (ii) deblocking the elongated fragments to form elongated fragments having free 3'-hydroxyls, until the polynucleotide is synthesized. Any template-free polymerase can be used in the invention, in particular a TdT, more particularly a TdT variant described in WO2017 / 216472, WO2019 / 135007, W02020 / 099451 , WO2021 / 1 16270, WO2021 / 213903, WO2022 / 063835, WO2023083997, WO2020 / 239737 and WO2023 / 083999, the entire content and sequences of which is incorporated by reference.
[0025] In some embodiments, said initiator nucleic acid is elongated according to a predetermined sequence. Advantageously, the anchor nucleic acid remains immobilized to the solid surface throughout at least two cycles of steps (a) to (d).
[0026] The method may comprise a further step of amplifying the synthesized polynucleotide, thereby producing a plurality of amplified nucleic acids, preferably wherein any reactant incompatible with the amplification is removed before amplification. Advantageously, the method further comprises storing the synthesized polynucleotide and / or the amplified nucleic acids. In particular, the method comprises, after storage of the synthesized polynucleotide, a step of further extending the 3’-end of the synthesized polynucleotide, thereby synthesizing a further extended synthesized polynucleotide.
[0027] In some embodiments, the method comprises a quality control step, comprising controlling that a synthesized polynucleotide has been synthesized, and / or controlling the sequence of synthesized polynucleotide. Said quality control step may comprise hybridizing a nucleic acid probe to the synthesized polynucleotide, wherein said nucleic acid probe comprises a detectable moiety, and detecting the nucleic acid probe hybridized to the elongated polynucleotide.
[0028] Preferably, the method comprises removing the nucleic acid probe after the detection step.
[0029] In some embodiments, said nucleic acid probe comprises a sequence of consecutive nucleotides complementary to a sequence of consecutive nucleotides spanning the junction of the initiator nucleic acid and the synthesized polynucleotide, preferably comprising at least 10 nucleotides of the initiator nucleic acid and 10 nucleotides of the synthesized polynucleotide.
[0030] Said detectable moiety may be a label or a dye, preferably attached at the 3’-end of the nucleic acid probe.
[0031] In some embodiments, a plurality of different anchor nucleic acids are immobilized at a plurality of sites on the solid surface, wherein at step (a), the plurality of anchor nucleic acids is contacted with a plurality of different initiator nucleic acids, wherein each different initiator nucleic acid hybridizes to a single anchor nucleic acid of the plurality of different anchor nucleic acids through a specific hybridization sequence. Step (c) of the method advantageously comprises site-specifically disrupting the hybridization of the initiator nucleic acids to the anchor nucleic acids. In particular, step (c) comprises at least one of:
[0032] -site-specifically applying denaturing conditions to the solid surface, site-specifically displacing the hybridization of the initiator nucleic acid to the anchor nucleic acids, through the addition of one or more displacement nucleic acids specifically hybridizing to a part of the anchor nucleic acids; and site-specifically cleaving cleavable groups within a part of the initiator nucleic acids. In some embodiments, the solid surface is an electrochemical device. The electrochemical device may comprise at least one electrode arranged on the surface of the electrochemical device. Preferably, the anchor nucleic acid is immobilized at the surface of the electrode. In some embodiments, the electrode is an anode. In other embodiments, the electrode is a cathode. The electrochemical device advantageously comprises a plurality of electrodes, each electrode being independently addressable. In some embodiments, the electrochemical device comprises different types of electrodes selected from a cathode, an anode, a sensing electrode and a reference electrode.
[0033] The site of synthesis preferably comprises a plurality of electrodes grouped together in a non- concentric or concentric manner.
[0034] In some embodiments, the electrodes at least partly protrude from the surface of the electrochemical device and / or are at least partly recessed in the surface of the electrochemical device. The surface of the electrochemical device may comprise one or more well, wherein each well comprises one or more electrodes. The electrochemical device may comprise a plurality of groups of electrodes, wherein each group comprises a plurality of electrodes of the same type and each group is independently addressable. In some embodiments, the electrochemical device is a CMOS chip.
[0035] In some embodiments, the hybridization between the initiator nucleic acid and the anchor nucleic acid is disrupted by application of a pH change, wherein said pH change is generated electrochemically. Accordingly, in some embodiments, step (c) comprises applying denaturing conditions to disrupt the hybridization between the initiator nucleic acid and the anchor nucleic acid, wherein said denaturing conditions comprise the application of a pH change .wherein said pH change is generated at least one electrode of a group of electrodes by application of an electric potential or current at said electrode in the presence of one or more redox agent. Step (c) may be carried out in a phosphate-buffered solution or in an acetate-buffered solution.
[0036] In some embodiments, step (a) comprises the application of an electrical potential or current at at least one electrode of a group of electrodes to perform hybridization of the initiator nucleic acid and the anchor nucleic acid. Step (a) may be carried out in a phosphate-buffered solution or in an acetate- buffered solution.
[0037] Another aspect of the invention relates to a kit adapted for use in the method of the disclosure, comprising:
[0038] - an anchor nucleic acid and an initiator acid wherein said anchor nucleic acid and nucleic acids comprise complementary nucleotide sequences capable of being hybridized to one another, preferably wherein said complementary sequences are respectively located at the 5’-end of said first and second nucleic acids,
[0039] - at least one nucleic acid polymerase; and
[0040] - optionally one or more 3'-0-blocked nucleoside triphosphate. In some embodiments, said initiator nucleic acid comprises one or more cleavable group(s) such that cleavage of the cleavable group(s) breaks the initiator nucleic acid into two or more nucleic acid fragments;
[0041] In some embodiments, said kit comprises at least one displacement nucleic acid comprising a sequence of nucleotides complementary with the anchor nucleic acid, wherein the sequence complementarity between the displacement nucleic acid and the anchor nucleic acid is higher than the sequence complementarity between the initiator nucleic acid and the anchor nucleic acid; and / or
[0042] In some embodiments, said kit comprises at least one denaturing agent capable of disrupting the hybridization between the anchor nucleic acid and the initiator nucleic acid selected from a denaturing agent.
[0043] The nucleic acid polymerase is preferably a terminal deoxynucleotidyl transferase.
[0044] Another aspect of the invention relates to a method for storing information, comprising providing one or more items of information in the form of binary data, converting said binary data into one or more polynucleotide sequences, synthesizing polynucleotides having said polynucleotide sequences according to the method of synthesizing polynucleotides according to the invention, and storing said polynucleotides. In some embodiments, the method for storing information comprises a step of reading the stored information, comprising sequencing the stored polynucleotides and converting the generated sequences into one or more items of information in the form of binary data.
[0045] BRIEF DESCRIPTION OF THE DRAWINGS
[0046] Fig. 1 shows a schematic representation of steps of an embodiment of the method for synthesizing polynucleotides of the invention.
[0047] Fig. 2 shows another representation of steps of an embodiment of the method for synthesizing polynucleotides of the invention.
[0048] Fig. 3A to D illustrate several configurations of an anchor nucleic acid.
[0049] Fig. 4 illustrates an embodiment in which a synthesized polynucleotide is cleaved from a hybridized nucleic acid initiator.
[0050] Fig. 5 illustrates an embodiment in which a synthesized polynucleotide is reused for further extension.
[0051] Fig. 6 illustrates an embodiment in which removal of the initiator nucleic acid is assisted by cleavage.
[0052] Fig. 7 illustrates an embodiment in which removal of the initiator nucleic acid is carried out by competitive displacement.
[0053] Fig. 8 illustrates an embodiment in which a quality control step is carried out.
[0054] Fig. 9 illustrates an embodiment in which different initiators are hybridized on an array.
[0055] Fig. 10 illustrates an embodiment in which an initiator is hybridized site-specifically to an array. Fig. 11 illustrates an embodiment in which an extended initiator is removed site-specifically from an array.
[0056] Fig. 12 shows fluorescence scans (Amersham Typhoon, 550V) of reusable low-density chip (LDC) after initiator DNA (iDNA) loading and removal in 50 mM NaOH, for 10 cycles.
[0057] Fig. 13 shows fluorescence scans (Amersham Typhoon, 550V) of reusable low-density chip (LDC) after iDNA loading and removal in 5mM NaOH in 0.1 M Ac.
[0058] Fig.14 shows fluorescence scans (Amersham Typhoon, 550V) of reusable low-density chip (LDC) after iDNA loading and removal in 100% formamide.
[0059] Fig. 15 shows fluorescence scans (Amersham Typhoon, 550V) of reusable low-density chip (LDC) after iDNA loading and removal in 0.5M NaOH, and 50 cycles of synthesis.
[0060] Fig. 16 shows fluorescence scans (Amersham Typhoon, 550V) of reusable low-density chip (LDC) after iDNA loading and removal in 100% formamide, and 10 cycles of synthesis.
[0061] Fig. 17A shows a cyclic voltammogram of the solution of 17 mM chloroanilic acid, 0.1 M Ascorbic acid, 0.1 M Acetate in MQ water (pH = 10.4, 2.6% DMSO), starting with the reduction process. 2 electrodes configuration, E(V) vs. Pt, scan rate = 20 mV / s.
[0062] Fig. 17B shows a detailed reduction signature of chloroanilic acid. The range of currents needed to change the pH is represented by the full double arrow, and the corresponding voltages by the dotted arrow.
[0063] Fig. 18 shows an overlay of chronoamperometry profiles measured during iDNA removal: 17 mM Chloroanilic acid, 0.1 M Ascorbic acid, 0.1 M Acetate in MQ water (pH = 10.4, 2.6% DMSO). Stimulation duration t = 100 s: Pale blue = E1 (V) = -1.1 V vs. Pt; Medium Blue = E2(V) = -1.2 V vs. Pt; Dark blue = E3(V) = -1.3 V vs. Pt). Chronoamperogram for E3(V) = -1.3 V vs. Pt was stopped after 40 s due to water splitting.
[0064] Fig. 19 shows fluorescence images of LDC’s electrodes (from 0 to 3) after the first round of hybridization, electrochemical collection, chemical removal, and iDNA reloading (black = maximal fluorescence intensity, white = no fluorescence).
[0065] Fig. 20 is a Table showing the percentage of fluorescence intensity at the center of the WE of the different electrodes (0 to 3) after the first round of hybridization, electrochemical collection, chemical denaturation, and iDNA reloading. Percentage values were compared to the intensity of the first hybridization.
[0066] Fig. 21 shows fluorescence images of the different electrodes (from 0 to 3) after the first, second, third, and fourth hybridization and electrochemical collection (black = maximal fluorescence intensity, white = no fluorescence).
[0067] Fig. 22 is a Table showing the percentage of the fluorescence intensity at the center of the anode of the different electrodes (0 to 3) after the first, second, and third rounds of electrochemical collection. Fig. 23 shows the percentage of fluorescence intensities measured at the center of the WE of LDC electrodes (0 to 3) after the first, second, third, and fourth hybridization, as compared to the intensity of the first hybridization.
[0068] Fig. 24 shows the fluorescence scans of reusable LDC after iDNA loading and removal (black = maximal fluorescence intensity, white = no fluorescence).
[0069] Fig. 25 shows the percentage of the mean fluorescence intensity at the center of working electrodes after the first, second, third and fourth rounds of chemical denaturation. Percentage values were compared to the intensity of the first hybridization.
[0070] Fig. 26 shows fluorescence images of the different electrodes (from 0 to 1) after the first, second, and third hybridization and electrochemical collection (black = maximal fluorescence intensity, white = no fluorescence).
[0071] Fig. 27 shows the evolution of the pH as a function of time for the e-Removal solution: 20 mM Chloroanilic acid, 20 mM TMHQ, 10 mM phosphate in MQ water (pH initial = 11.0, 5% DMSO).
[0072] Fig. 28 shows cyclic voltammograms in 20 mM Chloroanilic acid, 20 mM TMHQ, 10 mM phosphate in MQ water (pH = 11 .0, 5% DMSO), at different aging time, starting with the reduction process. 2 electrodes configuration, E(V) vs. Pt.
[0073] Fig. 29 shows the percentage of fluorescence intensities at the center of the WE of the different electrodes (0 to 2) after the first hybridization, followed by two electrochemical collections with the same solution at t = 0 or 5h after its pH was set to 11 , and iDNA reloading (black = maximal fluorescence intensity, white = no fluorescence). During the first electrochemical collection, only the electrode 1 was stimulated at -1 ,8V vs Pt. During the second one, only the electrode 2 was stimulated at -1 ,8V vs Pt. Percentage values were compared to the intensity of the first hybridization.
[0074] Fig. 30 shows a table of the DNA samples collected through initiator removal using different potentials, and a control condition using control template diluted in the removal solution.
[0075] Fig. 31 shows the Qubit and NGS results of samples 1.-4 after their library preparation.
[0076] Fig. 32 illustrates the concepts of electrochemical synthesis and electrochemical removal, a) Concept of electrochemical synthesis: Left = Illustrations of the impact of pH diffusion gradient generated during the deprotection step of electrochemical synthesis on DNA strands. Right = picture taken during pH modulation experiment, b) Concept of electrochemical Removal: Left = Illustration of the removal mechanism, which consists in targeting the area inside the working electrode (small rings, as opposed to the counter electrode, large rings) when performing electrochemical collection of DNA template after synthesis, to discard incomplete DNA strands from Library prep. Right = Fluorescence picture taken after removal.
[0077] Fig. 33 shows an overlay of coulometry showing the charge collected (current vs time) while applying different potentials at the working electrode (WE) (from E (V) = -1 ,6V to -2.1V vs. Pt, purple with an increasing intensity, E (V) = -2.2V vs. Pt in blue). The stimulation ended either when the charge collected reached Q (C) = 1 mC, or after t = 600 s. Fig. 34 shows fluorescence images of LDC’s electrodes after electrochemical collections at different potentials, for a fixed charge collected (current vs time) of Q (C) = 1 mC (except at -1 ,6V vs. Pt) (black = maximal fluorescence intensity, white = no fluorescence).
[0078] Fig. 35 shows the percentage of fluorescence intensity at the center of the working electrode (WE) of the different electrodes (0 to 3) after the first and second round of hybridization, electrochemical collection at different potentials with a fixed charge collected, chemical removal, and iDNA reloading. Intensity values were compared to the intensity of the first hybridization. For the 3rdhybridization of 3, an inhomogeneity of fluorescence at this electrode was evidenced.
[0079] Fig. 36 shows Fluorescence scans (Amersham, Typhoon, 550V) of successive e-Adsorption experiments performed on the same LDC while using different formulations (first with acetate, then with phosphate and KCI).
[0080] DETAILED DESCRIPTION OF THE INVENTION
[0081] While the invention is amenable to various modifications and alternative forms, specifics thereof have been shown by way of example in the drawings and will be described in detail. It should be understood, however, that the intention is not to limit the invention to the particular embodiments described. The intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the invention.
[0082] Definitions
[0083] In order that the present disclosure be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description.
[0084] As used herein the terms “nucleic acid”, “polynucleotide”, “oligonucleotide” refers to naturally- occurring or synthetic polymeric forms of nucleotides. The oligonucleotides and nucleic acid molecules of the present invention may be formed from naturally occurring nucleotides, for example forming deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) molecules. Alternatively, the naturally occurring oligonucleotides may include structural modifications to alter their properties, such as in peptide nucleic acids (PNA) or in locked nucleic acids (LNA). The solid phase synthesis of oligonucleotides and nucleic acid molecules with naturally occurring or artificial bases is well known in the art. The terms should be understood to include equivalents, analogs of either RNA or DNA made from nucleotide analogs and as applicable to the embodiment being described, single-stranded or double-stranded polynucleotides. Nucleotides useful in the invention include, for example, naturally-occurring nucleotides (for example, ribonucleotides or deoxyribonucleotides), or natural or synthetic modifications of nucleotides, or artificial bases. Any of the nucleic acids disclosed herein may be, in particular embodiments, oligonucleotides.
[0085] In some embodiments, the methods provided herein use nucleic acids that are immobilized on a surface or substrate (e.g., support-bound oligonucleotides). As used herein the term “support”, “surface” and “substrate” are used interchangeably and refers to a porous or non-porous solvent insoluble material on which polymers such as nucleic acids are synthesized or immobilized. As used herein “porous” means that the material contains pores having substantially uniform diameters (for example in the nm range). Porous materials include paper, synthetic filters etc. In such porous materials, the reaction may take place within the pores. The support can have any one of a number of shapes, such as pin, strip, plate, disk, rod, bends, cylindrical structure, particle, including bead, nanoparticles and the like. The support can have variable widths. The support can be hydrophilic or capable of being rendered hydrophilic and includes inorganic powders such as silica, magnesium sulfate, and alumina; natural polymeric materials, particularly cellulosic materials and materials derived from cellulose, such as fiber containing papers, e.g., filter paper, chromatographic paper, etc.; synthetic or modified naturally occurring polymers, such as nitrocellulose, cellulose acetate, poly (vinyl chloride), polyacrylamide, cross linked dextran, agarose, polyacrylate, polyethylene, polypropylene, poly (4-methylbutene), polystyrene, polymethacrylate, polyethylene terephthalate), nylon, poly(vinyl butyrate), polyvinylidene difluoride (PVDF) membrane, glass, controlled pore glass, magnetic controlled pore glass, ceramics, metals, and the like etc.; either used by themselves or in conjunction with other materials. Preferred solid surfaces in the methods of the invention are microelectrode arrays, in particular chips such as complementary metal-oxide-semiconductor (CMOS) chips.
[0086] As used herein, an “initiator nucleic acid” (or equivalent terms, such as “initiator”, “initiator oligonucleotide”, or the like) usually refers to a short oligonucleotide sequence with a free 3’-end, which can be further elongated, for instance by a template-free polymerase such as TdT. In one embodiment, the initiator nucleic acid is a DNA initiator. In an alternative embodiment, the initiator nucleic acid is an RNA initiator. In some embodiments, an initiator nucleic acid possesses between 3 and 100 nucleotides, in particular between 3 and 20 nucleotides. In some embodiments, the initiator nucleic acid is single- stranded. In alternative embodiments, the initiating fragment is doublestranded. In some embodiments, an initiator may comprise a non-nucleic acid compound having a free hydroxyl to which a TdT may couple a 3’-0-protected dNTP, e.g. Baiga, U.S. patent publications US2019 / 0078065 and US2019 / 0078126.
[0087] As used herein, an “extended initiator” refers to an initiator nucleic acid to which an elongation reaction, also referred to as synthesis reaction, has been carried out. An “extended initiator” is thus also referred to as a nucleic acid initiator bound to a synthesized polynucleotide, or an initiator carrying a synthesized polynucleotide. Except specified otherwise, the terms “removing the initiator nucleic acid” or the like, include the removal of the initiator nucleic acid in an extended form, i.e. bound to the synthesized polynucleotide. Similarly, the terms “removing the synthesized polynucleotide” or the like, include the removal of the synthesized polynucleotide in a bound form, i.e bound to the nucleic acid initiator.
[0088] As used herein, the term "hybridize" or "specifically hybridize" refers to a process where two complementary nucleic acid strands anneal to each other under appropriately stringent conditions. Nucleic acid hybridization techniques are well known in the art. See, e.g., Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y.(1989); Ausubel, F.M. et al., Current Protocols in Molecular Biology, John Wiley & Sons, Secaucus, N.J. (1994).
[0089] As used herein, the term "complementarity" refers to standard Watson / Crick base pairing rules. In the invention, an antisense nucleic acid molecule and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense nucleic acid can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g. attachment of the antisense nucleic acid molecule to the target nucleic acid).
[0090] Complementarity may be partial in which only some of the nucleotide bases of two nucleic acid strands are matched according to the base pairing rules. Stable duplexes may contain mismatched base pairs, degenerative, or unmatched nucleotides. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the antisense molecule, base composition and sequence of the antisense molecule, incidence of mismatched base pairs, ionic strength, other hybridization buffer components and conditions.
[0091] Percent complementarity of an antisense nucleic acid compound with a region of a target nucleic acid can be determined by alignment. For example, an antisense compound in which 18 out of 20 nucleotides are complementary to a target sequence, i.e. with two mismatches between its sequence and the target sequence, would represent 90% complementarity. Percent complementarity of an antisense compound with a region of a target nucleic acid can also be determined using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin) pileup program, or any of sequence comparison algorithms such as BLAST, FASTA or CLUSTALW.
[0092] Also as used herein, the term “denaturation” means the process of separating double-stranded nucleic acids to generate single-stranded nucleic acids. This process is also referred to as 'melting'. The denaturation of double-stranded nucleic acids can be achieved by various methods.
[0093] As used herein, “binary data” or “digital data” refers to data encoded using the standard binary code, or a base 2 {0,1} alphabet, data encoded using a hexadecimal base 16 alphabet, data encoded using the base 10 {0-9} alphabet, data encoded using ASCII characters, or data encoded using any other discrete alphabet of symbols or characters in a linear encoding fashion.
[0094] The present inventors have developed new methods for synthesizing polynucleotides, which allow to use an immobilization support for several repeated cycles of synthesis. In the method, initiator nucleic acids can be loaded, extracted and erased from the solid surface, e.g. encapsulated chips (CMOS and LDCs). The reusability of the chips drastically decreases the cost of synthesis on CMOS. It also considerably increases the synthesis workflow since cleaning and reloading a chip takes less than 2h vs. 4 days to prepare a new chip. By making possible to reuse a chip, the method also provides important waste reductions in the oligonucleotide process. Generally, methods of polynucleotide synthesis comprise repeated cycles of steps (a) to (c), or (a) to (d), wherein step (a) is a step of hybridization of an anchor nucleic acid and an initiator nucleic acid, step (b) is a step of elongation of the initiator nucleic acid, step (c) is a step of removal or dehybridization of the extended initiator nucleic acid from the anchor nucleic acid and step (d) is a step of recovery or collection of the polynucleotide synthesized during the elongation step. The method can also comprise additional steps, between any of steps (a) to (d), or before or after steps (a) to (d). As illustrated in Fig. 1 and as well in the configuration shown in Fig. 3A, an anchor nucleic acid 101 is attached by its 3’-end to a solid surface 100. The anchor nucleic acid 101 may be a single strand polynucleotide. The anchor nucleic acid 101 is preferably attached to an electrode 104 on the solid surface 100. The anchor nucleic acid 101 is contacted with an initiator nucleic acid 102, typically a single strand oligonucleotide. The initiator nucleic acid 102 and anchor nucleic acid 101 comprise complementary sequences of nucleotides at their 5’-ends, allowing them to hybridize under appropriate stringency conditions. As shown in Fig. 1 , the end of the initiator nucleic acid 102 which is proximal to the solid surface 100, is hybridized to the anchor nucleic acid 101. Through this hybridization, the initiator nucleic acid 102 is indirectly immobilized to the solid surface 100 in a releasable manner. The other end of the initiator nucleic acid 102, which is distal to the solid surface 100, typically comprises a free 3’-OH which is available for an elongation reaction by which one or several further nucleotides can be linked. Said free 3’-OH end is preferably not hybridized to the anchor nucleic acid. In some embodiments, the 3’-end of the initiator nucleic acid 102, is initially protected by a labile group, e.g. a chemically-cleavable or photocleavable group, which can be removed under appropriate conditions, to release a free 3’-OH end available for further elongation by a polymerase.
[0095] Hybridization buffers to carry out specific hybridization of nucleic acid oligonucleotides are known from the skilled person. An exemplary hybridization buffer comprises 5xSSC, 0.1 % Tween 20.
[0096] In certain embodiments, hybridization of the initiator nucleic acid is performed electrochemically, e.g. by application of an electric stimulus. In some embodiments, step (a) comprises the application of an electrical potential or current at at least one electrode of a group of electrodes to perform hybridization of the initiator nucleic acid (102) and the anchor nucleic acid (101).
[0097] Controlled changes in electrical potential and / or intensity of one or more electrodes in a group of electrodes, such as an electrode array can be used to perform hybridization of the initiator nucleic acid in a spatially-resolved way. In particular, the solid surface may be an electrochemical device comprising a plurality of groups of electrodes, wherein each group comprises a plurality of electrodes of the same type and each group is independently addressable. More particularly, the electrochemical device may be a CMOS chip.
[0098] In some embodiments, the applied electric potential change is of at least 0.1 V, 0.2 V, 0.3 V, 0.4 V, 0.5 V, 0.6 V, 0.7 V, 0.8 V, 0.9 V, 1 V, 1 .25 V or 1 .5 V vs a reference electrode such as a Pt reference electrode. In some embodiments, the hybridization is carried out in a phosphate-buffered solution. In some embodiments, the phosphate-buffered solution comprises from 1 mM to 500 mM phosphate, in particular from 2 mM to 200 mM phosphate, more particularly from 5 mM to 100 mM phosphate. In some embodiments, the hybridization is carried out in an acetate-buffered solution. In some embodiments, the acetate-buffered solution comprises from 50 mM to 2M acetate, in particular from 100 mM to 1 M acetate, more particularly from 200 mM to 800 mM acetate.
[0099] In a further step of the method, the initiator nucleic acid 102 is elongated at its 3’-end. Elongation occurs by addition of a sequence of nucleotides at the free 3’-OH end of the initiator nucleic acid 102. The term “elongation”, as used herein includes any process of “nucleic acid synthesis”, e.g. “DNA synthesis” or “RNA synthesis”. Elongation of the initiator nucleic acid may be carried out by template- free enzymatic elongation or by any of other synthesis method well known by the skilled person. Elongation generally involves several cycles of elongation steps, wherein at each cycle, a nucleotide or nucleotide analogues is added at the free end of the initiator nucleic acid 102. In some embodiments, the synthesized polynucleotide has lengths in the range of from 10 to 500 nucleotides, in particular of from 50 to 500 nucleotides. In other embodiments, such polynucleotides have lengths in the range of from 50 to 1000 nucleotides or higher. The synthesized polynucleotide is preferably synthesized as a non-hybridized single strand nucleic acid. In particular, the synthesized polynucleotide is preferably not hybridized to a template nucleic acid and / or to the anchor nucleic acid. The addition of nucleotides generally follows a predetermined order such as to produce a synthesized polynucleotide 103, according to a predetermined sequence. As a result of the elongation step, the initiator nucleic acid 102 has become an extended initiator, that is an elongated polynucleotide comprising, at its 5’-end, the initiator nucleic acid 102 bound, at its 3’-end to a synthesized polynucleotide 103. The synthesized polynucleotide 103 may consist in a DNA molecule, a RNA molecule or a mixed DNA / RNA molecule. Depending on the nucleotide reagents which are provided during the elongation reaction and the elongation methods, the synthesized polynucleotide 103 may incorporate different types of nucleotides, e.g. naturally-occurring nucleotides or modified nucleotide analogues. The synthesized polynucleotide 103 may be functionalized by incorporation of specific functional sequences and / or functional chemical groups. The synthesized polynucleotide 103 may for instance comprise one or more of a primer site, an index, a unique identifier, a barcode, encoded data. Barcodes are typically known nucleic acid sequences that allow some feature of a polynucleotide with which the barcode is associated to be identified. An index is a sequence comprising a primer site and a sequencing adapter. The sequencing adapter can comprise a P5 sequencing adapter or P7 sequencing adapter, that allow the polynucleotide to bind to the surface of a flow cell during next-generation sequencing (NGS) analysis (see e.g. Meyer, M., & Kircher, M. (2010). Illumina sequencing library preparation for highly multiplexed target capture and sequencing. Cold Spring Harbor Protocols, 2010{Q)).
[0100] In a further step of the method, the initiator nucleic acid 102 is removed from the anchor nucleic acid101. This step of removal is typically carried out by disruption of the duplex formed between the complementary regions of the initiator nucleic acid 102 and the anchor nucleic acid 101. Such disruption may be brought about by the application of melting or denaturing conditions to the nucleic acid duplex, e.g. by application of heat, chemical agent or pH changes. As shown in Fig. 1 , when the initiator nucleic acid 102 is removed from the anchor nucleic acid 101 , it may be in an elongated form, i.e. bound to the synthesized polynucleotide 103. In other embodiments, as illustrated in Fig. 4, the synthesized polynucleotide 103 is cleaved from the initiator nucleic acid 102 before the removal of the initiator nucleic acid 102 from the anchor nucleic acid 101. To this end, the initiator nucleic acid may comprise, a cleavable nucleotide in its sequence, for instance at its 3’-end. Alternatively, a cleavable nucleotide 113 may be added to the synthesized strand during elongation of the initiator nucleic acid, e.g. in first position (i.e., 5’) of the synthesized polynucleotide. The cleavable nucleotide 113 may comprise a cleavable group selected from a photocleavable group, a chemically cleavable group, an enzymatically cleavable group, and their combinations. Enzymatically cleavable groups may be selected from the group consisting in a deoxyuridine (dU), a deoxyinosine (dl), an inosine, a uracil, a nitroindole, a hypoxanthine, a thymidine glycol, a 5-hydroxyuracil, 5,6-dihydrouracil, a 5-hydroxycytosine and at least one of their combinations. Other cleavable groups are described in this disclosure and can be used in this embodiment. After cleavage of the synthesized polynucleotide, the hybridized initiator can be used for a further elongation cycle, thereby synthesizing a further polynucleotide strand 114 which may comprise a cleavable nucleotide 113, e.g. incorporated in first position.
[0101] Returning to Fig. 1 , the removal of the extended initiator nucleic acid 102, 103 may be followed by an amplification step to clonally increase the copy number of the synthesized polynucleotide 103, bound or not to the initiator nucleic acid 102. Nucleic acid amplification methods, such as PCR are well known from the skilled person and involve the addition of suitable reagents such as primers, nucleotides and a suitable polymerase and the application of appropriate reaction conditions. To this effect, the extended initiator may comprise primer sites for the binding of PCR primers. The primer sites may be located within the synthesized portion of the extended initiator 102, 103 (i.e. within the synthesized polynucleotide 103) and / or within the initiator nucleic acid 102 region. Amplification may be carried out in the same reaction chamber in which the sequence of steps (a) to (c) is carried out. In one embodiment, amplification is carried out between steps (c) and (d).
[0102] In some embodiments, the extended initiator 102, 103 and / or the synthesized polynucleotide 103 is collected from the reaction chamber, e.g. by washing or by capture of the synthesized polynucleotide, for instance through an affinity tag. The collection of the synthesized polynucleotide 103 may be performed after an amplification step.
[0103] After removal and, optionally, collection of the extended initiator 102, 103 or of the synthesized polynucleotide 103, a further cycle of steps (a) to (c) or (a) to (d) can be repeated on the solid surface. Cycles of steps (a) to (c) or (a) to (d) are repeated at least one time, i.e. two cycles are performed consecutively on the same solid surface. Advantageously, cycles are repeated more than one time, e.g. at least two times, preferably at least three times on the same solid surface.
[0104] In some embodiments, the synthesized polynucleotide 103 or the extended initiator 102, 103 carrying the synthesized polynucleotide 103 is stored. Storage may be carried out, for instance, after amplification of the synthesized polynucleotide 103. Such storage is particularly useful where the polynucleotide, e.g. DNA is used as a support for data storage. In appropriate conditions of storage, DNA can be stored for decades or centuries. The stored DNA can then be retrieved and read, e.g. by massively parallel sequencing methods.
[0105] In some embodiments, the extended initiator 102, 103 carrying the synthesized polynucleotide 103 can be retrieved after storage and reapplied to a solid surface 100 of synthesis for a further cycle of synthesis, as illustrated in Fig. 5, leading to the synthesis of a further synthesized polynucleotide 115. Such method of synthesis “on top” provides a high level of flexibility for storing data information as it enables iterative writing and data storage.
[0106] Each step of the method is generally carried out by incubation of the solid surface bound with the nucleic acids, with appropriate solutions, reagents and buffers. The above method may also include washing steps between or within any of the above steps to wash or remove the solutions and reagents required to carry out each step. In particular, washing steps can be carried out after the hybridization step, after the elongation step and / or after the removal step. It is for instance preferred to wash the reaction chamber before amplification, in order to remove any reagent detrimental to an amplification reaction, such as PCR.
[0107] An illustration of a sequence of steps according to the invention is also shown in Figure 2, with specific sequences shown for the anchor nucleic acid, initiator nucleic acid and synthesized polynucleotide. As illustrated, an exemplary sequence for the duplex is GCGCACTGTA:CGCGTGACATT, with a Tm of 47°C. In one embodiment, the duplex formed by the anchor nucleic acid and the initiator nucleic acid has a Tm of at least 35°C, preferably at least 40°C, still preferably at least 42 °C, more preferably at least 45°C. In some embodiments, the duplex formed by the anchor nucleic acid and the initiator nucleic acid has a Tm of at least 50°C or at least 55°C or at least 60°C.
[0108] The efficiency of the method can be assessed, e.g., by the level of hybridized initiator nucleic acid at step (a) of a subsequent cycle of steps (a) to (c) or (a) to (d), in comparison with the level of hybridized initiator nucleic acid at step (a) of the immediately preceding cycle of steps (a) to (c) or (a) to (d). The assessment is made in comparable conditions, in particular with an initiator nucleic acid having the same sequence at each cycle. In some embodiments, the level of hybridized initiator nucleic acid at step (a) of a subsequent cycle is at least 60%, preferably at least 70%, more preferably at least 80%, still preferably at least 85%, even more preferably at least 90%, most preferably 95%, 98% or 99% of the level of hybridized initiator nucleic acid at step (a) of the immediately preceding cycle. In other terms, there is a loss of hybridization of 40% or less, preferably 30% or less, more preferably 20% or less, still preferably 15% or less, even more preferably 10% or less, from a cycle to the next cycle. The level of hybridized initiator nucleic acid can be assessed by various ways, e.g. by measuring fluorescence of a dye linked to the initiator nucleic acid.
[0109] Anchor nucleic acid
[0110] As used herein, an “anchor” or “anchor nucleic acid” generally refers to a nucleic acid molecule which is used as an immobilization intermediate between the solid surface and the initiator nucleic acid. Typically, an anchor nucleic comprises a first end which can be immobilized to the solid surface and a second end which can be hybridized to the initiator nucleic acid.
[0111] The anchor nucleic acid is preferably a single-stranded oligonucleotide. In some embodiments, the anchor nucleic acid comprises from 10 to 100 nucleotides, preferably from 20 to 100 nucleotides. The anchor nucleic acid may be attached to the solid surface by its 3’- or 5’-end. In preferred embodiments illustrated in Fig. 3A, the anchor nucleic acid is immobilized to the solid surface by its 3’-end, which typically means that its 5’-end, which is distal to the solid surface, is adapted to hybridize the nucleic acid initiator.
[0112] In some embodiment, the anchor nucleic acid is partially or fully double-stranded. When the anchor nucleic acid is partially double-stranded it may comprise a central double-stranded region and a 5’- and / or 3’-overhang. The 3’-overhang is preferably capable of being attached to the solid surface, whilst the 5’-overhang is preferably capable of being hybridized to the initiator nucleic acid.
[0113] The anchor nucleic acid may have alternative configurations, so long as such configurations maintain its capability to be attached to the solid surface and, at the same time, to hybridize the initiator nucleic acid. As illustrated in Fig. 3C and 3D, the anchor nucleic acid may be a hairpin nucleic acid. In some embodiments, the hairpin anchor nucleic acid is immobilized to the support by a stem-loop structure. In some embodiments, the immobilized hairpin anchor nucleic acid comprises a free 3’-end and a free 5’-end. The initiator nucleic acid preferably hybridizes to the free 5’-end of the hairpin nucleic acid. In some embodiments, a further initiator nucleic acid 102’ binds to the hairpin nucleic acid, through hybridization to a spacer nucleic acid 126 hybridized to the free 3’-end of the hairpin nucleic acid.
[0114] In such hairpin configuration, two nucleic acid initiators with the same sequence or different sequences can be hybridized to a single anchor, and therefore to a single attachment site on the solid surface, thus increasing the synthesis capability of the support.
[0115] The method of attachment of the anchor nucleic acid to the solid surface is advantageously selected such that the anchor nucleic acid remains immobilized to the solid surface throughout at least two cycles of steps (a) to (d). The attachment, in particular, is selected to resist to the denaturation conditions applied in step (c) of the method, to disrupt the hybridization between the anchor nucleic acid and the initiator nucleic acid.
[0116] In some embodiments, the anchor nucleic acid is covalently attached to the solid surface. Methods for covalently attaching nucleic acids to a solid surface are well known to the skilled person and are described in the art. Exemplary methods rely on the use of chemically-functionalized surfaces which can attach a chemical linker at one end of the anchor nucleic acid. The surface may be chemically- functionalized, e.g. with polyacrylamide hydrogels, such as silane-free acrylamide (SFA). Polyacrylamide functionalization of solid surfaces, e.g. glass surfaces, is described in W02005 / 065814, hereby incorporated by reference in its entirety. The linker may be selected from thiophosphate or thiols linkers, amino-containing linkers and silane linkers. For instance, silanetriolate anchoring can be used for attachment to a metal oxide support surface (Fournier, M., Hoogeveen, D. A., Bonke, S. A., Spiccia, L., & Simonov, A. N. (2018). Cooperative silanetriolate- carboxylate sensitiser anchoring for outstanding stability and improved performance of dye- sensitised photoelectrodes. Sustainable Energy & Fuels, 2(8), 1707-1718.). Acetate, hydroxamate or phosphate linkers can also be grafted at the surface of metal oxide semi-conductors, to attach molecules at said surface. In specific embodiments, a 3’-thiophosphate linker is used.
[0117] In other embodiments, the anchor nucleic acid is attached to the solid surface in a non-covalent manner. For instance, as illustrated in Fig. 3B the anchor nucleic acid 101 may be indirectly attached to the solid surface 100 by hybridization to an intermediate nucleic acid, which is itself attached to the solid surface 100. Through this configuration, it is possible to use chips loaded with 5’-immobilized oligonucleotides. Anchor nucleic acids can then be hybridized to the 5’-immobilized oligonucleotides such that the anchor nucleic acid has a free 5’-end available to hybridize the nucleic acid initiator. This configuration makes also possible to use different anchor nucleic acids site-specifically hybridized to a common intermediate nucleic acid immobilized on the solid surface.
[0118] Elongation
[0119] At step (b) of the method, the nucleic acid initiator may be elongated, preferably according to a predetermined sequence.
[0120] Elongation may be carried out by a variety of nucleic acid synthesis methods which are well known of the skilled person and include, for instance chemical synthesis, template-directed elongation or template-free synthesis.
[0121] Elongation is generally carried out in conditions which maintain hybridization between the initiator nucleic acid and the anchor nucleic acid, typically in non-denaturing conditions. Preferably, elongation is carried out in mild conditions, e.g. in the absence of organic solvent. In preferred embodiments, elongation is carried out in aqueous conditions. In some embodiments, elongation is carried out at a pH comprised between 4.0 and 10, preferably between 4.5 and 9.5. Advantageously, elongation is performed by template-free synthesis, preferably carried out via an enzyme-driven elongation reaction. A preferred polymerase for the enzyme-driven elongation reaction is a terminal deoxynucleotidyl transferase (TdT).
[0122] Generally, methods of template-free enzymatic DNA synthesis comprise repeated cycles of (i) contacting under elongation conditions the initiator or elongated fragments having a free 3'-O- hydroxyls with a 3'-G-blocked nucleoside triphosphate and a terminal deoxynucleotidyl transferase (TdT) so that the initiator or elongated fragments are elongated by incorporation of a 3'-G-blocked nucleoside triphosphate to form 3'-G-blocked elongated fragments, and (ii) deblocking the elongated fragments to form elongated fragments having free 3'-hydroxyls, until the polynucleotide is synthesized. The general elements of template-free enzymatic synthesis is described in the following references: Ybert et al, International patent publication WO / 2015 / 159023; Ybert et al, International patent publication WO / 2017 / 216472; Hyman, U.S. patent 5436143; Hiatt et al, U.S. patent 5763594; Jensen et al, Biochemistry, 57: 1821-1832 (2018); Mathews et al, Organic & Biomolecular Chemistry, 14(35), 8278-8288 (2016); Schmitz et al, Organic Lett., 1 (11): 1729-1731 (1999).
[0123] Template-free enzymatic DNA synthesis is carried out by repeated cycles of nucleotide addition to the nucleic acid initiator. At each cycle, a 3’-0-protected-dNTP and a template-free polymerase, such as a TdT or variant thereof (e.g. Ybert et al, WO / 2017 / 216472), are added to the initiator (or elongated initiator) under conditions effective for the enzymatic incorporation of the 3’-0-protected- dNTP onto the 3’ end of the initiator (or elongated initiator). This reaction produces elongated initiator nucleic acids whose 3’-hydroxyls are protected. If the elongated initiator polynucleotide contains a competed sequence, then the 3’-O- protection group may be removed, or deprotected, and the desired sequence may be cleaved from the original initiator polynucleotide. Such cleavage may be carried out using any of a variety of single strand cleavage techniques, for example, by inserting a cleavable nucleotide at a predetermined location within the original initiator polynucleotide. An exemplary cleavable nucleotide may be a uracil nucleotide which is cleaved by uracil DNA glycosylase. If the elongated initiator polynucleotide does not contain a completed sequence, then the 3’-O- protection groups are removed to expose free 3’-hydroxyls and the elongated initiator polynucleotides are subjected to another cycle of nucleotide addition and deprotection. In accordance with on aspect of the invention, 3’-O- protection groups are electrochemically labile groups. That is, deprotection or cleavage of the protection group is accomplished by changing the electrochemical conditions in the vicinity of the protection group which result in cleavage. Such changes in electrochemical conditions may be brought about by changing or applying a physical quantity, such as a voltage difference or light to activate auxiliary species which, in turn, cause changes in the electrochemical conditions at the site of the protection group, such as an increase or decrease in pH.
[0124] The 3’-0-blocked dNTPs employed in the invention may be purchased from commercial vendors or synthesized using published techniques, e.g. U.S. patent 7057026; Guo et al, Proc. Natl. Acad. Sci., 105(27): 9145-9150 (2008); Benner, U.S. patent 7544794.
[0125] In addition to providing 3’-G-blocked dNTP monomers with base protection groups, elongation reactions may be performed at higher temperatures using thermal stable template-independent polymerases (also called template-free polymerases). For example, a thermal stable templateindependent polymerase having activity above 40°C may be employed; or, in some embodiments, a thermal stable template-independent polymerase having activity in the range of from 40-85°C may be employed; or, in some embodiments, a thermal stable template-independent polymerase having activity in the range of from 40-65°C may be employed.
[0126] Enzymatic nucleic acid synthesis enables to synthesize longer and purer DNA fragments, fasterthan chemistry. The cycle time factor is particularly interesting for data storage as it enables to increase the throughput 15 to 20-fold. Performing the synthesis in aqueous media also makes it greener (no organic solvants used during synthesis), simplifies instrumentation (no need to control the environment) and eliminates the need for chemical waste management facilities. Elongation may comprise repeated cycles of extension and deblocking. In particular, elongation may comprise repeated cycles of (i) contacting under elongation conditions the initiator or elongated fragments having a free 3'-0-hydroxyls with a 3'-0-blocked nucleoside triphosphate and a terminal deoxynucleotidyl transferase (TdT) so that the initiator or elongated fragments are elongated by incorporation of a 3'-0-blocked nucleoside triphosphate to form 3'-0-blocked elongated fragments, and (ii) deblocking the elongated fragments.
[0127] In some embodiments, reaction conditions for an elongation step (also sometimes referred to as an extension step or a coupling step) may comprise the following: 25 |j.M purified TdT; 125-600 |j.M 3’- O-blocked dNTP (e.g. 3’-0-NH2-blocked dNTP); about 10 to about 500 mM potassium cacodylate buffer (pH between 6.5 and 7.5) and from about 0.01 to about 10 mM of a divalent cation (e.g. C0CI2 or MnCb), where the elongation reaction may be carried out in a 50 ptL reaction volume, at a temperature within the range of from room temperature to 45°C, for a duration of, e.g., 3 minutes.
[0128] In embodiments, in which the 3’-0-blocked dNTPs are 3’-0-NH2-blocked dNTPs, reaction conditions for a deblocking step may comprise the following: 700 mM NaNC>2; 1 M sodium acetate (adjusted with acetic acid to pH in the range of 4.8-6.5), where the deblocking reaction may be carried out in a 50 .L volume, at a temperature within the range of from room temperature to 45°C for a duration of about 30 seconds to several minutes. Washes may be performed with the cacodylate buffer without the components of the coupling reaction (e.g. enzyme, monomer, divalent cations).
[0129] 3’-0-amino blocking groups may also be deblocked by application of a phosphonate compound, in particular a carbonylbisphosphonate compound as described in International patent application PCT / EP2024 / 062042.
[0130] Removal of the initiator nucleic acid
[0131] Step (c) of the method comprises applying denaturing condition to disrupt the hybridization between the initiator nucleic acid 102 and the anchor nucleic acid 101. Said denaturing conditions may comprise the application of at least one denaturing agent, of a pH change and / or heat.
[0132] Chemical denaturing agents lower the melting temperature (Tm) of the nucleic acid duplex by competing for hydrogen bond donors and acceptors with pre-existing nitrogenous base pairs.
[0133] In some embodiments, the denaturing agent is selected from the group consisting of formamide, an alkyl-substituted amide, urea or a urea-based denaturant, thiourea, guanidine, sodium salicylate, dimethyl sulfoxide (DMSO), propylene glycol and their mixtures. In some embodiments, the denaturing agent is an intercalating agent
[0134] In some embodiments, a pH change is applied to denature the nucleic acid duplex. Said pH change is preferably an alkaline pH change, which may be brought about by application of an alkaline agent. Alkaline agents denature nucleic acid duplexes by increasing the pH of the solution. Alkaline solutions are characterized by an abundance of hydroxide ions which adversely affect the stability of the double helix by removing ions from the base pairs of the nucleic acid duplex. This breaking of the hydrogen bonds between two oligonucleotides denatures the structure of the double-helix, separating the nucleic acid duplex into its component strands. The alkaline agent and its concentration may be selected to reach a pH of at least 10, preferably at least 10.5, still preferably at least 11 , more preferably at least 11 .5, still preferably at least 12. In particular, the pH may be from 10 to 13.5, preferably from 11 to 13.5, more preferably from 1 1 .5 to 13.5, still preferably from 12 to 13. Appropriate alkaline conditions for denaturation can be adjusted by the skilled person depending, more specifically, on the melting temperature of the nucleic acid duplex formed by hybridization of the initiator nucleic acid and anchor nucleic acid.
[0135] In some embodiments, the alkaline agent is a strong base, particularly a strong base selected from the group consisting of KOH, NaOH, NH4OH and Ca(OH)2.
[0136] NaOH is a preferred alkaline agent. It is preferably applied at a concentration of 1 mM or higher, e.g. 1 mM to 1 M, still preferably of 5mM or higher, e.g. 5mM to 1 M. It is particularly preferred to apply NaOH at a concentration of from 1 mM to 50mM, still preferably of from 50mM to 1 M.
[0137] In some embodiment, a pH change is generated at an electrode, via the application of an electric potential or current at said electrode in the presence of one or more redox agent. Preferably, the pH change is an alkaline pH change generated by producing hydroxide ions at said electrode. Said production of hydroxide ions generally results a redox reaction involving one or more redox agents, triggered by the application of an electric potential or current at said electrode. In some embodiments, the applied electric potential change is of at least -0.5V, -1 V, -1.1 V, -1.2V, - 1.3V, -1.4V, -1.5V, - 1 ,6V, -1 ,7V, -1 ,8V, -1 ,9V, -2.0V, -2.1V, -2.3V, -2.4V or -2.5V vs a reference electrode such as a Pt reference electrode. The applied electric potential change may depend on the reaction conditions and the redox agent used in the buffer.
[0138] The solution for removing the initiator nucleic acid may thus comprise one or more redox agents.
[0139] In some embodiments, said redox agent is an oxidized agent. In some embodiments, said redox agent is a reduced agent.
[0140] Exemplary redox agents useful for the invention are benzoquinones or substituted benzoquinones.
[0141] In particular, said redox agent is a compound of Formula I: with R1, R2, R3 and R4 being, independently of one another, selected from -H, -SChNa; -SO3H; - COOH; -PO(POH)3; -OH; ketone (=O), -F; -Cl; -I; a substituted or unsubstituted alkyl chain; an aromatic chain, a substituted or unsubstituted alkyne chain, a substituted or unsubstituted alkene chain, azide (-N3).
[0142] The alkaline chain may be selected from methyl, ethyl, propyl and hexyl.
[0143] The aromatic chain may be selected from phenyl or cyclohexane.
[0144] In particular, the redox compound may be selected from 2,5-dimethylbenzoquinone, 2,3- dimethylbenzoquinone, tetrafluorobenzoquinone, tetrachlorobenzoquinone, tetraiodobenzoquinone, alizarin red S, anthraquinone-2,6-disulfonate, 2,3,5,6-tetrakis(propylsulfanyl-3'-sulfonate)-1 ,4- benzoquinone tetrasodium salt, 2,3,5,6-tetrakis(ethylsulfanyl-2'-sulfonate)-1 ,4-benzoquinone tetrasodium salt, 2-phenyl-3,5,6-tri(propylsulfanyl-3'-sulfonate)-1 ,4-benzoquinone trisodium salt, 2,3- dimethyl-5,6-di(propylsulfanyl-3'-sulfonate)-1 ,4-benzoquinone disodium salt, 2,5-dimethyl-3,6- di(propylsulfanyl-3'-sulfonate)-1 ,4-benzoquinone disodium salt, 2,6-dimethyl-3,5-bis(propylsulfanyl- 3'-sulfonate)-1 ,4-benzoquinone disodium salt and 2, 3, 5-trimethyl-6-(propylsulfanyl-3'-sulfonate)-1 ,4- benzoquinone sodium salt.
[0145] The redox agent may also be selected from hydrosoluble porphyrins and hydrosoluble phthalocyanines. They can be metal free or metalated (M = Fe, Mn, Cu, Ni, Co).
[0146] The denaturation step may also be conducted in a presence of one or more reduced agents. Reduced agents help to improve the overall pH modulation by i) increasing conductivity of the solution, ii) balance the overall redox reaction at pixels and iii) create acidic area that can be used to block areas from removal.
[0147] Accordingly, in one embodiment, the redox agent is a reduced agent. The redox agent can be selected from hydroquinones and substituted hydroquinones. In particular, said redox agent agent is a compound of Formula II: with R1, R2, R3 and R4 being, independently of one another, selected from -H, -SChNa; -SO3H; - COOH; -PO(POH)3; -OH; ketone (=O), -F; -Cl; -I; a substituted or unsubstituted alkyl chain; an aromatic chain, a substituted or unsubstituted alkyne chain, a substituted or unsubstituted alkene chain, azide (-N3).
[0148] The alkaline chain may be selected from methyl, ethyl, propyl and hexyl.
[0149] The aromatic chain may be selected from phenyl or cyclohexane.
[0150] In some embodiments, the redox agent is selected from 2,5-dimethylhydroquinone, 2,3- dimethylhydroquinone, trimethylhydroquinone, tetrafluorohydroquinone, tetrachlorohydroquinone, tetraiodohydroquinone, Hydroquinonesulfonic acid, Tiron, 2,5-Dihydroxybenzenesulfonic acid, sodium (L) ascorbate, 2,3,5,6-tetrakis(propylsulfanyl-3'-sulfonate)-1 ,4-hydroquinone tetrasodium salt, 2, 3, 5, 6-tetrakis(ethylsulfanyl-2'-sulfonate)-1 ,4-hydroquinone tetrasodium salt, 2-phenyl-3,5,6- tri(propylsulfanyl-3'-sulfonate)-1 ,4-hydroquinone trisodium salt, 2,3-dimethyl-5,6-di(propylsulfanyl-3'- sulfonate)-1 ,4-hydroquinone disodium salt, 2,5-dimethyl-3,6-di(propylsulfanyl-3'-sulfonate)-1 ,4- hydroquinone disodium salt, 2, 6-dimethyl-3,5-bis(propylsulfanyl-3'-sulfonate)-1 ,4-hydroquinone disodium salt, 2, 3, 5-trimethyl-6-(propylsulfanyl-3'-sulfonate)-1 ,4-hydroquinone sodium salt, sodium 3,3'-((2,5-dihydroxy-3,6-bis(trifluoromethyl)-1 ,4-phenylene)bis(sulfanediyl))bis(pr-opane-1- sulfonate) and 3,4,5,6-tetrakis(propylsulfanyl-3'-sulfonate)catechol.
[0151] In some embodiments, the redox agent is ascorbic acid or sodium ascorbate.
[0152] Ascorbic acid and hydroquinones, such as trimethylhydroquinone or chloroanilic acid, as used in the examples, are preferred redox agents.
[0153] When a 2-electrodes electrochemical cell is used, two redox agents or more may be used in combination, e.g. a quinone and another redox agent, or two quinones. The quinone may be a hydroquinone, e.g. chloroanilic acid and / or trimethylhydroquinone. The other agent may be ascorbic acid or sodium ascorbate. This situation is illustrated in the appended examples, where a 2-electrode low-density chip (LDC) is used. Exemplary couples of redox agents that may be used are chloroanilic acid / ascorbic acid and chloroanilic acid / TMHQ.
[0154] In other cases, only one redox agent may be used. This is particularly advantageous when 3- electrode electrochemical cells are used, due to the enhanced stability of such electrochemical cells. For instance, a quinone such as a hydroquinone or a benzoquinone may be used as redox agent.
[0155] Various buffers can be used to effect the initiator nucleic acid removal, e.g. acetate, phosphate, MES, PIPES, MOPS, CAPS, HEPES, borate. It is particularly preferred that the disruption of the hybridization between the initiator nucleic acid and the anchor nucleic acid, i.e. the initiator removal, be effected in a phosphate-buffered solution or an acetate-buffered solution, more preferably in a phosphate-buffered solution. In some embodiments, the initiator nucleic acid removal is carried out in a phosphate-buffered solution. In some embodiments, the phosphate-buffered solution comprises from 1 mM to 500 mM phosphate, in particular from 5 mM to 200 mM phosphate, more particularly from 10 mM to 100 mM phosphate. In some embodiments, the initiator nucleic acid removal is carried out in an acetate-buffered solution. In some embodiments, the acetate-buffered solution comprises from 50 mM to 2M acetate, in particular from 100 mM to 1 M acetate, more particularly from 200 mM to 800 mM acetate.
[0156] The solution for initiator removal may also comprise salts and ionic liquids, in particular selected from Tetrabutylammonium hexafluorophosphate(TBuA.PF6), Tetrabutylammonium Fluoride (TBAF), Potassium chloride, Sodium chloride, Lithium chloride, Potassium perchlorate, Sodium perchlorate, Lithium perchlorate, Lithium bis(trifluoromethanesulfonyl)imide (LiTFSI).
[0157] It some embodiments, the denaturation comprises the application of heat. For instance, the method may comprise applying temperatures that are higherthan the Tm of the nucleic acid duplex including, for example, at least 1 °C, at least 2°C, at least 5 °C, at least 10 °C, at least 15 °C, at least 20 °C, at least 25 °C or at least 50 °C above the Tm of the nucleic acid duplex. In some embodiments, the method comprises applying a temperature above 45 °C, above 50 °C, above 55 °C, above 60 °C, above 65 °C, above 70 °C, above 75°C, above 80°C, above 85°C, above 90°C or above 95°C.
[0158] The removal step (c) may also include a combination of application of heat with application of a denaturing agent, under appropriate conditions. Using combinations of denaturation or melting stimuli may allow to apply milder conditions for denaturation, i.e. lower temperatures and / or lower concentrations of denaturing agent.
[0159] In some embodiments, denaturation of the nucleic acid duplex may be assisted by cleavage of the nucleic acid initiator 102, prior to its removal, as illustrated in Fig. 6. In such embodiments the hybridized nucleic acid initiator 102 is a cleavable nucleic acid molecule. This cleavable nucleic acid molecule may contain one or more cleavable groups 106, i.e. a chemical group which is susceptible to be cleaved when exposed to appropriate conditions, thereby separating the initiator nucleic acid 102 into two fragments. Accordingly, in some embodiments, of the method of the invention, the initiator nucleic acid 102 comprises at least one cleavable group 106, and step (c) comprises cleaving the cleavable group 106 within the initiator nucleic acid 102, thereby breaking the initiator nucleic acid 102 into two or more nucleic acid fragments. The initiator nucleic acid 102 may comprise more than one cleavable groups, resulting in a fragmentation of the initiator nucleic acid, after cleavage, in more than two fragments.
[0160] The cleavable group 106 is preferably located within the portion of the initiator nucleic acid 102 which hybridizes to the anchor nucleic acid 101 , i.e. in the complementary duplex (ds-DNA region). Any type of cleavage reaction can be used, so long as it is compatible with the nucleic acid synthesis method. In particular, the cleavable group 106 can be selected from a chemically-cleavable group, a photocleavable group or an enzymatically-cleavable group. Photocleavable groups are particularly preferred as they allow cleavage in milder conditions, for instance in water or in simple buffers compatible with further steps of PCR, without requiring further purification or adjustment of pH or ionic strength.
[0161] Cleavage-assisted removal of the initiator nucleic acid 102 may further comprises applying denaturing conditions during and / or after the cleavage step to disrupt the hybridization of the cleaved initiator nucleic acid 102 to the anchor nucleic acid 101 . Cleavage is indeed generally carried out to disrupt the nucleic acid duplex, but cleavage may not be sufficient to effect the de-hybridation process if denaturing conditions are not applied. The cleavage of the cleavable group(s) 106 breaks the nucleic acid initiator into two or more nucleic acid fragments: a 5’-fragment 107 which is proximal to the solid surface and a 3’-fragment which comprises the rest of the nucleic acid initiator 102 bound to the synthesized polynucleotide 103. The cleaving step destabilizes the nucleic acid duplex between the anchor 101 and the initiator 102 and makes the denaturing or melting of step c) easier as the hybridized strand is broken into smaller parts, with lower melting temperatures.
[0162] Thanks to the cleavage step, milder denaturation conditions can be used, which preserves the immobilized nucleic acids for subsequent synthesis cycles. The efficiency of the denaturation step can also be improved. In some embodiments, the cleavage of the nucleic acid initiator reduces the duplex Tm by at least 1 .5 times, preferably by at least 2 times.
[0163] In some embodiments, the step of cleavage leaves a free 3’-hydroxyl on a cleaved strand which permits the 5’-cleaved fragment 107 to be further extended, e.g. to serve of initiator for further cycles of steps (a) to (c).
[0164] Preferably, the nucleic acid initiator has a sequence such that the 5’ fragment 107 obtained after cleavage is not amplified during subsequent steps of amplification of the synthesized polynucleotide. In particular, the 5’-fragment does not comprise a primer-binding sequence, wherein primer-binding sequences are motifs within the synthesised polynucleotide used for PCR amplification of the synthesized polynucleotide 103. In some embodiments, the 5’-fragment 107 comprises an affinity tag, e.g. biotin, for purification after disruption of the nucleic acid duplex.
[0165] A variety of cleavable groups 106 can be used. In some embodiments, the cleavable group 106 may be located along the oligonucleotide backbone, for example, a modified 3'-5' internucleotide linkage in place of one of the phosphodiester groups, such as ribose, dialkoxysilane, phosphorothioate, and phosphoramidate internucleotide linkage. The cleavable oligonucleotide analogs may also include a substituent on, or replacement of, one of the bases or sugars, such as 7-deazaguanosine, 5- methylcytosine, inosine, uridine, and the like. Inosine, for instance, can be cleaved by inosine-specific endonucleases V.
[0166] In some embodiments, the cleavable linking group may be a photocleavable linker, such as an orthonitrobenzyl photocleavable linker. Synthesis and cleavage conditions of photocleavable oligonucleotides on solid surfaces are described, for example, in Venkatesan et al., J. Org. Chem. 61 :525- 529 (1996), Kahl et al, J. Org. Chem. 64:507-510 (1999), Kahl et al, J. Org. Chem. 63:4870- 4871 (1998), Greenberg et al., J. Org. Chem. 59:746-753 (1994), Holmes et al., J. Org. Chem. 62:2370-2380 (1997), and U.S. Pat. No. 5,739,386. Ortho-nitrobenzyl-based linkers, such as hydroxymethyl, hydroxyethyl, and Fmoc-aminoethyl carboxylic acid linkers, may also be obtained commercially. Photocleavable linkages also include nitrobenzylether and thymidine dimer.
[0167] Exemplary chemically cleavable internucleotide linkages for use in the methods described herein include, for example, -cyano ether, 5'-deoxy-5'-aminocarbamate, 3'deoxy-3'-aminocarbamate, urea, 2'-cyano-3',5'-phosphodiester, 3'-(S)-phosphorothioate, 5'-(S)-phosphorothioate, 3'-(N)- phosphoramidate, 5'-(N)-phosphoramidate, -amino amide, vicinal diol, ribonucleoside insertion, 2'- amino-3',5'-phosphodiester, allylic sulfoxide, ester, silyl ether, dithioacetal, 5'-thio-furmal, -hydroxy methyl -phosphonic bisamide, acetal, 3'-thio-furmal, methylphosphonate and phosphotriester. Internucleoside silyl groups such as trialkylsilyl ether and dialkoxysilane are cleaved by treatment with fluoride ion. Base-cleavable sites include -cyano ether, 5'-deoxy-5'-aminocarbamate, 3'-deoxy- 3'- aminocarbamate, urea, 2'-cyano-3',5'-phosphodiester, 2'-amino-3',5'-phosphodiester, ester and ribose. Thio-containing internucleotide bonds such as 3'-(S)-phosphorothioate and 5'-(S)- phosphorothioate are cleaved by treatment with silver nitrate or mercuric chloride. Acid cleavable sites include 3'-(N)- phosphoramidate, 5'-(N)-phosphoramidate, dithioacetal, acetal and phosphonic bisamide. An aminoamide internucleotide bond is cleavable by treatment with isothiocyanate, and titanium may be used to cleave a 2'-amino-3',5'-phosphodiester-0-ortho-benzyl internucleotide bond. Vicinal diol linkages are cleavable by treatment with periodate. Methods for synthesizing and cleaving nucleic acids containing chemically cleavable, and photocleavable groups are described for example, in U.S. Pat. No. 5,700,642.
[0168] In some embodiments, cleavable nucleotides may be an enzymatically-cleavable nucleotide analog such as deoxyuridine or 8-oxo-deoxyguanosine that are recognized by specific glycosylases (e.g. uracil deoxyglycosylase followed by endonuclease VIII, and 8-oxoguanine DNA glycosylase, respectively).
[0169] In some embodiments, enzymatically-cleavable groups include nucleotides comprising base analogs cleavable by endonuclease III which include, but are not limited to, urea, thymine glycol, methyl tartonyl urea, alloxan, uracil glycol, 6-hydroxy-5,6-dihydrocytosine, 5-hydroxyhydantoin, 5- hydroxycytocine, trans-l -carbamoyl -2 -oxo-4, 5-dihydrooxyimidazolidine, 5,6-dihydrouracil, 5- hydroxy cytosine, 5- hydroxyuracil, 5-hydroxy-6-hydrouracil, 5-hydroxy-6-hydrothymine, 5,6- dihydrothymine. In some embodiments, enzymatically-cleavable groups include nucleotides comprising base analogs cleavable by formamidopyrimidine DNA glycosylase which include, but are not limited to, 7,8-dihydro-8-oxoguanine, 7,8-dihydro-8-oxoinosine, 7,8-dihydro-8-oxoadenine, 7,8- dihydro-8-oxonebularine, 4,6-diamino-5- formamidopyrimidine, 2,6-diamino-4-hydroxy-5- formamidopyrimidine, 2,6-diamino-4-hydroxy-5-N- methylformamidopyrimidine, 5-hydroxy cytosine, 5-hydroxyuracil. In some embodiments, enzymatically-cleavable groups include nucleotides comprising base analogs cleavable by hNeil 1 which include, but are not limited to, guanidinohydantoin, spiroiminodihydantoin, 5-hydroxyuracil, thymine glycol. In some embodiments, enzymatically-cleavable groups include nucleotides comprising base analogs cleavable by thymine DNA glycosylase which include, but are not limited to, 5-formylcytosine and 5-carboxycytosine. In some embodiments, enzymatically-cleavable groups include nucleotides comprising base analogs cleavable by human alkyladenine DNA glycosylase which include, but are not limited to, 3- methyladenine, 3-methylguanine, 7-methylguanine, 7-(2-chloroehyl)-guanine, 7-(2-hydroxyethyl)- guanine, 7-(2-ethoxyethyl)-guanine, 1 ,2-bis-(7-guanyl)ethane, 1 ,N6-ethenoadenine, 1 ,N2- ethenoguanine, N2,3-ethenoguanine, N2,3-ethanoguanine, 5-formyluracil, 5-hydroxymethyluracil, hypoxanthine. In some embodiments, cleavable nucleotides include 5-methylcytosine cleavable by 5-methylcytosine DNA glycosylase.
[0170] In some embodiments, ribonucleotides may be employed as cleavable nucleotides, wherein a cleavage step may be implemented using a ribonuclease, such as RNase H. In other embodiments, cleavage steps may be carried out by treatment with a nickase.
[0171] Further cleavable linkages are disclosed in the following references: Pon, R., Methods Mol. Biol. 20:465-496 (1993); Verma et al„ Ann. Rev. Biochem. 67:99-134 (1998); U.S. Pat. Nos. 5,739,386, 5,700,642 and 5,830,655; and U.S. Patent Publication Nos. 2003 / 0186226 and 2004 / 0106728, Urdea et al, U.S. patent 5367066. Synthesis and cleavage conditions of chemically cleavable oligonucleotides are described in U.S. Pat. Nos. 5,700,642 and 5,830,655. Phosphorothioate internucleotide linkage may be selectively cleaved under mild oxidative conditions. Selective cleavage of the phosphoramidate bond may be carried out under mild acid conditions, such as 80% acetic acid. Selective cleavage of ribose may be carried out by treatment with dilute ammonium hydroxide. In another embodiment, a cleavable linking group may be an amino linker. The resulting oligonucleotides bound to the linker via a phosphoramidite linkage may be cleaved with 80% acetic acid yielding a 3'-phosphorylated oligonucleotide, which may (if desired) be removed by a phosphatase.
[0172] In some embodiments, the removal step (c) is performed by competitive displacement, which may comprise contacting the anchor nucleic acid 101 with a displacement nucleic acid 108 which will disrupt the hybridization of the displacement nucleic acid 108 to the anchor nucleic acid 101. As illustrated in Fig. 7, the duplex between the anchor nucleic acid and the initiator nucleic acid is contacted with a displacement nucleic acid 108. The displacement nucleic acid 108 is a polynucleotide strand which comprises a sequence complementary to the sequence of the anchor nucleic acid which forms a duplex with the initiator nucleic acid 102. The sequence complementarity, as well as the concentrations and reaction conditions, are such that the displacement nucleic acid 108 is capable to displace, i.e. disrupt by replacement, the hybridization between the initiator nucleic acid 102 and the anchor nucleic acid 101. In some embodiments, this displacement is achieved by a higher sequence complementarity between the displacement nucleic acid 108 and the anchor nucleic acid 101 in comparison to the sequence complementarity between the initiator nucleic acid 102 and the anchor nucleic acid 101. A higher sequence complementarity is, for instance, provided if the displacement nucleic acid has a longer domain of complementarity with the anchor nucleic acid 101 in comparison to the domain of complementarity between the initiator nucleic acid 102 and the anchor nucleic acid 101 , thus forming a longer duplex once hybridized. A higher sequence complementarity may also be provided by other ways, e.g. complementarity-enhancing modified nucleotides in the displacement nucleic acid 108.
[0173] Returning to Fig. 7, once the displacement nucleic acid 108 is hybridized to the anchor nucleic acid 101 , it can be elongated, i.e. it serves as initiator for a next cycle of steps (a) to (d), i.e. for the synthesis of a further polynucleotide 109.
[0174] In alternative embodiments also illustrated in Fig. 7, the displacement nucleic acid can be removed and a new initiator 102 can be added to hybridize to the anchor nucleic acid.
[0175] Alternatively, as shown in right-end portion of Fig. 7, the method can comprise a step of hybridizing a bridging nucleic acid 110 to the displacement nucleic acid 108, wherein the bridging nucleic acid 110 is used as anchor nucleic acid 101 for a next cycle of steps (a) to (d).a bridging nucleic acid 110. The bridging nucleic acid is typically a polynucleotide strand which comprises a sequence at its 3’- end which hybridizes with the 5’-end of the displacement nucleic acid 108. Once hybridized, the bridging nucleic acid 110 has a 3’-end which is proximal to the solid surface and a 5’-end which is distal to the solid surface. The bridging nucleic acid 110 can be used as an anchor nucleic acid 101 for a next cycle of steps (a) to (c) or (a) to (d). In such embodiments, the method can comprise adding 1 a further initiator nucleic acid 111 which hybridizes to the bridging nucleic acid 110. Elongation of the initiator nucleic acid 111 leads to the synthesis of a synthesized polynucleotide 112 on top of the initiator nucleic acid 111.
[0176] In some embodiments, the displacement nucleic acid 108 and / or the bridging nucleic acid 110 comprise an affinity tag for purification after de-hybridization of said nucleic acids with their duplexforming partners.
[0177] Each of the processes disclosed herein for disrupting the hybridization of the initiator nucleic acid to the anchor nucleic acid can be repeated for several cycles, i.e. the same process is used for several cycles. Alternatively, a hybrid approach can be used, wherein some cycles rely on one process, e.g. competitive displacement, while other cycles rely on another process, e.g. heat application or denaturation. The processes and conditions for disrupting the hybridization as disclosed herein can also be used in combination, i.e. a combination of heat application with chemical denaturation or, for instance, heat application and competitive displacement. Any combination of the removal processes and / or conditions disclosed herein is encompassed by the present invention.
[0178] Quality control
[0179] In some embodiments, the method for synthesizing polynucleotides comprises one or more steps of quality control. Quality control includes, for instance controlling that a polynucleotide has been synthesized, i.e. that the initiator has been extended during the extension step. Quality control may also include controlling the sequence of the synthesized polynucleotide, i.e. controlling that the synthesized polynucleotide has the sequence which was predetermined for the synthesis.
[0180] Said quality control step may be carried out at different stages of the synthesis cycle. It is typically carried out after the elongation step (b). A quality control during elongation can also be performed, i.e. after a number of nucleotides have been added but before full completion of the elongation according to the predetermined sequence.
[0181] Preferably, quality control is carried out when elongation is completed and the initiator is still hybridized to the anchor nucleic acid, i.e. before step (b) and step (c). Quality control may also be carried out after removal of the extended initiator nucleic acid from the anchor nucleic acid. A quality control between step (b) and (c) is preferred.
[0182] In some embodiments, quality control comprises attaching a detectable probe to the synthesized polynucleotide 103, and detecting said probe. After detection, the probe can be removed from the synthesized polynucleotide. Advantageously, the probe is a nucleic acid probe with can hybridize to a region of the synthesized polynucleotide. Quality control through hybridization of a detectable probe is illustrated in Fig 9. Using a nucleic acid probe 124, typically an oligonucleotide of 10 to 50 nucleotides, preferably 15 to 50 nucleotides, allows to detect the synthesized polynucleotide in a sequence-specific manner, thereby controlling that synthesis has effectively occurred and at the same time controlling the correctness of the synthesized sequence. Quality control may therefore comprise hybridizing a nucleic acid probe to the synthesized polynucleotide 103, wherein said nucleic acid probe comprises a detectable moiety, and detecting the nucleic acid probe hybridized to the elongated polynucleotide. In one embodiment, the nucleic acid probe hybridizes to a region of the extended initiator spanning the junction between the nucleic acid initiator and the synthesized polynucleotide. Preferably, said sequence spanning the junction between the nucleic acid initiator and the synthesized polynucleotide comprises at least 10 nucleotides of the initiator nucleic acid 102 and 10 nucleotides of the synthesized polynucleotide 103.
[0183] The detectable probe 124 or detectable moiety 125 attached to the nucleic acid probe may be any detectable chemical group, e.g. a photodetectable moiety such as a fluorophore. The detectable moiety 125 is preferably attached at the 3’-end of the nucleic acid probe.
[0184] Once a signal is detected, the detectable probe 124 is removed, e.g. de-hybridized in the case of a nucleic acid probe. In some embodiments, the nucleic acid probe comprises a cleavable group within its hybridized region. In such embodiments, the method comprises a step of cleaving the cleavable group before removing the nucleic acid probe. As described in the present specification, the cleavage of a cleavable group within a strand involved in a nucleic acid duplex, breaks said strand into several fragments, thereby making easier to denature said duplex by lowering its melting temperature. Preferably, said cleavable group is different from the cleavable group comprised in the initiator nucleic acid, when the initiator nucleic acid comprises a cleavable group to assist its removal from the anchor nucleic acid. In particular, cleavable groups which are cleavable under different conditions are preferably used.
[0185] Synthesis on arrays
[0186] In one aspect, the invention provides methods for parallel enzymatic synthesis of a plurality of different polynucleotides each having a predetermined sequence of nucleotides. In some embodiments, parallel synthesis is implemented by providing a support having discrete, nonoverlapping, addressable sites where separate polynucleotides are synthesized and a means for controlling electrochemical conditions at each site independently of the other sites is provided. In some embodiments, such parallel synthesis support is a planar support having a regular pattern of addressable sites, such as, a rectilinear pattern of sites, or a hexagonal pattern of sites. In some embodiments, each site of a planar support is associated with one or more electrodes whose electrical characteristics may be controlled in an addressable manor independent of other electrodes of the planar support. In some embodiments, such planar supports have a plurality of sites comprising at least 256 sites, at least 512 sites, at least 1024 sites, at least 5000 sites, at least 10,000 sites, at least 25,000 sites, or at least 100,000 sites and as many as at least 10,000,000 sites or at least 100,000,000s site or at least 1 ,000,000,000 sites. In some embodiments, such planar supports have a plurality of sites greater than 1000, or 10,000, or 25,000, or 50,000, or 100,000, or 500,000, and up to 1 ,000,000 sites or up to 10,000,000 sites. In some embodiments, the sites of such planar supports are disposed in a regular array and each site is associated with at least one electrode integrated with the planar support. In some embodiments, the discrete site at which synthesis and / or sequencing take place each has an area in the range of from .25 pM to 1000 pM , or from 1 pM to 1000 pM , or from 10 pM to 1000 pM , or from 100 pM to 1000 pM . In some embodiments, the amount of polynucleotides synthesized at each site is at least 10-6fmol, or at least 10-3fmol, or at least 1 fmol, or at least 1 pmol, or the amount of polynucleotide synthesized at each site is in the range of from 10-6fmol to 1 fmol, or from 10-3fmol to 1 fmol, or from 1 fmol to 1 pmol, or from 10-6pmol to 10 pmol, or from 10-6pmol to 1 pmol. In some embodiments, the number of polynucleotides synthesized at each site is in the range of from 1000 molecules to 106molecules, or from 1000 molecules to 109molecules, or from 1000 molecules to 1012molecules.
[0187] Guidance for making arrays is found in many available references and treatises on integrated circuit design and manufacturing and micromachining, including, but not limited to, Allen et al, CMOS Analog Circuit Design (Oxford University Press, 2nd Edition, 2002); Levinson, Principles of Lithography, Second Edition (SPIE Press, 2005); Doering and Nishi, Editors, Handbook of Semiconductor Manufacturing Technology, Second Edition (CRC Press, 2007); Baker, CMOS Circuit Design, Layout, and Simulation (IEEE Press, Wiley-lnterscience, 2008); Veendrick, Deep-Submicron CMOS ICs (Kluwer-Deventer, 1998); Cao, Nanostructures & Nanomaterials (Imperial College Press, 2004); and the like, which relevant parts are hereby incorporated by reference. Likewise, guidance for carrying out electrochemical measurements of the invention is found in many available references and treatises on the subject, including, but not limited to, Saveant and Costentin, 2ndedition Elements of Molecular and Biomolecular Electrochemistry (Wiley, 2019); Sawyer et al, Electrochemistry for Chemists, 2nd edition (Wiley Interscience, 1995); Bard and Faulkner, Electrochemical Methods: Fundamentals and Applications, 2nd edition (Wiley, 2000); and the like, which relevant parts are hereby incorporated by reference.
[0188] In some embodiments, each site on an electrode array may be configured as a potentiostat and / or galvanostat electrochemical cell, as described in Metrohm application note EC08 and in W02020 / 020608, the disclosure of which is incorporated by reference in its entirety.
[0189] Chips enabling localized potential variation on a large scale can be used, for example, by employing electrode arrays fabricated using CMOS chip technology or other semiconductor technology. CMOS chips are a particularly preferred solid surface for implementation of the method of the invention. Advantages of this technology include pitch reduction to permit massively large-scale synthesis, stackability of chips and synthesis and storage on small beads. The use of CMOS chip scaling supports the ability to ultimately provide billions of such synthesis sites on a standard, low cost, mass- produced chip. Localized voltage / light actuation can also be used to accelerate the synthesis chemistry and shorten the cycle time, such as from ~30 minutes down to seconds. The actuator electrodes may be derivatized with chemical layers that transduce voltage or current to other useful electrochemical local environment changes, such as, for example, to provide for voltage-generated acids or bases. In other aspects, a voltage / current may modulate a conformational or steric or mechanical change of local polymer / molecular matrix structure in which the synthesis takes place, that physically impedes or allows the base addition. In particular, one embodiment of such a system could have micro- or nano-wells or containers at each site, which contain the growing DNA oligos and which can be actuated to open / close to physically selectively control the base addition reactions. The added bases may also contain charge or other modifications that facilitates the use of voltage or light to direct and control the process. CMOS chip scaling and voltage or current or light-directed synthesis offers the potential for large increases in scale, and reductions in cost of the process and instrument used to perform synthesis. The finished DNA fragments, consisting of multiple exemplars of each target sequence for a given pixel as each site, can be released from the support postsynthesis, and pooled in solution to form a physical archive. Large-scale electrode arrays comprising a plurality of individually addressable electrodes formed in a circuit- supporting substrate, especially CMOS, have been constructed for phosphoramidite-based synthesis and for sensor applications, e.g. Montgomery, U.S. patents 6093302, 6444111 and 6280595; Gindilis, U.S. patent 9339782; Maurer et al, U.S. patent 9267213; Maurer et al, PLos One, December 2006, issue 1 , e34; Fomina et al, LabChip, 16: 2236-2244 (2016); Kavusi et al, U.S. patent 9075041 ; Johnson et al, U.S. patent 9874538 and 9910008; Gordon et al, U.S. patent 6251595; Levine et al, and the like. IEEE J. Solid State Circuits, 43: 1859-1871 (2008); and the like. These references provide guidance for the design of particular embodiments of the present invention with respect to such features as electrode numbers, size, composition and configurations at array sites; CMOS circuitry for voltage and current control and measurement; array fabrication and operation; methodologies for attaching or immobilizing chemical components (such as, for example, initiators) at array sites; and the like.
[0190] In some embodiments, the methods performing parallel synthesis of a plurality of polynucleotides allow the synthesis of different polynucleotides having different sequences on a same solid surface, e.g. an array or chip. As shown in Fig. 9, a plurality of different anchor nucleic acids 116, 1 17, 118 can be immobilized at a plurality of sites on the solid surface. The plurality of different anchors 116, 117, 118 may be directly immobilized to the solid surface, e.g. by covalent immobilization or, alternatively, a plurality of different bridging nucleic acids may be used as anchors 116, 117, 118, as described in the present specification. Such bridging nucleic acids are oligonucleotides which are indirectly immobilized to the solid surface through hybridization to another nucleic acid, which may be itself immobilized to a generic anchor nucleic acid. Embodiments using bridging nucleic acids has the advantage to enable the synthesis of diversified polynucleotides having a variety of sequences, through the use of a generic array having a common anchor on its surface.
[0191] Returning to Fig. 9, at step (a) of the method, the plurality of anchor nucleic acids 116, 117, 118 is contacted with a plurality of different initiator nucleic acids 119, 120, 121 , wherein each different initiator nucleic acid hybridizes with a specific anchor nucleic acid of the plurality of different anchor nucleic acids 116, 117, 118. Specific hybridization is achieved through specific complementary sequences. After elongation of the plurality of different initiator nucleic acids 119, 120, 121 , disruption of the anchor nucleic acid 116, 117, 118: initiator nucleic acid 119, 120, 121 duplexes can be carried out site-specifically, such that only a part of the initiator nucleic acids 119, 120, 121 are removed. In some embodiments, site-specific removal comprises at least one of:
[0192] -site-specifically applying denaturing conditions to the solid surface, - site-specifically displacing the hybridization of the initiator nucleic acid to the anchor nucleic acids, through the addition of one or more displacement nucleic acids specifically hybridizing to a part of the anchor nucleic acids; and
[0193] - site-specifically cleaving cleavable groups within a part of the initiator nucleic acids.
[0194] For instance, a displacement nucleic acid can be added to the solid surface to remove the initiator nucleic acid by competitive inhibition. The displacement nucleic acid has a specific hybridization sequence allowing said displacement nucleic acid to hybridize to one of the anchor nucleic acids immobilized on the solid surface. Through its hybridization to a specific anchor nucleic acid, the displacement nucleic acid removes the initiator nucleic acid which was hybridized to the anchor nucleic acid. At the same time, the hybridization of the other anchor: initiator duplexes are maintained, providing a site-specific removal of an initiator strand.
[0195] As an alternative or in combination, site-specific initiator removal can be achieved by locally applying a cleavage stimulus to cleave a cleavable group present in an initiator nucleic acid site-specifically hybridized to its complementary anchor. The cleavable group can be selected from a chemically cleavable group, a photocleavable group or an enzymatically cleavable group as described herein. Advantageously, different initiator nucleic acids comprise different cleavable groups which are cleavable by different stimuli, such that removal of each different initiator nucleic will be actioned separately.
[0196] As an alternative or in combination, site-specific initiator removal can be achieved by site-specific application of denaturing conditions. Preferably, an electrode 104 is used for local stimulation 104’, as illustrated in Fig. 10. For instance, controlled changes in electrical potential at an electrode of an electrode array can be used to change the pH in a local, spatially-resolved way, thereby releasing the extended initiator nucleic acid 102, 103. Advantageous conditions for generating hydroxide ions at an electrode of an electrode array are described in the examples and include, for example, the use of redox agents. Examples of suitable redox agents are described in the present disclosure. In some embodiments, the redox couple chloroanilic acid / ascorbic acid is used. In other embodiments, the redox couple chloroanilic acid / trimethylhydroquinone is used.
[0197] Whereas site-specific oligonucleotide synthesis can be achieved by using arrays coated with different anchors and / or different bridging nucleic acids, as described above, it is also possible to hybridize the initiator nucleic acids in a site-specific way by using an array comprising a common anchor immobilized to the solid surface. For instance, as illustrated in Fig. 11 , certain electrodes 104 of the array can be controlled so as to induce site-specific conditions which allow or do not allow the binding of the initiator nucleic acid to the anchor nucleic acid or, similarly, of the bridging nucleic acid to its duplex-forming partner. The potential of an electrode 104’ can be modified to locally induce an alkaline pH change which prevents the formation of a duplex between the initiator nucleic acid and the immobilized anchor. No potential variation is applied at other electrodes 104 of the array, such that these other sites are capable to form duplexes between the anchor nucleic acid 101 and the initiator nucleic acid 102. A site-specific initiator coating of the array results from this method. Local stimulation of an electrode array is also applicable in embodiments in which the initiator nucleic acid comprises a cleavable group within the region which is complementary with the anchor nucleic acid 101. In such embodiments, a stimulus, e.g. a voltage change, can be applied at an electrode 104’, e.g. to create an alkaline pH change, so as to cleave the cleavage group in a site-specific manner. The cleavage of the initiator nucleic acid 102 in fragments prevents its hybridization to the anchor nucleic acid.
[0198] Some aspects of the invention relate to a method for parallelly synthesizing a plurality of polynucleotides of a microelectrode array comprising a plurality of electrodes, wherein each group comprises a plurality of electrodes of the same type and each group is independently addressable, comprising:
[0199] (i) providing a plurality of anchor nucleic acids immobilized the plurality of electrodes; and
[0200] (ii) repeating cycles of:
[0201] (a) contacting the anchor nucleic acids with initiator nucleic acids comprising a free 3’-OH end, under conditions such that each initiator nucleic acid hybridizes with an anchor nucleic acid over at least a part of their nucleotide sequences;
[0202] (b) elongating the 3’-OH end of said initiator nucleic acids, to produce synthesized polynucleotides bound to the 3’-end of the initiator nucleic acids;
[0203] (c) disrupting the hybridization of the initiator nucleic acids to the anchor nucleic acids; and
[0204] (d) optionally recovering the synthesized polynucleotides.
[0205] In some embodiments, anchor nucleic acids immobilized to the electrodes of a same group of electrodes have the same sequence.
[0206] In some embodiments, initiator nucleic acids hybridized to the anchor nucleic acids immobilized to the electrodes of a same group of electrodes have the same sequence.
[0207] In some embodiments, anchor nucleic acids immobilized to the electrodes of different groups of electrodes have different sequences.
[0208] In some embodiments, initiator nucleic acids hybridized to the anchor nucleic acids immobilized to the electrodes of different groups of electrodes have the different sequences.
[0209] Some aspects of the invention relate to a kit adapted for use in the method of the disclosure, comprising:
[0210] - an anchor nucleic acid and an initiator acid wherein said anchor nucleic acid and nucleic acids comprise complementary nucleotide sequences capable of being hybridized to one another, preferably wherein said complementary sequences are respectively located at the 5’-end of said first and second nucleic acids,
[0211] - at least one nucleic acid polymerase, preferably a terminal deoxynucleotidyl transferase;
[0212] - optionally one or more 3'-0-blocked nucleoside triphosphate, wherein:
[0213] - said initiator nucleic acid comprises one or more cleavable group(s) such that cleavage of the cleavable group(s) breaks the initiator nucleic acid into two or more nucleic acid fragments, or wherein said kit further comprises;
[0214] - said kit comprises at least one displacement nucleic acid 108 comprising a sequence of nucleotides complementary with the anchor nucleic acid 101 , wherein the sequence complementarity between the displacement nucleic acid 108 and the anchor nucleic acid 101 is higher than the sequence complementarity between the initiator nucleic acid 102 and the anchor nucleic acid 101 ; and / or
[0215] - said kit comprises at least one denaturing agent capable of disrupting the hybridization between the anchor nucleic acid and the initiator nucleic acid selected from a denaturing agent.
[0216] Preferably, said initiator nucleic acid comprises a cleavable group within the nucleotide sequence complementary to the anchor nucleic acid.
[0217] In some embodiments, the nucleic acid polymerase is a terminal deoxynucleotidyl transferase.
[0218] In some embodiments, the kit further comprises one or more of:
[0219] - a solid surface, preferably a microelectrode array such as a chip, more preferably a CMOS chip;
[0220] - reagents for nucleic acid synthesis, in particular template-free nucleic acid synthesis;
[0221] - one or more buffers, in particular a hybridization buffer and / or a denaturation buffer; and
[0222] - an apparatus for nucleic acid synthesis, in particular template-free nucleic acid synthesis.
[0223] In some embodiments, the anchor nucleic acid is immobilized on a solid surface, preferably by covalent attachment.
[0224] In some embodiments, the kit comprises one or more bridging nucleic acids and / or intermediate nucleic acids as defined in the present disclosure. In some embodiments, the kit comprises one or more quality control nucleic acids, as defined in the present disclosure.
[0225] The aspects of the invention relating to the methods of the disclosure are also applicable to the kit of the invention.
[0226] In other aspects, the invention relates to a method for storing information. In some embodiments, the method comprises providing one or more items of information in the form of binary data, converting said binary data into one or more polynucleotide sequences, synthesizing polynucleotides having said polynucleotide sequences according to the method for synthesizing polynucleotides as described in the present disclosure, optionally amplifying said polynucleotides and storing said polynucleotides.
[0227] In some instances of the method, the information is converted from the 1s and 0s of binary code into the code of A, T, G, and C bases of DNA. In some embodiments, the method further comprises a step of reading the stored information, comprising extracting the stored polynucleotides, sequencing the extracted polynucleotides and converting the generated sequences into one or more items of information in the form of binary data.
[0228] The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.
[0229] Example 1 : Synthesis on reusable surfaces: New chemical method to hybridize / de-hybridize initiator DNA (iDNA) on low density chips (LDCs).
[0230] Experiments:
[0231] Low Density Chips (LDC) were used: Ti / Au / Ti LDC (MEMSCAP) coated with Silane Free Acrylamide (SFA) (3h curing time) and coupled with 2 pM anchored DNA (SEQ ID NO:1 , in 1 mM Phosphate buffer, 1 h).
[0232] 2 pM Fluorescent iDNA template (SEQ ID NO:2, FAM-labelled, solution in 5xSSC, 0.1 % Tween 20, 1 h) was then hybridized with the anchor.
[0233] Results:
[0234] A 50 mM NaOH solution applied for 30 min (pH = 12.7) proved to be successful in removing iDNA completely from the surface without damaging it, even after 10 repeats of hybridization / removal cycles (Fig. 12). A reduced concentration of 5mM NaOH pH = 11.7) incubated 30mn in a saline solution e.g. 0.1 M sodium acetate was also efficient in removing iDNA (Fig. 13). Higher concentrations of NaOH were also tested (NaOH, 0.5M and 0.1 M) and successfully removed iDNA from the LDC surface when applied for shorter time durations (1 Omn incubation of NaOH, 0.5M).
[0235] The inventors also tested incubation of the LDC in 100% formamide during 10mn. This condition was also efficient to remove the iDNA from the chip (Figure 14). Use of formamide is more suited to gel electrophoresis and further steps of PCR than NaOH, who needs to be neutralized before further amplification of the sample.
[0236] Figures 12 to 14 show that several key objectives are reached by the hybridization / dehybridization method: i) obtain concentrated and uniform pattern of hybridized iDNA; ii) Extract sufficient concentration of template for library prep; iii) Erase completely iDNA traces without causing damage to the SFA surface and the electrodes; iv) Ensure reproducibility of the method preventing any aging effect.
[0237] Conclusion:
[0238] Several chemical formulations have been identified to remove and reload iDNA sample on reusable surface without damaging the LDC. Removing iDNA at pHs between 1 1 and 12 can be reached with redox couples. Example 2: Synthesis after removal of iDNA.
[0239] Experiments:
[0240] Low Density Chips (LDC) were used: Ti / Au / Ti LDC (MEMSCAP) coated with SFA (3h curing time) and coupled with 3’-thiophosphate-anchored DNA (SEQ ID NO:1).
[0241] 1 pM Fluorescent iDNA template (SEQ ID NO:1), FAM-labelled, solution in 5xSSC, 0.1 % Tween 20 (hybridization buffer), 1 h was then hybridized during 2H with the anchor. A higher stringency in the buffer (e.g. 0.1X SSC, 0.002% Tween 20) will exert pressure selection amongst the oligonucleotides in solution such that, hybridization will only occur if the oligonucleotides have a high degree of complementarity.
[0242] Results:
[0243] A 0.5M NaOH solution applied for 10 min removed successfully the iDNA from the LDC surface (Fig. 15). After removal of the NaOH solution, the chip was washed thoroughly in MQ water and dried with argon. Application of 10 pM of the iDNA template during 2h or 16h, in hybridization buffer, rehybridized successfully the iDNA to the anchor.
[0244] 50 cycles of synthesis were conducted by template-free synthesis using TdT.
[0245] De novo synthesis of an oligonucleotide with 50 nucleotides was performed successfully using anchor-rehybridized iDNA. The re-used chips, after a first cycle of iDNA removal, behave efficiently for oligonucleotide synthesis. Similar results were obtained with only 1 h hybridization time.
[0246] The experiment was repeated, using removal in 100% formamide (10mn) instead of NaOH (Fig. 16). 10 cycles of synthesis were performed successful on iDNA hybridized on a re-used chip, after erasing a first iDNA coating.
[0247] Conclusion:
[0248] This experiment shows that the surface of the LDC is not damaged after removal of the iDNA induced by a strong base (NaOH). iDNA can then be re-hybridized successfully and synthesis by TdT occurs normally on a re-used chip.
[0249] Example 3: electrochemical removal of iDNA at specific locations of the LDC surfaces
[0250] Experiments were conducted to identify electroactive redox system(s) to extract DNA initiator at specific locations of the LDC surfaces.
[0251] Experiments:
[0252] Low Density Chips (LDC) were used: Ti / Au / Ti LDC (MEMSCAP) coated with SFA (3h curing time) and coupled with 2 pM anchored DNA (SEQ ID NO:1 , in 1 mM Phosphate buffer, 1 h). Fluorescent iDNA template (SEQ ID NO:2, 2pM, FAM-labelled, solution in 5 x SSC, 0.1 % Tween, 1 h) was then hybridized with the anchor.
[0253] A solution of 17 mM chloroanilic acid, 0.1 M ascorbic acid, 0.1 M acetate in MQ water (pH = 10.4, 2.6% DMSO) was used for the DNA extraction process. Four Working Electrodes (WE - small rings) were set at specific potentials for 5 min: V = VOCP; -1 .1 V; -1 .2 V or -1 .3 V vs. Pt. The entire process was recorded while using Dino-Lite camera in a transparent electrochemical cell. Once the extraction process was completed, the LDC was characterized or renewed. Entire iDNA was removed from the whole surface off cell configuration while using 10 mM NaOH, 0.1 M Acetate in MQ water (pH = 11.8) for 30 min. The LDC was then reloaded by incubation of 2 pM of the template (SEQ ID NO:2) in solution in 5 x SSC, 0.1 % Tween for 1 hour.
[0254] Fluorescence scans (Amersham Typhoon, Cy2, 550 V) were used to check the state of the LDC after preparation, after electrochemical extraction of templates, after complete removal and reload of iDNA.
[0255] The entire procedure was repeated three times on the same LDC to check reproducibility of DNA removal and degradation of anchored DNA.
[0256] Results:
[0257] To extract iDNA templates at specific locations of the LDC surfaces, electrochemical mechanisms have been exploited to locally rise the pH above 12 at the WE. To this end, the inventors needed to identify a redox system capable of generating a high number of hydroxide ions while being reduced, without leading to water splitting. The combination of chloroanilic acid and ascorbic acid has revealed to generate currents from -15 pA to +15 pA in the potential window of [-1 .4 V to +1 ,3V vs. Pt] (Fig. 17A). From pH modulation models, one requirement was to obtain currents between -5 pA and -15 pA to see significant changes of pHs. These values were obtained at potential values of -1 .05 V to - 1.35 V vs. Pt. which were near water splitting (EH2 = -1.25 V in 2 electrode configuration). Three values (Ei = -1.1 V, E2 = -1.2 V, and E3 = -1.3 V vs. Pt) were tested while performing chronoamperometry to address the effect of the generated currents on the LDC. After t = 100s of stimulation, currents reached plateau at - 4 pA for E1, - 7 pA for E2. E3 has shown formation of bubbles at the WE and discontinuities in the chronoamperogram. Both phenomena were the characteristic signature of water splitting (Fig. 18).
[0258] Once a suitable redox system was identified, electrochemical stimulations were performed for 5 min on a LDC where FAM-iDNA was hybridized, each electrode respectively stimulated at E1, E2 and E3. Each stimulation resulted in different patterns of fluorescence (Figures 19 and 20). All of them led to a localized iDNA denaturation: iDNA was preferentially removed at the WE (center disk) compared to the CE (larger disk), wherein the non-stimulated electrode is used as control. When reducing the potential from -1.1 V to -1.3 V vs. Pt, the percentage of iDNA removed at the anode increased as well as the area of denaturation. 80% of the signal was recovered after reload of fluorescent iDNA for the stimulations performed at Ei and E2. These values are almost on par with condition 0 that did not encounter stimulus (90% recovery). On the contrary, potential values close to water splitting E3 showed only 50% of fluorescence was recovered between the 1stand 2ndhybridization. This demonstrates that generation of Hydrogen gas tend to damage in an irreversible manner the bond between 5’thiosphosphate- anchored DNA and the SFA layer.
[0259] The entire protocol was repeated twice on the same LDC. The same fluorescence patterns were successfully reproduced three times (Fig. 21 and 22). On the voltammograms of the three solutions used for the electrochemical collections, a switch towards the left for the reduction area is observed for the third solution, resulting in lower currents and thus explaining the lower DNA collection obtained.
[0260] After each round of electrochemical collection, iDNA could successfully be hybridized again to the anchor (Fig. 23).
[0261] Conclusion:
[0262] A new redox system composed of chloroanilic acid and ascorbic acid was investigated to electrochemically modulate pH toward alkaline conditions. By screening activation potentials, iDNA hybridized at the surface of a LDC was extracted in localized areas. We noted that the area of collection can be modulated as a function of potential. This process was successfully reproduced three times on the same LDC where iDNA was reloaded after each cycle of electrochemical collection. In the future, this process could enable to collect specifically synthesized DNA strand for library prep, thus increasing purities of the template. The selected formulation is a good model to identify the range of currents required to locally modulate the pH toward alkaline conditions.
[0263] Example 4: Optimization of iDNA removal
[0264] Experiments were conducted to optimize the protocol to de-hybridize iDNA samples present on LDCs while preventing any damages to anchored DNA.
[0265] Experiments:
[0266] A Low Density Chip (LDC) was used: Ti / Au / Ti LDC (MEMSCAP) coated with SFA (3h curing time) and coupled with 2 pM anchored DNA (SEQ ID NO:1 , in 1 mM Phosphate buffer, 1 h). 2 pM, fluorescent iDNA template (SEQ ID NO:2, FAM-labelled, solution in 5 x SSC, 0.1 % Tween, 1 h) was then hybridized with the anchored DNA.
[0267] To remove entire iDNA arrays from the whole surface in open cell configuration, 10 mM phosphate in MQ water (pH = 12.0) was applied for 30 min.
[0268] Fluorescence scans (Amersham Typhoon, Cy2, 550 V) were carried out to check the state of the LDC after complete removal and reload of iDNA. The procedure was repeated three times on the same LDC to check reproducibility of DNA removal and possible degradation of anchored DNA.
[0269] Results:
[0270] A solution of 10 mM NaOH, 0.1 M Acetate in MQ water (pH = 11.8) was previously used, in the experiments described in the present disclosure, to remove iDNA from the whole surface of the LDC. After few cycles of iDNA arrays load / reloads, a fading effect was observed in the fluorescence scans. Acetate was thus demonstrated to be compatible with the performance of several cycles of DNA hybridization and dehybridization, but it was nevertheless suspected to induce some damage to the anchored DNA. A new formulation was tested using 22mM NaOH in 10 mM phosphate in MQ water (pH = 12.0). DNA removal and reloading were performed three times (Figure 25). The three chemical de-hybridizations resulted in an intensity decrease around 70%, which is comparable to what was obtained with the acetate-containing formulation. After each iDNA reloading, intensities of fluorescence above 90% were recovered (Figure 25), proving that the phosphate formulation was not degrading anchored DNA.
[0271] Conclusion:
[0272] A formulation composed of 10 mM phosphate buffer in MQ at pH 12.0 was investigated to chemically de-hybridize iDNA on LDCs. This formulation was shown to be capable of removing iDNA as efficiently as the former formulations used, without damaging the anchor more than 10% for three repeats.
[0273] Example 5: optimization of DNA extraction at specific locations of the LDC surface
[0274] Experiments were conducted to optimize the protocol to extract DNA template at specific locations of the LDC surfaces using electroactive redox system(s).
[0275] Experiments:
[0276] A Low Density Chip (LDC) was used: Ti / Au / Ti LDC (MEMSCAP) coated with SFA (3h curing time) and coupled with 2 pM anchored DNA (SEQ ID NO:1 , in 1 mM Phosphate buffer, 1 h). Fluorescent iDNA template (SEQ ID NO:2, FAM-labelled, solution in 5 x SSC, 0.1 % Tween, 1 h) was then hybridized with the anchored DNA.
[0277] A solution of 20 mM Chloroanilic acid, 20 mM TMHQ, 10 mM phosphate in MQ water (pH = 11.0, 5% DMSO) was used for the collection process.
[0278] One channel (WE - small rings) was then set at a specific potential V = -1 .8 V vs. Pt for 300s. The entire process was recorded while using Dino-Lite camera in a transparent LDC flow-cell. Once collection process was completed, the LDC was characterized or renewed. The entire iDNA sample was removed from the whole surface off cell configuration by using 10 mM phosphate in MQ water (pH = 12.0) for 30 min. The LDC was then reloaded by incubation of 2 pM of template (SEQ ID NO:2) in solution in 5 x SSC, 0.1 % Tween for 1 hour.
[0279] Fluorescence scans (Amersham Typhoon, Cy2, 550 V) were carried out to check the state of the LDC after preparation of the chip, after electrochemical collection of templates, after complete removal and reload of iDNA.
[0280] The entire procedure was repeated three times on the same LDC to check reproducibility of DNA removal and possible degradation of anchored DNA.
[0281] Results:
[0282] In previous experiments, a formulation containing 17 mM chloroanilic acid, 0.1 M sodium ascorbate, 0.1 M Acetate in MQ water (pH = 10.4, 2.6% DMSO) was used to perform electrochemical collection of iDNA. However, due to the progressive oxidation of sodium ascorbate in our storage conditions, the pH of the formulation and the cyclic voltammetry profiles were evolving. In addition, after each round of electrochemical collection and DNA reloading, the overall quantity of iDNA on LDC surface was decreasing, even though the protocol was still compatible with the performance of several cycles of hybridization / dehybridization. For these reasons, a new formulation was investigated. As in our previous experiments, phosphate was evidenced not to damage anchored DNA, phosphate buffer was used instead of acetate. In addition, sodium ascorbate was replaced by 2,3,5-trimethyl hydroquinone (TMHQ). Finally, the pH of the formulation was set at 11 .0 to facilitate electrochemical removal of iDNA as well as reinforce stabilization of chloroanilic acid.
[0283] Three electrochemical collection sessions of iDNA were then performed on LDC and resulted in the same pattern of fluorescence intensity loss (Figure 26). At the selected potential of -1 .8 V vs. Pt, the collection of iDNA was localized to the center of the WE. The charge collected (current vs time) at the end of the 300s stimulation were of 1.18 mC, 1.13 mC, and 0.83 mC, for the first, second, and third collection sessions, respectively. We also noted that reloading of iDNA was successful after each session: no degradation of anchored DNA was observed. This improvement proved that the chosen potential and the range of charge collected ( / .e. concentration of hydroxide molecules produced) were not destructive to the electrodes, the SFA surface and the anchored DNA.
[0284] Testing was extended further while storing the removal formulation for days. This time, a decrease in the pH of the formulation over time was evidenced and monitored (Figure 27). To assess whether the electrochemical collection was affected by the pH of the solution, a freshly prepared solution was compared with the same solution that was aged for 5h at room temperature. Their respective pH was measured at 11 .0 and 8.9. Voltammograms were recorded and compared in Figure 28: the changes observed in the range of potentials corresponding to chloroanilic acid reduction were minimal. Stimulation using the two solutions were then performed at a potential of -1 .8 V vs. Pt for 5 min, on the same LDC (Figure 29). The charge collected (current vs time) at the end of the 300s stimulation were of 1 .13 mC and 1.19 mC for the first and second electrochemical dehybridization, respectively. The patterns of iDNA removal and the decrease of fluorescence intensity (of around 65%) were similar for the two solutions (Figure 29). Finally, there was no significant impact of the solution aging and change of pH over 5h on the electrochemical collection of iDNA. If needed, the underlying mechanisms of the solution pH shift could be evaluated by proton-coupled electron transfer characterization method.
[0285] Conclusion:
[0286] A new redox system composed of chloroanilic acid and TMHQ was investigated to electrochemically modulate pH toward alkaline conditions. This new formulation has revealed to be superior in term of stability and accuracy for stimulation compared to the chloroanilic and ascorbic acid. Several repeats of the electrochemical removal of iDNA led to reproducible pattern and same quality of iDNA removal. It was shown to give stable results when aging for 5h after its pH was set to 11 .
[0287] Example 6: integrity of the synthesized DNA
[0288] Experiments were conducted to verify that synthesized DNA can be extracted electrochemically without damaging its sequence.
[0289] Experiments(s):
[0290] A Low Density Chip (LDC) was used: Ti / Au / Ti LDC (MEMSCAP) coated with SFA (6h curing time) and coupled with 2 pM anchored DNA (SEQ ID NO:1 , in 1 mM Phosphate buffer, 1 h). Fluorescent iDNA template (SEQ ID NO:2, FAM-labelled, solution in 5 x SSC, 0.1 % Tween, 1 h) was then hybridized with the anchor.
[0291] A chemical synthesis of +50nt was performed on the LDC. The elongation formulation was composed of 0.5 M Cacodylate buffer, 1 mM C0CI2, 10 pM F6 TdT (without glycerol), 500 pM dNTP-ONH2 in MQ water, +15% DMSO and 0.05% Tween. Deprotection was performed while using Deblock Buffer (Sodium acetate (pH 5.2) 0.6M, Sodium nitrite 1.3M). Proteinase K in TST buffer (Tris-HCI (pH 8.0) 10mM, EDTA solution 0.25mM, NaCI solution 100mM, Tween 20 solution 0.5% (v / v)) was used as an extra wash that occurred every 10 cycles of synthesis.
[0292] The target structure (DNA / n / f / ator-pavload-primer site) was:
[0293] TTTTTGCTGTTTCGCGTGACATTCTAAATACGGATGTGGC-ATCCGACTGAAAGTACGCGAG- TAGACTGCTAGAAATCCTTGTGATACG .
[0294] DNA templates were extracted electrochemically by using 20 pL of 20 mM chloroanilic acid, 20 mM TMHQ, 10 mM phosphate in MQ water (pH = 11.0, 5% DMSO). This solution was allowed to age for 1 h maximum. Each Working Electrodes (WE - small rings) were sequentially activated at specific potentials for 300s: V = VOCP; -1 .8 V; -2.0 V or -2.1 V vs. Pt. At each time, the solution was collected, the flow-cell was refilled with new solution before the following WE stimulation session. At the end, 4 iDNA templates were collected, one corresponding to a specific collection protocol (EOCP vs. E = - 1.8 V; -2.0 V or -2.1 V vs. Pt). Each template was amplified and indexed using primers (SEQ ID NO:6 and SEQ ID NO:7) at 0.5 pM, with 10 Amp. 120 Index. A positive control was prepared using 13.2 pg of control template in 1 pL of the same solution (Figure 30). Purification was performed while using Monarch kits.
[0295] Fluorescence scans (Amersham Typhoon, Cy2, 550 V) were used to check the state of the LDC before and after electrochemical collection of templates.
[0296] Samples were analyzed by Qubit, Fragment, and NGS analysis.
[0297] Res u Its (s):
[0298] A protocol was developed to extract synthesized DNA in a reduced volume of solution (20 pL). The sequential stimulation on the LDC led to collected charges of 0.6 mC, 1.4 mC, and 1.4 mC, all corresponding to the specific potentials of -1.8 V, -2.0, V and -2.1 V vs. Pt, respectively. From the fluorescence images, the pattern of DNA removal is unclear. The Fragment analyzer results showed that all samples were amplified and indexed, with a sharp peak at the expected length.
[0299] From Fragment Analyzer analysis, no deteriorated DNA strands nor smaller fragment and smears could have been identified. This proved that the e-Removal collection method and the formulation was compatible with PCR conditions for library prep. In terms of quantities, the samples 1 to 3 were in the same range of DNA concentrations, from 5.2 to 11 .5 ng / pL, eight times lower on average than control sample 4 (Figure 31). High NGS purities were obtained, with a mean value of 83.1 % and a maximal difference of 0.9% between the samples 1 to 3 (Figure 31). The plot analysis showed similar errors, with deletions and G to T substitutions being the principal ones. Finally, the formulation developed was suitable for DNA extraction and compatible with its PCR amplification and further analysis. From all these observations, we could conclude that the entire methodology has not degraded the collected DNA.
[0300] Conclusion:
[0301] This experiment shows that synthesized DNA from LDC can be extracted, amplified, and analyzed. The formulation used was compatible with PCR amplification and did not degrade DNA, as shown by the Fragment analyzer and NGS purities. Next, the same analysis will be performed on DNA synthesized through uniform electrochemical synthesis on LDC.
[0302] Example 7: Accuracy of the localization of DNA extraction
[0303] Experiments were carried out to determine electrochemical conditions to use for a precise control of the localization of DNA extraction. Experiments(s):
[0304] A low Density Chip (LDC) was used: Ti / Au / Ti LDC (MEMSCAP) coated with SFA (6h curing time) and coupled with 2 pM anchored DNA (SEQ ID NO:1 , in 1 mM Phosphate buffer, 1 h). Fluorescent iDNA template (SEQ ID NO:2, FAM-labelled, solution in 5 x SSC, 0.1 % Tween, 1 h) was then hybridized with the anchor.
[0305] A solution of 20 mM Chloroanilic acid, 20 mM TMHQ, 10 mM phosphate in MQ water (pH = 11.0, 5% DMSO) was used for the collection process. It was allowed to age for 1 h maximum.
[0306] Each of the LDC four Working Electrodes (WE - small rings) were set at specific potentials E(V) until the charge collected ( / .e. integration of current with time = absolute concentration of hydroxide ions produced) reached -1 mC or for a maximal duration of 600s. Once collection protocol was completed, the LDC was characterized and renewed. The entire iDNA was removed from the whole surface off cell w We using 10 mM phosphate in MQ water (pH = 12.0) for 30 min. The LDC was then reloaded while incubation 2 pM of template in solution in 5 x SSC, 0.1 % Tween for 1 hour.
[0307] Fluorescence scans (Amersham Typhoon, Cy2, 550 V) were used to check the state of the LDC after preparation, after electrochemical collection of templates, after complete removal and reload of iDNA.
[0308] The entire procedure was repeated twice in two consecutive days on the same LDC to assess the effect of potentials on DNA extraction localization. For the first electrochemical collection, the WE were set at the potentials V = VOCP; -1 .6 V; -1 .8 V or -2.1 V vs. Pt. For the second collection, they were set at V = VOCP; -1 .7 V; -1 .9 V or -2.2 V vs. Pt.
[0309] Res u Its (s):
[0310] Since the beginning of pH modulation experiments, an intermediate region was identified between the cathode and anode that is generated during stimulation. Considering the frequencies of deprotection cycles and the possible special shifts of deprotection area due to diffusion, we hypothesize that partially elongated DNA strands are generated in this intermediate region (see Figure 32).
[0311] Collection of both complete and partially elongated DNA strands shall lead to lower NGS purities when comparing the results of uniform electrochemical syntheses to chemical ones. The inventors hypothesized that this drawback could be overcome by performing precise removal of DNA in order to extract only the fully-elongated DNA.
[0312] The inventors thus searched to determine more finely the stimulation parameters, e.g. potential E (V) and charge Q (C), allowing to extract with precision areas of fully elongated DNA.
[0313] First, a range of potentials was determined that would allow DNA extraction without generating water splitting: from E (V) = -1 .6 to -2.2 V vs. Pt. Secondly, results from previous experiments showed that a charge collected of Q (C) = 1 mC during stimulation resulted in a complete extraction of DNA strands without damaging it, as compared to standard chemical extraction method.
[0314] The concept was to program a limit value of Q (C) = 1 mC for the stimulation while increasing E(V). For each coulometry, localization of DNA collection was characterized with fluorescence scans. Overlay of all coulometries measured are reported in the Figure 33. The lowest potential of E (V) = - 1 ,6V vs. Pt was not sufficient to obtain a collected charge of Q (C) = 1 mC within 600 s. It resulted in an incomplete extraction of iDNA (only half of what could be obtained according to the chemical extraction method) (Figure 34 and 35). From E (V) = -1.7 to -2.2 V vs. Pt, iDNA was completely removed, with an expansion of the collected area as a function of potentials. In term of accuracy, collection area could have been contained specifically inside the WE only for E (V) = -1 .7 V vs. Pt (Figure 3). Cycles of hybridization and removal can be repeated without substantial loss of signal (Figure 4).
[0315] As coulometry is directly attached to the absolute amount of hydroxide ion produced, this method can be considered as quasi-absolute: if the storage conditions do not degrade the formulation, the parameters explored in this example are perfectly reproducible and can be directly transposed to any electrochemical device.
[0316] Conclusion:
[0317] After having identified an electroactive redox system composed of chloroanilic acid and TMHQ, we showed that we could finely control the area of DNA collection on the LDC surface by varying potential E (V) of the reduction reaction. The entire method can be easily transposed to any device while keeping E (V) and Q (C) as references. This will enable to collect synthesized DNA on the area of choice as well as giving the possibility to boost purity rates of library preparations.
[0318] Example 8: Formulation for localized attachment of iDNA
[0319] Experiment(s):
[0320] Low Density Chips (LDCs): Ti / Au / Ti LDC (MEMSCAP), were coated with SFA (5h curing time) and coupled with 10 pM of anchored DNA in 0.1 M Phosphate buffer for 16h. e-Adsorption (electrical stimulation-driven attachment of iDNA) was performed in an open cell configuration. First, a solution of 0.5 M sodium acetate, 10 pM iDNA (FAM-labelled), pH 5, was used to perform e-Adsorption at 45°C. An electrical stimulation was applied to one Working Electrode (WE - small ring), with the potential being set at +0.8 V vs. Pt for 60 s. The surface was then washed with 0.5 M sodium acetate, pH 5, then with MQ water. Then a solution of 20 mM phosphate, 0.5 M KCI, 10 pM iDNA, pH 5 was used to perform a second e-Adsorption at 45°C. An electrical stimulation was applied to two other WEs, with the potential being set at +0.8 V vs. Pt for 60 s. The surfaces were washed with MQ water and dried. A stringent wash was then performed on LDCs to remove any physisorbed or partially hybridized iDNA. LDC’s surfaces were incubated with 5X SSC, 0.1 % Tween 20 for 5 min at 40°C. This step was repeated three times. They were incubated with 0.1X SSC, 0.002% Tween 20 for 30 s at 40°C, and then rinsed with MQ water and dried.
[0321] Fluorescence scans (Amersham Typhoon, Cy2, 550 V) were used to check the state of the LDCs after e-Adsorption and stringent wash.
[0322] Results: e-Adsorption was performed on different electrodes of the same LDC using two different solutions: we compared a formulation containing 20 mM phosphate, 0.5 M KCI, pH 5 to a formulation composed of acetate. In both cases, a strong and localized fluorescent signal could be evidenced. Thus, when using a low concentration of phosphate and high concentration of KCI, the same pattern of preferential iDNA hybridization as for a high concentration of acetate could be obtained. The e- Adsorption method can be performed with different formulations.
[0323] Conclusions:
[0324] We evidenced that the use of DNA anchoring and removal by hybridization allows the re-use of the surfaces and extends their lifetime. We have further improved the method by finding new formulations for the e-Adsorption process. Combining a low concentration of phosphate with a high concentration of KCI salt, we could obtain the same pattern of iDNA localized hybridization as for & formulation composed of acetate.
[0325] Example 9:
[0326] Investigation of anchored-DNA stability
[0327] Experiment(s):
[0328] Low Density Chips (LDCs): Ti / Au / Ti LDC (MEMSCAP), were coated with SFA (5h curing time), then washed with MQ water and coupled with 2 pM of fluorescent photocleavable DNA in 0.1 M Phosphate buffer overnight.
[0329] A set of LDCs were incubated for 104h in different solutions: MQ water (1); 22 mM NaOH, 10 mM phosphate, pH = 12 (2); 5X SSC, 0.1 % Tween 20 (3); 0.5 M acetate, pH = 5 (4); 0.5 M phosphate, pH = 5 (5); 20 mM phosphate, 0.5 M KCI, pH = 5 (6). They were imaged at t = 0, 1 , 7, 13, 80, and 104 h. Uniform chemical syntheses of +50 nt were then performed on LDCs at 37°C, using our flow cell design as previously described. Chemical deprotection was performed while using phosphonate- based deprotection buffer, as described in PCT / EP2024 / 062042, incorporated herein by reference. The elongation formulation was composed of 0.5M Caco buffer, 1 mM C0CI2, 10 pM TdT, 500 pM dNTP-ONH2 in MQ water and +15% DMSO. Proteinase K was used as an extra wash that occurred every 10 cycles of synthesis. The following sequence was synthesized: 5’-ATC-CGA-CTG-AAA-GTA-CGC-GAG-ATA-GAC-TGC- TAG-AAA-TCC-TTG-TGA-TTA-CG-3’ (SEQ ID NO: 11). The target structure (DNA f / ator-payload- primer site) was: TTTTTGCTGTTTCGCGTGACATTCTAAATACGGATGTGGC-
[0330] ATCCGACTGAAAGTACGCGAG-ATAGACTGCTAGAAATCCTTGTGATACG (SEQ ID NO: 13). DNA arrays were extracted through photocleaving (MQ water, 8W, A = 365 nm, 15 min). Each template was amplified and indexed. A positive control was prepared using 13.2 pg of Eurogentech template (GCTGTTTCGCGTGACATTCTAAATACGGATGTGGCATCCGACTGGGGGTACGCGAGATAGAC TGCTAGAAATCCTTGTGATTACG) (SEQ ID NO: 14) ‘in 1 pL of the same solution (Figure 1). Purification was performed while using Monarch kits.
[0331] Fluorescence scans (Amersham Typhoon, Cy2, 550 V) were used to check the level of fluorescence at different time during solution incubations, and after the synthesis.
[0332] Samples were analyzed with Qubit and NGS analysis.
[0333] Results:
[0334] The objective of this study is to study possible sources of loss of fluorescence during the EDS process on reusable LDC surfaces. Two hypotheses are that fluorescence loss is due to the DNA being removed from the surface or degraded due to the repeated exposition to different formulations. To assess these hypotheses, we used a surface coupled with a fluorescent photocleavable DNA as a model to study DNA anchor removal and degradation.
[0335] First, we studied whether the coupled DNA was being removed from the surface when being exposed to different formulations used in the DNA hybridization / removal cycles:
[0336] 1: MQ water, as a control condition.
[0337] 2: 22 mM NaOH, 10 mM phosphate, pH = 12 (formulation used for the chemical removal of the iDNA hybridized on the anchor).
[0338] 3: 5X SSC, 0.1 % Tween 20 (formulation used to hybridize iDNA on the anchor).
[0339] 4: 0.5 M acetate, pH = 5, which ( formulation used to perform e-Adsorption)
[0340] 5: 20 mM phosphate, 0.5 M KCI, pH = 5 (formulation used for e-Adsorption).
[0341] For I and 2, the first 13h of incubation were performed at room temperature, as they would normally be used. All the others were performed at 60°C. After 13h, all fluorescence intensities were higher than 94% (Table 1). As the processes (chemical removal, hybridization, e-Adsorption) were usually performed in less than 2h, this result evidenced that they could be carried out at least 6 times on the surface without removing the DNA coupled to the surface.
[0342] Temperature of incubation: 25°C, 60°C
[0343] Table 1 : Table of the fluorescence intensity evolution compared to t = Oh, for LDCs incubated in various formulations at either 25°C (gray background boxes) or 60°C (white background boxes).
[0344] Conclusions: To be able to use the reusable surfaces of the 120k CMOS for a long period of time, we studied the effect of different formulations on the removal of coupled DNA. We focused on the formulations used for iDNA hybridization, chemical removal, and e-Adsorption. Fluorescent labelled DNA was used, and its intensity measured in order to assess DNA removal from the surface. Incubation with an alkaline formulation (pH = 12) for 13 h at 25°C (corresponding to 26 cycles of chemical removal) was not impairing the surface. On the contrary, two formulations resulted in less than 25% decrease in fluorescence intensity after 100 h at 60°C and a chemical synthesis (incubation with 0.5 M acetate (pH = 5) or 20 mM phosphate, 0.5M KCI (pH = 5)). From the NGS analysis, it appeared that all formulations were generating a similar rate of errors in the DNA initiator.
[0345] SEQUENCES
[0346] Table 2: sequences referred to in the specification
[0347] REFERENCES Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.
Claims
CLAIMS
1. Method for synthesizing polynucleotides, comprising :(i) providing at least one anchor nucleic acid (101) immobilized to a solid surface (100); and(ii) repeating cycles of:(a) contacting the anchor nucleic acid (101) with at least one initiator nucleic acid (102) comprising a free 3’-OH end, under conditions such that the initiator nucleic acid (102) and the anchor nucleic acid (101) hybridize over at least a part of their nucleotide sequences;(b) elongating the 3’-OH end of said initiator nucleic acid (102), to produce a synthesized polynucleotide (103) bound to the initiator nucleic acid (102);(c) disrupting the hybridization of the initiator nucleic acid (102) to the anchor nucleic acid(101); and(d) optionally recovering the synthesized polynucleotide (103).
2. Method according to claim 1 , wherein step (c) comprises applying denaturing conditions to disrupt the hybridization between the initiator nucleic acid (102) and the anchor nucleic acid (101). wherein said denaturing conditions comprise the application of at least one denaturing agent, a pH change and / or heat, preferably wherein the denaturing agent is selected from formamide, an alkylsubstituted amide, urea or a urea-based denaturant, thiourea, guanidine, sodium salicylate, dimethyl sulfoxide (DMSO), propylene glycol, and their mixtures, and preferably wherein said pH change is generated by application of an electric potential or current at an electrode in the presence of one or more redox agent.
3. Method according to claim 1 or 2, wherein said initiator nucleic acid (102) comprises at least one cleavable group (106), preferably selected from a chemically-cleavable group, a photocleavable group and an enzymatically-cleavable group, and step (c) comprises cleaving the cleavable group (106) within the initiator nucleic acid (102), thereby breaking the initiator nucleic acid into two or more nucleic acid fragments, preferably further comprising applying denaturing conditions during and / or after the cleavage step to disrupt the hybridization of the cleaved initiator nucleic acid(102) to the anchor nucleic acid (101).
4. Method according to any one of claims 1 to 3, wherein step (c) comprises contacting the anchor nucleic acid (101) with a displacement nucleic acid (108), under conditions such that said displacement nucleic acid (108) hybridizes to the anchor nucleic acid (101), thereby disrupting the hybridization of the displacement nucleic acid (108) to the anchor nucleic acid (101).
5. Method of claim 4, wherein said displacement nucleic acid (108) and said anchor nucleic acid (101) comprises complementary sequences of nucleotides, wherein the sequence complementarity between the displacement nucleic acid (108) and the anchor nucleic acid (101) is higher than the sequence complementarity between the initiator nucleic acid (102) and the anchor nucleic acid (101).
6. Method of any of the preceding claims, wherein the anchor nucleic acid (101) is a singlestranded oligonucleotide and has its 3’-end attached to the solid surface (100), or is a single-stranded oligonucleotide immobilized by hybridization to an intermediate nucleic acid attached by its 5’-end to the solid surface (100), or is a hairpin nucleic acid attached to the solid surface (100).
7. Method of any of the preceding claims, wherein at step (b) the initiator nucleic acid (102) is elongated via a template-free elongation reaction.
8. Method of claim 7, wherein said template-free elongation reaction is enzyme-driven.
9. Method of claim 8, wherein said template-free elongation reaction is performed through the activity of a template-free polymerase, preferably a terminal deoxynucleotidyl transferase.
10. Method of any of the preceding claims, comprising a further step of amplifying the synthesized polynucleotide (103), thereby producing a plurality of amplified nucleic acids, preferably wherein any reactant incompatible with the amplification is removed before amplification, and optionally further comprising storing the synthesized polynucleotide (103) and / or the amplified nucleic acids.
11. Method of any one of the preceding claims, comprising a quality control step, comprising controlling that a synthesized polynucleotide (103) has been synthesized, and / or controlling the sequence of synthesized polynucleotide (103), preferably wherein said quality control step comprises hybridizing a nucleic acid probe to the synthesized polynucleotide (103), wherein said nucleic acid probe comprises a detectable moiety, and detecting the nucleic acid probe hybridized to the elongated polynucleotide.
12. Method of any of the preceding claims, wherein a plurality of different anchor nucleic acids (116, 117, 118) are immobilized at a plurality of sites on the solid surface, wherein at step (a), the plurality of anchor nucleic acids (116, 117, 118)) is contacted with a plurality of different initiator nucleic acids (1 19, 120, 121), wherein each different initiator nucleic acid hybridizes to a single anchor nucleic acid of the plurality of different anchor nucleic acids 116, 117, 118) through a specific hybridization sequence.
13. Method of claim 12, wherein step (c) comprises site-specifically disrupting the hybridization of the initiator nucleic acids (119, 120, 121) to the anchor nucleic acids (116, 117, 1 18).
14. Method of any one of the preceding claims, wherein the solid surface (100) is an electrochemical device comprising a plurality of groups of electrodes, wherein each group comprises a plurality of electrodes of the same type and each group is independently addressable, preferably wherein the electrochemical device is a CMOS chip.
15. Method of claim 14, wherein step (c) comprises applying denaturing conditions to disrupt the hybridization between the initiator nucleic acid (102) and the anchor nucleic acid (101), wherein said denaturing conditions comprise the application of a pH change .wherein said pH change is generated at at least one electrode of a group of electrodes by application of an electric potential or current at said electrode in the presence of one or more redox agent.
16. Method of claim 14 or claim 15, wherein step (a) comprises the application of an electrical potential or current at at least one electrode of a group of electrodes to perform hybridization of the initiator nucleic acid (102) and the anchor nucleic acid (101).
17. Method of any of the preceding claims, wherein step (a) is carried out in a phosphate- buffered solution or in an acetate-buffered solution.
18. Method of any of the preceding claims, wherein step (c) is carried out in a phosphate- buffered solution or in an acetate-buffered solution.
19. Kit adapted for use in the method of any one of claims 1 to 18, comprising:- an anchor nucleic acid and an initiator acid wherein said anchor nucleic acid and nucleic acids comprise complementary nucleotide sequences capable of being hybridized to one another, preferably wherein said complementary sequences are respectively located at the 5’-end of said first and second nucleic acids,- at least one nucleic acid polymerase, preferably a template-free polymerase such as a terminal deoxynucleotidyl transferase; and- optionally one or more 3'-0-blocked nucleoside triphosphate.
20. Kit of claim 19, wherein said initiator nucleic acid comprises one or more cleavable group(s) such that cleavage of the cleavable group(s) breaks the initiator nucleic acid into two or more nucleic acid fragments.
21. Kit of claim 19 or 20, wherein said kit comprises at least one displacement nucleic acid (108) comprising a sequence of nucleotides complementary with the anchor nucleic acid (101), wherein the sequence complementarity between the displacement nucleic acid (108) and the anchor nucleic acid (101) is higher than the sequence complementarity between the initiator nucleic acid (102) and the anchor nucleic acid (101).
22. Kit of any one of claims 19 to 21 , wherein said kit comprises at least one denaturing agent capable of disrupting the hybridization between the anchor nucleic acid (101) and the initiator nucleic acid (102).
23. Method for storing information, comprising providing one or more items of information in the form of binary data, converting said binary data into one or more polynucleotide sequences, synthesizing polynucleotides having said polynucleotide sequences according to the method defined in claims 1 to 18, optionally amplifying said polynucleotides and storing said polynucleotides.