A method for an in vitro diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid beta-related disease
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- GENXPRO
- Filing Date
- 2023-07-07
- Publication Date
- 2026-05-13
AI Technical Summary
Current methods for diagnosing neurodegenerative diseases like Alzheimer's lack accessibility, simplicity, and accuracy, particularly in requiring invasive sample collection and failing to provide reliable, non-invasive peripheral biomarkers for early diagnosis and monitoring.
An in vitro method involving the analysis of RNA samples from biological fluids to determine the expression levels of specific RNAs such as Fxyd3, Trappc3, and others, comparing these levels to reference expressions for diagnosis, prognosis, and treatment monitoring of neurodegenerative diseases.
This method offers a more accessible, sensitive, and specific approach for diagnosing and monitoring neurodegenerative diseases, enabling early detection and effective treatment monitoring without invasive procedures.
Smart Images

Figure EP2023068898_16012025_PF_FP_ABST
Abstract
Description
[0001] A method for an in vitro diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid p- related disease
[0002] The present invention relates to a method for an in vitro diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease.
[0003] Alzheimer's disease (AD) is a chronic neurodegenerative disease characterized by progressive loss of cognitive function and pathologically by extracellular deposition of amyloid-beta peptide (AR>) and intracellular deposition of hyper-phosphorylated tau protein in neurofibrillary tangles in the brain, associated with progressive neuronal degeneration (Marcus et al. J Neurogenet. 2011 ; 25(4): 127-33; Gotz et al, Br J Pharmacol. 2012; 165(5): 1246-59).
[0004] AD is the most common form of dementia. Approximately 46.8 million people worldwide currently live with AD or other types of dementia. With an ageing population, this number is estimated to increase to 131.5 million by 2050 (World Alzheimer Report, 2015). As such, AD is becoming an increasingly important burden on the affected individuals and their families as well as economic and social costs on medical and healthcare resources in both developed and emerging countries.
[0005] Dementia with Lewy bodies (DLB) and Parkinson’s disease dementia (PDD), both called Lewy body dementias, are the second most common type of degenerative dementia in patients older than 65 years and their brain pathological hallmarks are alpha-synuclein neuronal inclusions (Lewy bodies, and Lewy neurites), accompanied by neuronal loss (Lancet. 2015 Oct 24; 386(10004): 1683-97). Variants in three genes APOE, SNCA, and GBA have been associated with an increased risk of dementia with Lewy bodies, but in most cases, the cause is unknown.
[0006] Frontotemporal dementia (FTD) is the third most common dementia across all age groups and the 1stor the 2nd(after AD) prevalent dementia in the 45-64 years age group. The most common form is known as behavioral variant frontotemporal dementia (bvFTD), which is characterized (in its early stages) by changes in personality, behavior, and judgment. Other disorders under the “frontotemporal disorders” umbrella include Pick’s disease, primary progressive aphasia, primary non-fluent aphasia, semantic dementia, corticobasal degeneration (CBD) syndrome, progressive supranuclear palsy (PSP), frontotemporal dementia (FTD) with parkinsonism, and FTD with amyotrophic lateral sclerosis (ALS).
[0007] Further amyloid [3-related diseases are e.g. amyloidosis. Abnormal protein accumulation is a feature observed in the following diseases: amyloidosis, Alzheimer’s disease, Parkinson’s disease, Creutzfeldt-Jakob disease, motor neuron diseases and the large group of polyglutamine disorders, including Huntington’s disease (Merlini, Giampaolo; Bellotti, Vittorio (2003). Molecular Mechanisms of Amyloidosis. New England Journal of Medicine, 349(6), 583-596. doi:10.1056 / nejmra023144; Koo EH, Lansbury PT Jr, Kelly JW. Amyloid diseases: abnormal protein aggregation in neurodegeneration. Proc Natl Acad Sci U S A. 1999 Aug 31 ;96(18):9989-90. doi: 10.1073 / pnas.96.18.9989).
[0008] Based on these issues, various RNAs have been proposed as biomarkers for the detection of Alzheimer's disease, for example, as described in the documents EP 2733219 A1 , EP 3184646 A1 , EP 3725882 A1 , WO 2015 / 091902 A2, WO 2019 / 048500 A1 and WO 2020 / 049135 A1 .
[0009] Overall, the existing tests either lack an easy accessibility and simplicity for use for diagnosis of the large AD population and / or lack accuracy (sensitivity and specificity). This represents a major impediment and bottleneck to develop reliable and rapid diagnosis tests for AD. Another impediment is the identification of a biomarker that does not require invasive sample collecting, such as a spinal tap. The lack of such an accessible, sensitive and specific biomarker, that could be validated by cellular, animal model, pre-clinical models, and human testing, impedes the development of therapies and drugs for AD or the study of pathological processes triggering AD or involved in the progression of AD. Today, clearly there is a high unmet medical need for efficient preventive or disease-modifying therapeutic treatment, as well as for an accurate and non-invasive peripheral biomarker test for early diagnosis of AD including preclinical and early MCI and for applications in drug development (patient stratification and repeated monitoring of drug efficacy in clinical trials), to monitor the efficacy and to adjust the dosing of potential future therapies.. Likewise, for non-AD dementia, including DLB and for many FTD related neurodegenerative disorders, there is a high unmet medical need for efficient preventive or disease-modifying therapeutic treatment, and for an accurate and non- invasive peripheral biomarker test for diagnosis in particular of their early forms.
[0010] Thus, even in view of the results achieved within the last years, there still exists a growing need in the art in order to develop an improved method for an in vitro diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease, especially an improved method for an in vitro diagnosis, prognosis, staging and / or treatment monitoring of Alzheimer's disease.
[0011] Thus, there is a high medical need to provide a more effective, more reliable method for the diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease of subjects, preferably mammalian subjects, more preferably human subjects.
[0012] The human brain is known to be able to adapt to neurodegenerative disease thanks to its plasticity (Hill NL, Kolanowski AM, Gill DJ. Plasticity in Early Alzheimer's Disease: An Opportunity for Intervention. Top Geriatr Rehabil. 2011 Oct;27(4):257- 267. doi: 10.1097 / tgr.0b013e31821 e588e.) For this reason, often AD symptoms are just noticed when the brain is already severely affected. Consequently, there is a high need of a diagnosis before conventional symptoms or signs of AD disease are obvious to the environment.
[0013] These objects and further objects which are not stated explicitly but which are derivable or discernible from the connections discussed herein by way of introduction are solved by a method for an in vitro diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease having all features of claim 1 .
[0014] The present invention accordingly provides a method for an in vitro diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease, wherein the method comprises the steps: a) Obtaining an RNA sample from at least one biological fluid obtained from an individual; b) Determining an expression level of at least one predetermined RNA based on the RNA sample obtained in step a); c) Comparing said expression level to one or several reference expression levels, wherein the comparison of said determined expression level to said one or several reference expression levels is used for the diagnosis, prognosis, staging and / or treatment monitoring of the disease; wherein said at least one predetermined RNA is selected from the group consisting of
[0015] Fxyd3, Trappc3, Clstn2, Deptor, Hoxaas3, Sdk1 , Gm42836, Ldb2, Hist1 h3c, 201001611 SRik, 5430405H02Rik, AC160051.3, Mrpl45, Slc9a9, 5031415H12Rik, Gm12940, Gm20628, AC131120.1 , Gm20634, 4930512B01 Rik, Hist2h2be, Gm43581 , A430018G15Rik, Gm43062, mmu-miR-216a-5p, B930095G15Rik, Gm20501 , CT033754.1 , Pou2af1 , Reps2, Hist1 h4b, Gm26699, Gm19409, Pld5, Gm16105, 9330160F10Rik, B230398E01 Rik, Gm44633, CT030159.2, Eif4g3, Gm44570, Gm31718, Nr6a1 os, Tmem250-ps, 8430423G03Rik, D930016D06Rik, Slc4a7, Gm26831 , AC165261.1 , A430072P03Rik, Gm7331 , Gm12374, Gm15832, C030029H02Rik, Adamts2, 4930509H03Rik, Tex50, 4930556M19Rik;
[0016] D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl ; and
[0017] Pou2af1 , 201001611 SRik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrW, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331 ; preferably said at least one predetermined RNA is selected from the group consisting of
[0018] D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl ; and
[0019] Pou2af1 , 2010016118Rik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrW, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331.
[0020] Useful genes or transcripts include coding RNA transcripts, antisense coding RNA transcripts, processed RNA transcripts (gene or transcripts without open reading frame (ORF)), long intergenic ncRNA, sense intronic IncRNA and antisense IncRNA. Preferably, at least two, more preferably at least three of the genes or transcripts as mentioned above can be used for the purpose of the present invention.
[0021] According to a further subject matter of the present invention, the method comprises the use of at least one, preferably at least two, more preferably at least three genes or transcripts selected from the group consisting of D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef , Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl . This embodiment is useful for a method wherein the determined expression level is preferably achieved with a normalization step. According to a further subject matter of the present invention, the method comprises the use of at least one, preferably at least two, more preferably at least three genes or transcripts selected from the group consisting of Pou2af1 , 2010016118Rik, A430072P03Rik, Arhgef16, Gm 12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrlO, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261 .1 , Eif4g3, Gm7331 . This embodiment is useful for a method wherein the determined expression level is achieved without a normalization step.
[0022] It is important to understand that the at least one biological fluid in step a) is preferably not actually obtained from the individual within the method according to the invention. The RNA sample is obtained from the at least one biological fluid, which preferably had been somehow obtained from the individual at an earlier stage. Therefore preferably, the step of obtaining at least one biological fluid from the individual is not a part of the method according to the present invention.
[0023] In particular preferably, the method according to the present invention does not contain any step for medical treatment of an individual and / or is not a method for medical treatment of an individual.
[0024] By means of the method according to the invention it is possible in an unforeseeable and surprising manner to improve methods for the diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease as mentioned above. The present invention accordingly provides a method for the diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease which is easy accessible and simple for use for diagnosis of the large AD population and / or shows a high sensitivity and specificity.
[0025] Definitions
[0026] Unless defined otherwise herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The term “diagnosis” of a disease, as used herein, is meant to include a process of determining which disease or condition explains a person's symptoms and signs.
[0027] “Prognosis” is a term for predicting the likely or expected development of a disease or of a treatment of a disease, including whether the signs and symptoms will improve or worsen (and how quickly) or remain stable over time; expectations of quality of life, such as the ability to carry out daily activities; the potential for complications and associated health issues; and the likelihood of survival (including life expectancy).
[0028] The term "predicting an outcome" of a disease, as used herein, is meant to include both a prediction of an outcome of a patient undergoing a given therapy and a prognosis of a patient who is not treated.
[0029] An "outcome" within the meaning of the present invention is a defined condition attained in the course of the disease. This disease outcome may e.g. be a clinical condition such as "relapse of disease", "remission of disease", "response to therapy", a disease stage or grade or the like.
[0030] A "risk" is understood to be a probability of a subject or a patient to develop or arrive at a certain disease outcome. The term "risk" in the context of the present invention is not meant to carry any positive or negative connotation with regard to a patient's wellbeing but merely refers to a probability or likelihood of an occurrence or development of a given event or condition.
[0031] The term “staging” as used herein, is meant to determine the extent to which a disease has developed.
[0032] The term “treatment monitoring” is meant to include the processes and activities that need to take place to characterize and to monitor disease progression or treatment effectiveness or aid in diagnosis.
[0033] The term "clinical data" relates to the entirety of available data and information concerning the health status of a patient including, but not limited to, age, sex, weight, menopausal / hormonal status, etiopathology data, anamnesis data, data obtained by in vitro diagnostic methods such as blood or urine tests, data obtained by imaging methods, such as x-ray, computed tomography, MRI, PET, SPECT, ultrasound, electrophysiological data, genetic analysis, gene expression analysis, biopsy evaluation, intraoperative findings.
[0034] The term "classification of a sample" of a patient, as used herein, relates to the association of said sample with at least one of at least two categories. These categories may be for example "high risk" and "low risk"; or high, intermediate and low risk; wherein risk is the probability of a certain event occurring in a certain time period, e.g. occurrence of disease, progression of disease, etc. It can further mean a category of favourable or unfavourable clinical outcome of disease, responsiveness or non-responsiveness to a given treatment or the like. Classification may be performed by use of an algorithm, in particular a discriminant function. A simple example of an algorithm is classification according to a first quantitative parameter, e.g. expression level of a nucleic acid of interest, being above or below a certain threshold value. Classification of a sample of a patient may be used to predict an outcome of disease or the risk of developing a disease. Instead of using the expression level of a single nucleic acid of interest, a combined score of several nucleic acids of interest of interest may be used. Further, additional data may be used in combination with the first quantitative parameter. Such additional data may be clinical data from the patient, such as sex, age, weight of the patient, disease grading, previous and other conditions etc.
[0035] A "discriminant function" is a function of a set of variables used to classify an object or event. A discriminant function thus allows classification of a patient, sample or event into a category or a plurality of categories according to data or parameters available from said patient, sample or event. Such classification is a standard instrument of statistical analysis well known to the skilled person. E.g. a patient may be classified as "high risk" or "low risk", "in need of treatment" or "not in need of treatment" or other categories according to data obtained from said patient, sample or event. Classification is not limited to "high" vs. "low", but may be performed into a plurality of categories, grading or the like. Examples for discriminant functions which allow a classification include, but are not limited to discriminant functions defined by support vector machines (SVM), k-nearest neighbors (kNN), (naive) Bayes models, or piecewise defined functions such as, for example, in subgroup discovery, in decision trees, in logical analysis of data (LAD) an the like. The term "expression level" refers, e.g., to a determined quantification of a nucleic acid of interest. The term "normalized expression level " or "normalized expression level / counts" refers , e. g. to a value for the quantification of a specific molecule after correction of the technical factors that can prevent direct comparison of expression measures. Terms such as “normalization step” and the like correspond thereto. Such normalization can be achieved using methods like, e.g. Trimmed Mean of M-values (TMM) or Relative Log Expression (RLE) [Abbas-Aghababazadeh F, Li Q, Fridley BL (2018) Comparison of normalization approaches for gene expression studies completed with high-throughput sequencing. PLoS ONE 13(10): e0206312. https: / / doi.org / 10.1371 / journal.pone.0206312]. The term "normalized expression level / counts" can also refer to, e.g. a determined level of expression compared either to a predetermined internal reference nucleic acid or to a computed average expression value wherein the computed average expression value or the expression level of the predetermined internal reference nucleic acid (also referred as housekeeping gene or transcript) is the basis for evaluating the level of expression of a nucleic acid of interest.
[0036] The normalization avoids the influence of the number of sequencing reads for the samples. Several approaches that are widely described as for example TPM, FPKM, DESeq2 or TMM may be used (Yingdong Zhao et al. “TPM, FPKM, or Normalized Counts? A Comparative Study of Quantification Measures for the Analysis of RNA- seq Data from the NCI Patient-Derived Models Repository”, Journal of Translational Medicine volume 19, Article number: 269 (2021 ), Ciaran Evans et al. “Selecting between-sample RNA-Seq normalization methods from the perspective of their assumption”, Briefings in Bioinformatics, Volume 19, Issue 5, September 2018, Pages 776-792). For the present invention DESeq2 is preferably used (Michael Love et al. “Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2”, Genome Biology volume 15, Article number: 550 (2014)).
[0037] The term “pattern of expression levels” refers to a determined level of expression of at least two genes of interest. A pattern is not limited to the comparison of two genes but is also related to multiple comparisons of genes to reference genes or samples. A certain "pattern of expression levels" may also result and be determined by comparison and measurement of several nucleic acids of interest disclosed hereafter and display the relative abundance of these transcripts to each other. The term "expression profile" concerns a pattern of expression levels wherein at least two normalized expression levels are compared at different point of times. Expression levels may also be assessed relative to expression in different tissues, patients versus healthy controls, etc. The expression level may be generated by any convenient means, e.g. nucleic acid hybridization (e.g. microarray, nanoString nCounter), nucleic acid amplification (e.g. PCR, RT-PCR, qRT-PCR, high-throughput RT-PCR, droplet digital PCR), ELISA for quantitation, next generation sequencing (NGS, e.g. ABI SOLID, Roche / 454 GS FLX, Illumina sequencing platforms), flow cytometry (e.g. LUMINEX, Milipore Guava) and the like, that allow the determination of an RNA expression level in a subject and comparison between samples. The expression level can be based on the reads of a transcript. There are several complex ways to calculate diagnostic scores from NGS datasets. IMPRESS created a score comparing the expression level of different genes between themselves (Noam Auslander et al. “Robust prediction of response to immune checkpoint blockade therapy in metastatic melanoma”, Nature Medicine volume 24, pages 1545-1549 (2018)). Preferably, a scoring system for the analysis is created. The score is expected to translate the expression of a set of predefined transcripts into a score that consists of usually limited digits for example 1-50 or A-G. The score can be generated using different approaches. One preferable approach is by setting thresholds of normalized gene expression for each of the predetermined genes according to the expression values observed in disease and control samples and comparing the normalized expression with the thresholds, the genes expression can be defined with one of the categories: “Normal”, “Risk 1” or “Risk 2”. To combine the results from multiple genes, a score can be calculated based on the capacity of that transcript to distinguish disease and control of an individual (in other words, based on the statistical significancy (p-value)). If the gene expression is “Normal” the gene mark is zero. In case the gene expression is calculated to be “Risk 1”, the mark is the calculated gene specific score. If the gene expression is “Risk 2”, the mark can be calculated as the double of “Risk 1”.
[0038] Based on these values, the final score for the sample is calculated by summing the marks of each of transcripts. This scoring approach is merely an example, and any other scoring system is also possible and is understood to be within the scope of the present invention. A "reference expression level", "reference normalized expression level" or “reference pattern of expression levels” within the meaning of the invention shall be understood as being any expression levels, normalized expression levels or pattern of expression levels that can be used for the comparison to another expression level, normalized expression level or pattern of expression levels. In a preferred embodiment of the invention, a reference expression level is, e.g., an average expression level observed in a group of healthy or diseased individuals and / or individuals without the disease of interest (neurodegenerative disease and amyloidosis-related disease), serving as a reference group. The "reference expression level", "reference normalized expression level" or “reference pattern of expression levels” can be measured or provided as a database.
[0039] In the context of the present invention a "sample" or a "biological sample" is a sample which is derived from or has been in contact with a biological organism. Examples for biological samples are: cells, tissue, body fluids, biopsy specimens, blood, urine, saliva, sputum, plasma, serum, cell culture supernatant, and others.
[0040] A "probe" is a molecule or substance capable of specifically binding or interacting with a specific biological molecule. The terms "primer", "primer pair" and "probe" shall have ordinary meaning of these terms which is known to the person skilled in the art of molecular biology. In a preferred embodiment of the invention "primer", "primer pair" and "probes" refer to oligonucleotide or polynucleotide molecules with a sequence identical to, complementary to, homologues of, or homologous to regions of the target molecule or target sequence which is to be detected or quantified, such that the primer, primer pair or probe can specifically bind to the target molecule, e.g. target nucleic acid, RNA, DNA, cDNA, gene, transcript, peptide, polypeptide, or protein to be detected or quantified. As understood herein, a primer may in itself function as a probe. A "probe" as understood herein may also comprise e.g. a combination of primer pair and labelled probe, as is common in many commercially available qPCR methods.
[0041] A "gene" is a set of segments of nucleic acid that contains the information necessary to produce an RNA product. A "gene product" is a biological molecule produced through transcription or expression of a part of the genome, e.g. a coding RNA transcript, an antisense coding RNA transcript, a processed RNA transcript (gene or transcripts without open reading frame (ORF)), a long intergenic ncRNA, a sense intronic IncRNA, an antisense IncRNA, or an mRNA.
[0042] A "miRNA" is a short, naturally occurring RNA molecule and shall have the ordinary meaning understood by a person skilled in the art. A "molecule derived from an miRNA" is a molecule which is chemically or enzymatically obtained from a miRNA template, such as cDNA.
[0043] A “long non-coding RNA (IncRNA)” is a type of RNA, generally defined to be more than 200 nucleotides long and not translated into protein. As used herein the term “long non-coding RNA (IncRNA)” is meant to include intergenic lincRNAs, intronic ncRNAs, and sense and antisense IncRNAs.
[0044] The term "array" refers to an arrangement of addressable locations on a device, e.g. a chip device. The number of locations can range from several to at least hundreds or thousands. Each location represents an independent reaction site. Arrays include, but are not limited to nucleic acid arrays, protein arrays and antibody-arrays. A "nucleic acid array" refers to an array containing nucleic acid probes, such as oligonucleotides, polynucleotides or larger portions of genes. The nucleic acid on the array is preferably single stranded. A "microarray" refers to a biochip or biological chip, i.e. an array of regions having a density of discrete regions with immobilized probes of at least about 100 / cm2.
[0045] A "Amplification-based method" refers to methods comprising amplification of nucleic acids, e.g. polymerase chain reaction (PCR). These are methods of exponential amplification of nucleic acids, e.g. DNA, including cDNA, or RNA by enzymatic replication in vitro using one, two or more primers. For RNA amplification, a reverse transcription may be used as a first step. PCR-based methods comprise kinetic or quantitative PCR (qPCR) which is particularly suited for the analysis of expression levels. When it comes to the determination of expression levels, a PCR based method may for example be used to detect the presence of a given RNA by (1 ) reverse transcription of the complete RNA of a sample (the so called transcriptome) into cDNA with help of a reverse transcriptase enzyme, and (2) detecting the presence of a given cDNA with help of respective primers. This approach is commonly known as reverse transcriptase PCR (rtPCR). The term "PCR based method" comprises both end-point PCR applications as well as kinetic / real time PCR techniques applying special fluorophores or intercalating dyes which emit fluorescent signals as a function of amplified target and allow monitoring and quantification of the target. Quantification methods could be either absolute by comparing to external standard curves or relative to a comparative internal standard. Further "Amplificationbased methods" can also be applied such as Phi based isothermal amplification methods (Berthet N, et al. Phi29 polymerase based random amplification of viral RNA as an alternative to random RT-PCR. BMC Mol Biol. 2008 Sep 4;9:77. doi: 10.1 186 / 1471 -2199-9-77.).
[0046] The term "next generation sequencing" or "high throughput sequencing" refers to high-throughput sequencing technologies that parallelize the sequencing process, producing thousands or millions of sequences at once. Examples include Massively Parallel Signature Sequencing (MPSS) Polony sequencing, 454 pyrosequencing, Illumina (Solexa) sequencing, SOLiD sequencing, Ion semiconductor sequencing, DNA nanoball sequencing, Helioscope(TM)single molecule sequencing, Single Molecule SMRT(TM) sequencing, Single Molecule real time (RNAP) sequencing, Nanopore DNA or RNA sequencing. A Next Generation Sequencing (NGS) dataset is the result of a sequencing analysis. In this analysis, an identification of RNA molecules is performed based on their sequence. For example if in a sample of plasma, 25 times the sequence TAGCTTATCAGACTGATGTTGA is identified, one can be sufficiently sure that this sequence is from the miRNA hsa-miR-21 -5p. This way, it can be understood that 25 sequencing reads of the miRNA hsa-miR-21 -5p have been identified. For each sample, several millions of reads are sequenced to make sure a truthful representation of the RNA content of that sample is obtained. By informatically comparing all the sequenced reads with the databases of sequences of known RNAs or DNA, one ends up with a table with the number of reads for each of the known RNA molecules - an NGS dataset.
[0047] The term "marker" or "biomarker" refers to a biological molecule, e.g., a nucleic acid, peptide, protein, hormone, etc., whose presence or concentration can be detected and correlated with a known condition, such as a disease state, or with a clinical outcome, such as response to a treatment.
[0048] The genes or transcripts as known, e.g. Fxyd3, Trappc3, Clstn2, Deptor, Hoxaas3, Sdk1 , Gm42836, Ldb2, Hist1 h3c, 201001611 SRik, 5430405H02Rik, AC160051.3, Mrpl45, Slc9a9, 5031415H12Rik, Gm 12940, Gm20628, AC131120.1 , Gm20634, 4930512B01 Rik, Hist2h2be, Gm43581 , A430018G15Rik, Gm43062, mmu-miR-216a-5p, B930095G15Rik, Gm20501 , CT033754.1 , Pou2af1 , Reps2, Hist1 h4b, Gm26699, Gm19409, Pld5, Gm16105, 9330160F10Rik, B230398E01 Rik, Gm44633, CT030159.2, Eif4g3, Gm44570, Gm31718, Nr6a1 os, Tmem250-ps, 8430423G03Rik, D930016D06Rik, Slc4a7, Gm26831 , AC165261.1 , A430072P03Rik, Gm7331 , Gm12374, Gm15832, C030029H02Rik, Adamts2, 4930509H03Rik, Tex50, 4930556M19Rik;
[0049] D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl ; and
[0050] Pou2af1 , 201001611 SRik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrW, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331 include e. g. coding RNA transcripts, antisense coding RNA transcripts, processed RNA transcripts (gene or transcripts without open reading frame (ORF)), long intergenic ncRNA, sense intronic IncRNA and antisense IncRNA.
[0051] In some cases of the genes as mentioned above, the antisense transcripts are preferred while in other cases the sense transcripts are preferred. The following information shows in which cases the sense transcripts of a gene are preferred and in which cases of the antisense transcripts a gene are preferred. For example, the sense transcripts of the gene Fxyd3 are preferred over the antisense transcripts of the gene. Consequently, the sense transcripts of the gene is noted Fxyd3 (ST) in order to emphasize these transcripts. Furthermore, the antisense transcripts of the gene Gm5431 are preferred over the sense transcripts of the gene. Consequently, the antisense transcripts of the gene is noted Gm5431 (AS) in order to emphasize these transcripts. Both are examples indicating that the lists above concerning the genes claiming the sense and antisense transcripts and the following lists concerning the sense and antisense transcripts of these genes, respectively, could be combined based on the fact that the preference for each gene transcript is independent from the preference of other genes.
[0052] In step a) an RNA sample from at least one biological fluid obtained from an individual is provided. Consequently, any biological fluid sample of an individual comprising RNA being analyzable in accordance with the present invention could be used. According to a specific embodiment it can be provided that RNA from at least one biological fluid obtained from an individual can be used without specific isolation steps. E. g. the biological fluid obtained from an individual can be processed by methods inhibiting disturbing biological compounds such as disturbing enzymes Faridani OR, Abdullayev I, Hagemann-Jensen M, Schell JP, Lanner F, Sandberg R. Single-cell sequencing of the small-RNA transcriptome. Nat Biotechnol. 2016 Dec;34(12): 1264-1266. doi: 10.1038 / nbt.3701.). Also, RNA was shown to be directly analyzable by the use of sequence-specific probes that carry fluorophores, e.g. with the NANOSTRING Instrument using non-chaotropic lysis buffers; also qPCR is possible without RNA-lsolation e.g. with the “Cell-2-CT” products from Thermo Fisher Scientific; but other approaches may be available or possible in the future as well. Furthermore, specific binding sites could be used to discover RNA of interest.
[0053] According to a preferred embodiment, the step of obtaining an RNA sample from at least one biological fluid obtained from an individual includes an isolation step of the RNA of the sample. Isolation of RNA from at least one biological fluid obtained from an individual is well known in the art. RNA isolation methodologies can include the use of magnetic beads that bind the RNA, protein precipitation combined with silica column isolation, proteinase K digestion combined with silica column isolation, and phenol with or without phase separation combined with silica column isolation. E. g. useful isolation methods are disclosed by Li, Xin, Maurizio Mauro, and Zev Williams. "Comparison of plasma extracellular RNA isolation kits reveals kit-dependent biases." Biotechniques 59.1 (2015): 13-17, (doi: 10.2144 / 000114306). According to a further subject matter of the present invention, the method for an in vitro diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease, wherein the method comprises the steps: a) Obtaining an RNA sample from at least one biological fluid obtained from an individual; b) Determining an expression level of at least one predetermined RNA based on the RNA sample obtained in step a); c) Comparing said expression level to one or several reference expression levels, wherein the comparison of said determined expression level to said one or several reference expression levels is used for the diagnosis, prognosis, staging and / or treatment monitoring of the disease; wherein said at least one predetermined RNA is selected from the group consisting of
[0054] Fxyd3 (ST), Trappc3 (ST), Clstn2 (AS), Deptor (AS), Hoxaas3 (ST), Sdk1 (ST), Gm42836 (ST), Ldb2 (AS), Hist1 h3c (ST), 201001611 SRik (AS), 5430405H02Rik (ST), AC160051.3 (ST), Mrpl45 (AS), Slc9a9 (ST), 5031415H12Rik (AS), Gm12940 (ST), Gm20628 (ST), AC131120.1 (ST), Gm20634 (ST), 4930512B01 Rik (ST), Hist2h2be (ST), Gm43581 (AS), A430018G15Rik (ST), Gm43062 (AS), mmu-miR- 216a-5p (ST), B930095G15Rik (ST), Gm20501 (ST), CT033754.1 (ST), Pou2af1 (AS), Reps2 (ST), Hist1 h4b (ST), Gm26699 (ST), Gm19409 (ST), Pld5 (AS), Gm16105 (ST), 9330160F10Rik (AS), B230398E01 Rik (ST), Gm44633 (ST), CT030159.2 (ST), Eif4g3 (ST), Gm44570 (ST), Gm31718 (ST), Nr6a1os (ST), Tmem250-ps (ST), 8430423G03Rik (ST), D930016D06Rik (ST), Slc4a7 (ST), Gm26831 (ST), AC165261.1 (AS), A430072P03Rik (AS), Gm7331 (AS), Gm 12374 (AS), Gm 15832 (ST), C030029H02Rik (ST), Adamts2 (ST), 4930509H03Rik (ST), Tex50 (ST), 4930556M19Rik (ST);
[0055] D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mid 24-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1 ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), Platrl O (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); and
[0056] Pou2af1 (ST), 2010016118Rik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrlO (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST); preferably said at least one predetermined RNA is selected from the group consisting of
[0057] D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1 ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), Platrl O (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); and
[0058] Pou2af1 (ST), 2010016118Rik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm12374
[0059] (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), Platrl O (ST), Gm21986
[0060] (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST).
[0061] The expression “(ST)” denotes the sense transcripts of the corresponding gene. E.g. the term “D830025C05Rik (ST)” denotes the sense transcripts of the gene D830025C05Rik. The expression “(AS)” denotes the antisense transcripts of the corresponding gene. E.g. the term “Reps2 (AS)” denotes the antisense transcripts of the gene Reps2.
[0062] According to a further subject matter of the present invention the method for an in vitro diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease, wherein the method comprises the steps: a) Obtaining an RNA sample from at least one biological fluid obtained from an individual; b) Determining an expression level of at least one predetermined RNA based on the RNA sample obtained in step a); c) Comparing said expression level to one or several reference expression levels, wherein the comparison of said determined expression level to said one or several reference expression levels is used for the diagnosis, prognosis, staging and / or treatment monitoring of the disease; wherein said at least one predetermined RNA is selected from the group consisting of SEQ_NO_1 to SEQ_NO_117, preferably, SEQ_NO_1 to SEQ_NO_72.
[0063] According to a preferred embodiment it can be provided that the method comprises the steps: a) Obtaining an RNA sample from at least one biological fluid obtained from an individual; b) Determining a pattern of expression levels of at least two predetermined RNAs based on the RNA sample obtained in step a); c) Comparing said pattern of expression levels to one or several reference pattern of expression levels, wherein the comparison of said determined pattern of expression levels to said one or several reference pattern of expression levels is used for the diagnosis, prognosis, staging and / or treatment monitoring of the disease; wherein said at least two predetermined RNAs are selected from the group consisting of
[0064] Fxyd3, Trappc3, Clstn2, Deptor, Hoxaas3, Sdk1 , Gm42836, Ldb2, Hist1 h3c, 201001611 SRik, 5430405H02Rik, AC160051.3, Mrpl45, Slc9a9, 5031415H12Rik, Gm12940, Gm20628, AC131120.1 , Gm20634, 4930512B01 Rik, Hist2h2be, Gm43581 , A430018G15Rik, Gm43062, mmu-miR-216a-5p, B930095G15Rik, Gm20501 , CT033754.1 , Pou2af1 , Reps2, Hist1 h4b, Gm26699, Gm19409, Pld5, Gm16105, 9330160F10Rik, B230398E01 Rik, Gm44633, CT030159.2, Eif4g3, Gm44570, Gm31718, Nr6a1 os, Tmem250-ps, 8430423G03Rik, D930016D06Rik, Slc4a7, Gm26831 , AC165261.1 , A430072P03Rik, Gm7331 , Gm12374, Gm15832, C030029H02Rik, Adamts2, 4930509H03Rik, Tex50, 4930556M19Rik;
[0065] D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl ; and
[0066] Pou2af1 , 201001611 SRik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrW, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331. Preferably, said at least two predetermined RNAs are selected from the group consisting of the preferred RNAs as mentioned above and below wherein said at least one predetermined RNA is selected (starting with D830025C05Rik and ending with Gm7331 ). According to a further preferred embodiment it can be provided that the method comprises the steps: a) Obtaining an RNA sample from at least one biological fluid obtained from an individual; b) Determining a pattern of expression levels of at least two predetermined RNAs based on the RNA sample obtained in step a); c) Comparing said pattern of expression levels to one or several reference pattern of expression levels, wherein the comparison of said determined pattern of expression levels to said one or several reference pattern of expression levels is used for the diagnosis, prognosis, staging and / or treatment monitoring of the disease; wherein said at least two predetermined RNAs are selected from the group consisting of
[0067] Fxyd3 (ST), Trappc3 (ST), Clstn2 (AS), Deptor (AS), Hoxaas3 (ST), Sdk1 (ST), Gm42836 (ST), Ldb2 (AS), Hist1 h3c (ST), 201001611 SRik (AS), 5430405H02Rik (ST), AC160051.3 (ST), Mrpl45 (AS), Slc9a9 (ST), 5031415H12Rik (AS), Gm12940 (ST), Gm20628 (ST), AC131120.1 (ST), Gm20634 (ST), 4930512B01 Rik (ST), Hist2h2be (ST), Gm43581 (AS), A430018G15Rik (ST), Gm43062 (AS), mmu-miR- 216a-5p (ST), B930095G15Rik (ST), Gm20501 (ST), CT033754.1 (ST), Pou2af1 (AS), Reps2 (ST), Hist1 h4b (ST), Gm26699 (ST), Gm19409 (ST), Pld5 (AS), Gm16105 (ST), 9330160F10Rik (AS), B230398E01 Rik (ST), Gm44633 (ST), CT030159.2 (ST), Eif4g3 (ST), Gm44570 (ST), Gm31718 (ST), Nr6a1os (ST), Tmem250-ps (ST), 8430423G03Rik (ST), D930016D06Rik (ST), Slc4a7 (ST), Gm26831 (ST), AC165261.1 (AS), A430072P03Rik (AS), Gm7331 (AS), Gm 12374 (AS), Gm 15832 (ST), C030029H02Rik (ST), Adamts2 (ST), 4930509H03Rik (ST), Tex50 (ST), 4930556M19Rik (ST);
[0068] D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), PlatrlO (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); and
[0069] Pou2af1 (ST), 2010016118Rik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrlO (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST). Preferably, said at least two predetermined RNAs are selected from the group consisting of the preferred RNAs as mentioned above and below wherein said at least one predetermined RNA is selected (starting with D830025C05Rik (ST) and ending with Gm7331 (ST).
[0070] According to a further preferred embodiment it can be provided that the method comprises the steps: a) Obtaining an RNA sample from at least one biological fluid obtained from an individual; b) Determining a pattern of expression levels of at least two predetermined RNAs based on the RNA sample obtained in step a); c) Comparing said pattern of expression levels to one or several reference pattern of expression levels, wherein the comparison of said determined pattern of expression levels to said one or several reference pattern of expression levels is used for the diagnosis, prognosis, staging and / or treatment monitoring of the disease; wherein said at least two predetermined RNAs are selected from the group consisting of SEQ_NO_1 to SEQ_NO_117, preferably, SEQ_NO_1 to SEQ_NO_72. Preferably, the neurodegenerative disease, neurological disease or amyloid [3-related disease is Alzheimer's Disease (AD).
[0071] It can be provided that the expression level is determined of at least one predetermined RNA selected from the group consisting of D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm 14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl . Preferably, a pattern of expression levels is determined of at least three predetermined RNAs of said group. Even more preferably, a pattern of expression is determined of at least four, preferably at least five and more preferably at least ten predetermined RNAs of said group. The group mentioned above provides a very reliable diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease, especially AD.
[0072] Furthermore, it can be provided that the expression level is determined of at least one predetermined RNA selected from the group consisting of D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1 ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416l19Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), PlatrW (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS). Preferably, a pattern of expression levels is determined of at least three predetermined RNAs of said group. Even more preferably, a pattern of expression is determined of at least four, preferably at least five and more preferably at least ten predetermined RNAs of said group. The group mentioned above provides a very reliable diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease, especially AD.
[0073] In addition, it can be provided that the expression level is determined of at least one predetermined RNA selected from the group consisting of SEQ_NO_22, SEQ_NO_23, SEQ_NO_24, SEQ_NO_25, SEQ_NO_26, SEQ_NO_27, SEQ_NO_28, SEQ_NO_29, SEQ_NO_30, SEQ_NO_31 , SEQ_NO_32, SEQ_NO_33, SEQ_NO_34, SEQ_NO_35, SEQ_NO_36, SEQ_NO_37, SEQ_NO_38, SEQ_NO_4, SEQ_NO_39, SEQ_NO_40, SEQ_NO_41 , SEQ_NO_42, SEQ_NO_43, SEQ_NO_44, SEQ_NO_45, SEQ_NO_46, SEQ_NO_47, SEQ_NO_48, SEQ_NO_49, SEQ_NO_50, SEQ_NO_51 , SEQ_NO_52, SEQ_NO_53, SEQ_NO_7, SEQ_NO_54, SEQ_NO_55, SEQ_NO_56, SEQ_NO_57, SEQ_NO_58, SEQ_NO_59, SEQ_NO_60, SEQ_NO_61 , SEQ_NO_9, SEQ_NO_62, SEQ_NO_10, SEQ_NO_63, SEQ_NO_11 , SEQ_NO_64, SEQ_NO_65, SEQ_NO_66, SEQ_NO_67, SEQ_NO_68, SEQ_NO_15, SEQ_NO_69, SEQ_NO_70, SEQ_NO_71 , SEQ_NO_16, SEQ_NO_72, SEQ_NO_18. Preferably, a pattern of expression levels is determined of at least three predetermined RNAs of said group. Even more preferably, a pattern of expression is determined of at least four, preferably at least five and more preferably at least ten predetermined RNAs of said group. The group mentioned above provides a very reliable diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease, especially AD.
[0074] The inventors surprisingly found that the expression levels of the group mentioned above is positive correlated with the quantities of amyloid-[3 present in the brain.
[0075] Furthermore, it can be provided that the expression level is determined of at least one predetermined RNA selected from the group consisting of Pou2af1 , 2010016118Rik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrlO, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331. In a preferred embodiment, the at least one, preferably at three RNAs is selected from the group consisting of Arhgef16, Scrnl , Sncaip, Tug1 , Mrpl45, Reps2, Eif4g3, even more preferably from the group consisting of Arhgef16, Scrnl , Sncaip, Tug1 , Mrpl45. Preferably, it can be provided that the expression level is determined of at least one predetermined RNA selected from the group consisting of Pou2af1 (ST), 201001611 SRik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrlO (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST). In a preferred embodiment, the at least one, preferably at three RNAs is selected from the group consisting of Arhgef16 (AS), Scrnl (AS), Sncaip (ST), Tug1 (ST), Mrpl45 (ST), Reps2 (AS), Eif4g3 (AS), even more preferably from the group consisting of Arhgef16 (AS), Scrnl (AS), Sncaip (ST), Tug1 (ST), Mrpl45 (ST). More preferably, it can be provided that the expression level is determined of at least one predetermined RNA selected from the group consisting of SEQ_NO_1 to SEQ_NO_21 . In a preferred embodiment, the at least one, preferably at three RNAs is selected from the group consisting of SEQ_NO_4, SEQ_NO_18, SEQ_NO_15, SEQ_NO_16, SEQ_NO_13, SEQ_NO_14, SEQ_NO_20, even more preferably from the group consisting of SEQ_NO_4, SEQ_NO_18, SEQ_NO_15, SEQ_NO_16, SEQ_NO_13. Preferably, a pattern of expression levels is determined of at least three predetermined RNAs of said groups. Even more preferably, a pattern of expression is determined of at least four, preferably at least five and more preferably at least ten predetermined RNAs of said group. The group mentioned above provides a very easy diagnosis of a neurodegenerative disease, neurological disease or amyloid [3- related disease, especially AD. The inventors surprisingly found that the expression of the group mentioned above indicates the risk for a neurodegenerative disease, neurological disease or amyloid [3-related disease, especially AD a simple manner. Healthy individuals do not express RNA of the group mentioned above and, hence, the presence of the RNA of the group mentioned above clearly shows a risk without performing more complex expression level analysis.
[0076] Preferably, the comparison of said determined expression level to said one or several reference expression levels is achieved by determining the presence of at least one RNA selected from the group consisting of Pou2af1 , 201001611 SRik, A430072P03Rik, Arhgef16, Gm 12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrlO, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331 ; preferably Pou2af1 (ST), 2010016118Rik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm 12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrlO (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST); more preferably SEQ_NO_1 to SEQ_NO_21. Preferably, the determined expression level is achieved without a normalization step. In a preferred embodiment, the at least one RNA is selected from the group consisting of Arhgef16, Scrnl , Sncaip, Tug1 , Mrpl45, Reps2, Eif4g3, even more preferably from the group consisting of Arhgef16, Scrnl , Sncaip, Tug1 , Mrpl45. In a more preferred embodiment, the at least one RNA is selected from the group consisting of Arhgef16 (AS), Scrnl (AS), Sncaip (ST), Tug1 (ST), Mrpl45 (ST), Reps2 (AS), Eif4g3 (AS), even more preferably from the group consisting of Arhgef16 (AS), Scrnl (AS), Sncaip (ST), Tug1 (ST), Mrpl45 (ST). In an even more preferred embodiment, the at least one RNA is selected from the group consisting of SEQ_NO_4, SEQ_NO_18, SEQ_NO_15, SEQ_NO_16, SEQ_NO_13, SEQ_NO_14, SEQ_NO_20, even more preferably from the group consisting of SEQ_NO_4, SEQ_NO_18, SEQ_NO_15, SEQ_NO_16, SEQ_NO_13.
[0077] The expression level or pattern of expression levels of an individual is compared to one or several reference expression levels or reference pattern of expression levels.
[0078] The comparison is used for the diagnosis, prognosis, staging and / or treatment monitoring of the disease. In a preferred embodiment, the comparison is used for a classification of the RNA sample into one of at least two classes. The classes can be defined as described above and below in more detail, e.g. “high risk", “intermediate risk” and "low risk". Furthermore, the classes can be related to stages of the disease as described above and below in more detail. Preferably, the classification can be considered as result of the comparison and is used for diagnosis, prognosis, staging and / or treatment monitoring of the disease. Furthermore a score as mentioned above and below can be used and the comparison results in a scoring of the RNA sample. Furthermore, the comparison can be used to provide an estimation or evaluation about the brain AR> plaque load of an individual. The RNA expression of the individual can be upregulated or downregulated compared to a standard expression level observed in a healthy individual. It can be provided that the expression level or pattern of expression levels is preferably determined of the at least one predetermined RNA or the at least two predetermined RNAs which is upregulated.
[0079] Preferably, it can be provided that said least one predetermined RNA comprises a False Discovery Rate (calculated by performing the statistical testing between control and disease samples and using DESeq2 [M.l. Love, et al., “Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2”, Genome Biol. 15 (2014) 550. https: / / doi.org / 10.1186 / s13059-014-0550-8] and following the Benjamini- Hochberg approach [Benjamini, Y. and Hochberg, Y., 1995. “Controlling the false discovery rate: a practical and powerful approach to multiple testing.”, Journal of the Royal statistical society: series B (Methodological), 57(1 ), pp.289-300.] ; FDR) of at most 0.01 , preferably of at most 0.001 , more preferably of at most 0.0001 , even more preferably of at most 10’5. More preferably, said least two predetermined RNA comprise a False Discovery Rate (Benjamini-Hochberg approach; FDR) of at most 0.01 , preferably of at most 0.001 , more preferably of at most 0.0001 , even more preferably of at most 10’5. The False Discovery Rate (Benjamini-Hochberg approach; FDR ) of the predetermined RNA to be preferably used for the method of the present invention is provided in the Examples.
[0080] Preferably, it can be provided that said least one predetermined RNA comprises a Pearson correlation coefficient between the average expression level of the RNA and the average brain AR> plaque load (correl) of at least 0.94, preferably of at least 0.98, more preferably of at least 0.995, even more preferably of at least 0.9980. More preferably, said least two predetermined RNA comprise a Pearson correlation coefficient between the average expression level of the RNA and the average brain AR> plaque load (correl) of at least 0.94, preferably of at least 0.97, more preferably of at least 0.98, more preferably of at least 0.995, even more preferably of at least 0.9980. The Pearson correlation coefficient between the average expression level of the RNA and the average brain AR> plaque load (correl) of the predetermined RNA to be preferably used for the method of the present invention is provided in the Examples. AR> plaque is an abbreviation for amyloid-beta peptide plaque. Since a correlation coefficient describes the strength and direction of an association between variables, the inventors calculated the Pearson correlation coefficient between the average expression level of the RNA and the average brain AR> plaque load [Schober, Patrick MD, PhD, MMedStat; Boer, Christa PhD, MSc; Schwarte, Lothar A. MD, PhD, MBA. Correlation Coefficients: Appropriate Use and Interpretation. Anesthesia & Analgesia 126(5):p 1763-1768, May 2018. DOI: 10.1213 / ANE.0000000000002864],
[0081] Preferably, it can be provided that said least one predetermined RNA comprises an absolute value of the binary logarithm of fold change (Iog2 Fold Change) of at least 2, preferably of at least 3, more preferably of at least 4, even more preferably of at least 5. More preferably, said least two predetermined RNA comprise an absolute value of the binary logarithm of fold change (Iog2 Fold Change) of at least 2, preferably of at least 3, more preferably of at least 4, even more preferably of at least 5. The Binary logarithm of fold change (Iog2 Fold Change) of the predetermined RNA to be preferably used for the method of the present invention is provided in the Examples. Briefly, the binary logarithm of fold change (Iog2 Fold Change) was calculated using the normalized values of gene expressions of disease and control samples, and the maximum likelihood estimate (MLE) estimation from DESeq2 [M.l. Love, et al., “Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2”, Genome Biol. 15 (2014) 550. https: / / doi.org / 10.1186 / s13059-014-0550-8].
[0082] The RNA sample is obtained from an individual from at least one biological fluid. Preferably, the at least one biological fluid is selected from the group consisting of blood, blood plasma, serum, lymph, cerebrospinal fluid, tear fluid, urine, and saliva.
[0083] It can be provided that the at least one biological fluid is processed to achieve a cell- free sample prior to step a) or said at least one biological fluid is a cell-free sample.
[0084] It can be provided that the at least one biological fluid is processed to achieve a vesicle-free sample prior to step a) or said at least one biological fluid is a vesicle- free sample.
[0085] It can be provided that the at least one biological fluid is processed to achieve a plasma sample prior to step a). It can be provided that the at least one biological fluid is processed to achieve an extracellular vesicles (EV) sample prior to step a).
[0086] It can be provided that the RNA sample is obtained from blood plasma as the at least one biological fluid.
[0087] It can be provided that the RNA sample is obtained from blood plasma extracellular vesicles (EV) as the at least one biological fluid.
[0088] It can be provided that the RNA sample is obtained from blood plasma and extracellular vesicles (EV) as at least one biological fluid.
[0089] In a preferred embodiment it can be provided that determining an expression level or a pattern of expression levels in step b) includes the calculation of an expression level value by the measuring of expression levels of a plurality of RNAs from the RNA sample obtained in step a) in form of expression level values and step b) includes mathematically combining the expression level values of said plurality of RNAs. Preferably, the mathematically combining the expression level values of said plurality of RNAs provides a normalization of the expression level and a normalized expression level is achieved. The same is true with regard to the pattern of expression levels such that a pattern of normalized expression levels is provided.
[0090] Preferably, the expression level values or pattern of normalized expression level values are normalized based on Next Generation Sequencing datasets.
[0091] The normalization avoids the influence of the number of sequencing reads for the samples as mentioned above. Preferably, the level of expression or expression level is based on counts.
[0092] For the discovery of biomarkers (comparison between samples from healthy and diseased individuals), normalization of the data should be performed. For the use of the present sets of biomarkers for diagnostics, normalization of the dataset can be used (Henry Han and Ke Men “How does normalization impact RNA-seq disease diagnosis?”, Journal of Biomedical Informatics, Volume 85, September 2018, Pages 80-92).
[0093] Furthermore, it can be provided that the expression levels of the plurality of RNAs from the RNA sample obtained in step a) are determined as expression level values and the expression level values are normalized based on an internal reference RNA. Useful internal reference RNA are well known in the art and, hence, the person skilled in the art is able to select the best internal reference RNA. Preferred reference RNAs (so called housekeepers) are RNAs know to have a basic function in biology that make them having a stable expression in specific tissues or samples. However, also transcripts without a stable expression can be used as references for a specific context, if they have a known ratio / relation to the RNA molecule of interest. E. g. such approach is disclosed by Shi, P., Ray, S., Zhu, Q. et al. “Top scoring pairs for feature selection in machine learning and applications to cancer outcome prediction.” BMC Bioinformatics 12, 375 (2011 ), (https: / / doi.org / 10.1186 / 1471 -2105-12-375). The scientific literature states that several RNAs can be used as housekeepers. Non limiting examples for the internal reference RNA are miR-16-5p, miR-191 -5p and miR-25-3p.
[0094] Furthermore, it can be provided that the reference expression levels or the reference pattern of expression levels comprise a gene expression level or a pattern of expression levels generated from a population of individuals that do not presently or in the future display neurodegenerative disease, neurological disease or amyloid [3- related disease.
[0095] In a preferred embodiment, the expression level values are preferably correlated with predefined specific stages of the neurodegenerative disease, neurological disease or amyloid [3-related disease.
[0096] Preferably, said expression level values are determined from at least one RNA selected from the group consisting of
[0097] D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl . More preferably, said expression level values are determined from at least one RNA selected from the group consisting of
[0098] D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), PlatrlO (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS).
[0099] Even more preferably, said expression level values are determined from at least one RNA selected from the group consisting of
[0100] SEQ_NO_22, SEQ_NO_23, SEQ_NO_24, SEQ_NO_25, SEQ_NO_26, SEQ_NO_27, SEQ_NO_28, SEQ_NO_29, SEQ_NO_30, SEQ_NO_31 , SEQ_NO_32, SEQ_NO_33, SEQ_NO_34, SEQ_NO_35, SEQ_NO_36, SEQ_NO_37, SEQ_NO_38, SEQ_NO_4, SEQ_NO_39, SEQ_NO_40, SEQ_NO_41 , SEQ_NO_42, SEQ_NO_43, SEQ_NO_44, SEQ_NO_45, SEQ_NO_46, SEQ_NO_47, SEQ_NO_48, SEQ_NO_49, SEQ_NO_50, SEQ_NO_51 , SEQ_NO_52, SEQ_NO_53, SEQ_NO_7, SEQ_NO_54, SEQ_NO_55, SEQ_NO_56, SEQ_NO_57, SEQ_NO_58, SEQ_NO_59, SEQ_NO_60, SEQ_NO_61 , SEQ_NO_9, SEQ_NO_62, SEQ_NO_10, SEQ_NO_63, SEQ_NO_11 , SEQ_NO_64, SEQ_NO_65, SEQ_NO_66, SEQ_NO_67, SEQ_NO_68, SEQ_NO_15, SEQ_NO_69, SEQ_NO_70, SEQ_NO_71 , SEQ_NO_16, SEQ_NO_72, SEQ_NO_18.
[0101] Preferably, based on the pattern of expression levels as mentioned above and below an expression profile could be determined and used for a diagnosis, prognosis, staging and / or treatment monitoring of the disease of interest, e. g. AD. In a further preferred embodiment, it can be provided that said steps a) to c) are repeated and the method further comprising a step d): d) comparing the values of an individual's expression level of at least one predetermined RNA or an individual's pattern of expression levels of at least two predetermined RNAs over time to determine if the individual's expression level or the individual's pattern of expression levels is changing over time, wherein a change in the individual's expression level or the individual's pattern of expression levels over time is indicative for an increase of an individual's risk of suffering from neurodegenerative disease, neurological disease or amyloid [3-related disease over time.
[0102] In an embodiment of the present invention, it can be provided that said determining an expression level of at least one predetermined RNA or pattern of expression levels of at least two predetermined RNAs comprises a detection step based on an amplification-based method.
[0103] A preferred amplification-based method includes the use of a PCR after reverse transcription of the RNA. While in the sequencing analysis all RNA molecules present in the sample are analyzed, in PCR, test primers (DNA molecules complementary to the molecule of interest) are used to synthesize copies of that same molecule and that allow its quantification by different methods known by the skilled artisan. This method is described for example by Higuchi, R., Dollinger, G., Walsh, P. et al. in ..Simultaneous Amplification and Detection of Specific DNA Sequences. “ Nat Biotechnol 0, 413-417 (1992). https: / / doi.org / 10.1038 / nbt0492-413 and later referred in Kubista M., et al. „The real-time polymerase chain reaction. “ Mol Aspects Med. 2006 Apr-Jun;27(2-3):95-125. doi: 10.1016 / j.mam.2005.12.007.
[0104] Furthermore, it can be provided that said determining an expression level of at least one predetermined RNA or pattern of expression levels of at least two predetermined RNAs comprises a detection step based on an array-based method.
[0105] An array-based method is a methodology that allows the quantification of specific DNA or RNA molecules by its hybridization to a set of probes (Mark Schena et al. “Quantitative Monitoring of Gene Expression Patterns with a Complementary DNA Microarray”. Science. 20 Oct 1995, Vol 270, Issue 5235, pp. 467-470). In short. DNA molecules complementary to a target are connected to the surface of a glass slide or other matrix The DNA or cDNA (cDNA is the complementary DNA produced from reverse transcribing RNA) is loaded in the glass slide and the DNA molecules complementary to the ones on the matrix will hybridize. By measuring fluorescence, the presence of the hybridized molecules is quantified.
[0106] Additionally, it can be provided that said determining an expression level of at least one predetermined RNA or pattern of expression levels of at least two predetermined RNAs comprises a detection step based on a sequencing method.
[0107] Preferably, said RNA sample is not processed by a gel size selection and said determining an expression level of at least one predetermined RNA or pattern of expression levels of at least two predetermined RNAs does not include a gel size selection.
[0108] In a preferred embodiment of the present invention, it can be provided that said RNA sample is processed including a ligation step using adaptors with randomized ends or said determining an expression level of at least one predetermined RNA or a pattern of expression levels of at least two predetermined RNAs include a ligation step using adaptors with randomized ends. Adaptors are nucleic acids (oligonucleotides) that carry specific sequences that are used as priming sites for PCR and subsequent NGS, they may also carry further sites, such as, for indexing the individual samples or individual molecules. Adapters with randomized ends are e.g. described in the document DE 10 2008 025656 A1 .
[0109] For determining the expression level and the assignation of an RNA detected to a specific gene or transcript, conventional data bases could be used, e.g. miRBase [A. Kozomara, et al., “MiRBase: From microRNA sequences to function”, Nucleic Acids Res. 47 (2019) D155-D162. https: / / doi.org / 10.1093 / nar / gky1141], piRNABank [S. Sai lakshmi, S. Agrawal, “piRNABank: A web resource on classified and clustered Piwi- interacting RNAs”, Nucleic Acids Res. 36 (2008) D173. https: / / doi.org / 10.1093 / nar / gkm696], GtRNAdb 18.1 [P.P. Chan, T.M. Lowe, GtRNAdb 2.0: “An expanded database of transfer RNA genes identified in complete and draft genomes”, Nucleic Acids Res. 44 (2016) D184-D189. https: / / doi.org / 10.1093 / nar / gkv1309], Ensembl 100 [A.D. Yates, et al. Ensembl 2020, Nucleic Acids Res. 48 (2020) D682-D688. https: / / doi.org / 10.1093 / nar / gkz966]). A further subject matter of the present invention is a method for identifying a drug or providing a drug target for the treatment of a neurodegenerative disease, neurological disease or amyloid [3-related disease, wherein said method comprises the use of at least one RNA selected from the group consisting of
[0110] D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl .
[0111] A further subject matter of the present invention is a method for identifying a drug or providing a drug target for the treatment of a neurodegenerative disease, neurological disease or amyloid [3-related disease, wherein said method comprises the use of at least one RNA selected from the group consisting of
[0112] D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1 ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), PlatrW (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS).
[0113] A further subject matter of the present invention is a method for identifying a drug or providing a drug target for the treatment of a neurodegenerative disease, neurological disease or amyloid [3-related disease, wherein said method comprises the use of at least one RNA selected from the group consisting of
[0114] SEQ_NO_22, SEQ_NO_23, SEQ_NO_24, SEQ_NO_25, SEQ_NO_26, SEQ_NO_27, SEQ_NO_28, SEQ_NO_29, SEQ_NO_30, SEQ_NO_31 , SEQ_NO_32, SEQ_NO_33, SEQ_NO_34, SEQ_NO_35, SEQ_NO_36, SEQ_NO_37, SEQ_NO_38, SEQ_NO_4, SEQ_NO_39, SEQ_NO_40, SEQ_NO_41 , SEQ_NO_42, SEQ_NO_43, SEQ_NO_44, SEQ_NO_45, SEQ_NO_46, SEQ_NO_47, SEQ_NO_48, SEQ_NO_49, SEQ_NO_50, SEQ_NO_51 , SEQ_NO_52, SEQ_NO_53, SEQ_NO_7, SEQ_NO_54, SEQ_NO_55, SEQ_NO_56, SEQ_NO_57, SEQ_NO_58, SEQ_NO_59, SEQ_NO_60, SEQ_NO_61 , SEQ_NO_9, SEQ_NO_62, SEQ_NO_10, SEQ_NO_63, SEQ_NO_11 , SEQ_NO_64, SEQ_NO_65, SEQ_NO_66, SEQ_NO_67, SEQ_NO_68, SEQ_NO_15, SEQ_NO_69, SEQ_NO_70, SEQ_NO_71 , SEQ_NO_16, SEQ_NO_72, SEQ_NO_18.
[0115] A further subject matter of the present invention are kits for performing the method of the present invention. With kit, a collection of materials, tools, and resources are meant that are assembled for conducting the experiments. The kits are designed to provide researchers skilled in the art with the necessary equipment and reagents to perform the expression analyses and optionally the scoring method. The kits can be used for research use only or for in vitro diagnostics (IVD). An example for a kit can contain primers and probes for quantitative reverse transcription PCR, PCR or hybridization based panels for NGS or probes for microarrays or for other fluorescent detection method such as Nanostring. The kits shall comprises means for determining an expression level of at least two RNAs selected from the group consisting of
[0116] Fxyd3, Trappc3, Clstn2, Deptor, Hoxaas3, Sdk1 , Gm42836, Ldb2, Hist1 h3c, 2010016118Rik, 5430405H02Rik, AC160051.3, Mrpl45, Slc9a9, 5031415H12Rik, Gm12940, Gm20628, AC131120.1 , Gm20634, 4930512B01 Rik, Hist2h2be, Gm43581 , A430018G15Rik, Gm43062, mmu-miR-216a-5p, B930095G15Rik, Gm20501 , CT033754.1 , Pou2af1 , Reps2, Hist1 h4b, Gm26699, Gm19409, Pld5, Gm16105, 9330160F10Rik, B230398E01 Rik, Gm44633, CT030159.2, Eif4g3, Gm44570, Gm31718, Nr6a1 os, Tmem250-ps, 8430423G03Rik, D930016D06Rik, Slc4a7, Gm26831 , AC165261.1 , A430072P03Rik, Gm7331 , Gm12374, Gm15832, C030029H02Rik, Adamts2, 4930509H03Rik, Tex50, 4930556M19Rik;
[0117] D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl ; and
[0118] Pou2af1 , 2010016118Rik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrW, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331 ; preferably said kit comprising means for determining an expression level of at least two RNAs selected from the group consisting of
[0119] D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, ArhgefW, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl ; and
[0120] Pou2af1 , 2010016118Rik, A430072P03Rik, ArhgefW, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrW, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331.
[0121] A further subject matter of the present invention is a kit for performing the method of the present invention as described above. The kit comprising means for determining an expression level of at least two RNAs selected from the group consisting of Fxyd3 (ST), Trappc3 (ST), Clstn2 (AS), Deptor (AS), Hoxaas3 (ST), Sdk1 (ST), Gm42836 (ST), Ldb2 (AS), Hist1 h3c (ST), 201001611 SRik (AS), 5430405H02Rik (ST), AC160051.3 (ST), Mrpl45 (AS), Slc9a9 (ST), 5031415H12Rik (AS), Gm12940 (ST), Gm20628 (ST), AC131120.1 (ST), Gm20634 (ST), 4930512B01 Rik (ST), Hist2h2be (ST), Gm43581 (AS), A430018G15Rik (ST), Gm43062 (AS), mmu-miR- 216a-5p (ST), B930095G15Rik (ST), Gm20501 (ST), CT033754.1 (ST), Pou2af1 (AS), Reps2 (ST), Hist1 h4b (ST), Gm26699 (ST), Gm19409 (ST), Pld5 (AS), Gm16105 (ST), 9330160F10Rik (AS), B230398E01 Rik (ST), Gm44633 (ST), CT030159.2 (ST), Eif4g3 (ST), Gm44570 (ST), Gm31718 (ST), Nr6a1 os (ST), Tmem250-ps (ST), 8430423G03Rik (ST), D930016D06Rik (ST), Slc4a7 (ST), Gm26831 (ST), AC165261.1 (AS), A430072P03Rik (AS), Gm7331 (AS), Gm 12374 (AS), Gm 15832 (ST), C030029H02Rik (ST), Adamts2 (ST), 4930509H03Rik (ST), Tex50 (ST), 4930556M19Rik (ST);
[0122] D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1 ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), Platrl O (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); and
[0123] Pou2af1 (ST), 201001611 SRik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrlO (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST); preferably said kits comprise means for determining an expression level of at least two RNAs selected from the group consisting of
[0124] D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), PlatrlO (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); and
[0125] Pou2af1 (ST), 2010016118Rik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrlO (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST).
[0126] A further subject matter of the present invention are kits for performing the method of the present invention. The kit comprising means for determining an expression level of at least two RNAs selected from the group consisting of SEQ_NO_1 to SEQ_NO_117, preferably, SEQ_NO_1 to SEQ_NO_72.
[0127] In a preferred embodiment, the kit preferably further comprises at least one reference pattern of expression levels for comparing with the expression level of at least one RNA from said sample.
[0128] In a more preferred embodiment it can be provided that the kit preferably further comprises means for determining an expression level at least one internal reference RNA for normalizing the expression level of at least two RNAs selected from the group consisting of Fxyd3, Trappc3, Clstn2, Deptor, Hoxaas3, Sdk1 , Gm42836, Ldb2, Hist1 h3c, 2010016118Rik, 5430405H02Rik, AC160051.3, Mrpl45, Slc9a9, 5031415H12Rik, Gm 12940, Gm20628, AC131120.1 , Gm20634, 4930512B01 Rik, Hist2h2be, Gm43581 , A430018G15Rik, Gm43062, mmu-miR-216a-5p, B930095G15Rik, Gm20501 , CT033754.1 , Pou2af1 , Reps2, Hist1 h4b, Gm26699, Gm19409, Pld5, Gm16105, 9330160F10Rik, B230398E01 Rik, Gm44633, CT030159.2, Eif4g3, Gm44570, Gm31718, Nr6a1 os, Tmem250-ps, 8430423G03Rik, D930016D06Rik, Slc4a7, Gm26831 , AC165261.1 , A430072P03Rik, Gm7331 , Gm12374, Gm15832, C030029H02Rik, Adamts2, 4930509H03Rik, Tex50, 4930556M19Rik;
[0129] D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl ; and
[0130] Pou2af1 , 2010016118Rik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrW, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331 ; preferably said kit preferably further comprises means for determining an expression level at least one internal reference RNA for normalizing the expression level of at least two RNAs selected from the group consisting of
[0131] D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, ArhgefW, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os,
[0132] Gm44115, Sortl , Tug1 , Colgalt2, Scrnl ; and
[0133] Pou2af1 , 2010016118Rik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, Platr , Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331.
[0134] In a more preferred embodiment it can be provided that the kit preferably further comprises means for determining an expression level at least one internal reference RNA for normalizing the expression level of at least two RNAs selected from the group consisting of
[0135] Fxyd3 (ST), Trappc3 (ST), Clstn2 (AS), Deptor (AS), Hoxaas3 (ST), Sdk1 (ST), Gm42836 (ST), Ldb2 (AS), Hist1 h3c (ST), 2010016118Rik (AS), 5430405H02Rik (ST), AC160051.3 (ST), Mrpl45 (AS), Slc9a9 (ST), 5031415H12Rik (AS), Gm12940 (ST), Gm20628 (ST), AC131120.1 (ST), Gm20634 (ST), 4930512B01 Rik (ST), Hist2h2be (ST), Gm43581 (AS), A430018G15Rik (ST), Gm43062 (AS), mmu-miR- 216a-5p (ST), B930095G15Rik (ST), Gm20501 (ST), CT033754.1 (ST), Pou2af1 (AS), Reps2 (ST), Hist1 h4b (ST), Gm26699 (ST), Gm19409 (ST), Pld5 (AS), Gm16105 (ST), 9330160F10Rik (AS), B230398E01 Rik (ST), Gm44633 (ST), CT030159.2 (ST), Eif4g3 (ST), Gm44570 (ST), Gm31718 (ST), Nr6a1os (ST), Tmem250-ps (ST), 8430423G03Rik (ST), D930016D06Rik (ST), Slc4a7 (ST), Gm26831 (ST), AC165261.1 (AS), A430072P03Rik (AS), Gm7331 (AS), Gm 12374 (AS), Gm 15832 (ST), C030029H02Rik (ST), Adamts2 (ST), 4930509H03Rik (ST), Tex50 (ST), 4930556M19Rik (ST);
[0136] D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), Platrl O (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); and
[0137] Pou2af1 (ST), 201001611 SRik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrlO (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST); said kit preferably further comprises means for determining an expression level at least one internal reference RNA for normalizing the expression level of at least two RNAs selected from the group consisting of
[0138] D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1 ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), Platrl O (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); and
[0139] Pou2af1 (ST), 201001611 SRik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), Platrl O (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST). In a more preferred embodiment it can be provided that the kit preferably further comprises means for determining an expression level at least one internal reference RNA for normalizing the expression level of at least two RNAs selected from the group consisting of SEQ_NO_1 to SEQ_NO_117, preferably, SEQ_NO_1 to SEQ_NO_72.
[0140] The following Table provides an overview over preferred genes and transcripts described in the present invention in more detail but does not limit the invention and its scope as claimed
[0141] Table 1
[0142] The transcripts of the genes and the genes as mentioned herein, especially in Table 1 , are essentially based and described in Ensembl release 100.38 (A.D. Yates, et al., Ensembl 2020, Nucleic Acids Res. 48 (2020) D682-D688. doi: 10.1093 / nar / gkz966). The SEQ_NO_92 “mmu-miR-216a-5p” is disclosed in miRBase version 22 [A. Kozomara, et al., “MiRBase: From microRNA sequences to function”, Nucleic Acids Res. 47 (2019) D155-D162. https: / / doi.org / 10.1093 / nar / gky1141]). The added term “as_” before the gene symbol means that it is the antisense molecule of that gene. The expression “(ST)” mentioned herein, especially in Table 1 , denotes as the sense transcripts of the corresponding gene. E.g. the term “D830025C05Rik (ST)” denotes the sense transcripts of the gene D830025C05Rik. The expression “(AS)” mentioned herein, especially in Table 1 , denotes the antisense transcripts of the corresponding gene. E.g. the term “Reps2 (AS)” denotes the antisense transcripts of the gene Reps2.
[0143] The invention is explained in greater detail below by means of examples. The invention can preferably be carried out throughout the range claimed and is not restricted to the examples given here.
[0144] Thus, the following examples describe the invention in more detail but do not limit the invention and its scope as claimed.
[0145] Examples:
[0146] The following examples are given in order to assist the skilled artisan to better understand the present invention by way of exemplification. The examples are not intended to limit the scope of protection conferred by the claims. The features, properties and advantages exemplified for the compounds and uses defined in the examples and / or the Figures related thereto may be assigned to other compounds and uses not specifically described and / or defined in the examples and / or the Figures related thereto, but falling under the scope of what is defined in the claims.
[0147] 1 Material and methods
[0148] 1.1 Animals
[0149] Animals are housed under standard conditions and fed ad libitum. All experimental protocols, handling and use of mice are approved by the Regierungsprasidium Darmstadt, Germany (V54-19c20 / 15-FK / 1052). For the present Experiments, we use litter-matched wild-type (WT) C57BL6 / J and transgenic Tg-SwDI mice. These animals express human A|3 precursor protein (hA[3PP) harboring the Swedish K670N / M671 L and vasculotropic Dutch / lowa E693Q / D694N mutations under the control of the neuronal Thy1.2 promoter [J. Davis, et al., “Early-onset and Robust Cerebral Microvascular Accumulation of Amyloid B-Protein in Transgenic Mice Expressing Low Levels of a Vasculotropic Dutch I Iowa Mutant Form of Amyloid B- Protein Precursor”, 279 (2004) 20296-20306. https: / / doi.Org / 10.1074 / jbc.M312946200],
[0150] 1.2 DNA extraction and genotyping
[0151] For genotyping the mice, tail biopsies are digested in 250 pl tail lysis buffer containing proteinase K (1 :1000) at 55°C overnight. Proteinase K is deactivated by heating the solution at 99°C for 20 mins. The primers being used to check the AD transgene were: sense 5’- AGG ACT GAC CAC TCG ACC AG -3’ and antisense 5’- CGG GGG TCT AGT TCT GCA T -3’.
[0152] 1.3 Immunohistochemistry
[0153] Brains are collected from mice, embedded in Tissue TEK® O.C.T. compound (Sakura) and frozen at -80°C. Cryosections with 10 pm are cut with the Microm HM550 microtome at -20°C, placed on Superfrost Microscope slides and dried on a heating plate set at 37 °C. The samples are fixed with 4 % PFA (in PBS) for 10 minutes at room temperature and left for 1 hour at room temperature in a humidifying chamber with a blocking / permeabilization buffer (PBS with 0,1% Triton-X and 1 % BSA). The sections are then incubated with the primary antibody (Rat Anti-CD31 BD Pharmingen 553370 1 :100) overnight at 4°C. The next day, the samples are incubated with the secondary antibody mix (Anti-rat DyLight 650 Thermo Fisher Scientific SA5-10029 1 :500 & methoxy-X04 ab142818 Abeam & Nuclear Green LCS1 ab138904 Abeam) 1 hour at room temperature and mounted with Aqua PolyMount. Pictures are taken with a confocal laser scanning microscope (Eclipse TE 2000-E, Nikon Instruments).
[0154] 1.4 A[3 plaque load measurement
[0155] The A|3 plaque load in dentate gyrus sections from transgenic and wild-type animals with 6 and 18 months of age is identified and measured by staining with methoxy- x04. Pictures are analysed with the NIS-Elements Microscope Imaging Software AR (Nikon Instruments). The same methoxy-X04 fluorescence threshold is defined and used for all pictures and a mask was set above the defined threshold containing only methoxy-positive fluorescence. The mask area is extracted for each image as pm2. Quantification of plaque load in the dentate gyrus of WT and Tg-SwDI mice, as determined by the plaque area (n=3).
[0156] 1.5 Blood sampling, processing, and RNA isolation from plasma
[0157] Whole blood from 6- and 18-month-old, anesthetized, male Tg-SwDI and WT mice are collected by cardiac puncture during the light cycle. Samples are immediately collected in 1.3 mL K3 EDTA tubes (Sarstedt, Numbrecht, Germany) and centrifuged (4°C, 10 min, 400g). The upper plasma layer is carefully isolated and stored at -80°C.
[0158] RNA is isolated from 50 pl of plasma using miRNeasy Serum / Plasma kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Additionally, the isolates are treated with heparinase I (New England BioLabs, Ipswich, MA, USA), as described by Engler and colleagues [A. Engler, et al., “Establishment of an easy and straight forward heparinase protocol to analyse circulating and myocardial tissue micro-RNA during coronary artery-bypass- graft surgery”, (2018) 1-9. https: / / doi.org / 10.1038 / s41598-018-19748-6]. Isolated RNA was stored at -80°C until further analysis.
[0159] 1.6 Small RNA sequencing Small RNA libraries are prepared using TrueQuant SmalIRNA Seq Kit (GenXPro, Frankfurt am Main, Germany). In general, library preparation is performed as described by Lipps et al. [C. Lipps, et al., “Non-lnvasive Approach for Evaluation of Pulmonary Hypertension Using Extracellular Vesicle-Associated Small Non-Coding RNA”, Biomolecules. (2019). https: / / doi.org / 10.3390 / biom9110666]. Briefly, 3’ and 5’ TrueQuant adapters are successively ligated to small RNA. Adapter-ligated RNA is reverse transcribed with and amplified by polymerase chain reaction (PCR). The amplified libraries are sequenced with the NextSeq500 platform (Illumina, San Diego, CA, USA).
[0160] 1.7 Bioinformatic analysis
[0161] Data processing and statistical analysis
[0162] A total of 54 million sRNA-seq reads are obtained from the 12 sequenced libraries. Adapter sequences are removed using Cutadapt v2.1 [M. Martin, “Cutadapt removes adapter sequences from high-throughput sequencing reads”, EMBnet. Journal. 17 (2011 ) 10. https: / / doi.Org / 10.14806 / ej.17.1.200], PCR-derived duplicates are removed using TrueQuant technology (GenXPro, Frankfurt am Main, Germany). Similar to the analysis performed by exceRpt, filtered and clipped sRNA-seq reads are sequentially mapped to several classes of RNA biotypes [J. Rozowsky, et al., “exceRpt: A Comprehensive Analytic Platform for Extracellular RNA Profiling”, (2019). https: / / doi.Org / 10.1016 / j.cels.2019.03.004], Using Bowtie2 [B. Langmead, S.L. Salzberg, “Fast gapped-read alignment with Bowtie 2”, Nat. Methods. 9 (2012) 357-359. https: / / doi.org / 10.1038 / nmeth.1923], sRNA-seq reads were first mapped to mature miRNA (miRBase version 22 [A. Kozomara, et al., “MiRBase: From microRNA sequences to function”, Nucleic Acids Res. 47 (2019) D155-D162. https: / / doi.org / 10.1093 / nar / gky1141]), followed by piRNA (piRNABank [S. Sai lakshmi, S. Agrawal, “piRNABank: A web resource on classified and clustered Piwi- interacting RNAs”, Nucleic Acids Res. 36 (2008) D173. https: / / doi.org / 10.1093 / nar / gkm696]), transfer RNA (tRNA) (GtRNAdb 18.1 [P.P. Chan, T.M. Lowe, GtRNAdb 2.0: “An expanded database of transfer RNA genes identified in complete and draft genomes”, Nucleic Acids Res. 44 (2016) D184-D189. https: / / doi.org / 10.1093 / nar / gkv1309]), ncRNA (Ensembl 100 [A.D. Yates, et al. Ensembl 2020, Nucleic Acids Res. 48 (2020) D682-D688. https: / / doi.org / 10.1093 / nar / gkz966]) and finally to the mouse genome (mm 10). Only unaligned reads from each mapping step are used for the following step. Mapping of mature miRNA was performed “end-to-end” mode and the following alignments are performed in “local” mode. The number of reads per transcript detected is counted by conventional manner. Normalization and testing for differential expression are calculated using the DESeq2 R / Bioconductor package [M.l. Love, et al., “Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2”, Genome Biol. 15 (2014) 550. https: / / doi.org / 10.1186 / s13059-014-0550-8]. Small RNAs with p- value <0.05 and |log2fc| >1 are considered as differentially expressed (DE). The analysis is performed in accordance with the guidelines described by Francisco and colleagues [D.M.F. Francisco, “Advancing brain barriers RNA sequencing: guidelines from experimental design to publication”, Fluids Barriers CNS. 17 (2020) 51. https: / / doi.Org / 10.1186 / s12987-020-00207-2],
[0163] 2 Performed Experiments
[0164] 2.1 A[3 plaques measurements
[0165] As mentioned above, A|3 plaques were measured and A|3 plaques were not detected in wild-type animals. By contrast, plaques were observed in transgenic mice at both, 6 and 18 months of age. On average, the plaque load found in the hippocampus from 18-month-old Tg-SwDI mice was 19 times higher than in 6-month-old transgenic mice.
[0166] 2.2 Correlation between specific RNA and A|3 plaques formation
[0167] Based on the methods mentioned above, the RNA transcripts as provided in Tables 2 and 3 have a high correlation to A|3 plaques formation and, hence are promising candidates for the diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3-related disease, especially Alzheimer's Disease.
[0168] Table 2
[0169] Table 3
[0170] The abbreviations in Tables 2 and 3 are as follows:
[0171] WT18:wild type mouse 18 months old; the data are the numerical average of normalized counts based on three mice;
[0172] WT6: wild type mouse 6 months old; the data are the numerical average of normalized counts based on three mice;
[0173] AD18: Alzheimer's Disease mouse 18 months old; the data are the numerical average of normalized counts based on three mice;
[0174] AD6: Alzheimer's Disease mouse 6 months old; the data are the numerical average of normalized counts based on three mice;
[0175] FDR: False discovery rate (Benjamini-Hochberg approach);
[0176] Iog2 Fold Change: Binary logarithm of fold change; correl: Pearson correlation coefficient between the average expression of the marker’s dataset and the average brain A|3 plaque load; as_: antisense transcript of the gene.
[0177] For illustration, some of the results of the genes Pou2af1 (ST, ENSMUSG00000032053, SEQ_NO_1 ) and 2010016l18Rik (ST, ENSMUST000001 91570.1 , SEQ_NO_2) as mentioned above are depicted in Figure 1 and Figure 2, respectively. Figure 1 discloses the correlation between plague formation and expression of gene Pou2af1 (ST, ENSMUSG00000032053, SEQ_NO_1 ). Figure 1a shows a graph wherein the area labeled with methoxy-X04 (abscissa) is plotted against the normalized RNA count (ordinate). The p value is about 5.9e-06, the R value is about 0.999994. Figure 1 b shows a column representation of the results wherein the area labeled with methoxy-X04 and the normalized RNA count are shown as ordinate. Figure 2 discloses the correlation between plague formation and expression of gene 2010016118Rik (ST, ENSMUST000001 91570.1 , SEQ_NO_2). Figure 2a shows a graph wherein the area labeled with methoxy-X04 (abscissa) is plotted against the normalized RNA count (ordinate). The p value is about 4.9e-05, the R value is about 0.999952. Figure 2b shows a column representation of the results wherein the area labeled with methoxy- X04 and the normalized RNA count are shown as ordinate.
Claims
Patent claims1 . A method for an in vitro diagnosis, prognosis, staging and / or treatment monitoring of a neurodegenerative disease, neurological disease or amyloid [3- related disease, wherein the method comprises the steps: a) Obtaining an RNA sample from at least one biological fluid obtained from an individual; b) Determining an expression level of at least one predetermined RNA based on the RNA sample obtained in step a); c) Comparing said expression level to one or several reference expression levels, wherein the comparison of said determined expression level to said one or several reference expression levels is used for the diagnosis, prognosis, staging and / or treatment monitoring of the disease; wherein said at least one predetermined RNA is selected from the group consisting ofFxyd3, Trappc3, Clstn2, Deptor, Hoxaas3, Sdk1 , Gm42836, Ldb2, Hist1 h3c, 201001611 SRik, 5430405H02Rik, AC160051.3, Mrpl45, Slc9a9, 5031415H12Rik, Gm12940, Gm20628, AC131120.1 , Gm20634, 4930512B01 Rik, Hist2h2be, Gm43581 , A430018G15Rik, Gm43062, mmu-miR- 216a-5p, B930095G15Rik, Gm20501 , CT033754.1 , Pou2af1 , Reps2, Hist1 h4b, Gm26699, Gm19409, Pld5, Gm16105, 9330160F10Rik, B230398E01 Rik, Gm44633, CT030159.2, Eif4g3, Gm44570, Gm31718, Nr6a1 os, Tmem250-ps, 8430423G03Rik, D930016D06Rik, Slc4a7, Gm26831 , AC165261.1 , A430072P03Rik, Gm7331 , Gm 12374, Gm 15832, C030029H02Rik, Adamts2, 4930509H03Rik, Tex50, 4930556M19Rik;D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm 14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9,Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm 10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl ; andPou2af1 , 2010016118Rik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrW, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331.
2. The method according to claim 1 , wherein said at least one predetermined RNA is selected from the group consisting ofFxyd3 (ST), Trappc3 (ST), Clstn2 (AS), Deptor (AS), Hoxaas3 (ST), Sdk1 (ST), Gm42836 (ST), Ldb2 (AS), Hist1 h3c (ST), 2010016118Rik (AS), 5430405H02Rik (ST), AC160051.3 (ST), Mrpl45 (AS), Slc9a9 (ST), 5031415H12Rik (AS), Gm12940 (ST), Gm20628 (ST), AC131120.1 (ST), Gm20634 (ST), 4930512B01 Rik (ST), Hist2h2be (ST), Gm43581 (AS), A430018G15Rik (ST), Gm43062 (AS), mmu-miR-216a-5p (ST), B930095G15Rik (ST), Gm20501 (ST), CT033754.1 (ST), Pou2af1 (AS), Reps2 (ST), Hist1 h4b (ST), Gm26699 (ST), Gm 19409 (ST), Pld5 (AS), Gm 16105 (ST), 9330160F10Rik (AS), B230398E01 Rik (ST), Gm44633 (ST), CT030159.2 (ST), Eif4g3 (ST), Gm44570 (ST), Gm31718 (ST), Nr6a1 os (ST), Tmem250-ps (ST), 8430423G03Rik (ST), D930016D06Rik (ST), Slc4a7 (ST), Gm26831 (ST), AC165261.1 (AS), A430072P03Rik (AS), Gm7331 (AS), Gm12374 (AS), Gm15832 (ST), C030029H02Rik (ST), Adamts2 (ST), 4930509H03Rik (ST), Tex50 (ST), 4930556M19Rik (ST);D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm 14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), ArhgefW (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1 ot1 (ST), Gm43696 (ST), AC121793.2 (ST),Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), PlatrlO (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); andPou2af1 (ST), 2010016118Rik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrlO (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST).
3. The method according to claim 1 or 2, wherein said at least one predetermined RNA is selected from the group consisting of SEQ_NO_1 to SEQ_NO_117.
4. The method according to one of claims 1 to 3, wherein said method comprises the steps: a) Obtaining an RNA sample from at least one biological fluid obtained from an individual; b) Determining a pattern of expression levels of at least two predetermined RNAs based on the RNA sample obtained in step a); c) Comparing said pattern of expression levels to one or several reference pattern of expression levels, wherein the comparison of said determined pattern of expression levels to said one or several reference pattern of expression levels is used for the diagnosis, prognosis, staging and / or treatment monitoring of the disease; wherein said at least two predetermined RNAs are selected from the group consisting ofFxyd3, Trappc3, Clstn2, Deptor, Hoxaas3, Sdk1 , Gm42836, Ldb2, Hist1 h3c, 2010016118Rik, 5430405H02Rik, AC160051.3, Mrpl45, Slc9a9,5031415H 12Rik, Gm12940, Gm20628, AC131120.1 , Gm20634, 4930512B01 Rik, Hist2h2be, Gm43581 , A430018G15Rik, Gm43062, mmu-miR- 216a-5p, B930095G15Rik, Gm20501 , CT033754.1 , Pou2af1 , Reps2, Hist1 h4b, Gm26699, Gm19409, Pld5, Gm16105, 9330160F10Rik, B230398E01 Rik, Gm44633, CT030159.2, Eif4g3, Gm44570, Gm31718, Nr6a1 os, Tmem250-ps, 8430423G03Rik, D930016D06Rik, Slc4a7, Gm26831 , AC165261.1 , A430072P03Rik, Gm7331 , Gm 12374, Gm 15832, C030029H02Rik, Adamts2, 4930509H03Rik, Tex50, 4930556M19Rik;D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm 14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl ; andPou2af1 , 2010016118Rik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrW, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331.
5. The method according to claim 4, wherein said at least two predetermined RNAs are selected from the group consisting ofFxyd3 (ST), Trappc3 (ST), Clstn2 (AS), Deptor (AS), Hoxaas3 (ST), Sdk1 (ST), Gm42836 (ST), Ldb2 (AS), Hist1 h3c (ST), 2010016118Rik (AS), 5430405H02Rik (ST), AC160051.3 (ST), Mrpl45 (AS), Slc9a9 (ST), 5031415H12Rik (AS), Gm12940 (ST), Gm20628 (ST), AC131120.1 (ST), Gm20634 (ST), 4930512B01 Rik (ST), Hist2h2be (ST), Gm43581 (AS), A430018G15Rik (ST), Gm43062 (AS), mmu-miR-216a-5p (ST), B930095G15Rik (ST), Gm20501 (ST), CT033754.1 (ST), Pou2af1 (AS), Reps2 (ST), Hist1 h4b (ST), Gm26699 (ST), Gm 19409 (ST), Pld5 (AS), Gm 16105 (ST), 9330160F10Rik (AS), B230398E01 Rik (ST), Gm44633 (ST), CT030159.2 (ST),Eif4g3 (ST), Gm44570 (ST), Gm31718 (ST), Nr6a1os (ST), Tmem250-ps (ST), 8430423G03Rik (ST), D930016D06Rik (ST), Slc4a7 (ST), Gm26831 (ST), AC165261.1 (AS), A430072P03Rik (AS), Gm7331 (AS), Gm12374 (AS), Gm 15832 (ST), C030029H02Rik (ST), Adamts2 (ST), 4930509H03Rik (ST), Tex50 (ST), 4930556M19Rik (ST);D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm 14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), PlatrlO (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); andPou2af1 (ST), 2010016118Rik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrlO (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST); or wherein said at least two predetermined RNAs are selected from the group consisting of SEQ_NO_1 to SEQ_NO_117.
6. The method according to one of claims 1 to 5, wherein the neurodegenerative disease, neurological disease or amyloid [3-related disease is Alzheimer's Disease.
7. The method according to one of claims 1 to 6, wherein said expression level or said pattern of expression levels is determined of at least one predetermined RNA or at least three predetermined RNAs selected from the group consisting ofD830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm 14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl .
8. The method of claim 7, wherein said expression level or said pattern of expression levels is determined of at least one predetermined RNA or at least three predetermined RNAs selected from the group consisting ofD830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm 14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), ArhgefW (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1 ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971 .9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), PlatrW (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); orwherein said expression level or said pattern of expression levels is determined of at least one predetermined RNA or at least three predetermined RNAs selected from the group consisting ofSEQ_NO_22, SEQ_NO_23, SEQ_NO_24, SEQ_NO_25, SEQ_NO_26, SEQ_NO_27, SEQ_NO_28, SEQ_NO_29, SEQ_NO_30, SEQ_NO_31 , SEQ_NO_32, SEQ_NO_33, SEQ_NO_34, SEQ_NO_35, SEQ_NO_36, SEQ_NO_37, SEQ_NO_38, SEQ_NO_4, SEQ_NO_39, SEQ_NO_40, SEQ_NO_41 , SEQ_NO_42, SEQ_NO_43, SEQ_NO_44, SEQ_NO_45, SEQ_NO_46, SEQ_NO_47, SEQ_NO_48, SEQ_NO_49, SEQ_NO_50, SEQ_NO_51 , SEQ_NO_52, SEQ_NO_53, SEQ_NO_7, SEQ_NO_54, SEQ_NO_55, SEQ_NO_56, SEQ_NO_57, SEQ_NO_58, SEQ_NO_59, SEQ_NO_60, SEQ_NO_61 , SEQ_NO_09, SEQ_NO_62, SEQ_NO_10 SEQ_NO_63, SEQ_NO_64, SEQ_NO_65, SEQ_NO_66, SEQ_NO_67, SEQ_NO_68, SEQ_NO_15, SEQ_NO_69, SEQ_NO_70, SEQ_NO_71 , SEQ_NO_16, SEQ_NO_72, SEQ_NO_18.
9. The method according to claim 7 or 8, wherein said pattern of expression levels is determined of at least four, preferably at least five and more preferably at least ten predetermined RNAs of said group.
10. The method according to one of claims 1 to 9, wherein said expression level or said pattern of expression levels is determined of at least one predetermined RNA or at least three predetermined RNAs selected from the group consisting of Pou2af1 , 2010016l18Rik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrlO, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrn1 , AC165261.1 , Eif4g3, Gm7331.11 . The method according to one of claims 1 to 10, wherein said expression level or said pattern of expression levels is determined of at least one predetermined RNA or at least three predetermined RNAs selected from the group consisting of Pou2af1 (ST), 2010016118Rik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrlO (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST);or wherein said expression level or said pattern of expression levels is determined of at least one predetermined RNA or at least three predetermined RNAs selected from the group consisting of SEQ_NO_1 to SEQ_NO_21 .
12. The method according to claim 10 or 11 , wherein said pattern of expression levels is determined of at least four, preferably at least five and more preferably at least ten predetermined RNAs of said group.
13. The method according to one of claims 1 to 12, wherein said expression level or said pattern of expression levels is determined of the at least one predetermined RNA, preferably least two predetermined RNAs which are upregulated.
14. The method according to one of claims 1 to 13, wherein said comparison of said determined expression level to said one or several reference expression levels or said comparison of said pattern of expression levels to said one or several reference pattern of expression levels is achieved by determining the presence of at least one predetermined RNA or of at least two predetermined RNAs selected from the group consisting of Pou2af1 , 2010016118Rik, A430072P03Rik, Arhgef16, Gm 12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrlO, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331.
15. The method according to one of claims 1 to 14, wherein said comparison of said determined expression level to said one or several reference expression levels or said comparison of said pattern of expression levels to said one or several reference pattern of expression levels is achieved by determining the presence of at least one predetermined RNA or of at least two predetermined RNAs selected from the group consisting of Pou2af1 (ST), 2010016118Rik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm 12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrlO (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST); orwherein said comparison of said determined expression level to said one or several reference expression levels or said comparison of said pattern of expression levels to said one or several reference pattern of expression levels is achieved by determining the presence of at least one predetermined RNA or of at least two predetermined RNAs selected from the group consisting of SEQ_NO_1 to SEQ_NO_21.
16. The method according to claim 15 or 16, wherein said determined expression level or said pattern of expression levels is achieved without a normalization step.
17. The method according to one of claims 1 to 16, wherein said at least one biological fluid is selected from the group consisting of blood, blood plasma, serum, lymph, cerebrospinal fluid, tear fluid, urine, and saliva.
18. The method according to one of claims 1 to 17, wherein said at least one biological fluid is processed to achieve a cell-free sample prior to step a) or said at least one biological fluid is a cell-free sample.
19. The method according to one of claims 1 to 18, wherein said at least one biological fluid is processed to achieve a vesicle-free sample prior to step a) or said at least one biological fluid is a vesicle-free sample.
20. The method according to one of claims 1 to 19, wherein said at least one biological fluid is processed to achieve a plasma sample prior to step a).21 . The method according to one of claims 1 to 20, wherein said at least one biological fluid is processed to achieve an extracellular vesicles (EV) sample prior to step a).
22. The method according to one of claims 17 to 20, wherein the RNA sample is obtained from blood plasma as the at least one biological fluid.
23. The method according to claim 18, wherein the RNA sample is obtained from blood plasma extracellular vesicles (EV) as the at least one biological fluid.
24. The method according to one of claims 17, 20 and 21 , wherein the RNA sample is obtained from blood plasma and extracellular vesicles (EV) as at least one biological fluid.
25. The method according to one of claims 1 to 15 and 17 to 24, wherein said determining an expression level or a pattern of expression levels in step b) includes the calculation of an expression level value by the measuring of expression levels of a plurality of RNAs from the RNA sample obtained in step a) in form of expression level values and step b) includes mathematically combining the expression level values of said plurality of RNAs.
26. The method according to claim 25, wherein the expression level values are normalized based on Next Generation Sequencing datasets.
27. The method according to one of claims 25 or 26, wherein the expression levels of the plurality of RNAs from the RNA sample obtained in step a) are determined as expression level values and the expression level values are normalized based on an internal reference RNA.
28. The method according to one of claims 1 to 27, wherein said reference expression levels or said reference pattern of expression levels comprise a gene expression level or a pattern of expression levels generated from a population of individuals that do not presently or in the future display neurodegenerative disease, neurological disease or amyloid [3-related disease.
29. The method according to one of claims 25 to 28, wherein said expression level values are correlated with predefines specific stages of the neurodegenerative disease, neurological disease or amyloid [3-related disease.
30. The method according to claim 29, wherein said expression level values are determined from at least one RNA selected from the group consisting ofD830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm 14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1ot1 , Gm43696, AC121793.2, Rrnadl, AC151971.9,Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm 10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl .31 . The method according to claim 29 or 30, wherein said expression level values are determined from at least one RNA selected from the group consisting ofD830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm 14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), ArhgefW (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971 .9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), PlatrW (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); or wherein said expression level values are determined from at least one RNA selected from the group consisting ofSEQ_NO_22, SEQ_NO_23, SEQ_NO_24, SEQ_NO_25, SEQ_NO_26, SEQ_NO_27, SEQ_NO_28, SEQ_NO_29, SEQ_NO_30, SEQ_NO_31 , SEQ_NO_32, SEQ_NO_33, SEQ_NO_34, SEQ_NO_35, SEQ_NO_36, SEQ_NO_37, SEQ_NO_38, SEQ_NO_4, SEQ_NO_39, SEQ_NO_40, SEQ_NO_41 , SEQ_NO_42, SEQ_NO_43, SEQ_NO_44, SEQ_NO_45, SEQ_NO_46, SEQ_NO_47, SEQ_NO_48, SEQ_NO_49, SEQ_NO_50, SEQ_NO_51 , SEQ_NO_52, SEQ_NO_53, SEQ_NO_7, SEQ_NO_54,SEQ_NO_55, SEQ_NO_56, SEQ_NO_57, SEQ_NO_58, SEQ_NO_59, SEQ_NO_60, SEQ_NO_61 , SEQ_NO_09, SEQ_NO_62, SEQ_NO_10 SEQ_NO_63, SEQ_NO_64, SEQ_NO_65, SEQ_NO_66, SEQ_NO_67, SEQ_NO_68, SEQ_NO_15, SEQ_NO_69, SEQ_NO_70, SEQ_NO_71 , SEQ_NO_16, SEQ_NO_72, SEQ_NO_18.
32. The method according to one of claims 1 to 31 , wherein said steps a) to c) are repeated and the method further comprising a step d): d) comparing the values of an individual's expression level of at least one predetermined RNA or an individual's pattern of expression levels of at least two predetermined RNAs over time to determine if the individual's expression level or the individual's pattern of expression levels is changing over time, wherein a change in the individual's expression level or the individual's pattern of expression levels over time is indicative for an increase of an individual's risk of suffering from neurodegenerative disease, neurological disease or amyloid [3- related disease over time.
33. The method according to one of claims 1 to 32, wherein said determining an expression level of at least one predetermined RNA or pattern of expression levels of at least two predetermined RNAs comprises a detection step based on an amplification-based method.
34. The method according to one of claims 1 to 33, wherein said determining an expression level of at least one predetermined RNA or pattern of expression levels of at least two predetermined RNAs comprises a detection step based on an array-based method.
35. The method according to one of claims 1 to 34, wherein said determining an expression level of at least one predetermined RNA or pattern of expression levels of at least two predetermined RNAs comprises a detection step based on a sequencing method.
36. The method according to one of claims 1 to 35, wherein said least one predetermined RNA or said least two predetermined RNAs comprise a False discovery rate (Benjamini-Hochberg approach; FDR) of at most 0.05, preferablyof at most 0.001 , more preferably of at most 0.0001 , even more preferably of at most 10’5.
37. The method according to one of claims 1 to 36, wherein said least one predetermined RNA or said least two predetermined RNAs comprise a Pearson correlation coefficient between the average expression level of the RNA and the average brain A|3 plaque load (correl) of at least 0.94, preferably of at least 0.98, more preferably of at least 0.995, even more preferably of at least 0.9980.
38. The method according to one of claims 1 to 37, wherein said least one predetermined RNA or said least two predetermined RNAs comprise a Binary logarithm of fold change (Iog2 Fold Change) of at least 2, preferably of at least 3, more preferably of at least 4, even more preferably of at least 5.
39. The method according to one of claims 1 to 38, wherein said step a) includes an isolation step to obtain an RNA sample from at least one biological fluid obtained from an individual.
40. A method for identifying a drug or providing a drug target for the treatment of a neurodegenerative disease, neurological disease or amyloid [3-related disease, wherein said method comprises the use of at least one RNA selected from the group consisting ofD830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm 14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1ot1 , Gm43696, AC121793.2, Rrnadl, AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl .41 . A method for identifying a drug or providing a drug target for the treatment of a neurodegenerative disease, neurological disease or amyloid [3-related disease,wherein said method comprises the use of at least one RNA selected from the group consisting ofD830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm 14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971 .9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), PlatrlO (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); or wherein said method comprises the use of at least one RNA selected from the group consisting ofSEQ_NO_22, SEQ_NO_23, SEQ_NO_24, SEQ_NO_25, SEQ_NO_26, SEQ_NO_27, SEQ_NO_28, SEQ_NO_29, SEQ_NO_30, SEQ_NO_31 , SEQ_NO_32, SEQ_NO_33, SEQ_NO_34, SEQ_NO_35, SEQ_NO_36, SEQ_NO_37, SEQ_NO_38, SEQ_NO_4, SEQ_NO_39, SEQ_NO_40, SEQ_NO_41 , SEQ_NO_42, SEQ_NO_43, SEQ_NO_44, SEQ_NO_45, SEQ_NO_46, SEQ_NO_47, SEQ_NO_48, SEQ_NO_49, SEQ_NO_50, SEQ_NO_51 , SEQ_NO_52, SEQ_NO_53, SEQ_NO_7, SEQ_NO_54, SEQ_NO_55, SEQ_NO_56, SEQ_NO_57, SEQ_NO_58, SEQ_NO_59, SEQ_NO_60, SEQ_NO_61 , SEQ_NO_9, SEQ_NO_62, SEQ_NO_10, SEQ_NO_63, SEQ_NO_11 , SEQ_NO_64, SEQ_NO_65, SEQ_NO_66, SEQ_NO_67, SEQ_NO_68, SEQ_NO_15, SEQ_NO_69, SEQ_NO_70, SEQ_NO_71 , SEQ_NO_16, SEQ_NO_72, SEQ_NO_18.
42. A kit for performing the method according to one of claims 4 to 39, said kit comprising means for determining an expression level of at least two RNAs selected from the group consisting ofFxyd3, Trappc3, Clstn2, Deptor, Hoxaas3, Sdk1 , Gm42836, Ldb2, Hist1 h3c, 2010016118Rik, 5430405H02Rik, AC160051.3, Mrpl45, Slc9a9, 5031415H12Rik, Gm12940, Gm20628, AC131120.1 , Gm20634, 4930512B01 Rik, Hist2h2be, Gm43581 , A430018G15Rik, Gm43062, mmu-miR- 216a-5p, B930095G15Rik, Gm20501 , CT033754.1 , Pou2af1 , Reps2, Hist1 h4b, Gm26699, Gm19409, Pld5, Gm16105, 9330160F10Rik, B230398E01 Rik, Gm44633, CT030159.2, Eif4g3, Gm44570, Gm31718, Nr6a1 os, Tmem250-ps, 8430423G03Rik, D930016D06Rik, Slc4a7, Gm26831 , AC165261.1 , A430072P03Rik, Gm7331 , Gm 12374, Gm 15832, C030029H02Rik, Adamts2, 4930509H03Rik, Tex50, 4930556M19Rik;D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm 14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl ; andPou2af1 , 2010016118Rik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, PlatrW, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331.
43. A kit for performing the method according to one of claims 4 to 39, said kit comprising means for determining an expression level of at least two RNAs selected from the group consisting ofFxyd3 (ST), Trappc3 (ST), Clstn2 (AS), Deptor (AS), Hoxaas3 (ST), Sdk1 (ST), Gm42836 (ST), Ldb2 (AS), Hist1 h3c (ST), 2010016118Rik (AS),5430405H02Rik (ST), AC160051.3 (ST), Mrpl45 (AS), Slc9a9 (ST), 5031415H12Rik (AS), Gm12940 (ST), Gm20628 (ST), AC131120.1 (ST), Gm20634 (ST), 4930512B01 Rik (ST), Hist2h2be (ST), Gm43581 (AS), A430018G15Rik (ST), Gm43062 (AS), mmu-miR-216a-5p (ST), B930095G15Rik (ST), Gm20501 (ST), CT033754.1 (ST), Pou2af1 (AS), Reps2 (ST), Hist1 h4b (ST), Gm26699 (ST), Gm 19409 (ST), Pld5 (AS), Gm 16105 (ST), 9330160F10Rik (AS), B230398E01 Rik (ST), Gm44633 (ST), CT030159.2 (ST), Eif4g3 (ST), Gm44570 (ST), Gm31718 (ST), Nr6a1 os (ST), Tmem250-ps (ST), 8430423G03Rik (ST), D930016D06Rik (ST), Slc4a7 (ST), Gm26831 (ST), AC165261.1 (AS), A430072P03Rik (AS), Gm7331 (AS), Gm12374 (AS), Gm15832 (ST), C030029H02Rik (ST), Adamts2 (ST), 4930509H03Rik (ST), Tex50 (ST), 4930556M19Rik (ST);D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm 14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1 ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971 .9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), Platrl O (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25 (ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); andPou2af1 (ST), 2010016118Rik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrlO (ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST); orsaid kit comprising means for determining an expression level of at least two RNAs selected from the group consisting of SEQ_NO_1 to SEQ_NO_117.
44. The kit of claim 42 or 43, further comprising at least one reference pattern of expression levels for comparing with the expression level of at least one RNA from said sample.
45. The kit according to one of claims 42 to 44, further comprising means for determining an expression level at least one internal reference RNA for normalizing the expression level of at least two RNAs selected from the group consisting ofFxyd3, Trappc3, Clstn2, Deptor, Hoxaas3, Sdk1 , Gm42836, Ldb2, Hist1 h3c, 201001611 SRik, 5430405H02Rik, AC160051.3, Mrpl45, Slc9a9, 5031415H12Rik, Gm12940, Gm20628, AC131120.1 , Gm20634, 4930512B01 Rik, Hist2h2be, Gm43581 , A430018G15Rik, Gm43062, mmu-miR- 216a-5p, B930095G15Rik, Gm20501 , CT033754.1 , Pou2af1 , Reps2, Hist1 h4b, Gm26699, Gm19409, Pld5, Gm16105, 9330160F10Rik, B230398E01 Rik, Gm44633, CT030159.2, Eif4g3, Gm44570, Gm31718, Nr6a1 os, Tmem250-ps, 8430423G03Rik, D930016D06Rik, Slc4a7, Gm26831 , AC165261.1 , A430072P03Rik, Gm7331 , Gm 12374, Gm 15832, C030029H02Rik, Adamts2, 4930509H03Rik, Tex50, 4930556M19Rik;D830025C05Rik, AC117194.1 , 4732496C06Rik, Gm32122, Gm42303, Gm45609, Gm45733, Gm37401 , Gm43112, Gm 14703, AC153506.3, EU599041 , Gm20342, A430010J10Rik, 4930488L21 Rik, Gm42939, A430010J10Rik, Arhgef16, Mir124-2hg, AA465934, Gm29325, C230088H06Rik, Kcnq1 ot1 , Gm43696, AC121793.2, Rrnadl , AC151971.9, Gm19656, 5830416119Rik, Gm28707, CT010463.2, AI849053, Gm43972, Gm5431 , 4930452N14Rik, Gm13568, Gm13055, Gm26909, Gm45379, Gm10062, 9430065F17Rik, Plcbl , PlatrW, Gm20644, Gm21986, 9430065F17Rik, Gm26632, Wbscr25, Dbpht2, Hist2h4, Gm11131 , Wbscr25, Sncaip, Adap2os, Gm44115, Sortl , Tug1 , Colgalt2, Scrnl ; andPou2af1 , 2010016118Rik, A430072P03Rik, Arhgef16, Gm12374, Gm43581 , Gm5431 , 9330160F10Rik, Platrl O, Gm21986, Gm26632, 5031415H12Rik, Mrpl45, Reps2, Sncaip, Tug1 , Gm43062, Scrnl , AC165261.1 , Eif4g3, Gm7331.
46. The kit according to one of claims 42 to 44, further comprising means for determining an expression level at least one internal reference RNA for normalizing the expression level of at least two RNAs selected from the group consisting ofFxyd3 (ST), Trappc3 (ST), Clstn2 (AS), Deptor (AS), Hoxaas3 (ST), Sdk1 (ST), Gm42836 (ST), Ldb2 (AS), Hist1 h3c (ST), 2010016118Rik (AS), 5430405H02Rik (ST), AC160051.3 (ST), Mrpl45 (AS), Slc9a9 (ST), 5031415H12Rik (AS), Gm12940 (ST), Gm20628 (ST), AC131120.1 (ST), Gm20634 (ST), 4930512B01 Rik (ST), Hist2h2be (ST), Gm43581 (AS), A430018G15Rik (ST), Gm43062 (AS), mmu-miR-216a-5p (ST), B930095G15Rik (ST), Gm20501 (ST), CT033754.1 (ST), Pou2af1 (AS), Reps2 (ST), Hist1 h4b (ST), Gm26699 (ST), Gm 19409 (ST), Pld5 (AS), Gm 16105 (ST), 9330160F10Rik (AS), B230398E01 Rik (ST), Gm44633 (ST), CT030159.2 (ST), Eif4g3 (ST), Gm44570 (ST), Gm31718 (ST), Nr6a1 os (ST), Tmem250-ps (ST), 8430423G03Rik (ST), D930016D06Rik (ST), Slc4a7 (ST), Gm26831 (ST), AC165261.1 (AS), A430072P03Rik (AS), Gm7331 (AS), Gm12374 (AS), Gm15832 (ST), C030029H02Rik (ST), Adamts2 (ST), 4930509H03Rik (ST), Tex50 (ST), 4930556M19Rik (ST);D830025C05Rik (ST), AC117194.1 (ST), 4732496C06Rik (ST), Gm32122 (ST), Gm42303 (ST), Gm45609 (ST), Gm45733 (ST), Gm37401 (ST), Gm43112 (ST), Gm 14703 (ST), AC153506.3 (ST), EU599041 (ST), Gm20342 (ST), A430010J10Rik (ST), 4930488L21 Rik (ST), Gm42939 (ST), A430010J10Rik (ST), Arhgef16 (AS), Mir124-2hg (ST), AA465934 (ST), Gm29325 (ST), C230088H06Rik (ST), Kcnq1 ot1 (ST), Gm43696 (ST), AC121793.2 (ST), Rrnadl (ST), AC151971.9 (ST), Gm19656 (ST), 5830416119Rik (ST), Gm28707 (ST), CT010463.2 (ST), AI849053 (ST), Gm43972 (ST), Gm5431 (AS), 4930452N14Rik (ST), Gm13568 (ST), Gm13055 (ST), Gm26909 (ST), Gm45379 (ST), Gm 10062 (ST), 9430065F17Rik (ST), Plcbl (ST), PlatrlO (ST), Gm20644 (ST), Gm21986 (ST), 9430065F17Rik (ST), Gm26632 (ST), Wbscr25(ST), Dbpht2 (ST), Hist2h4 (ST), Gm11131 (ST), Wbscr25 (ST), Sncaip (ST), Adap2os (ST), Gm44115 (ST), Sortl (ST), Tug1 (ST), Colgalt2 (AS), Scrnl (AS); andPou2af1 (ST), 201001611 SRik (ST), A430072P03Rik (ST), Arhgef16 (AS), Gm 12374 (ST), Gm43581 (ST), Gm5431 (AS), 9330160F10Rik (ST), PlatrW(ST), Gm21986 (ST), Gm26632 (ST), 5031415H12Rik (ST), Mrpl45 (ST), Reps2 (AS), Sncaip (ST), Tug1 (ST), Gm43062 (ST), Scrnl (AS), AC165261.1 (ST), Eif4g3 (AS), Gm7331 (ST); or further comprising means for determining an expression level at least one internal reference RNA for normalizing the expression level of at least two RNAs selected from the group consisting of SEQ_NO_1 to SEQ_NO_117.