Molecules resistant to nuclease digestion
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- LIFE TECHNOLOGIES CORP
- Filing Date
- 2024-06-28
- Publication Date
- 2026-05-06
AI Technical Summary
Current bacteriophage-mediated RNA packaging systems are limited by the size of encapsidated RNA sequences, typically accommodating only up to 3 kilobases, and produce low concentrations of encapsidated RNA, making them unsuitable for detecting large viral RNA sequences like HIV, and are costly due to high production frequencies.
A dual-expression polynucleotide vector system that includes a bacteriophage promoter sequence, RNA hairpin structures, a multiple cloning site, and a viral coat protein sequence, allowing for the encapsidation of larger non-bacteriophage sequences up to 7 kilobases and increasing production yields to concentrations greater than 10^6 copies/mL, making them resistant to ribonuclease digestion.
The system enables the production of nuclease-resistant RNA detection and quantification standards that can effectively detect and quantify larger viral RNA sequences with improved stability and cost-effectiveness by encapsidating up to 7 kilobase RNA segments in high concentrations, overcoming the limitations of existing systems.
Smart Images

Figure US2024036278_02012025_PF_FP_ABST
Abstract
Description
MOLECULES RESISTANT TO NUCLEASE DIGESTIONCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority under 35 U.S.C. §1 19(e) to U.S. Provisional Patent Application No. 63 / 51 1 ,127, filed June 29, 2023, which is herein incorporated by reference in its entirety.SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created, June 26, 2024, is named “TP386985WO1.xml” and is 2,160 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety.FIELD
[0003] This disclosure relates to various aspects and uses of nuclease resistant nucleic acids. The disclosure also provides various methods of producing, or synthesizing, such nuclease resistant nucleic acids, use of viral-like systems to produce large amounts of nucleic acid and the use of nuclease resistant nucleic acids in various diagnostic assays. The disclosure provides methods of assaying for the presence and / or quantity of RNA.BACKGROUND
[0004] Naked RNA standards, single stranded RNA molecules and double stranded RNA molecules are highly susceptible to ribonuclease digestion. Due to the prevalence of ribonucleases in the environment, the use of naked RNA standards in assays designed to detect the presence of an RNA virus in a sample has been challenging. For example, a method typically employed to detect the presence of an RNA virus is fluorescent RT-PCR. An inherent problem in diagnostic PCR assays is the presence of amplification inhibitors which may cause false-negative results. Therefore, the addition of an amplifiable nucleic acid in the PCR assay serves as an internal control (IC). These internal controls are typically naked RNA molecules and can be readily degraded by any ribonuclease at the site of sample preparation and / or the site where the fluorescent RT-PCR method is performed. Since effectively monitoring whether ribonuclease contamination occurs during the nucleic acid extraction process of the sample and / or during the setup of the detection method cannot be easily performed, and the accuracy of the detection method is difficult to ensure, the development of quality control samples and standard substances that are stable, have no infectivity and can be used for detecting viral nucleic acid sequence is of great significance to the clinical detection of viral species.
[0005] Bacteriophages that possess RNA as their genetic material (i.e. , RNA bacteriophages) have developed a means to protect their RNA genetic material from ribonuclease digestion. RNA bacteriophages have long been used as model systems to study the mechanisms of RNA replication and translation. The RNA genome within RNA bacteriophages is resistant to ribonuclease digestion due to the protein coat produced by the bacteriophage. Bacteriophages are simple to grow and purify, and genomic RNA can be purified from the bacteriophages. Bacteriophages can be classified into subgroups based on their serotyping (e.g., group 1, 11, III or IV); however, genetically speaking, bacteriophages are divided into two major subclasses, A and B (Stockley, 1994; Witherell, 1991). Bacteriophage MS2 / R17 (serological group I) has been well- studied, in addition to other RNA bacteriophages such as GA (group II), Q-beta (group III), andSP (group IV). These RNA bacteriophages infect the male strains of Escherichia coli, that is, those which harbor the F' plasmid and produce an F pilus for conjugation.
[0006] The MS2 bacteriophage is an icosahedral structure, 275 A in diameter, and lacks a tail or any other obvious surface appendage (Stockley, 1994). This bacteriophage has large holes at both the 5- and 3-fold axes which might be the exit points of the RNA during bacterial infection. The MS2 bacteriophage consists of 180 units of the bacteriophage coat protein ("14 kDa) which encapsidate the bacteriophage genome (Stockley, 1994; Witherell, 1991). The MS2 RNA genome is a single strand encoding the (+) sense of 3569 nucleotides. The genes of the RNA genome are organized from the 5' end as follows: the maturase or A protein, the bacteriophage coat protein, a 75 amino acid lysis protein, and a Replicase subunit. The lysis gene overlaps the coat protein gene and the Replicase gene and is translated in the +1 reading frame of the coat protein. Each bacteriophage particle has a single copy of maturase which is required for interacting with the F pilus and thus mediating bacterial infection.
[0007] The MS2 bacteriophage has been used to create protected RNA molecules. Pasloske et al. (J. Clin. Microbiol. 1998, 3590-3594) produced a plasmid-driven packaging system possessing DNA that encoded the MS2 coat protein, a target RNA sequence, and the MS2 operator downstream of an inducible lac promoter. The recombinant packaging vector was transformed into E. coli and isopropyl-b-D-thiogalactopyranoside was added to induce the transcription of the target RNA sequence and the expression of pseudoviral particles. As the coat protein translated, it bound to the operator sequence at the 3’ end of the target RNA sequence and initiated encapsidation of the target RNA sequence to produce pseudoviral particles. The target RNA sequences packaged within the coat protein of MS2 were shown to possess high resistance to DNase and RNase treatment.
[0008] These “packaged” RNA sequences are often referred to as virus-like particles or VLPs. Recently, considerable efforts have been devoted to construction of VLPs. Before 2013, more than 110 VLPs had been constructed from viruses belonging to 35 families (Zeltins, Mol.Biotechnol. 2013, 53, 92-107). MS2 VLPs were prevalent and offered a novel delivery platform for several years due to their effective, convenient process for packaging and delivering RNAs, DNAs, epitope peptides, and drugs within bacteriophage capsids (Sun et al., Biochem. Biophys. Res. Commun. 2011 , 407, 124-128; Wei et al., Biomed. Phamnacother. 2009, 63, 313-318; Wu et al., Nanomedicine. 2005, 1 , 67-76; Zhang et al., PLoS One. 2015, 10, e0134681; Zhang et al. Appl. Microbiol. Biotechnol. 2015, 99, 7047-7057.), their excellent adjuvant properties, their improved safety over traditional vaccines derived from attenuated or inactivated infectious viral strains and their capability to target specific tissues after modification with a ligand.
[0009] Though the use of bacteriophages to protect RNA sequences has been shown to be successful, current bacteriophage-mediated RNA packaging systems are limited by the size of the encapsidated RNA sequence. Current bacteriophage-mediated RNA packaging systems are merely designed to encapsidate RNA sequences that are about 3 kilobases (KB) or less in length. This limitation has made it challenging to use encapsidated RNA sequences or molecules as internal controls in detection methods designed to detect the presence of large viral RNA sequences (e.g., HIV or those having more than 3KB) in samples. Additionally, current bacteriophage-mediated RNA packaging methodologies and systems produce low concentrations of encapsidated RNA sequences or molecules (about 5 x 105copies / mL). These low production yields lead to higher production frequencies of encapsidated RNA sequences or molecules and higher production costs.
[0010] The dual-expression polynucleotide vectors and methods described herein address the limitations of current bacteriophage-mediated RNA packaging methodologies and systems.SUMMARY
[0011] Disclosed herein is a dual-expression polynucleotide vector comprises a first polynucleotide sequence that comprises, in the 5’ to 3’ direction, a bacteriophage promotersequence operatively linked to a sequence encoding a plurality of first RNA hairpin structures, a multiple cloning site sequence, a sequence encoding a plurality of second RNA hairpin structures, and a transcription terminator sequence; and a second polynucleotide sequence that comprises, in the 5’ to 3’ direction, a bacteriophage promoter sequence operatively linked to a ribosome binding site sequence, a viral coat protein sequence, and the transcription terminator sequence.
[0012] In an embodiment, the vector further com prises a sequence encoding a viral maturase protein.
[0013] In an embodiment, the viral maturase protein is a MS2 viral maturase protein.
[0014] In an embodiment, the vector further comprises a sequence encoding a gene that confers antibiotic resistance.
[0015] In an embodiment, the gene that confers antibiotic resistance is selected from the group consisting of ampicillin, kanamycin, spectinomycin, streptomycin, carbenicillin, bleomycin, erythromycin, polymyxin B, streptomycin, tetracycline, and chloramphenicol.
[0016] In an embodiment, the bacteriophage promoter sequence is an inducible promoter sequence.
[0017] In an embodiment, the bacteriophage promoter sequence is one selected from a T7 promoter sequence, a pTAC promoter sequence, and a pBAD promoter sequence.
[0018] In an embodiment, the viral coat protein is a MS2 viral coat protein.
[0019] In an embodiment, the viral coat protein is a modified viral coat protein comprising a viral coat protein having an exogenous polypeptide sequence conjugated to an exterior of said viral coat protein.
[0020] In an embodiment, the exogenous polypeptide sequence is a targeting ligand that specifically binds to a cell surface protein or is an antigen.
[0021] In an embodiment, the exogenous polypeptide sequence is a detectable tag.
[0022] In an embodiment, the viral coat protein is a modified viral coat protein comprising a viral coat protein having an exogenous polypeptide sequence conjugated to the interior of said viral coat protein.
[0023] In an embodiment, the plurality of the first RNA hairpin structures are identical.
[0024] In an embodiment, the plurality of the second RNA hairpin structures are identical.
[0025] In an embodiment, at least one of the plurality of first RNA hairpin structures is identical to at least one of the second RNA hairpin structures.
[0026] In an embodiment, at least one of the plurality of first and second RNA hairpin structures includes SEQ ID NO: 1.
[0027] In an embodiment, the sequence encoding the plurality of first RNA hairpin structures encodes two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve RNA hairpin structures.
[0028] In an embodiment, the sequence encoding the plurality of second RNA hairpin structures encodes two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve RNA hairpin structures.
[0029] In an embodiment, the multiple cloning site sequence further comprises a nonbacteriophage sequence.
[0030] In an embodiment, the non-bacteriophage sequence is greater than 3 kb in length.
[0031] In an embodiment, the non-bacteriophage sequence is between about 4 kb to about 7 kb in length.
[0032] In an embodiment, the non-bacteriophage sequence is about 6 kb in length.
[0033] In an embodiment, the non-bacteriophage sequence is about 500 bp in length.
[0034] In an embodiment, the vector can exclude a sequence encoding a viral maturase protein.
[0035] Disclosed herein is a recombinant RNA segment, comprises, in the 5’ to 3’ direction, a plurality of first RNA hairpin structures separated from a plurality of second RNA hairpin structures by a non-bacteriophage sequence.
[0036] In an embodiment of the second aspect, the plurality of the first RNA hairpin structures are identical.
[0037] In an embodiment, the plurality of the second RNA hairpin structures are identical.
[0038] In an embodiment, at least one of the plurality of the first hairpin structures is identical to at least one of the second RNA hairpin structures.
[0039] In an embodiment, at least one of the plurality of first and second RNA hairpin structures has SEQ ID NO: 1.
[0040] In an embodiment, the plurality of first RNA hairpin structures comprises two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve RNA hairpin structures.
[0041] In an embodiment, the plurality of second RNA hairpin structures comprises two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve RNA hairpin structures.
[0042] In a third aspect, an RNA detection and / or quantification standard or control, comprises the recombinant RNA segment encapsidated in a bacteriophage viral coat protein, wherein the RNA detection and / or quantification standard or control is resistant to ribonuclease.
[0043] In an embodiment, the bacteriophage viral coat protein is of an E. coli bacteriophage of genetic subclass A.
[0044] In an embodiment, the bacteriophage viral coat protein is of an E. coli bacteriophage of serological group I.
[0045] In an embodiment, the bacteriophage viral coat protein is of an MS2 / R17 bacteriophage.
[0046] In an embodiment, the bacteriophage viral coat protein is a modified bacteriophage viral coat protein.
[0047] In an embodiment, the modified bacteriophage viral coat protein further comprises a polypeptide sequence that is a targeting ligand that specifically binds to a cell surface protein or is an antigen.
[0048] In an embodiment, the modified bacteriophage viral coat protein further comprises a polypeptide sequence that is a detectable tag.
[0049] In an embodiment, the non-bacteriophage sequence is a standard.
[0050] In an embodiment, the non-bacteriophage sequence is a diagnostic standard.
[0051] In an embodiment, the non-bacteriophage sequence is a standard for a virus, a pathogen, or a synthetic RNA.
[0052] In an embodiment, the non-bacteriophage sequence further comprises a modified virus sequence.
[0053] In an embodiment, the RNA detection and / or quantification standard or control is a standard for a virus, a pathogen, or a synthetic RNA.
[0054] Disclosed herein is a method for detecting for the presence or quantity of target RNA in a sample, comprises admixing the sample with the RNA detection and / or quantification standard or control; isolating RNA from the admixture; and assaying the isolated RNA for the presence or quantity of the target RNA.
[0055] Disclosed herein is a method of producing an RNA detection and / or quantification standard or control including the recombinant RNA segment encapsidated in a bacteriophage viral coat protein, and wherein the RNA detection and / or quantification standard or control is resistant to ribonuclease, the method comprises transforming a vector including sequences encoding the recombinant RNA segment into a cell to produce a transformed cell; and culturing the transformed cell under conditions allowing for transcription of the recombinant RNA segment, co-expression of the bacteriophage viral coat protein and the recombinant RNA segment, and encapsidation of the recombinant RNA segment in the bacteriophage viral coat protein such that the RNA detection and / or quantification standard or control is resistant to ribonuclease.
[0056] Disclosed herein is a method of producing an RNA detection and / or quantification standard or control in vivo comprises transforming the vector into a cell to produce a transformed cell; and culturing the transformed cell under conditions allowing for transcription of a recombinant RNA segment encoded by sequences in the vector, co-expression of the viral coat protein and a recombinant RNA segment, and encapsidation of the recombinant RNA segment in the viral coat protein such that the RNA detection and / or quantification standard or control is resistant to ribonuclease.
[0057] In embodiments, a concentration of the RNA detection and / or quantification standard or control is greater than 1 x 106copies / mL.
[0058] In embodiments, the concentration of the RNA detection and / or quantification standard or control is between about 1 x 107and 1 x 1014copies / mL.
[0059] In embodiments, the concentration of the RNA detection and / or quantification standard or control is about 1 x 1013copies / mL.
[0060] In embodiments, the culturing the transformed cell includes administering an induction agent to allow for transcription of the recombinant RNA segment and expression of the viral coat protein.
[0061] In embodiments, the induction agent is selected from the group consisting of isopropyl P-D-1 -thiogalactopyranoside (IPTG), lactose, arabinose and propionate.
[0062] In embodiments, the induction agent is IPTG.
[0063] In embodiments, the method further comprises purifying the RNA detection and / or quantification standard or control.
[0064] In embodiments, the purifying includes performing ultracentrifugation, size exclusion chromatography, or combinations thereof.
[0065] In embodiments, the method further comprises subjecting the RNA detection and / or quantification standard or control to a nuclease treatment.
[0066] Disclosed herein is a method of producing a nucleic acid detection and / or quantification standard or control comprises transforming the vector into a cell to produce a transformed cell; and culturing the transformed cell under conditions allowing for transcription of a recombinant RNA segment encoded by sequences in the vector, co-expression of the viral coat protein and the recombinant RNA segment, and encapsidation of the recombinant RNA segment in the viral coat protein such that the encapsidated recombinant RNA segment is resistant to ribonuclease.
[0067] Disclosed herein is a nucleic acid detection and / or quantification standard or control is produced by the method of the seventh aspect.
[0068] Disclosed herein is a method for detecting the presence or quantity of target nucleic acid in a sample, comprises admixing the sample with the nucleic acid detection and / or quantification standard or control; isolating nucleic acid from the admixture; and assaying the isolated nucleic acid for the presence or quantity of the target nucleic acid.
[0069] Disclosed herein is a method of producing an encapsidated therapeutic product comprises transforming the vector into a cell to produce a transformed cell; and culturing the transformed cell under conditions allowing for transcription of a recombinant RNA segment encoded by sequences in the vector, co-expression of the viral coat protein and the recombinant RNA segment, and encapsidation of the recombinant RNA segment in the viral coat protein such that the encapsidated RNA segment is resistant to ribonuclease.
[0070] Disclosed herein is an encapsidated therapeutic product is produced by the method of the tenth aspect.
[0071] Disclosed herein is a method for detecting the presence or quantity of target nucleic acid in a sample, comprises admixing the sample with the encapsidated therapeutic product; isolating nucleic acid from the admixture; and assaying the isolated nucleic acid for the presence or quantity of the target nucleic acid.BRIEF DESCRIPTION OF THE DRAWINGS
[0072] The skilled artisan will understand that the drawings described below are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
[0073] FIG. 1 depicts an exemplary embodiment of a dual-expression polynucleotide vector that includes a first polynucleotide sequence including a bacteriophage promoter sequence, a sequence encoding a plurality of first RNA hairpin structures, a multiple cloning site sequence, a sequence encoding a plurality of second RNA hairpin structures, and a transcription terminator sequence; and a second polynucleotide sequence including a bacteriophage promoter sequence, a ribosome binding site sequence, a viral coat protein sequence, and a transcription terminator sequence.
[0074] FIG. 2 depicts an exemplary embodiment of a dual-expression polynucleotide vector that includes a maturase sequence.
[0075] FIG. 3 depicts an exemplary embodiment of a method for producing or synthesizing an RNA detection and / or quantification control or standard including a recombinant RNA segment.
[0076] FIG. 4A shows an electron microscopic image of a construct including recombinant RNA segments encapsidated by viral coat proteins according to exemplary embodiments, and FIG. 4B shows the Ct values for the construct compared to an empty capsid and a control.
[0077] FIG. 5A shows an electron microscopic image of a construct including recombinant RNA segments encapsidated by viral coat proteins according to exemplary embodiments, and FIG. 5B shows percentage of resistance for purified fractions of the construct compared to controls.DETAILED DESCRIPTION
[0078] The present disclosure provides various aspects and uses of nuclease resistant nucleic acids. The disclosure also provides various methods of producing, or synthesizing, suchnuclease resistant nucleic acids, use of viral-like systems to produce large amounts of nucleic acid and the use of nuclease resistant nucleic acids in various diagnostic assays. The disclosure provides methods of assaying for the presence and / or quantity of RNA.
[0079] The present disclosure provides RNA detection and / or quantification controls or standards, and methods of producing RNA detection and / or quantification controls or standards. The disclosure provides polynucleotide vectors for synthesis of an RNA detection and / or quantification control or standard including a recombinant nucleic acid segment encapsidated by viral coat protein.
[0080] One aspect of the present disclosure is a dual-expression polynucleotide vector that includes the following: (i) a first polynucleotide sequence including, in the 5’ to 3’ direction, a bacteriophage promoter sequence operatively linked to a sequence encoding a plurality of first RNA hairpin structures, a multiple cloning site sequence, a sequence encoding a plurality of second RNA hairpin structures, and a transcription terminator sequence; and (ii) a second polynucleotide sequence including, in the 5’ to 3’ direction, a bacteriophage promoter sequence operatively linked to a ribosome binding site sequence, a viral coat protein sequence, and a transcription terminator sequence.
[0081] As used herein, the term “dual expression polynucleotide vector” refers to a polynucleotide vector that comprises, or includes, two promoters that terminate transcription at the same termination signal and allow for the expression of two genes from one expression vector.
[0082] As used herein, the term “polynucleotide” refers to either a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA). This term should be understood to include, as equivalents, analogs of either DNA or RNA made from nucleotide analogs and to be applicable to single stranded (such as sense or antisense) and double stranded polynucleotides. The term as used herein also encompasses cDNA, that is complementary or copy DNA produced from an RNA template, for example by the action of a reverse transcriptase.
[0083] As used herein, the term “bacteriophage” refers to any virus that parasitizes a bacterium by infecting it and reproducing inside it. A “RNA bacteriophage” is a bacteriophage that uses RNA as its genetic material.
[0084] As used herein, the term “promoter sequence” refers to a polynucleotide sequence upstream of a gene where relevant proteins (such as RNA polymerase and transcription factors) bind to initiate transcription of that gene.
[0085] As used herein, the term “RNA hairpin structure” refers to a loop of messenger RNA (mRNA) that is created when an mRNA strand folds and forms base pairs with another section of the same strand. The resulting structure takes the shape of a loop or a U-shape. Hairpins are a type of secondary structure in RNA molecules.
[0086] As used herein, the term “multiple cloning site sequence” refers to a short segment of polynucleotides present in an expression vector that comprises, or includes, restriction sites and allows for the insertion of a polynucleotide sequence of interest into the expression vector.
[0087] As used herein, the term “transcription terminator sequence” refers to a sequence of polynucleotides that marks the end of transcription of a gene or operon.
[0088] As used herein, the term “ribosome binding site sequence” refers to a sequence of polynucleotides to which ribosomes can bind and initiate translation.
[0089] As used herein, the term “a viral coat protein sequence” refers to a polynucleotide sequence that, once transcribed and translated, produces a capsid or protein shell around a polynucleotide sequence or molecule. The term “capsid” refers to a macromolecular assembly composed of viral protein subunits. A capsid can contain about 60, 120, 180, 240, 300, 360 or more than 360 viral protein subunits. The interactions of these subunits lead to the formation of a protective protein shell with an inherent repetitive organization and a spherical or icosahedarical structure.
[0090] In exemplary embodiments, the dual-expression polynucleotide vector includes a sequence encoding a viral maturase protein. The maturase protein encoding sequence canencode any maturase protein known to those of ordinary skill in the art. In some exemplary embodiments, the maturase protein encoding sequence encodes for the MS2 mutase protein.
[0091] In exemplary embodiments, the sequence encoding a viral maturase protein is optional, and thus the dual-expression polynucleotide vector may not include a sequence encoding a viral maturase protein.
[0092] In exemplary embodiments, the dual-expression polynucleotide vector includes a sequence encoding a gene that confers antibiotic resistance. The sequence can encode a gene that confers resistance to ampicillin, kanamycin, spectinomycin, streptomycin, carbenicillin, bleomycin, erythromycin, polymyxin B, streptomycin, tetracycline, chloramphenicol and any combination thereof. It should be understood that the sequence can also encode for other genes known by those of ordinary skill in the art that confer resistance to antibiotics not exemplified above.
[0093] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the bacteriophage promoter sequence in the first and / or second polynucleotide sequence, wherein the bacteriophage promoter sequence in the first and / or second polynucleotide sequence is an inducible promoter sequence. The bacteriophage promoter sequence in the first and / or second polynucleotide sequence can be an inducible promoter sequence selected from, but not limited to, a T7 promoter sequence, a pBAD promoter sequence, a pTAC promoter sequence or any other inducible promoter sequence known to those of ordinary skill in the art.
[0094] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the bacteriophage promoter sequence in the first and second polynucleotide sequence, wherein the bacteriophage promoter sequence in the first polynucleotide sequence and the bacteriophage promoter sequence in the second polynucleotide sequence are identical.
[0095] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the bacteriophage promoter sequence in the first and second polynucleotide sequence,wherein the bacteriophage promoter sequence in the first polynucleotide sequence and the bacteriophage promoter sequence in the second polynucleotide sequence are different
[0096] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the viral coat protein sequence, wherein the viral coat protein sequence is a sequence that encodes the MS2 viral coat protein. It should be understood that the dual-expression polynucleotide vector can contain a viral coat protein sequence known to those of ordinary skill in the art that encodes for a viral coat protein sequence other than the MS2 viral coat protein. In some embodiments, the dual-expression polynucleotide vector comprises, or includes, the viral coat protein sequence, wherein the viral coat protein sequence is a modified viral coat protein comprising a viral coat protein having an exogenous polypeptide sequence conjugated to the exterior of the viral coat protein. In yet further embodiments, the exogenous polypeptide conjugated to the exterior of the viral coat protein is an exogenous polypeptide the specifically binds to a cell surface protein.
[0097] There are a number of cell surface proteins, for example cell surface receptors, which may be appropriately targeted by the exogenous polypeptide and already have a targeting ligand (e.g., an antibody or portion thereof) already available. Such structures include, but are not limited to: Class I and Class II major histocompatibility antigens; various cytokines (e.g., receptors for IL- 1 , IL-4, IL-6, IL-13, IL-22, IL-25, IL-33, etc.), cell-type specific growth hormones, brain derived neurotrophic Factor (BDNF), ciliary neuronal factor (CTNF), colony stimulating growth factor, endothelial growth factor, epithelial growth factor, fibroblast growth factor, collagen derived neurotrophic factor, glial growth factor, gro-beta / mip 2, hepatocyte growth Factor, insulin-like growth factor, interferon (a-IFN, [3-IFN, ylFN, common IFN), interleukin (IL-1 , IL-2, IL-3, IL-4, IL- 5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14), keratinocyte growth factor, leukemia inhibitory factor, macrophage / monocyte chemotactic activator, nerve growth factor, neutrophil activating factor 2, platelet derived growth factor, stem cell factor, transforming growth factor, tumor necrosis factor. As receptors for vascular endothelial growth factor, and lipid proteins,additional transmembrane receptors such as PRLR or other type 1 transmembrane receptors, G- protein coupled receptors such as GCGR, Navi. 7, a receptor comprising an ion channel such as ASIC1 or ASIC2; Cell adhesion molecules; transport molecules of metabolites such as amino acids; Antigen receptors of B- and T-lymphocytes (e.g. B cell receptors and binding proteins (e.g. CD19, CD20, etc.) and T cell receptors and binding proteins (e.g. CD3, CD4, CD8, etc.); Tetraspanin protein (e.g. CD63).
[0098] In yet further embodiments, the exogenous polypeptide conjugated to the exterior of the viral coat protein is an antigen. Non-limiting exemplary antigens may include pathogenic viral or bacterial antigens. For example, exemplary bacterial antigens may be derived from organisms that cause diphtheria, tetanus, pertussis, meningitis, and other pathogenic states, including, without limitation, antigens derived from Corynebacterium diphtheriae, Clostridium tetani, Bordetella pertussis, Neisseria meningitides, including serotypes Meningococcus A, B, C, Y and WI35 (MenA, B, C, Y and WI35), Haemophilus influenza type B (Hib), and Helicobacter pylori. Exemplary viral antigens may be derived from a double-stranded RNA virus, a positive sense RNA virus, a negative sense RNA virus, a retrovirus, such as a Coronaviridae virus, a Picornaviridae virus, a Caliciviridae virus, a Flaviviridae virus, a Togaviridae virus, a Bornaviridae, a Filoviridae, a Paramyxoviridae, a Pneumoviridae, a Rhabdoviridae, an Arenaviridae, a Bunyaviridae, an Orthomyxoviridae, or a Deltavirus.
[0099] In yet further embodiments, the exogenous polypeptide conjugated to the exterior of the viral coat protein is a detectable tag. Non-limiting examples of detectable tags include glutathione-S-transferase, poly-histidine, avidin, streptavidin, FLAG, V5, Myc, hemagglutinin, and NE.
[0100] In some embodiments, the dual-expression polynucleotide vector comprises, or includes, the viral coat protein sequence, wherein the viral coat protein is a modified viral coat protein comprising a viral coat protein having an exogenous polypeptide sequence conjugated to the interior of the viral coat protein. In some embodiments, the exogenous polypeptide conjugatedto the interior of the viral coat protein has pharmaceutical properties. For example, the exogenous polypeptide may be a therapeutic antibody.
[0101] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of first RNA hairpin structures, wherein all of the plurality of first RNA hairpin structures encoded are identical.
[0102] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of first RNA hairpin structures, wherein all of the plurality of first RNA hairpin structures have identical polynucleotide sequence.
[0103] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of first RNA hairpin structures, wherein at least two of the first RNA hairpin structures have different structures.
[0104] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of first RNA hairpin structures, wherein at least two of the first RNA hairpin structures have different polynucleotide sequences.
[0105] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of second RNA hairpin structures, wherein all of the plurality of second RNA hairpin structures are identical.
[0106] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of second RNA hairpin structures, wherein all of the RNA hairpin structures have identical polynucleotide sequence.
[0107] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of second RNA hairpin structures, wherein at least two of the second RNA hairpin structures have different structures.
[0108] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of second RNA hairpin structures, wherein at least two of the second RNA hairpin structures have different polynucleotide sequences.
[0109] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of first RNA hairpin structures, wherein each RNA hairpin structure in the sequence has a polynucleotide sequence of AACAUGAGGAUCACCCAUGU (SEQ ID NO: 1).
[0110] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of second RNA hairpin structures, wherein each RNA hairpin structure in the sequence has a polynucleotide sequence of AACAUGAGGAUCACCCAUGU (SEQ ID NO: 1).
[0111] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of first RNA hairpin structures and the sequence encoding a plurality of second RNA hairpin structures, wherein has all RNA hairpin structures have a polynucleotide sequence of AACAUGAGGAUCACCCAUGU (SEQ ID NO: 1). An advantage of having RNA hairpin structures having the sequence of SEQ ID NO: 1 in the sequences encoding a plurality of RNA hairpin structures is that it allows for tighter encapsidation of the transcribed product of the polynucleotide sequence inserted into the multiple cloning site of the dual expression vector.
[0112] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of first RNA hairpin structures, wherein the sequence encodes two, three, four, five, six, seven, eight, nine, ten, eleven or at least twelve RNA hairpin structures.
[0113] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of second RNA hairpin structures, wherein the sequence encodes two, three, four, five, six, seven, eight, nine, ten, eleven, or at least twelve RNA hairpin structures.
[0114] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the sequence encoding a plurality of first RNA hairpin structures and a plurality of secondRNA hairpin structures, wherein a number of the first RNA hairpin structures is different than a number of the second RNA hairpin structures. For instance, there can be more of the first RNA hairpin structures than the second RNA hairpin structures. Alternatively, there can be more of the second RNA hairpin structures than the first RNA hairpin structures.
[0115] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the multiple cloning site sequence, wherein the multiple cloning site sequence includes a non-bacteriophage polynucleotide sequence.
[0116] As used herein, the term “non-bacteriophage polynucleotide sequence” refers to any polynucleotide sequence not naturally expressed by a bacteriophage.
[0117] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the multiple cloning site sequence, wherein the multiple cloning site sequence includes a non-bacteriophage polynucleotide sequence originating from a virus (for instance, HIV-1 , HIV- 2, HCV, HTLV-1 , HTLV-2, hepatitis G, an enterovirus, Zika virus, orthoebolaviruses such as Ebola virus), or a pathogen (for instance, a blood-borne pathogen, bacterium, or a microorganism). However, embodiments are not limited thereto, and the non-bacteriophage polynucleotide sequence can originate from any source of RNA.
[0118] In some embodiments, the non-bacteriophage polynucleotide sequence is a synthetic sequence. It should be understood that the multiple cloning site sequence can include other nonbacteriophage polynucleotide sequences known to those of ordinary skill in the art that are not exemplified above.
[0119] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the multiple cloning site sequence, wherein the multiple cloning site sequence includes a polynucleotide sequence greater than 3 KB in length. In other exemplary embodiments, the polynucleotide sequence greater than 3 KB in length is a non-bacteriophage polynucleotide sequence.
[0120] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the multiple cloning site sequence, wherein the multiple cloning site sequence includes a polynucleotide sequence having a length ranging from about 500B to about 1KB, 500B to about 2KB, 500B to about 3KB, 3 KB to about 4KB, from about 3KB to about 5KB, from about 3KB to about 6KB, from about 3KB to about 7KB, from about 4 KB to about 5KB, from about 4KB to about 6KB, from about 4KB to about 7KB, from about 5 KB to about 6KB, from about 5KB to about 7KB, or from about 6KB to about 7KB. In other exemplary embodiments, the polynucleotide sequence having a length ranging from about 3 KB to about 4KB, from about 3KB to about 5KB, from about 3KB to about 6KB, from about 3KB to about 7KB, from about 4 KB to about 5KB, from about 4KB to about 6KB, from about 4KB to about 7KB, from about 5 KB to about 6KB, from about 5KB to about 7KB, or from about 6KB to about 7KB, is a non-bacteriophage polynucleotide sequence. In other embodiments, the multiple cloning site sequence includes a polynucleotide sequence having a length of about 500B, 600B, 700B, 800B, 900B, 1KB, 1.1 KB, 1.2KB, 1.3KB, 1.4KB, 1.5KB, 1.6KB, 1.7KB, 1.8KB, 1.9KB, 2KB, 2.1 KB, 2.2KB, 2.3KB, 2.4KB, 2.5KB, 2.6KB, 2.7KB, 2.8KB, 2.9KB, 3KB, 3.1 KB, about 3.2KB, about 3.3KB, about 3.4KB, about 3.5KB, about 3.6KB, about 3.7KB, about 3.8KB, about 3.9KB, about 4.0KB, about 4.1 KB, about 4.2KB, about 4.3KB, about 4.4KB, about 4.5KB, about 4.6KB, about 4.7KB, about 4.8KB, about 4.9KB, about 5.0KB, about 5.1KB, about 5.2KB, about 5.3KB, about 5.4KB, about 5.5KB, about 5.6KB, about 5.7KB, about 5.8KB, about 5.9KB, about 6.0KB, about 6.1KB, about 6.2KB, about 6.3KB, about 6.4KB, about 6.5KB, about 6.6KB, about 6.7KB, about 6.8KB, about 6.9KB, or about 7.0KB. In other embodiments, the multiple cloning site sequence includes a polynucleotide sequence having a length of about 500B, 600B, 700B, 800B, 900B, 1 KB, 1.1 KB, 1 ,2KB, 1 ,3KB, 1 ,4KB, 1 ,5KB, 1 ,6KB, 1.7KB, 1.8KB, 1.9KB, 2KB, 2.1 KB, 2.2KB, 2.3KB, 2.4KB, 2.5KB, 2.6KB, 2.7KB, 2.8KB, 2.9KB, 3KB, 3.1 KB, about 3.2KB, about 3.3KB, about 3.4KB, about 3.5KB, about 3.6KB, about 3.7KB, about 3.8KB, about 3.9KB, about 4.0KB, about 4.1KB, about 4.2KB, about 4.3KB, about 4.4KB, about 4.5KB, about 4.6KB, about 4.7KB, about 4.8KB, about 4.9KB, about 5.0KB, about 5.1 KB,about 5.2KB, about 5.3KB, about 5.4KB, about 5.5KB, about 5.6KB, about 5.7KB, about 5.8KB, about 5.9KB, about 6.0KB, about 6.1 KB, about 6.2KB, about 6.3KB, about 6.4KB, about 6.5KB, about 6.6KB, about 6.7KB, about 6.8KB, about 6.9KB, or about 7.0KB is a non-bacteriophage polynucleotide sequence.
[0121] In exemplary embodiments, the dual-expression polynucleotide vector comprises, or includes, the multiple cloning site sequence, wherein the multiple cloning site sequence includes a polynucleotide sequence having a length of about 6 KB. In other exemplary embodiments, the polynucleotide sequence having a length of about 6 KB is a non-bacteriophage polynucleotide sequence.
[0122] In some exemplary embodiments, the multiple cloning site sequence includes a single polynucleotide sequence. In other exemplary embodiments, the multiple cloning site sequence includes two or more polynucleotide sequences. In further exemplary embodiments, a plurality of hairpins can be between, or separate, the two or more polynucleotide sequences.
[0123] FIG. 1 depicts an exemplary embodiment of a dual-expression polynucleotide vector.
[0124] Referring to FIG. 1, a dual expression vector (100) comprises, or includes, a first polynucleotide sequence (101) that includes a bacteriophage promoter sequence (103), a sequence encoding a plurality of first RNA hairpin structures (105), a multiple cloning site sequence (107), a sequence encoding a plurality of second RNA hairpin structures (109) and a transcription terminator sequence (111). The exemplary embodiment of the dual-expression polynucleotide vector also comprises, or includes, a second polynucleotide sequence (113) that includes a bacteriophage promoter sequence (115), a ribosome binding site sequence (117), a viral coat protein sequence (119) and the transcription terminator sequence (111).
[0125] FIG. 2 also depicts an exemplary embodiment of a dual-expression polynucleotide vector.
[0126] Referring to FIG. 2, a dual expression vector (200) comprises, or includes, a first polynucleotide sequence (201) that includes a bacteriophage promoter sequence (203), asequence encoding a plurality of first RNA hairpin structures (205), a multiple cloning site sequence (207), a sequence encoding a plurality of second RNA hairpin structures (209) and a transcription terminator sequence (211). The first polynucleotide sequence (201) further includes a sequence encoding a viral maturase protein (221). The exemplary embodiment of the dualexpression polynucleotide vector also comprises, or includes, a second polynucleotide sequence (213) that includes a bacteriophage promoter sequence (215), a ribosome binding site sequence (217), a viral coat protein sequence (219) and the transcription terminator sequence (211).
[0127] Another aspect of the present disclosure is a recombinant RNA segment that includes, in the 5’ to 3’ direction, the following: a plurality of first RNA hairpin structures (such as 105 or 205), a non-bacteriophage polynucleotide sequence (such as 107 or 207), and a plurality of second RNA hairpin structures (such as 109 or 209).
[0128] In exemplary embodiments, the recombinant RNA segment comprises, or includes, a plurality of first RNA hairpin structures, wherein each of the first RNA hairpin structures has an identical structure.
[0129] In exemplary embodiments, the recombinant RNA segment comprises, or includes, a plurality of first RNA hairpin structures, wherein at least two first RNA hairpin structures have a different structure than each other.
[0130] In exemplary embodiments, the recombinant RNA segment comprises, or includes, a plurality of first RNA hairpin structures, wherein each of the first RNA hairpin structures has an identical polynucleotide sequence.
[0131] In exemplary embodiments, the recombinant RNA segment comprises, or includes, a plurality of first RNA hairpin structures, wherein at least two first RNA hairpin structures have different polynucleotide sequences than each other.
[0132] In exemplary embodiments, the recombinant RNA segment comprises, or includes, a plurality of second RNA hairpin structures, wherein each of the second RNA hairpin structures has an identical structure.
[0133] In exemplary embodiments, the recombinant RNA segment comprises, or includes, a plurality of second RNA hairpin structures, wherein at least two second RNA hairpin structures have different structures than each other.
[0134] In exemplary embodiments, the recombinant RNA segment comprises, or includes, a plurality of second RNA hairpin structures, wherein each of the second RNA hairpin structures has an identical polynucleotide sequence.
[0135] In exemplary embodiments, the recombinant RNA segment comprises, or includes, a plurality of second RNA hairpin structures, wherein at least two second RNA hairpin structures have different polynucleotide sequences than each other.
[0136] In exemplary embodiments, recombinant RNA segment comprises, or includes, both the plurality of first RNA hairpin structures and the plurality of second RNA hairpin structures, wherein each of the first and second RNA hairpin structures has an identical structure.
[0137] In exemplary embodiments, recombinant RNA segment comprises, or includes, both the plurality of first RNA hairpin structures and the plurality of second RNA hairpin structures, wherein each of the first and second RNA hairpin structures have an identical polynucleotide sequence.
[0138] In exemplary embodiments, recombinant RNA segment includes both the plurality of first RNA hairpin structures and the plurality of second RNA hairpin structures, wherein at least one of the first RNA hairpin structures has an identical structure as at least one of the second RNA hairpin structures.
[0139] In exemplary embodiments, recombinant RNA segment includes both the plurality of first RNA hairpin structures and the plurality of second RNA hairpin structures, wherein at least one of the first RNA hairpin structures has an identical polynucleotide sequence as at least one of the second RNA hairpin structures.
[0140] In exemplary embodiments, recombinant RNA segment includes both the plurality of first RNA hairpin structures and the plurality of second RNA hairpin structures, wherein at leastone of the first hairpin structures has a different sequence than at least one of second RNA hairpin structures.
[0141] In exemplary embodiments, recombinant RNA segment includes both the plurality of first RNA hairpin structures and the plurality of second RNA hairpin structures, wherein at least one of the first RNA hairpin structures has a different polynucleotide sequence than at least one of second RNA hairpin structures.
[0142] In exemplary embodiments, the recombinant RNA segment comprises, or includes, the plurality of first RNA hairpin structures, wherein each or at least one of the first RNA hairpin structures has a polynucleotide sequence of AACAUGAGGAUCACCCAUGU (SEQ ID NO: 1).
[0143] In exemplary embodiments, the recombinant RNA segment comprises, or includes, a plurality of second RNA hairpin structures, wherein each or at least one of the second RNA hairpin structures has a polynucleotide sequence of AACAUGAGGAUCACCCAUGU (SEQ ID NO: 1).
[0144] In exemplary embodiments, the recombinant RNA segment comprises, or includes, the plurality of first RNA hairpin structures and the plurality of second RNA hairpin structures, wherein each RNA hairpin structure has a polynucleotide sequence of AACAUGAGGAUCACCCAUGU (SEQ ID NO: 1).
[0145] In exemplary embodiments, the recombinant RNA segment includes the plurality of first RNA hairpin structures and the plurality of second RNA hairpin structures, wherein at least one of the first RNA hairpin structures and at least one of the second RNA hairpin structures has a polynucleotide sequence of AACAUGAGGAUCACCCAUGU (SEQ ID NO: 1).
[0146] In exemplary embodiments, the recombinant RNA segment comprises, or includes, a plurality of first RNA hairpin structures including two, three, four, five, six, seven, eight, nine, ten, eleven, or at least twelve first RNA hairpin structures.
[0147] In exemplary embodiments, the recombinant RNA segment comprises, or includes, a plurality of second RNA hairpin structures including two, three, four, five, six, seven, eight, nine, ten, eleven, or at least twelve second RNA hairpin structures.
[0148] In exemplary embodiments, the recombinant RNA segment comprises the nonbacteriophage polynucleotide sequence, wherein the non-bacteriophage polynucleotide sequence originates from a virus (for instance, HIV-1 , HIV-2, HCV, HTLV-1 , HTLV-2, hepatitis G, an enterovirus, Zika virus, orthoebolaviruses such as Ebola virus), or a pathogen (for instance, a blood-borne pathogen, bacterium, or a microorganism). In some embodiments, the nonbacteriophage polynucleotide sequence encodes a synthetic RNA sequence. It should be understood that the non-bacteriophage polynucleotide sequence can originate from other sources known to those of ordinary skill in the art that are not exemplified above.
[0149] In exemplary embodiments, the recombinant RNA segment comprises, or includes, the non-bacteriophage polynucleotide sequence, wherein the non-bacteriophage polynucleotide sequence has a polynucleotide sequence greater than 3 KB in length.
[0150] In exemplary embodiments, the recombinant RNA segment comprises, or includes, the non-bacteriophage polynucleotide sequence, wherein the non-bacteriophage polynucleotide sequence has a polynucleotide sequence ranging from about 4 KB to about 7KB in length.
[0151] In exemplary embodiments, the recombinant RNA segment comprises, or includes, the non-bacteriophage polynucleotide sequence, wherein the non-bacteriophage polynucleotide sequence has a length of about 6 KB. In other embodiments, the recombinant RNA segment comprises, or includes, the non-bacteriophage polynucleotide sequence, wherein the nonbacteriophage polynucleotide sequence has a length of about 500B.
[0152] Another aspect of the disclosure is an RNA detection and / or quantification standard resistant to ribonuclease including any recombinant RNA segment described herein encapsidated in a bacteriophage viral coat protein.
[0153] As used herein, the terms “nuclease resistant” and “ribonuclease resistant” mean that a nucleic acid sequence and / or molecule exhibits increased resistance to nuclease over a naked, unmodified nucleic acid molecule of the same sequence.
[0154] In exemplary embodiments, the RNA detection and / or quantification standard is encapsidated in a modified bacteriophage viral coat protein. In some embodiments, the modified bacteriophage viral coat protein further comprises a polypeptide sequence that is a targeting ligand that specifically binds to a cell surface protein or is an antigen. In other embodiments, the modified bacteriophage viral coat protein further comprises a polypeptide sequence that is a detectable tag.
[0155] In exemplary embodiments, the RNA detection and / or quantification standard is encapsidated in a bacteriophage viral coat protein of an E. coli bacteriophage belonging to genetic subclass A. It should be understood that the E. coli bacteriophages belonging to other genetic subclasses known to those of ordinary skill in the art can be used as the source of the viral coat protein.
[0156] In exemplary embodiments, the RNA detection and / or quantification standard is encapsidated in a bacteriophage viral coat protein of an E. coli bacteriophage belonging to serological group I. It should be understood that the E. coli bacteriophages belonging to other serological groups known to those of ordinary skill in the art can be used as the source of the viral coat protein.
[0157] In exemplary embodiments, the RNA detection and / or quantification standard is encapsidated in the MS2 / R17 bacteriophage viral coat protein.
[0158] In exemplary embodiments, the RNA segment included within the RNA detection and / or quantification standard comprises, or includes, a non-bacteriophage sequence that is a standard.
[0159] In exemplary embodiments, the RNA segment included within the RNA detection and / or quantification standard or control comprises, or includes, a non-bacteriophage sequence that is a diagnostic standard or control, such as, but not limited to, a standard or control for a virus (for instance, a HIV-1 standard or control, a HIV-2 standard or control, a HCV standard or control, a HTLV-1 standard or control, a HTLV-2 standard or control, a hepatitis G standard or control, anenterovirus standard or control, a Zika virus standard or control, an orthoebolavirus standard or control such as a Ebola virus standard or control), or a standard or control for a pathogen (for instance, a blood-borne pathogen standard or control, a bacterium standard or control, or a microorganism standard or control). In some embodiments, the RNA segment included within the RNA detection and / or quantification standard or control is a synthetic RNA standard or control.
[0160] In exemplary embodiments, the RNA segment included within the RNA detection and / or quantification standard comprises, or includes, a modified non-bacteriophage sequence, such as, but not limited to, a modified virus sequence, a modified pathogen sequence, or a synthetic sequence.
[0161] Another aspect of the present disclosure is a method for detecting the presence or quantity of target RNA of diagnostic value in a sample, the method including at least one or more of the following: (i) admixing the sample with an RNA detection and / or quantification standard or control that comprises, or includes, a recombinant RNA segment including, in the 5’ to 3’ direction, the following: a plurality of first RNA hairpin structures, a non-bacteriophage sequence, and a plurality of second RNA hairpin structures, whereby the recombinant RNA segment is encapsidated in a bacteriophage viral coat protein; (ii) isolating RNA from the admixture; and (iii) assaying for the presence or quantity of the target RNA of diagnostic value.
[0162] In exemplary embodiments, the method includes: (i) admixing the sample with the RNA detection and / or quantification standard or control that comprises, or includes, the recombinant RNA segment including, in the 5’ to 3' direction, the plurality of first RNA hairpin structures, the non-bacteriophage sequence, and the plurality of second RNA hairpin structures, whereby the recombinant RNA segment is encapsidated in the bacteriophage viral coat protein; (ii) isolating RNA from the admixture; and (iii) assaying for the presence or quantity of the target RNA of diagnostic value.
[0163] In exemplary embodiments, the sample is selected from the group including, but not limited to, blood, saliva, semen, tissue or mucus. It should be understood that other samplesources used in RNA detection assays known to those of ordinary skill in the art can be used in the method.
[0164] In exemplary embodiments, the method includes isolating RNA from the admixture, wherein the isolating can include, but is not limited to, performing ultracentrifugation, column chromatography (e.g., high-pressure chromatography), size exclusion chromatography, agarose gel electrophoresis or any combination thereof. It should be understood that other processes for isolating RNA from an admixture not exemplified above and known to those of ordinary skill in the art can be used in the method.
[0165] In exemplary embodiments, isolation of RNA from the admixture includes isolating the target RNA from the sample, and isolating the recombinant nucleic acid segment from the viral coat protein.
[0166] In some exemplary embodiments, the target RNA and the recombinant nucleic acid are isolated simultaneously to streamline the process and / or to eliminate variables that could compromise the assaying.
[0167] In exemplary embodiments, the method includes assaying for the presence or quantity of the target RNA of diagnostic value, wherein the assaying can include performing RT-PCR on the RNA isolated from the admixture, performing qPCR on the RNA isolated from the admixture, performing qRT-PCR on the RNA isolated from the admixture or performing hot-start PCR on RNA isolated from the admixture. It should be understood that other assays for detecting the presence of RNA in a sample not exemplified above and known to those of ordinary skill in the art can be used in the method.
[0168] In exemplary embodiments, the assaying for the presence or quantity of the target RNA of diagnostic value includes assaying both the target RNA and the recombinant nucleic acid segment isolated from the admixture to determine the presence or quantity of the target RNA and the quantity of the recombinant nucleic acid segment.
[0169] Another aspect of the present disclosure is a method of producing or synthesizing a RNA detection and / or quantification control or standard including a recombinant RNA segment as described herein, the method including at least one or more of the following: (i) transforming a dual-expression polynucleotide vector described herein into a cell; and (ii) culturing the cell under conditions allowing for transcription of the recombinant RNA segment, expression of the bacteriophage viral coat protein, and encapsidation of the recombinant RNA segment in bacteriophage viral coat protein such that the RNA detection and / or quantification standard is resistant to ribonuclease.
[0170] In exemplary embodiments, the method of producing or synthesizing of a RNA detection and / or quantification control or standard including a recombinant RNA segment as described herein includes transforming a dual-expression polynucleotide vector into a cell, wherein the cell is a bacteria designed for recombinant expression. In exemplary embodiments, the cell is an E. coli cell. In exemplary embodiments, the cell is a BL21 E. coli cell. It should be understood that other cells capable of recombinant expression not exemplified above and known to those of ordinary skill in the art can be used in the method.
[0171] In exemplary embodiments, the method of producing or synthesizing a RNA detection and / or quantification control or standard including a recombinant RNA segment as described herein includes culturing the cell under conditions allowing for transcription of the recombinant RNA segment, expression of the bacteriophage viral coat protein, and encapsidation of the recombinant RNA segment in bacteriophage viral coat protein, wherein the culturing conditions include administering an induction agent to allow for transcription of the recombinant RNA segment and expression of the viral coat protein. The induction agent can be, but is not limited to, isopropyl -D-1 -thiogalactopyranoside (IPTG), lactose, arabinose or propionate. It should be understood that other induction agents not exemplified above and known to those of ordinary skill in the art can be used in the method.
[0172] In exemplary embodiments, the method of producing or synthesizing a RNA detection and / or quantification control or standard including a recombinant RNA segment as described herein includes transforming a dual-expression polynucleotide vector into a cell, wherein the dualexpression polynucleotide vector is transformed into the cell via lipid-based processes, micro- / nano-particle processes, polymeric-based processes, peptide-based processes, dendrimerbased processes, electroporation, laser-based processes, injection, sonoporation or magnetofection. It should be understood that other methods not exemplified above and known to those of ordinary skill in the art can be used in the method.
[0173] In exemplary embodiments, the method of producing or synthesizing a RNA detection and / or quantification control or standard including a recombinant RNA segment as described herein includes purifying the encapsidated recombinant RNA segment. The RNA detection and / or quantification standard can be purified by ultracentrifugation, size exclusion chromatography, precipitation, or any other purification method known to those of ordinary skill in the art.
[0174] In exemplary embodiments, the method of producing or synthesizing a RNA detection and / or quantification control or standard including a recombinant RNA segment as described herein includes producing the RNA detection and / or quantification standard in concentrations greater than 1 x 106copies / mL.
[0175] In exemplary embodiments, the method of producing or synthesizing a RNA detection and / or quantification control or standard including a recombinant RNA segment as described herein includes producing the RNA detection and / or quantification standard in concentrations ranging from about 1 x 107to about 1 x 1014copies / mL, from about 1 x 107to about 1 x 1013copies / mL, from about 1 x 107to aboutl x 1012copies / mL, from about 1 x 107to about 1 x 1011copies / mL, from about 1 x 107to about 1 x 101° copies / mL, from about 1 x 107to about 1 x 109copies / mL. from about 1 x 107to about 1 x 108copies / mL, from about 1 x 108to about 1 x 1014copies / mL, from about 1 x 108to about 1 x 1013copies / mL, from about 1 x 108to about 1 x 1012copies / mL, from about 1 x 108to about 1 x 1011copies / mL, from about 1 x 1010to about 1 x 1014copies / mL, from aboutx 108to about 1 x 109copies / mL, from about 1 x 109to about 1 X 1014copies / mL, from about 1 x 109to about 1 x 1013copies / mL, from about 1 x 109to about 1 X 1012copies / mL, from about 1 x 109to about 1 x 1011copies / mL, from about 1 x 109to about 1 X 101° copies / mL, from about 1 x 1010to about 1 x 1014copies / mL, from about 1 x 101° to about 1 x 1013copies / mL, from about 1 x 101° to about 1 x 1012copies / mL, from about 1 x 101° to about 1 x 1011copies / mL, from about 1 x 1011to about 1 x 1014copies / mL, from about 1 x 1011to about 1 x 1013copies / mL, from about 1 x 1011to about 1 x 1012copies / mL, from about 1 X 1012to about 1 x 1014copies / mL, or from about 1 x 1012to about 1 x 1013copies / mL.
[0176] In exemplary embodiments, the method of producing or synthesizing a RNA detection and / or quantification control or standard including a recombinant RNA segment as described herein includes producing the RNA detection and / or quantification standard in concentrations of about 1 x 106, 2 x 106, 3 x 106, 4 x 106, 5 x 106, 6 x 106, 7 x 106, 8 x 106, 9 x 106, 1 x 107, 2 x 107,3 x 107, 4 x 107, 5 x 107, 6 x 107, 7 x 107, 8 x 107, 9 x 107, 1 x 10s, 2 x 10s, 3 x 10s, 4 x 10s, 5 x10s, 6 x 10s, 7 x 108, 8 x 108, 9 x 108, 1 x 109, 2 x 109, 3 x 109, 4 x 109, 5 x 109, 6 x 109, 7 x 109, 8 x 109, 9 x 109, 1 x 101°, 2 x 101°, 3 x 101°, 4 x 101°, 5 x 101°, 6 x 101°, 7 x 101°, 8 x 101°, 9 x 101°,1 x 1011, 2 x 1011, 3 x 1011, 4 x 1011, 5 x 1011, 6 x 1011, 7 x 1011, 8 x 1011, 9 x 1011, 1 x 1012, 2 x1012, 3 x 1012, 4 x 1012, 5 x 1012, 6 x 1012, 7 x 1012, 8 x 1012, 9 x 1012, or 1 x 1013copies / mL.
[0177] In exemplary embodiments, the method of producing or synthesizing a RNA detection and / or quantification control or standard including a recombinant RNA segment as described herein includes subjecting the RNA detection and / or quantification standard to a nuclease treatment.
[0178] FIG. 3 depicts an exemplary embodiment of a method for producing or synthesizing an RNA detection and / or quantification control or standard including a recombinant RNA segment.
[0179] Referring to FIG. 3, a dual-expression polynucleotide vector (301) is obtained, the dual-expression polynucleotide vector encoding a recombinant RNA segment (303) and an antibiotic resistance gene (305). The dual-expression polynucleotide vector (301) is thentransformed into a cell (307) to produce a transformed cell (309). The transformed cell (309) is then induced to begin expressing the recombinant RNA segment and bacteriophage viral coat protein, whereby an induced cell (311) is produced. The induced cell (311) continues to culture under inducing conditions until a cell having a sufficient concentration of recombinant RNA and viral coat protein (313) is achieved. At this point, the viral coat protein begin encapsidating the recombinant RNA in the cell to produce a cell having encapsidated recombinant RNA (315). After encapsidation is complete, the encapsidated RNA segments (317) can be recovered from the cell (315) and stored for use as RNA detection and / or quantification standards or controls.
[0180] Another aspect of the present disclosure is a method of producing, or synthesizing, an RNA detection and / or quantification standard or control in vivo that includes at least one or more of the following: (i) transforming a dual-expression polynucleotide vector described into a cell; and (ii) culturing the cell under conditions allowing for transcription of the recombinant RNA segment, expression of the bacteriophage viral coat protein, and encapsidation of the recombinant RNA segment in bacteriophage viral coat protein such that the encapsidated RNA is resistant to ribonuclease.
[0181] In exemplary embodiments, the method of producing, or synthesizing, an RNA detection and / or quantification standard or control in vivo includes producing the RNA detection and / or quantification standard in concentrations greater than 1 x 106copies / mL.
[0182] In exemplary embodiments, the method of producing, or synthesizing, an RNA detection and / or quantification standard in vivo includes producing the RNA detection and / or quantification standard or control in concentrations ranging from about 1 x 107to about 1 x 1014copies / mL, from about 1 x 107to about 1 x 1013copies / mL, from about 1 x 107to aboutl x 1012copies / mL, from about 1 x 107to about 1 x 1011copies / mL, from about 1 x 107to about l x 101° copies / mL, from about 1 x 107to about 1 x 109copies / mL. from about 1 x 107to about 1 x 108copies / mL, from about 1 x 108to about 1 x 1014copies / mL, from about 1 x 108to about l x 1013copies / mL, from about 1 x 108to about 1 x 1012copies / mL, from about 1 x 108to about 1 x 1011copies / mL, from about 1 x 1 O10to about 1 x 1014copies / ml_, from about 1 x 108to about 1 x 109copies / mL, from about 1 x 109to about 1 x 1014copies / mL, from about 1 x 109to about 1 x 1013copies / mL, from about 1 x 109to about 1 x 1012copies / mL, from about 1 x 109to about 1 x 1011copies / mL, from about 1 x 109to about 1 x 1010copies / mL, from about 1 x 1010to about 1 X 1014copies / mL, from about 1 x 101° to about 1 x 1013copies / mL, from about 1 x 101° to about 1 X 1012copies / mL, from about 1 x 1O10to about 1 x 1011copies / mL, from about 1 x 1011to about 1 X 1014copies / mL, from about 1 x 1011to about 1 x 1013copies / mL, from about 1 x 1011to about 1 X 1012copies / mL, from about 1 x 1012to about 1 x 1014copies / mL, or from about 1 x 1012to about 1 x1013copies / mL .
[0183] In exemplary embodiments, the method of producing, or synthesizing, an RNA detection and / or quantification standard or control in vivo includes producing the RNA detection and / or quantification standard in concentrations of about 1 x 106, 2 x 106, 3 x 106, 4 x 106, 5 x 106,6 x 106, 7 x 106, 8 x 106, 9 x 106, 1 x 107, 2 x 107, 3 x 107, 4 x 107, 5 x 107, 6 x 107, 7 x 107, 8 x107, 9 x 107, 1 x 108, 2 x 108, 3 x 108, 4 x 10s, 5 x 108, 6 x 108, 7 x 10s, 8 x 108, 9 x 108, 1 x 109, 2 x 109, 3 x 109, 4 x 109, 5 x 109, 6 x 109, 7 x 109, 8 x 109, 9 x 109, 1 x 1010, 2 x 1010, 3 x 1O10, 4 x1010, 5 x 1010, 6 x 1010, 7 x 1010, 8 x 1010, 9 x 1010, 1 x 1011, 2 x 1011, 3 x 1011, 4 x 1011, 5 x 1011, 6 x 1011, 7 x 1011, 8 x 1011, 9 x 1011, 1 x 1012, 2 x 1012, 3 x 1012, 4 x 1012, 5 x 1012, 6 x 1012, 7 x 1012,8 x 1012, 9 x 1012, or 1 x 1013copies / mL.
[0184] In exemplary embodiments, the method of producing, or synthesizing, an RNA detection and / or quantification standard or control in vivo includes culturing the cell under conditions allowing for transcription of the recombinant RNA segment, expression of the bacteriophage viral coat protein, and encapsidation of the recombinant RNA segment in bacteriophage viral coat protein, wherein the culturing conditions include administering an induction agent to allow for transcription of the recombinant RNA segment and expression of the viral coat protein. The induction agent can be, but is not limited to, isopropyl p-D-1- thiogalactopyranoside (IPTG), lactose, arabinose or propionate. It should be understood thatother induction agents not exemplified above and known to those of ordinary skill in the art can be used in the method.
[0185] In exemplary embodiments, the method of producing, or synthesizing, an RNA detection and / or quantification standard or control in vivo includes transforming a dual-expression polynucleotide vector into a cell, wherein the dual-expression polynucleotide vector is transformed into the cell via lipid-based processes, micro- / nano-particle processes, polymeric-based processes, peptide-based processes, dendrimer-based processes, electroporation, laser-based processes, injection, sonoporation or magnetofection. It should be understood that other methods not exemplified above and known to those of ordinary skill in the art can be used in the method.
[0186] In exemplary embodiments, the method of producing, or synthesizing, an RNA detection and / or quantification standard or control in vivo includes purifying the RNA detection and / or quantification standard or control. The RNA detection and / or quantification standard can be purified by ultracentrifugation, size exclusion chromatography or any other purification method known to those of ordinary skill in the art.
[0187] In exemplary embodiments, the method of producing, or synthesizing, an RNA detection and / or quantification standard in vivo includes subjecting the RNA detection and / or quantification standard or control to nuclease treatment.
[0188] FIGS. 4A shows an electron microscopic image of a construct including recombinant RNA segments encapsidated by viral coat proteins according to an exemplary embodiment, and FIG. 4B shows the Ct values for the construct compared to an empty capsid and a control.
[0189] FIG. 4A shows an electron microscopic image of a 6KB recombinant RNA segment encapsidated by viral coat proteins.
[0190] Referring to FIG. 4B, Ct values of the 6 KB construct according to an exemplary embodiment are shown in comparison to an empty capsid under various conditions. As shown in FIG. 4B, the Ct values steady decline for increasing concentrations of the construct compared tothe same concentrations of the empty capsid or the NTC control. Thus, the construct according to an exemplary embodiment exhibits high resistance to nuclease.
[0191] FIGS. 5A shows an electron microscopic image of a construct including recombinant RNA segments encapsidated by viral coat proteins according to an exemplary embodiment, and FIG. 5B shows percentage of resistance for purified fractions of the construct.
[0192] In particular, FIG. 5A shows an electron microscopic image of a 1.6 KB recombinant RNA segment encapsidated by viral coat proteins according to another exemplary embodiment. As shown in FIG. 5B, purified fractions of the construct in the presence of human serum exhibit up to 70% RNA resistance, which is comparable to that of the native virus.
[0193] The RNA detection and / or quantification standards described herein can be used in any diagnostic method as quality control standards.
[0194] The dual expression polynucleotide vectors can be used in the production of chemotherapeutics, vaccines and encapsidated RNA or DNA molecules.
[0195] In a first aspect, a dual-expression polynucleotide vector comprises a first polynucleotide sequence that comprises, in the 5’ to 3’ direction, a bacteriophage promoter sequence operatively linked to a sequence encoding a plurality of first RNA hairpin structures, a multiple cloning site sequence, a sequence encoding a plurality of second RNA hairpin structures, and a transcription terminator sequence; and a second polynucleotide sequence that comprises, in the 5’ to 3’ direction, a bacteriophage promoter sequence operatively linked to a ribosome binding site sequence, a viral coat protein sequence, and the transcription terminator sequence.
[0196] In an embodiment of the first aspect, the vector further comprises a sequence encoding a viral maturase protein.
[0197] In an embodiment of the first aspect, the viral maturase protein is a MS2 viral maturase protein.
[0198] In an embodiment of the first aspect, the vector further comprises a sequence encoding a gene that confers antibiotic resistance.
[0199] In an embodiment of the first aspect, the gene that confers antibiotic resistance is selected from the group consisting of ampicillin, kanamycin, spectinomycin, streptomycin, carbenicillin, bleomycin, erythromycin, polymyxin B, streptomycin, tetracycline, and chloramphenicol.
[0200] In an embodiment of the first aspect, the bacteriophage promoter sequence is an inducible promoter sequence.
[0201] In an embodiment of the first aspect, the bacteriophage promoter sequence is one selected from a T7 promoter sequence, a pTAC promoter sequence, and a pBAD promoter sequence.
[0202] In an embodiment of the first aspect, the viral coat protein is a MS2 viral coat protein.
[0203] In an embodiment of the first aspect, the viral coat protein is a modified viral coat protein comprising a viral coat protein having an exogenous polypeptide sequence conjugated to an exterior of said viral coat protein.
[0204] In an embodiment of the first aspect, the exogenous polypeptide sequence is a targeting ligand that specifically binds to a cell surface protein or is an antigen.
[0205] In an embodiment of the first aspect, the exogenous polypeptide sequence is a detectable tag.
[0206] In an embodiment of the first aspect, the viral coat protein is a modified viral coat protein comprising a viral coat protein having an exogenous polypeptide sequence conjugated to the interior of said viral coat protein.
[0207] In an embodiment of the first aspect, the plurality of the first RNA hairpin structures are identical.
[0208] In an embodiment of the first aspect, the plurality of the second RNA hairpin structures are identical.
[0209] In an embodiment of the first aspect, at least one of the plurality of first RNA hairpin structures is identical to at least one of the second RNA hairpin structures.
[0210] In an embodiment of the first aspect, at least one of the plurality of first and second RNA hairpin structures includes SEQ ID NO: 1.
[0211] In an embodiment of the first aspect, the sequence encoding the plurality of first RNA hairpin structures encodes two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve RNA hairpin structures.
[0212] In an embodiment of the first aspect, the sequence encoding the plurality of second RNA hairpin structures encodes two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve RNA hairpin structures.
[0213] In an embodiment of the first aspect, the multiple cloning site sequence further comprises a non-bacteriophage sequence.
[0214] In an embodiment of the first aspect, the non-bacteriophage sequence is greater than 3 kb in length.
[0215] In an embodiment of the first aspect, the non-bacteriophage sequence is between about 4 kb to about 7 kb in length.
[0216] In an embodiment of the first aspect, the non-bacteriophage sequence is about 6 kb in length.
[0217] In an embodiment of the first aspect, the non-bacteriophage sequence is about 500 bp in length.
[0218] In an embodiment of the first aspect, the vector can exclude a sequence encoding a viral maturase protein.
[0219] In a second aspect, a recombinant RNA segment, comprises, in the 5’ to 3’ direction, a plurality of first RNA hairpin structures separated from a plurality of second RNA hairpin structures by a non-bacteriophage sequence.
[0220] In an embodiment of the second aspect, the plurality of the first RNA hairpin structures are identical.
[0221] In an embodiment of the second aspect, the plurality of the second RNA hairpin structures are identical.
[0222] In an embodiment of the second aspect, at least one of the plurality of the first hairpin structures is identical to at least one of the second RNA hairpin structures.
[0223] In an embodiment of the second aspect, at least one of the plurality of first and second RNA hairpin structures has SEQ ID NO: 1.
[0224] In an embodiment of the second aspect, the plurality of first RNA hairpin structures comprises two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve RNA hairpin structures.
[0225] In an embodiment of the second aspect, the plurality of second RNA hairpin structures comprises two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve RNA hairpin structures.
[0226] In a third aspect, an RNA detection and / or quantification standard or control, comprises the recombinant RNA segment encapsidated in a bacteriophage viral coat protein, wherein the RNA detection and / or quantification standard or control is resistant to ribonuclease.
[0227] In an embodiment of the third aspect, the bacteriophage viral coat protein is of an E. coli bacteriophage of genetic subclass A.
[0228] In an embodiment of the third aspect, the bacteriophage viral coat protein is of an E. coli bacteriophage of serological group I.
[0229] In an embodiment of the third aspect, the bacteriophage viral coat protein is of an MS2 / R17 bacteriophage.
[0230] In an embodiment of the third aspect, the bacteriophage viral coat protein is a modified bacteriophage viral coat protein.
[0231] In an embodiment of the third aspect, the modified bacteriophage viral coat protein further comprises a polypeptide sequence that is a targeting ligand that specifically binds to a cell surface protein or is an antigen.
[0232] In an embodiment of the third aspect, the modified bacteriophage viral coat protein further comprises a polypeptide sequence that is a detectable tag.
[0233] In an embodiment of the third aspect, the non-bacteriophage sequence is a standard.
[0234] In an embodiment of the third aspect, the non-bacteriophage sequence is a diagnostic standard.
[0235] In an embodiment of the third aspect, the non-bacteriophage sequence is a standard for a virus, a pathogen, or a synthetic RNA.
[0236] In an embodiment of the third aspect, the non-bacteriophage sequence further comprises a modified virus sequence.
[0237] In an embodiment of the third aspect, the RNA detection and / or quantification standard or control is a standard for a virus, a pathogen, or a synthetic RNA.
[0238] In a fourth aspect, a method for detecting for the presence or quantity of target RNA in a sample, comprises admixing the sample with the RNA detection and / or quantification standard or control; isolating RNA from the admixture; and assaying the isolated RNA for the presence or quantity of the target RNA.
[0239] In a fifth aspect, a method of producing an RNA detection and / or quantification standard or control including the recombinant RNA segment encapsidated in a bacteriophage viral coat protein, and wherein the RNA detection and / or quantification standard or control is resistant to ribonuclease, the method comprises transforming a vector including sequences encoding the recombinant RNA segment into a cell to produce a transformed cell; and culturing the transformed cell under conditions allowing for transcription of the recombinant RNA segment, co-expression of the bacteriophage viral coat protein and the recombinant RNA segment, and encapsidation of the recombinant RNA segment in the bacteriophage viral coat protein such that the RNA detection and / or quantification standard or control is resistant to ribonuclease.
[0240] In a sixth aspect, a method of producing an RNA detection and / or quantification standard or control in vivo comprises transforming the vector into a cell to produce a transformedcell; and culturing the transformed cell under conditions allowing for transcription of a recombinantRNA segment encoded by sequences in the vector, co-expression of the viral coat protein and a recombinant RNA segment, and encapsidation of the recombinant RNA segment in the viral coat protein such that the RNA detection and / or quantification standard or control is resistant to ribonuclease.
[0241] In embodiments of the fourth, fifth or sixth aspects, a concentration of the RNA detection and / or quantification standard or control is greater than 1 x 106copies / mL.
[0242] In embodiments of the fourth, fifth and sixth aspects, the concentration of the RNA detection and / or quantification standard or control is between about 1 x 107and 1 x 1014copies / mL.
[0243] In embodiments of the fourth, fifth or sixth aspects, the concentration of the RNA detection and / or quantification standard or control is about 1 x 1013copies / mL.
[0244] In embodiments of the fifth or sixth aspects, the culturing the transformed cell includes administering an induction agent to allow for transcription of the recombinant RNA segment and expression of the viral coat protein.
[0245] In embodiments of the fifth or sixth aspects, the induction agent is selected from the group consisting of isopropyl p-D-1-thiogalactopyranoside (IPTG), lactose, arabinose and propionate.
[0246] In embodiments of the fifth or sixth aspects, the induction agent is IPTG.
[0247] In embodiments of the fifth or sixth aspects, the method further comprises purifying the RNA detection and / or quantification standard or control.
[0248] In embodiments of the fifth or sixth aspects, the purifying includes performing ultracentrifugation, size exclusion chromatography, or combinations thereof.
[0249] In embodiments of the fifth or sixth aspects, the method further comprises subjecting the RNA detection and / or quantification standard or control to a nuclease treatment.
[0250] In a seventh aspect, a method of producing a nucleic acid detection and / or quantification standard or control comprises transforming the vector into a cell to produce a transformed cell; and culturing the transformed cell under conditions allowing for transcription of a recombinant RNA segment encoded by sequences in the vector, co-expression of the viral coat protein and the recombinant RNA segment, and encapsidation of the recombinant RNA segment in the viral coat protein such that the encapsidated recombinant RNA segment is resistant to ribonuclease.
[0251] In an eighth aspect, a nucleic acid detection and / or quantification standard or control is produced by the method of the seventh aspect.
[0252] In a ninth aspect, a method for detecting the presence or quantity of target nucleic acid in a sample, comprises admixing the sample with the nucleic acid detection and / or quantification standard or control; isolating nucleic acid from the admixture; and assaying the isolated nucleic acid for the presence or quantity of the target nucleic acid.
[0253] In a tenth aspect, a method of producing an encapsidated therapeutic product comprises transforming the vector into a cell to produce a transformed cell; and culturing the transformed cell under conditions allowing for transcription of a recombinant RNA segment encoded by sequences in the vector, co-expression of the viral coat protein and the recombinant RNA segment, and encapsidation of the recombinant RNA segment in the viral coat protein such that the encapsidated RNA segment is resistant to ribonuclease.
[0254] In an eleventh aspect, an encapsidated therapeutic product is produced by the method of the tenth aspect.
[0255] In a twelfth aspect, a method for detecting the presence or quantity of target nucleic acid in a sample, comprises admixing the sample with the encapsidated therapeutic product; isolating nucleic acid from the admixture; and assaying the isolated nucleic acid for the presence or quantity of the target nucleic acid.
[0256] Exemplary embodiments allow for the encapsidation of larger recombinant RNA segments (i.e., up to 7 kB) than that of the conventional RNA capsids (i.e., up to 1500 bp). Exemplary embodiments also allow for the encapsidation of more recombinant RNA segments (i.e., 10E13 copies / mL) within a capsid than that of the conventional capsids (i.e., 5E10 copies / mL). By producing abundant and highly-concentrated nuclease-resistant RNAs, the encapsidated recombinant RNAs according to exemplary embodiments are more cost-effective than the conventional RNA capsids.
[0257] It is noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the," include plural referents unless expressly and unequivocally limited to one referent. The use of "or" means "and / or" unless stated otherwise. The use of “comprise,” “comprises,” “comprising,” “include,” “includes,” and “including” are interchangeable and not intended to be limiting. Furthermore, where the description of one or more embodiments uses the term “comprising,” those skilled in the art would understand that, in some specific instances, the embodiment or embodiments can be alternatively described using the language “consisting essentially of” and / or “consisting of.”
[0258] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, and treatises are hereby expressly incorporated by reference in their entirety for any purpose. In the event that one or more of the incorporated documents defines a term that contradicts that term's definition in this application, this application controls.
[0259] All references cited herein, including patents, patent applications, papers, text books, and the like, and the references cited therein, to the extent that they are not already, are hereby incorporated by reference in their entirety. In the event that one or more of the incorporated literature and similar materials differs.
Claims
We claim:
1. A dual-expression polynucleotide vector comprising: a first polynucleotide sequence that comprises, in the 5’ to 3’ direction, a bacteriophage promoter sequence operatively linked to a sequence encoding a plurality of first RNA hairpin structures, a multiple cloning site sequence, a sequence encoding a plurality of second RNA hairpin structures, and a transcription terminator sequence; and a second polynucleotide sequence that comprises, in the 5’ to 3’ direction, a bacteriophage promoter sequence operatively linked to a ribosome binding site sequence, a viral coat protein sequence, and the transcription terminator sequence.
2. The vector of claim 1 , further comprising a sequence encoding a viral maturase protein.
3. The vector of claim 2, wherein the viral maturase protein is a MS2 viral maturase protein.
4. The vector of any of claims 1-3, further comprising a sequence encoding a gene that confers antibiotic resistance.
5. The vector of claim 4, wherein the gene that confers antibiotic resistance is selected from the group consisting of ampicillin, kanamycin, spectinomycin, streptomycin, carbenicillin, bleomycin, erythromycin, polymyxin B, streptomycin, tetracycline, and chloramphenicol.
6. The vector of any of claims 1-5, wherein the bacteriophage promoter sequence is an inducible promoter sequence.
7. The vector of any of claims 1-5, wherein the bacteriophage promoter sequence is one selected from a T7 promoter sequence, a pTAC promoter sequence, and a pBAD promoter sequence.
8. The vector of any of claims 1-7, wherein the viral coat protein is a MS2 viral coat protein.
9. The vector of any of claims 1-7, wherein the viral coat protein is a modified viral coat protein comprising a viral coat protein having an exogenous polypeptide sequence conjugated to an exterior of said viral coat protein.
10. The vector of claim 9, wherein the exogenous polypeptide sequence is a targeting ligand that specifically binds to a cell surface protein or is an antigen.
11. The vector of claim 9, wherein the exogenous polypeptide sequence is a detectable tag.
12. The vector of any of claims 1-7, wherein the viral coat protein is a modified viral coat protein comprising a viral coat protein having an exogenous polypeptide sequence conjugated to the interior of said viral coat protein.
13. The vector of any of claims 1-12, wherein the plurality of the first RNA hairpin structures are identical.
14. The vector of any of claims 1-12, wherein the plurality of the second RNA hairpin structures are identical.
15. The vector of any of claims 1-14, wherein at least one of the plurality of first RNA hairpin structures is identical to at least one of the second RNA hairpin structures.
16. The vector of any of claims 1-15, wherein at least one of the plurality of first and second RNA hairpin structures includes SEQ ID NO: 1.
17. The vector of any of claims 1-16, wherein the sequence encoding the plurality of first RNA hairpin structures encodes two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve RNA hairpin structures.
18. The vector of any of claims 1-17, wherein the sequence encoding the plurality of second RNA hairpin structures encodes two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve RNA hairpin structures.
19. The vector of any of claims 1-18, wherein the multiple cloning site sequence further comprises a non-bacteriophage sequence.
20. The vector of claim 19, wherein the non-bacteriophage sequence is greater than 3 kb in length.
21. The vector of claim 20, wherein the non-bacteriophage sequence is between about 4 kb to about 7 kb in length.
22. The vector of claim 21 , wherein the non-bacteriophage sequence is about 6 kb in length.
23. The vector of claim 19, wherein the non-bacteriophage sequence is about 500 bp in length.
24. A recombinant RNA segment, comprising, in the 5’ to 3’ direction: a plurality of first RNA hairpin structures separated from a plurality of second RNA hairpin structures by a non-bacteriophage sequence.
25. The recombinant RNA segment of claim 24, wherein the plurality of the first RNA hairpin structures are identical.
26. The recombinant RNA segment of claims 24-25, wherein the plurality of the second RNA hairpin structures are identical.
27. The recombinant RNA segment of any one of claims 24-26, wherein at least one of the plurality of the first hairpin structures is identical to at least one of the second RNA hairpin structures.
28. The recombinant RNA segment of any of claims 24-27, wherein at least one of the plurality of first and second RNA hairpin structures has SEQ ID NO: 1.
29. The recombinant RNA segment of any of claims 24-28, wherein the plurality of first RNA hairpin structures comprises two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve RNA hairpin structures.
30. The recombinant RNA segment of any of claims 24-29, wherein the plurality of second RNA hairpin structures comprises two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve RNA hairpin structures.
31. An RNA detection and / or quantification standard or control, comprising: the recombinant RNA segment of any of claims 24-30 encapsidated in a bacteriophage viral coat protein, wherein the RNA detection and / or quantification standard or control is resistant to ribonuclease.
32. The RNA detection and / or quantification standard or control of claim 31 , wherein the bacteriophage viral coat protein is of an E. coli bacteriophage of genetic subclass A.
33. The RNA detection and / or quantification standard or control of any of claims 31-32, wherein the bacteriophage viral coat protein is of an E. coli bacteriophage of serological group I.
34. The RNA detection and / or quantification standard or control of any of claims 31-33, wherein the bacteriophage viral coat protein is of an MS2 / R17 bacteriophage.
35. The RNA detection and / or quantification standard or control of any of claims 31-34, wherein the bacteriophage viral coat protein is a modified bacteriophage viral coat protein.
36. The RNA detection and / or quantification standard or control of claim 35, wherein the modified bacteriophage viral coat protein further comprises a polypeptide sequence that is a targeting ligand that specifically binds to a cell surface protein or is an antigen.
37. The RNA detection and / or quantification standard or control of claim 35, wherein the modified bacteriophage viral coat protein further comprises a polypeptide sequence that is a detectable tag.
38. The RNA detection and / or quantification standard or control of any of claims 31-37, wherein the non-bacteriophage sequence is a standard.
39. The RNA detection and / or quantification standard or control of claim 38, wherein the nonbacteriophage sequence is a diagnostic standard.
40. The RNA detection and / or quantification standard or control of claim 39, wherein the nonbacteriophage sequence is a standard for a virus, a pathogen, or a synthetic RNA.
41. The RNA detection and / or quantification standard or control of claim 40, wherein the nonbacteriophage sequence further comprises a modified virus sequence.
42. The RNA detection and / or quantification standard or control of any of claims 27-38, wherein the RNA detection and / or quantification standard or control is a standard for a virus, a pathogen, or a synthetic RNA.
43. A method for detecting for the presence or quantity of target RNA in a sample, comprising: admixing the sample with the RNA detection and / or quantification standard or control according to any one of claims 31 to 42; isolating RNA from the admixture; and assaying the isolated RNA for the presence or quantity of the target RNA.
44. A method of producing an RNA detection and / or quantification standard or control including the recombinant RNA segment of any of claims 24 to 30 encapsidated in a bacteriophage viral coat protein, and wherein the RNA detection and / or quantification standard or control is resistant to ribonuclease, the method comprising: transforming a vector including sequences encoding the recombinant RNA segment into a cell to produce a transformed cell; and culturing the transformed cell under conditions allowing for transcription of the recombinant RNA segment, co-expression of the bacteriophage viral coat protein and the recombinant RNA segment, and encapsidation of the recombinant RNA segment in the bacteriophage viral coat protein such that the RNA detection and / or quantification standard or control is resistant to ribonuclease.
45. A method of producing an RNA detection and / or quantification standard or control in vivo comprising: transforming the vector according to any one of claims 1 to 23 into a cell to produce a transformed cell; and culturing the transformed cell under conditions allowing for transcription of a recombinant RNA segment encoded by sequences in the vector, co-expression of the viral coat protein and a recombinant RNA segment, and encapsidation of the recombinant RNA segment in the viral coat protein such that the RNA detection and / or quantification standard or control is resistant to ribonuclease.
46. The method of claims 43 to 45, wherein a concentration of the RNA detection and / or quantification standard or control is greater than 1 x 106copies / ml_.
47. The method of claim 46, wherein the concentration of the RNA detection and / or quantification standard or control is between about 1 x 107and 1 x 1014copies / mL.
48. The method of claim 47, wherein the concentration of the RNA detection and / or quantification standard or control is about 1 x 1013copies / mL.
49. The method of any of claims 44 to 48, wherein the culturing the transformed cell includes administering an induction agent to allow for transcription of the recombinant RNA segment and expression of the viral coat protein.
50. The method of claim 49, wherein the induction agent is selected from the group consisting of isopropyl p-D-1-thiogalactopyranoside (IPTG), lactose, arabinose and propionate.
51. The method of claims 49 or 50, wherein the induction agent is IPTG.
52. The method of any of claims 44-51 , further comprising purifying the RNA detection and / or quantification standard or control.
53. The method of claim 52, wherein the purifying includes performing ultracentrifugation, size exclusion chromatography, or combinations thereof.
54. The method of any of claims 44-53, further comprising subjecting the RNA detection and / or quantification standard or control to a nuclease treatment.-SO-55. A method of producing a nucleic acid detection and / or quantification standard or control comprising: transforming the vector according to any of claims 1 to 23 into a cell to produce a transformed cell; and culturing the transformed cell under conditions allowing for transcription of a recombinant RNA segment encoded by sequences in the vector, co-expression of the viral coat protein and the recombinant RNA segment, and encapsidation of the recombinant RNA segment in the viral coat protein such that the encapsidated recombinant RNA segment is resistant to ribonuclease.
56. A nucleic acid detection and / or quantification standard or control produced by the method of claim 55.
57. A method for detecting the presence or quantity of target nucleic acid in a sample, comprising: admixing the sample with the nucleic acid detection and / or quantification standard or control according to claims 55 or 56; isolating nucleic acid from the admixture; and assaying the isolated nucleic acid for the presence or quantity of the target nucleic acid.
58. A method of producing an encapsidated therapeutic product comprising: transforming the vector according to any one of claims 1 to 23 into a cell to produce a transformed cell; and culturing the transformed cell under conditions allowing for transcription of a recombinant RNA segment encoded by sequences in the vector, co-expression of the viral coat protein and the recombinant RNA segment, and encapsidation of the recombinant RNA segment in the viral coat protein such that the encapsidated RNA segment is resistant to ribonuclease.-SI-59. An encapsidated therapeutic product produced by the method of claim 58.
60. A method for detecting the presence or quantity of target nucleic acid in a sample, comprising: admixing the sample with the encapsidated therapeutic product according to claims 58 or 59; isolating nucleic acid from the admixture; and assaying the isolated nucleic acid for the presence or quantity of the target nucleic acid.
61. The vector of claim 1 excluding a sequence encoding a viral maturase protein.