Method of genome-editing

EP4742891A2Pending Publication Date: 2026-05-20UNIV GENT
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
UNIV GENT
Filing Date
2024-07-10
Publication Date
2026-05-20

AI Technical Summary

Technical Problem

Current CRISPR-Cas9 gene editing methods have low transformation efficiency for arthropods, particularly chelicerates, making it difficult to achieve successful gene editing in these organisms, with existing techniques resulting in less than 1% successful editing rates.

Method used

A combination of cationic nanoparticles, such as Branched Amphipathic Peptide Capsules (BAPC), and an endosomal escape reagent like saponin is used with the CRISPR-Cas9 ribonucleoprotein complex to enhance delivery and increase transformation efficiency by facilitating the escape of the complex from endosomes, resulting in efficiencies between 6% to 25%.

Benefits of technology

The combination significantly increases gene editing efficiency in arthropods, overcoming the limitations of traditional methods by achieving higher successful editing rates and enabling efficient genome editing in previously difficult-to-transform species.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000015_0001
    Figure IMGF000015_0001
  • Figure IMGF000028_0001
    Figure IMGF000028_0001
  • Figure IMGF000028_0002
    Figure IMGF000028_0002
Patent Text Reader

Abstract

The present invention relates to the field of genome-editing, more specific of difficult to transform organisms such as e.g. invertebrates and in particular Arthropoda. The present disclosure provides a combination comprising one or more cationic nanoparticles, one or more endosomal escape reagent(s), and one or more ribonucleoprotein (RNP) complexes wherein said RNP comprises a Cas RNA-guided nuclease associated with a guide RNA (gRNA), and the use thereof in the production of a non-human genetically modified organism. The invention further provides a combination as defined herein for use in CRISPR based methods.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Method of genome-editing

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to the field of genome-editing, more specific of difficult to transform organisms such as e.g. invertebrates and in particular Arthropoda. The present disclosure provides a combination comprising one or more amphiphilic peptide(s), one or more endosomal escape reagent(s), and one or more ribonucleoprotein (RNP) complexes wherein said RNP comprises a Cas RNA-guided nuclease associated with a guide RNA (gRNA) and the use thereof in the production of a non-human genetically modified animal. The invention further provides a combination as defined herein for use in CRISPR based methods.

[0004] BACKGROUND TO THE INVENTION

[0005] The use of CRISPR-Cas9 has revolutionized functional genetic work in many organisms, including more and more insect species. However, successful gene editing or genetic transformation has not yet been reported for arthropods and in particular chelicerates, the second largest group of terrestrial animals. Within this group, some mite and tick species are economically very important for agriculture and human health, and the availability of a gene-editing tool would be a significant advancement for the field.

[0006] The lack of efficient tools for reverse genetics that can directly validate the involvement of genes and mutations in phenotypes of interest however has impeded critical advances in e.g. chelicerate related molecular biology. Successful CRISPR-Cas-mediated gene manipulation has been reported for a steadily increasing number of organisms in the arthropod subphyla and Hexapoda, including Diptera, Hymenoptera, Hemiptera, Coleoptera, Orthoptera and diverse Lepidoptera, but not in the wide group of chelicerates.

[0007] The CRISPR-Cas technique currently usually consists of a two-component system with a small, easy to synthesize single guide RNA (sgRNA) and a bacterial nuclease (for example Cas9). It introduces double-stranded breaks in eukaryotic genomes, where the breaks can be repaired randomly (non- homologous end-joining, NHEJ) or based on a template (homology-directed repair). In order to obtain efficient heritable genome editing, Cas and sgRNA should be delivered to the nucleus of oocytes. In Drosophila, this is currently most easily accomplished by injecting sgRNAs in transgenic embryos expressing Cas9 under a germline-specific promotor. Most current approaches with non-model organisms rely upon delivering the Cas9 ribonucleoprotein (RNP) complex (Cas9 protein + sgRNA) by embryonic microinjection. However, within the chelicerates, but also other arthropods, successful embryo injection has not been accomplished yet, as injected chelicerate embryos die (Garb et al., 2018).

[0008] An alternative method, avoiding the injection of eggs or embryos, is delivery of a Cas RNP complex to the germline by injecting the mother animals. Such approaches already proved to be successful for organisms such as nematodes and insects. Dermauw et al., 2020, also provided evidence that this approach can be used for mites, but CRISPR-Cas success rate was very low (less than 1 %). In addition, a technique called ReMOT, Receptor-Mediated Ovary Transduction of Cargo, has been proposed (Chaverra-Rodriguez et al., 2020). In ReMOT, a ligand is identified that interacts with oocyte receptors, and this ligand is engineered as a tag on the Cas protein, facilitating uptake after female injection. Although this principle of transformation could be transferrable to other organisms, the peptide ligand identified has no homologs other than in flies and mosquitoes.

[0009] A general problem with these techniques in arthropods is the low transformation efficiency resulting in a minor chance of successful gene editing.

[0010] Therefore, the overall objective of the present invention is to provide a combination that has unprecedented high transformation efficiency for difficult to transform organisms, e.g. arthropods, compared to any currently used Cas-based method. This is accomplished by exploiting the unexpected synergism between cationic nanoparticles such as Branched Amphipathic Peptide Capsules (BAPC) and an endosomal escape reagent. Female injection of a combination comprising these adjuvants, sgRNA and Cas9 protein, results in transformation efficiencies between 6% to 25% compared to unformulated Cas9 RNP’s composition barely reaching 1 % (0.1 % to 0.8%) in transformation efficiency.

[0011] The present invention provides a unique genome editing method in the field, in particular for arthropods and in particular for chelicerates but also for some other difficult to transform insects. The combination according to the invention increases the transformation efficiency compared with any other combination or method currently used for arthropods and circumvents difficult embryo injections.

[0012] SUMMARY OF THE INVENTION

[0013] In a first aspect, the present invention provides a combination comprising one or more cationic nanoparticles, one or more endosomal escape reagent(s), and one or more ribonucleoprotein (RNP) complexes wherein said RNP comprises a Cas RNA-guided nuclease associated with a guide RNA (gRNA). In particular, the endosomal escape reagent and the RNP complex is associated with (e.g., complexed, conjugated, encapsulated, absorbed, adsorbed, admixed) the nanoparticle.

[0014] In a specific embodiment, the cationic nanoparticle is a nanoparticle formed by assembly of amphiphilic compounds selected from the list comprising: peptides, lipids, polymers, or surfactants, or a mixture thereof, in particular by amphiphilic peptides.

[0015] In a further embodiment, the present invention provides a combination wherein the amphiphilic peptides assemble to a nanoparticle, in particular to a nanosphere.

[0016] In a specific embodiment, the cationic nanoparticle is a Branched Amphiphilic Peptide Capsule (BAPC).

[0017] In yet another embodiment, the present invention provides a combination wherein the endosomal escape reagent is selected from the list comprising saponin, L-leucyl- L-leucine O-methyl ester, UNC7938, amantadine, ammonium chloride, amphotericin B, bafilomycin A, or a derivative of any of the foregoing, or any combination thereof, in particular saponin or a derivative thereof. In a specific embodiment, the present invention provides a combination wherein said Cas RNA guided nuclease is selected from the list comprising: Cas9, Cas12, Cas 12a - i, Cas 12k, SaCas9, High-Fidelity Cas9, eSpCas9, CasMINI, Cas13, Cas 13a, Cas13b, Cas13c, Cas13d; CasX, CasY, Cas3, Cas5, Cas 8a, Cas8b, Cas8c, Casi o, Cas10d, Cas4-Cas1-Cas2 Complex, or Cas 14a.

[0018] In a particular embodiment, the present invention provides a combination wherein said Cas RNA guided nuclease is CRISPR-associated protein 9 (Cas9), and / or CRISPR-associated protein 12 (Cas12), or derivates thereof.

[0019] In another embodiment, the present invention provides a combination wherein the gRNA is selected from the list comprising: sgRNA, crRNAs, tracrRNAs.

[0020] In a specific embodiment, the present invention provides a combination wherein the mass ratio gRNA:cationic nanoparticle, in particular gRNA:BAPC is about and between 1 :1 to about 100:1 , about and between 2;1 to about 80:1 , about and between 3:1 to about 60:1 , about and between 4:1 to about 40:1 , about and between 5:1 to about 30:1 , or about and between 6:1 to about 20:1 .

[0021] In a further aspect, the present invention provides the use of a combination in a non-human female animal, resulting in the production of genetically modified offspring.

[0022] In a specific embodiment, the present invention provides the use of a combination according to the invention wherein a genetically modified organism is produced by in vivo knock-in and / or gene knockout engineering.

[0023] In yet a specific embodiment, the present invention provides the use of a combination according to the invention wherein the combination is injected in an organism, in particular invertebrates, more in particular arthropods, mollusks, annelids, platyhelminthes, nematodes, echinoderms, Porifera and / or Cnidaria.

[0024] In a further embodiment, the present invention provides the use of a combination according to the invention wherein the combination is injected into a female organism, in particular an arthropod, in particular a chelicerate, Pancrustacean or myriapod, even more in particular arachnida (including mites, ticks and spiders), insects and Crustacea.

[0025] In yet a further aspect, the present invention provides a combination comprising a positively charged nanoparticle, e.g. formed by an amphiphilic peptide, in particular BAPC; and an endosomal escape reagent, in particular saponin; for use in a Clustered regularly interspaced short palindromic repeats- CRISPR-associated enzyme (CRISPR-CAS) method.

[0026] In a specific embodiment, the present invention provides a combination for use for gene-editing of cells or tissues, or invertebrate animals, in particular arthropods. BRIEF DESCRIPTION OF THE FIGURES

[0027] With specific reference to the figures, it is to be noted that the particulars shown are by way of example and for purposes of illustrative discussion of the different embodiments of the present invention. They are presented in the cause of providing what is believed to be the most useful and readily description of the principles and conceptual aspects of the invention. In this regard no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention. The description taken with the drawings make it apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

[0028] Fig. 1 : Knock out frequencies of phytoene desaturase (albinism) observed in T. urticae in haploid male offspring after injection of virgin females. Fig. 1A) Effect of various adjuvants on the percentage of offspring showing albinism upon CRISPR / Cas9 knock-out using sgPD1 and sgPD2. Fig. 1 B) Effect of varying BAPC stock concentration added to the CRISPR / Cas9 mixture with sgPD2. Fig. 1 C) CRISPR / Cas9 KO efficiency obtained in two other target genes, CYP384A1 and ANTP, compared to CRISPR / Cas9 efficiencies for phytoene desaturase with sgPD2.

[0029] Fig. 2: Fig. 2A) Effect of age of injected mothers on CRISPR (BAPC + saponin) KO efficiency in the offspring. Fig. 2B) CRISPR (BAPC + saponin) KO efficiency observed in fertilized diploid eggs. As a control a group of virgin females (with unfertilized eggs) were also injected with the CRISPR / Cas9 mixture (BAPC + saponin).

[0030] Fig. 3: Region of the T. urticae CHS1 coding sequence in which an etoxazole resistance mutation (A- >T; indicated with an arrow;) was introduced using CRISPR / Cas9. The “Repair template” is shown in the middle while the corresponding CHS1 sequence in the susceptible and CRISPR / Cas9 edited strain is shown on top and at the bottom, respectively. Silent mutations were also included in the “Repair template” as a control for false positives (e.g. mites who gained the resistance mutation by chance instead of genetic engineering).

[0031] Fig. 4: CRISPR (BAPC + saponin) KO efficiencies for F. occidentalis (offspring produced in the first 24h post injection), A. gambiae and B. tabaci (offspring produced in the first 48h post injection). The vertical bar represents the average of the different measurements.

[0032] DETAILED DESCRIPTION OF THE INVENTION

[0033] The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.

[0034] As used in the specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. By way of example, "a compound" means one compound or more than one compound. Throughout the description and claims of this specification the word "comprise" and other forms of the word, such as "comprising" and "comprises," means including but not limited to, and is not intended to exclude, for example, other additives, components, integers, or steps. The term "about" or "approximately" as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, is meant to encompass variations of + / -10% or less, preferably + / -5% or less, more preferably + / - 1 % or less, and still more preferably + / -0.1 % or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier "about" or "approximately" refers is itself also specifically, and preferably, disclosed. The term "consisting essentially of or "consists essentially of means that e.g. a product or method must contain the listed compounds, ingredient(s), or steps and may also contain small amounts (for example up to 5 % by weight, or up to 1 % or 0.1 % by weight) of other ingredient(s), compounds, or steps provided that any additional ingredients, compounds, or steps do not affect the essential properties of the respective product or method. The terms described above and others used in the specification are well understood to those in the art. All references, and teachings specifically referred to, cited in the present specification are hereby incorporated by reference in their entirety.

[0035] The overall objective of the present invention is to provide a combination that has unprecedented high transformation efficiency for e.g. arthropods, compared to any currently used Cas-based method. This is accomplished by exploiting an unexpected synergism between two compounds, a positively charged nanoparticle such as a Branched Amphipathic Peptide Capsules (BAPC) and an endosomal escape reagent. Female injection of a combination comprising these adjuvants, together with sgRNA and a Cas protein, results in transformation efficiencies above 10%. This is unique in the field.

[0036] The present application is directed to the CRISPR / Cas gene editing system for use in both non-cellular and cellular settings, in vitro and in vivo, including cells from invertebrate animals - as well as a combination for use in any setting, including for use in gene-editing and in a method of therapeutic treatment.

[0037] In a first aspect, the present invention provides a combination or composition comprising, consisting essentially of or consisting of one or more cationic nanoparticles, one or more endosomal escape reagent(s), and one or more ribonucleoprotein (RNP) complexes wherein said RNP comprises a Cas RNA-guided nuclease associated with a guide RNA (gRNA). In a particular embodiment, the compounds in the combination or composition are not synthetically conjugated e.g. by using a linker. In another particular embodiment, the combination does not comprise chloroquine or fluorine (F).

[0038] The invention furthermore provides a method of preparing a CRISPR / Cas gene editing formulation, comprising the steps of: preparing a ribonucleoprotein (RNP) complex wherein said RNP comprises a Cas RNA-guided nuclease associated with a guide RNA (gRNA); adding to the RNP complex a cationic nanoparticle and an endosomal escape reagent as separate reagents. In said method, the nanoparticles are preformed, i.e. assembled as nanoparticle before mixing with the endosomal escape reagent and / or the RNP complex.

[0039] As used herein and unless otherwise specified, the term “combination” refers to the identity of all different, individual substances, compounds or elements (e.g. peptides, polypeptides, polynucleotides, proteins or residual proteins, surfactants, enzymes, agents, activators, modulators, regulators, etc.) that constitute the combination. It can be a solution, mixture, an emulsion, a suspension, liquid, aqueous or non-aqueous formulation prepared according to a specific procedure. As used herein "a combination" refers to any association between two or more items. The association can be spatial or refer to the use of the two or more items for a common purpose. Hence, in the context of the present invention, the combination as provided herein may be a single composition comprising all compounds. In the alternative, the combination according to the invention may also refers to two or more individual compositions, each comprising one of the compounds, which are nevertheless used in association with each other and used or administered / injected separately, either simultaneously or sequentially (i.e. with a short time interval). Said association, may include the simultaneous administration / injection of different compositions, or the separate administration / injection in such a manner that all components are still able to cooperate to achieve a high transformation efficiency. Some components impart specific properties to the combination when it is put into use. The combination is preferably used for genetic engineering techniques, in particular genetic editing purposes, more in particular for CRISPR / Cas-based methods.

[0040] In some embodiments, the combination according to the invention comprises the same amount or an excess of gRNA compared to cationic nanoparticle. More specific, the mass ratio gRNA to cationic nanoparticle (gRNA:cationic nanoparticle), is about or at least about 1 :1 , such as about or at least about 2:1 , 3:1 , 4:1 , 5:1 , 6:1 , 7:1 , 8:1 , 9:1 , 10:1 , 20:1 , 30:1 , 40:1 , 50:1 , 60:1 , 70:1 , 80:1 , 90:1 , or 100:1 .

[0041] In a particular embodiment, the present invention provides a combination wherein the mass ratio gRNA to BAPC (gRNA:BAPC) is about or at least about 1 :1 , such as about or at least about 2:1 , 3:1 , 4:1 , 5:1 , 6:1 , 7:1 , 8:1 , 9:1 , 10:1 , 20:1 , 30:1 , 40:1 , 50:1 , 60:1 , 70:1 , 80:1 , 90:1 , or 100:1.

[0042] In a further embodiment, the present invention provides a method or combination wherein the ratio gRNA:cationic nanoparticle is between 2:1 and 50:1 , more particular between 2:1 and 20:1 , in particular wherein the ratio gRNA:BAPC is about 6:1 .

[0043] In yet another embodiment, the combination according to the invention comprises a mass ratio gRNA:cationic nanoparticle, in particular gRNA:BAPC of about and between 1 :1 to about 100:1 , about and between 2;1 to about 80:1 , about and between 3:1 to about 60:1 , about and between 4:1 to about 40:1 , about and between 5:1 to about 30:1 , about and between 6:1 to about 20:1 .

[0044] In a specific embodiment, the combination according to the invention comprises a BAPC concentration of at least about 1 pg / pl, such as at least about 2, 3, 4, 5, 6, 7, 8, 9, 10 pg / pl, preferably at least about 5 pg / l, more preferably at least about 7 pg / pl, most preferably at least about 10 pg / pl.

[0045] In a further embodiment, the combination according to the invention comprises a BAPC concentration of about and between 1 pg / pl to about 50 pg / pl, about and between 2 pg / pl to about 40 pg / pl, about and between 3 pg / pl to about 30 pg / pl, about and between 4 pg / pl to about 20 pg / pl, about and between 5 pg / pl to about 10 pg / pl, preferably about and between 1 pg / pl to about 10 pg / pl. It will be understood by those skilled in the art that the optimal ratio will depend on various factors and thus can be modified as such to obtain a further increase in gene editing efficiency.

[0046] In one embodiment, the invention provides a kit of parts comprising or consisting of one or more nanoparticles as provided herein, one or more endosomal escape reagents as disclosed herein and oner or more RNP complexes as provided herein.

[0047] The CRISPR-Cas system relies on two main components: (1) a CRISPR-associated protein (Cas); also termed a Cas RNA-guided nuclease, and (2) a guide RNA molecule (gRNA) comprising (i) a targeting domain (which is capable of hybridizing to the genomic DNA target sequence), and (ii) a sequence which is capable of binding to a Cas. As used herein, the term ‘CRISPR’ refers to Clustered Regularly Interspaced Short Palindromic Repeat which is a bacterial genomic region used in pathogen defense.

[0048] In the context of the present invention, when reference is made to a “ribonucleoprotein (RNP) complex”, it is to be understood as the interaction between a gRNA and a CRISPR-associated protein. As such, the term “interaction” also refers to the formation of a complex by joining, coupling, pairing, combining, linking, relating two or more elements. In an embodiment, the CRISPR-associated protein is a nonspecific endonuclease. It is directed to the specific DNA locus by a gRNA, where it makes a doublestrand or single-strand break in the DNA. Insertion or deletion of nucleotides at or near the strand break creates the modified genome.

[0049] As these CRISPR-associated proteins naturally occur in many different types of bacteria, the exact arrangements of the CRISPR and structure, function and number of Cas genes and their product differ somewhat from species to species.

[0050] In some embodiments, one or more elements of a CRISPR system, in particular a Cas RNA-guided nuclease is derived from a particular organism comprising an endogenous CRISPR system selected from the list comprising: Streptococcus pyogenes, Streptococcus thermophilus, Listeria innocua, Campylobacter jejuni and Neisseria meningitidis. Additional species include: Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., cycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp., Blastopirellula marina, Bradyrhiz obium sp., Brevibacillus latemsporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lad, Candidates Puniceispirillum, Clostridiu cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter sliibae, Eubacterium dolichum, gamma proteobacterium, Gluconacetobacler diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, llyobacler polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica. Neisseria sp., Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tislrella mobilis, Treponema sp., or Verminephrobacter eiseniae.

[0051] It will be understood by those skilled in the art that various Cas RNA-guided nucleases can be used in the combination or method according to the invention. In a specific embodiment, the present invention provides a method or combination wherein one or more Cas RNA-guided nuclease is selected from the list comprising: Cas9, Cas12, Cas 12a - i, Cas 12k, SaCas9, High-Fidelity Cas9, eSpCas9, CasMINI, Cas13, Cas13a, Cas13b, Cas13c, Cas13d, CasX, CasY, Cas3, Cas5, Cas8a, Cas8b, Cas8c, Casi o, Cas10d, Cas4-Cas1-Cas2 Complex, or Cas 14a.

[0052] The selection of one or more suitable Cas RNA-guided nucleases is within the expertise of one of ordinary skill in the art. For example, although Cas9 is a preferred nuclease, one skilled in the art is aware that molecular complexes like CasX are smaller, easier to deliver and make fewer off-target genetic cuts. Alternatively, Cas12 is smaller and simpler compared to Cas9 while CasMINI is about twice as compact as Cas9 or Cas12.

[0053] In a particular embodiment, the present invention provides a method or combination comprising one or more RNP complexes comprising CRISPR-associated protein 9 (Cas9) or derivates thereof. Cas9 proteins are from a type II CRISPR / Cas system and typically share four key motifs with a conserved architecture. Motifs 1 , 2, and 4 are RuvC-like motifs, and motif 3 is an HNH motif. Exemplary Cas9 proteins are from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammon fex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Neisseria meningitidis, or Campylobacter jejuni. Additional examples of the Cas9 family members are described in WO2014 / 131833, incorporated herein by reference. Cas9 from S. pyogenes (SpCas9) (assigned SwissProt accession number Q99ZW2) is an exemplary Cas9 protein. Cas9 from S. aureus (SaCas9) (assigned UniProt accession number J7RUA5) is another exemplary Cas9 protein. Cas9 from Campylobacter jejuni (CjCas9) (assigned UniProt accession number Q0P897) is another exemplary Cas9 protein. Examples of Cas12 proteins are Cas12a (known as Cpf1) proteins of Lachnospiraceae bacterium (LbCas12a), Francisella novicida (FnCas12a), and Acidaminococcus sp. (AsCas12a).

[0054] In yet another embodiment, the method or combination according to the invention comprises Cas9 and / or Cas 12 or a derivative thereof. In particular, the Cas9 is a recombinant Streptococcus pyogenes (SpCas9) Cas9 protein or derivative thereof. In another embodiment, the Cas12 is a Cas12a (formerly Cpf1) endonuclease, or derivative thereof. As used herein, a ‘derivative’ refers to a functional variant or fragment of the original sequence and having a sequence identity of at least 80%, in particular 90%, more in particular 95%, even more in particular at least 96%, 97%, 98% or 99%.

[0055] In some embodiments, the ability of an active Cas9 molecule to interact with and cleave a target nucleic acid is protospacer-adjacent motif (PAM) sequence dependent. A PAM sequence is a sequence in the target nucleic acid. In some embodiments, cleavage of the target nucleic acid occurs upstream from the PAM sequence. Active Cas9 molecules from different bacterial species can recognize different sequence motifs (e.g., PAM sequences). In some embodiments, an active Cas9 molecule of S. pyogenes recognizes the sequence motif NGG and directs cleavage of a target nucleic acid sequence 1 to 10, e.g., 3 to 5, base pairs upstream from that sequence. In some embodiments, an active Cas9 molecule of S. thermophilus recognizes the sequence motif NGGNG and NNAG AAW (W=A or T) and directs cleavage of a core target nucleic acid sequence 1 to 10, e.g., 3 to 5, base pairs upstream from these sequences. In some embodiments, an active Cas9 molecule of S. mutans recognizes the sequence motif NGG or NAAR (R-A or G) and directs cleavage of a core target nucleic acid sequence 1 to 10, e.g., 3 to 5 base pairs, upstream from this sequence. In some embodiments, an active Cas9 molecule of S. aureus recognizes the sequence motif NNGRR (R=A or G) and directs cleavage of a target nucleic acid sequence 1 to 10, e.g., 3 to 5, base pairs upstream from that sequence. In some embodiments, an active Cas9 molecule of N. meningitidis recognizes the sequence motif NNNNGATT and directs cleavage of a target nucleic acid sequence 1 to 10, e.g., 3 to 5, base pairs upstream from that sequence. The ability of a Cas9 molecule to recognize a PAM sequence can be determined, e.g., using a transformation assay. In a particular embodiment, the Cas protein contains one, two, three or more nuclear localization sequences.

[0056] As used herein, the term “guide RNA (gRNA)” refers to one or more specific RNA sequence that recognizes the target DNA region of interest and directs the Cas there for editing. The gRNA can be made up of two parts: (i) CRISPR RNA (“crRNA”) also referred to as “gRNA spacer” which is a 17-20 nucleotide sequence complementary to the target DNA, and (ii) a trans-activating (“tracr”) RNA also referred to as “gRNA scaffold”, which serves as a binding scaffold for the Cas nuclease (i.e formation of a RNP complex). When a single RNA molecule comprises both a crRNA component and a tracrRNA component, reference is made to “sgRNA”. sgRNA can be synthetically generated or made in vitro or in vivo from a DNA template. Alternatively, the crRNA component and tracrRNA component can be present as separate RNA molecules, which are commonly referred to as 2-piece gRNAs or cr:tracrRNAs.

[0057] In another embodiment, the present invention provides a combination wherein the gRNA is selected from the list comprising: sgRNA, crRNAs, tracrRNAs, crtracrRNAs or a combination thereof. As used herein, the term “target sequence” refers to a sequence to which a guide sequence of a gRNA is designed to have complementarity to, and wherein hybridization between a target sequence and a guide sequence promotes the formation of a complex. For example, the scaffold gRNA (i.e. tracrRNA) hybridizes with the target RNA-guided nucleases (i.e. RNP complex) while the spacer gRNA (i.e. crRNA) hybridizes with a target sequence to form a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides.

[0058] In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell, in particular an ovary cell, even more in particular an oocyte. In some embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, endosome, mitochondrion or chloroplast.

[0059] In the context of the present invention, the term “hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the "complement" of the given sequence. As used herein, hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridisation and promote formation of a CRISPR complex. Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. The conditions appropriate for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of complementation between two nucleotide sequences, the greater the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences. For hybridizations between nucleic acids with short stretches of complementarity (e.g. complementarity over 35 or less, 30 or less, 25 or less, 22 or less, 20 or less, or 18 or less nucleotides) the position of mismatches becomes important (see Sambrook et al., 11.7-11.8). Typically, the length for a hybridisable nucleic acid is at least about 10 nucleotides. Illustrative minimum lengths for a hybridisable nucleic acid are: at least about 15 nucleotides; at least about 20 nucleotides; at least about 22 nucleotides; at least about 25 nucleotides; and at least about 30 nucleotides.

[0060] Additional components and / or elements of CRISPR gene editing systems known in the art, e.g., are described in US2014 / 0068797 and WO2015 / 048577, the contents of which are hereby incorporated by reference in their entirety.

[0061] The term “nanoparticle” as used herein can be interpreted broadly and refers to a carrier being used as a transport module for another substance, such as the endosomal escape reagent, protein and / or the RNA provided herein. Nanoparticles range from sizes of diameter 5-1000 nm, in particular from about 5 to about 500 nm, more in particular from about 5 to about 400 nm. In certain embodiments, the nanoparticle as envisaged herein has a mean diameter of 10-800 nm, 20-600 nm, 30-400 nm, or 40- 300 nm, such as a mean diameter of 50-300 nm, 60-300 nm, 70-300 nm, 80-300 nm, 90-300 nm or 100- 300 nm. The term "average diameter" refers to the mean hydrodynamic diameter of particles as measured by dynamic laser light scattering (DLS) with data analysis using the so-called cumulant algorithm, which provides as results the so-called Zaverage with the dimension of a length, and the polydispersity index (PI), which is dimensionless (Koppel D., J. Chem. Phys. 57, 1972, pp 4814-4820, ISO 13321). Here, "average diameter", "diameter" or "size" for particles is used synonymously with this value of the Zaverage.

[0062] In one embodiment, the nanoparticle is a cationic nanoparticle. The term “cationic nanoparticle” refers to a nanoparticle comprising a cationic agent embedded in the core or at the surface. Where the nanoparticle is to be used for complexation of nucleic acids such as RNA or proteins (such as Cas9), the positively charged nanoparticle is believed to interact electrostatically with the negatively charged DNA / RNA molecules, which not only facilitates complexation of the agent, but which may also protect the latter from enzymatic degradation.

[0063] The nanoparticle can be used to deliver nucleic acids to a target site of interest (e.g., cell, tissue, organ, and the like). The particle may be formed from at least one cationic or cationic ionizable lipid or lipid-like material, and / or at least one cationic polymer, or a mixture thereof, and a nucleic acid, more specific RNA. Cationic or cationic ionizable lipid or lipid-like material and / or the cationic polymer combine together with the nucleic acid to form aggregates, and this aggregation results in colloidal stable particles. In a further embodiment, particles described herein further comprise at least one lipid or lipid- like material other than a cationic or cationic ionizable lipid or lipid-like material, and / or at least one polymer other than a cationic polymer, or a mixture thereof.

[0064] Cationic agents / materials contemplated for use herein include those which are able to electrostatically bind nucleic acids. In some embodiments, cationic polymeric materials contemplated for use herein include any cationic polymeric materials with which nucleic acid or protein can be associated, e.g. by forming complexes with the nucleic acid or protein, or by forming vesicles in which the nucleic acid or protein is enclosed or encapsulated.

[0065] In one embodiment, the cationic agent may be a polycationic agent such as but not limited to chitosan, peptides (such as poly(L-lysine)), peptide derivatives (such as poly(L-lysine)-palmitic acid), polyethylenimine (PEI), poly(amido ethylenimine), and poly(amido amine). Given their high degree of chemical flexibility, polymeric materials are commonly used for nanoparticle-based delivery. Typically, cationic materials are used to electrostatically condense the negatively charged nucleic acid into nanoparticles. These positively charged groups often consist of amines that change their state of protonation in the pH range between 5.5 and 7.5, thought to lead to an ion imbalance that results in endosomal rupture. In addition, polymeric materials have been synthesized specifically for nucleic acid delivery. In one embodiment, a polymeric material may be or comprise protamine or polyalkyleneimine.

[0066] In a further embodiment, the nanoparticle of the invention is a carrier or particle comprising a lipid component (so called lipid-based nanoparticles), also referred to as a lipoplex formulation or lipid-based nanoparticle, and includes lipid nanoparticles (LNP), liposomes and micelles. The use of lipid-based nanoparticles to facilitate the delivery of the nucleic acids or proteins provided herein to target cells is especially contemplated by the present invention. The incorporated nucleic acids may be completely or partially located in the interior space of the particle, within the bilayer membrane of the particle, or associated with the exterior surface of the particle membrane. The association of a nucleic acid with a nanoparticle is also referred to herein as "encapsulation" wherein the nucleic acid is entirely integrated into the particle. The particle protects the nucleic acid from an environment which may contain enzymes or chemicals and allow the encapsulated nucleic acid to reach the target cell. While the nanoparticle can facilitate introduction of nucleic acids into target cells, the addition of polycations as provided herein, as a copolymer can facilitate, and in some instances markedly enhance the transfection efficiency.

[0067] The terms "lipid" and "lipid-like material" are used herein to refer to molecules which comprise one or more hydrophobic moieties or groups and optionally also one or more hydrophilic moieties or groups. Molecules comprising hydrophobic moieties and hydrophilic moieties are also frequently denoted as amphiphilic. Specific examples of amphiphilic compounds that may be included in an amphiphilic layer include, but are not limited to peptides, phospholipids, aminolipids, cationic amphiphilic drugs, and sphingolipids. Bilayer membranes of such nanoparticles are typically formed by amphiphilic molecules, such as peptides or lipids of synthetic or natural origin that comprise spatially separated hydrophilic and hydrophobic domains. Bilayer membranes of the (lipid)based nanoparticles can also be formed by amphiphilic polymers and surfactants (e.g., polymerosomes, niosomes, etc.). Examples of suitable lipids include, for example, the phosphatidyl compounds (e.g., phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides).

[0068] In a specific embodiment, the method or combination according to the invention comprises one or more cationic nanoparticles formed by assembly of compounds, more specific amphiphilic compounds, selected from the list comprising: peptides, lipids, polymers, or surfactants, or a mixture thereof, in particular peptides or lipids, or a mixture thereof, more in particular amphiphilic peptides. Positively charged polypeptides could exhibit interesting properties when self-assembled with lipids forming lipidpeptide nanocomplexes. Compared with traditional lipid nanoparticles (LNPs), lipid-peptide hybrid formulations, which amalgamate lipids with polypeptides, prove to be more effective than lipids alone by providing additional functionality to the lipocomplexes in many cases. This enables them to overcome cellular barriers more effectively, such as cell entry and endosomal escape.

[0069] Peptides can be used as functional moieties of lipoplexes / polyplexes, but also can also deliver nucleic acids themselves. Peptiplexes (peptide-nucleic acid complexes) as gene delivery system are stable, ease to synthesize and to modify. They can have diverse structures like polypeptides, dendrimers, linear and branched peptides, and all can serve as nucleic acid delivery vectors. For example, cell-penetrating peptides (CPPs) have been widely studied for gene delivery and usually refer to peptides consisting of 5-30 amino acids. Typically, CPPs enter cells with minimal cytotoxic effects, efficiently internalizing across cell membranes and playing a crucial role in transporting cargo into live cells. Two types can be distinguished: (1) protein derived peptides (e.g., transactivator of transcription (TAT) and penetratin); (2) synthetic peptides (e.g., PLL, PLA, PLO, PLH). Positive charged groups, such as s-amine of lysine, 6- amine of ornithine, imidazole group of histidine, and guanidine group of arginine, are all used to synthesize cationic polypeptides, including poly(L-lysine) (PLL), poly(L-ornithine) (PLO), poly(L- arginine) (PLA), and poly(L-histidine) (PLH), as well as their derivatives. Branched peptides are a further type of peptide-based nucleic acid delivery vectors. It has been reported that branched and dendrimeric cationic peptides have better transfection efficiencies than linear peptides due to their superior capacity for DNA condensation. In some instances peptide-based materials exhibit remarkable potential as gene carrier systems due to their biocompatibility and biodegradability that reduce the risk of cumulative cytotoxicity in contrast to many non-degradable polymers, such as e.g. polyethylenimine (PEI) and polyethylene glycol (PEG).

[0070] As used herein, the term “amphiphilic peptide” is to be understood as peptide-based molecules that assemble into supramolecular nanostructures and may include nanoparticles, spherical micelles, twisted ribbons, and high-aspect-ratio nanofibers. By way of example, in some embodiments, amphiphilic peptides as described herein can bind to one or more RNP complexes, more specifically a (Cas) RNP complex and can be employed to deliver such a complex into a cell. An amphiphilic peptide typically comprises a hydrophilic peptide sequence attached to a lipid tail, i.e. a hydrophobic alkyl chain with 10 to 16 carbons.

[0071] In an embodiment, the method or combination according to the invention comprises one or more amphiphilic peptide(s) comprising a lipid tail of at least 10 carbons such as at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 carbons.

[0072] One embodiment of the present invention provides a combination comprising amphiphilic peptides that are particularly suitable for interactions with charged ions. The amphiphilic peptides may be positively charged, and preferably are charged under physiological pH conditions. The charged moieties are particularly useful to induce assembly.

[0073] In a further embodiment, the present invention provides a method or combination wherein one or more amphiphilic peptides assemble into nanoparticles (also referred to herein as nanopsheres). Positively charged nanoparticles are particularly suitable to facilitate cellular uptake.

[0074] In a specific embodiment, the cationic nanoparticle is an Amphiphilic Peptide Capsule (APC), a Branched Amphiphilic Peptide Capsule (BAPC) or a Corralling Amphipathic Peptide Colloids (CAPC), preferably a BAPC.

[0075] As used herein, branched amphiphilic peptide capsules (BAPCs) are peptide nano-capsular spheres formed during the cooperative association of a mixture of two poly-cationic branched amphiphilic peptides. The capsules are water soluble, stable in blood, and made entirely of natural amino acids. Binding to BAPC via electrostatic interaction increases the stability and hence the delivery of RNP complexes to the target cells. Examples of BAPC are e.g. provided in WO2010 / 111652, incorporated by reference.

[0076] As used herein, Amphiphilic Peptide Capsule (APC) is a type of self-assembled nanostructures formed by amphiphilic peptides. These peptides have both hydrophilic (water-attracting) and hydrophobic (water-repelling) segments, allowing them to spontaneously organize in aqueous environments to form stable, hollow, spherical structures, often referred to as micelles or vesicles.

[0077] As used herein, Corralling Amphipathic Peptide Colloids (CAPC) refers to a type of self-assembled colloidal system formed by amphipathic (or amphiphilic) peptides. These peptides have both hydrophilic (water-attracting) and hydrophobic (water-repelling) segments, allowing them to spontaneously organize into structures in an aqueous environment. The term "corralling" implies a specific arrangement or behavior of these colloidal systems, potentially involving the containment or manipulation of particles or molecules within a defined region.

[0078] In a specific embodiment, at least one, preferably two poly-cationic branched amphiphilic peptides have a length of at least 10 amino residues, such as at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20 amino residues.

[0079] In some embodiments, the BAPC comprises two branched peptide sequences, preferably in an equimolar proportion, that assemble to form bilayer delimited capsules according to following formula: bis(FLIVI)-K-KKKK (SEQ ID No: 27) and bis(FLIVIGSII)-K-KKKK (SEQ ID No: 28) or;

[0080] Ac-Phe-Leu-lle-Val’Ile-Gly-SeMle-lle --nAc-Phe-leu-lie-Val-lle-Giy-Ser-ile-lle -5Lys-Lys-Lys-Lys-Iys-CONH2

[0081] Ac-Phe-Leu-iie-Vai-iie — ~ bis(htj)K-K. I c

[0082] F.W. * 26S2.7 Ac-Phe-Leu-I!e-Val-Ile“a-Lys-Lys-Lys-Lys-Lys-CONH2

[0083] In another embodiment, the BAPC comprises two branched peptide sequences wherein the first peptide and second peptide are preferably mixed at a molar ratio of from about 1 :10 to about 10:1 , more preferably from about 1 :5 to about 5:1 , and most preferably at about 1 :1 .

[0084] In another embodiment, the hydrophobic core sequences of the BAPCs are derived from an internal fragment of the human dihydropyridine sensitive L-type calcium channel segment CalVS3. The ability of the BAPCs to form bilayer-delimited spheres capable of trapping solutes is a consequence of the unique characteristics of its constituent peptides — bis(FLIVI)-K-K4 and bis(FLIVIGSII)-K-K4. In an embodiment, BAPCs are particularly suitable to form capsules to encapsulate Cas-gRNA complexes and deliver complexes across membranes. In another embodiment, the BAPCs are particularly suitable to form empty capsules to which Cas-gRNA complexes and / or endosomal escape reagents attach or stick to.

[0085] In a specific embodiment, the BAPCs interact with DNA in compact clusters ranging in average size from 50 to 250 nm, in particular 75 to 200 nm, more in particular 100 to 150 nm. BAPC can thus facilitate the uptake of DNA and potentially other types of nucleic acid in vitro and in vivo.

[0086] SUBSTITUTE SHEET (RULE 26) In a particular embodiment, the BAPCs have size in a range of about and between 5-50 nm, preferably about and between 10-40 nm, more preferably about and between 20-30 nm, most preferably about 25 nm.

[0087] In a specific embodiment, the BAPCs have a size of at least 5 nm, such as at least 6 nm, 7 nm, 8 nm, 9 nm, 10 nm, 11 nm, 12 nm, 13 nm, 14 nm, 15 nm, 16 nm, 17 nm, 18 nm, 19 nm, 20 nm, 21 nm, 22 nm, 23 nm, 24 nm, 25 nm, 26 nm, 27 nm, 28 nm, 29 nm or at least 30 nm.

[0088] In another embodiment, the BAPCs is a detergent- and / or protease-resistant BAPC.

[0089] Endosomes are the most obvious vesicles to install a transfer mechanism into the cell, since these are the first reached after internalization. In the context of the present invention, the term “endosomal escape reagent” is to be understood as an agent, drug, toxin, or any other compound that is particularly suitable to destabilize or disrupt an endosomal membrane barrier. Endosomal escape involves an initial membrane destabilization, followed by pore formation, endosomal rupture or membrane fusion. The three most relevant mechanisms of endosomal escape are (i) endosomal escape of drugs by photochemical internalization (PCI) or membrane-destabilizing agents, (ii) endosomal escape of bacterial toxins, and (iii) cell penetrating peptides (CPP)-mediated release of drugs from endosomes. Examples of endosomal escape reagents include cell penetrating peptides, viral membrane fusion proteins, endosomal leakage inducing molecules such as saponin or monensin.

[0090] In a particular embodiment, the release of the ribonucleoprotein according to the invention is particularly suitable to help the release of the ribonucleoprotein once delivered into the cell and are therefore particularly useful to achieve efficient gene editing.

[0091] In a particular embodiment, the present invention provides a combination wherein the endosomal escape reagent is selected from endosomal leakage molecules, a cell-penetrating peptide, a bacterial toxin, and viral membrane fusion proteins.

[0092] In yet another embodiment, the present invention provides a combination wherein one or more endosomal escape reagent is selected from the list comprising: saponin, L-leucyl- L-leucine O-methyl ester, UNC7938, amantadine, ammonium chloride, amphotericin B, bafilomycin A or a derivative of any of the foregoing, or any combination thereof. In one embodiment, the endosomal escape reagent is not chloroquine.

[0093] In a particular embodiment, the endosomal escape reagent is saponin. In the context of the present invention, the term “saponin" has its regular scientific meaning and refers herein to a group of amphipatic glycosides which comprise one or more hydrophilic glycone moieties combined with a lipophilic aglycone core which is a sapogenin. In a particular embodiment, the saponin may be naturally occurring or synthetic (i.e. non-naturally occurring). The term “saponin” includes naturally-occurring saponins, derivatives of naturally-occurring saponins, saponin-based derivatives, modified saponins as well as saponins synthesized de novo through chemical and / or biotechnological synthesis routes. Structurally, saponins are glycosides, sugars bonded to another organic molecule, usually a steroid or triterpene, a steroid building block. In some embodiments, the saponin according to the invention comprises a skeleton derived of a 30- carbon precursor oxidosqualene to which glycosyl residues are attached. In another embodiment, the skeleton of the saponin according to the invention comprises a structure selected from the group comprising: dammarane, tirucallane, lupane, hopane, oleanane, taraxasterane, ursane, cycloartane, lanostane, cucurbitane, and steroid. In a particular embodiment, the saponin comprises an oleanane skeleton. Specifically, Quillaja saponaria saponin (Quillaja saponins) is a mixture of molecules comprising sugar-bound aglycone moieties. The main aglycone (sapogenin) moiety is quillaic acid, a triterpene of predominantly 30-carbon atoms (hydrophobic) of the 12-oleanane type. The aglycone is bound to various sugars (hydrophilic) including glucose, glucuronic acid, galactose, xylose, apiose, rhamnose, fucose and arabinose.

[0094] The term “modified saponin” or “saponin derivative” has its regular scientific meaning and refers herein to a saponin which has one or more chemical modifications at positions where previously any of an aldehyde group, a carboxyl group, an acetate group and / or an acetyl group was present in the non- derivatized saponin before being subjected to chemical modification for provision of the modified saponin. For example, the modified saponin is provided by chemical modification of any one or more of an aldehyde group, a carboxyl group, an acetate group and / or an acetyl group in a saponin upon which the modified saponin is based, i.e. the saponin is provided and any of an aldehyde group, a carboxyl group, an acetate group and / or an acetyl group is chemically modified therewith providing the modified saponin. For example, the saponin that is modified for provision of the modified saponin is a naturally occurring saponin. Typically, the modified saponin is a synthetic saponin, typically the modified saponin is a modification of a natural saponin, and is thus derived from a natural saponin, although a modified saponin can also be derived from a synthetic saponin which may or may not have a natural counterpart. Typically, the modified saponin does not have a natural counterpart, i.e. the modified saponin is not produced naturally by e.g. plants or trees.

[0095] In a particular embodiment, the saponin of the invention can be obtained or derived from a natural source, such as but not limited to, soapbark tree (Quillaja saponaria), Tea Oil Camellia (Camellia oleifera), Mojave yucca (Yucca schidigera), licorice (Glycyrrhiza species), ginseng (Panax species), fenugreek (Trigonellafoenum-graceum), alfalfa (Medicago sativa), horse chestnut (Aesculus hippocastanum), soapwort (Saponaria officinaux), gypsophila genus (Gypsophila paniculata), Bupleurum kunmingense, Camellia sasanqua, and sarsaparilla (Smilax species), or extracts of those sources. In a very specific embodiment, the saponin of the invention is Quillaja-derived saponin, in particular Quillaja saponaria-demed saponin.

[0096] Saponins provided herein can be natural or synthetic and are commercially available.

[0097] In a specific embodiment, the method or combination according to the invention comprises saponin derived from Quillaja saponaria, also referred to as Quillaja Saponin (C36H54O11), or a (functional) derivative thereof.

[0098] In another embodiment, the saponins according to the invention can be purified saponin, more in particular laboratory grade, even more in particular high purity grade saponin. In a specific embodiment, the method or combination according to the invention comprises a concentration of endosomal reagent, in particular saponin, between 0.01 pg / pl and 1000 pg / pl, between 0.1 pg / pl and 900 pg / pl, between 0.1 pg / pl and 800 pg / plin particular between 1 pg / pl and 800 pg / pl, more in particular between 1 pg / pl and 500 pg / pl.

[0099] In another embodiment, the method or combination according to the invention comprises a concentration of endosomal reagent, in particular saponin, between 0.01 pg / pl and 500 pg / pl, between 0.1 pg / pl and 200 pg / pl, between 0.3 pg / pl and 100 pg / pl, between 0.5 pg / pl and 50 pg / pl, more in particular between 1 pg / pl and 30 pg / pl.

[0100] In another embodiment, the concentration of endosomal reagent, in particular saponin may be between 0.01 pg / pl and 70 pg / pl, between 0.1 pg / pl and 60 pg / pl, between 0.3 pg / pl and 40 pg / pl, between 0.5 pg / pl and 45 pg / pl, more in particular between 1 pg / pl and 40 pg / pl.

[0101] The concentration of the endosomal escape reagent is at least about 0.01 , 0.05, 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 , 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or 90 pg / pl.

[0102] Also for the endosomal escape reagent, it will be understood by those skilled in the art that the optimal ratio will depend on various factors such as target organism and thus can be modified as such to obtain a further increase in gene editing efficiency. For example, for Tetranychus urticae, a maximum dose of about 0.1 -0.3 pg / pl may be particularly suitable while for Frankliniella occidentalis the dose may reach about 1-3 pg / pl.

[0103] In the present invention, surprising results were observed for efficient germline editing when using a RNP complex together with BAPC and saponin, as exemplified in the example section. The highest efficiencies observed for formulations based solely on either saponin or solely on BAPC were less than 1 %. However, when combining both components, a germ line editing efficiency of 6% to 25% was observed.

[0104] In a specific embodiment, the present invention provides a combination comprising a saponin, a BAPC, and one or more ribonucleoprotein (RNP) complex wherein said RNP complex comprises a Cas RNA- guided nuclease associated with a guide RNA (gRNA). The invention further provides a gene-editing method using a saponin, a BAPC, and one or more ribonucleoprotein (RNP) complex wherein said RNP complex comprises a Cas RNA-guided nuclease associated with a guide RNA (gRNA).

[0105] In some embodiments, the method or combination according to the invention comprises an excess of Cas compared to gRNA, endosomal escape reagent, and / or amphiphilic peptide.

[0106] In a specific embodiment, the method or combination comprises at least 20% such as at least 30%, 40%, 50%, 60%, 70%, 80%, preferably at least 50% of a Cas RNA-guided nuclease.

[0107] In a specific embodiment of the present invention, the method, uses or the combination comprises: about 1-50 pg / pl Cas nuclease, in particular Cas9 or Cas12; about 1-10 pg / pl gRNA; about 1-50 pg / pl amphiphilic peptide, in particular BAPC; about 0.1-40 pg / pl endosomal escape reagent, in particular saponin.

[0108] In a further embodiment of the present invention, the method, uses or the combination comprises: about 40-50 pg / pl Cas nuclease, in particular Cas9 or Cas12; about 3-10 pg / pl gRNA; about 1-25 pg / pl amphiphilic peptide, in particular BAPC; about 1-40 pg / pl, endosomal escape reagent, in particular saponin.

[0109] In another embodiment of the present invention, the method, uses or the combination comprises: about 50 pg / pl Cas nuclease, in particular Cas9 or Cas12; about 3 pg / pl gRNA; about 1-40 pg / pl amphiphilic peptide, in particular BAPC; about 1-15 pg / pl endosomal escape reagent, in particular saponin.

[0110] In a particular embodiment of the present invention, the method, uses or the combination comprises: about 50 pg / pl Cas nuclease, in particular Cas9 or Cas12; about 10 pg / pl gRNA; about 10-25 pg / pl, amphiphilic peptide, in particular BAPC; about 1-10 pg / pl endosomal escape reagent, in particular saponin.

[0111] In some embodiments, the gRNA, in particular crRNA part of gRNA as defined herein can target various genes. Non-limiting examples of genes that can be targeted include but are not limited to: Phytoene desaturase (PD), CYP384A1 (CYP), Antennapedia (ANTP), Chitin synthase 1 (CHS), SLC25A38 orthologue (SLC), White, White-like, and kynurenine monooxygenase (KMO).

[0112] Non-limiting examples of nucleotide sequences that can be used as target sequences in the gRNA of the invention include but are not limited to: SEQ ID NOs 1-10 or SEQ ID NO: 32. In some embodiments, the gRNA of the invention comprises the nucleic acid sequence SEQ ID NO: 1-10, 32.

[0113] In some embodiments, one of the two complementary stretches of nucleotides of the single-molecule DNA-targeting RNA (or the DNA encoding the stretch) is at least about 60% identical to one of the targeted-RNA (crRNA) sequences set forth in SEQ ID NOs:1-10, 32 over a stretch of at least 8 contiguous nucleotides. For example, one of the two complementary stretches of nucleotides of the single-molecule DNA-targeting RNA (or the DNA encoding the stretch) is at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical or 100 % identical to one of the crRNA sequences set forth in SEQ ID NOs:1- 10, 32 over a stretch of at least 8 contiguous nucleotides. Further components to be used in the method or composition according to the invention are surfactants, such as Triton X-100, Tween 20 or CHAPS; water; or a buffering agent. Non-limitative examples can be normal water, pure water, ultrapure water, nuclease free water, or primary grade water. Buffered solutions are known in the art and include for example tris(hydroxymethyl)aminomethane (Tris), TAPS ([tris(hydroxymethyl)methylamino]propanesulfonic acid), or HEPES (4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid), phosphate buffer.

[0114] In the context of the present invention, the term ‘buffering agent’ or ‘buffer agent’ is to be understood as a weak acid or base used to maintain the acidity (pH) of a solution near a chosen value after the addition of another acid or base. Hence, the function of a buffer agent is to prevent a rapid change in pH when acids or bases are added to the solution. Accordingly, using at least one buffering agent, the pH of said composition or combination is roughly constant meaning that the pH shows little variation such as + / - 10% or less, preferably + / -5% or less, more preferably + / - 1 % or less, and still more preferably + / -0.1 % or less of and from the specified pH value. In a specific embodiment, the buffering agent is a TE buffer, including the components Tris, a common pH buffer (e.g. HCL), and EDTA. Further buffers are LB buffer (lithium borate buffer), TAE buffer (Tris base, acetic acid and EDTA). and TBE buffer (Tris base, boric acid and EDTA).

[0115] In a further aspect, the present invention provides the use of a combination as provided herein in a method for gene editing, in vitro or in vivo, more specific in the production of a genetically modified organism, including tissues and cells thereof. The present invention also provides a method for modifying genes in various cells and tissues. It has been shown that transformation efficiency can be increased by administering or injecting the combination according to the invention.

[0116] Methods for producing genetically modified animals are known in the art, and generally begin with a method of cell transfection. The genetically modified animal is particularly suitable to serve as a screening or disease model but may also be useful in applications outside of this field. These may include food or feed production through expression of, for instance, higher protein, carbohydrate, nutrient or vitamins levels than would normally be seen in the wildtype.

[0117] In one embodiment, the organism is selected from the group consisting of: an archaea, a bacterium, a eukaryotic single-cell organism, an algae, an animal, an invertebrate, a fly, a worm, or a cnidarian. In another embodiment, the organism is a genetically modified animal, in particular a genetically modified invertebrate animal. In this regard, especially arthropods (e.g. arachnida including mites, ticks, spiders; insects and Crustacea), mollusks, annelids, platyhelminthes, nematodes, echinoderms, Porifera and / or Cnidaria are preferred.

[0118] In a particular embodiment, the present invention provides the method or the use of a combination in the production of a non-human genetically modified organism as defined herein above. More specific, the invention provides the use of a combination in the production of genetically-modified offspring in a non-human female organism. As used herein, offspring are the young creation of living organisms, produced either by a single organism or, in the case of sexual reproduction, two organisms. Collective offspring may be known as a brood or progeny in a more general way. In some embodiments, the use of a combination for genome engineering is provided, provided that the use does not comprise a process for modifying the germ line genetic identity of human beings, and provided that the use is not a method for treatment of the human or animal body by surgery or therapy.

[0119] In some embodiments, the invention provides a method of modifying a target DNA, the method comprising contacting the target DNA with a combination according to the invention, wherein said contacting is in vitro or in a cell ex vivo, and wherein the target DNA is present in an archaea, a bacterium, a eukaryotic single-cell organism, an algae, an animal, an invertebrate, a fly, a worm, or a cnidarian. In particular, target DNA may be present in arthropods (e.g. arachnida including mites, ticks, spiders; insects and Crustacea), mollusks, annelids, platyhelminthes, nematodes, echinoderms, Porifera and / or Cnidaria.

[0120] As used herein, modifying a target DNA includes cleavage of the target DNA, introducing a mutation or deletion of one or more nucleic acids in the target DNA, or introducing an insertion of one or more nucleic acids in the target DNA.

[0121] In the context of the present invention, the term “genetically modified organism” is to be understood as an organism in which one or more changes have been made to the genome sequence, typically using high-tech genetic engineering such as CRISPR-Cas9, in an attempt to alter the traits or characteristics of said target organism. In the case of CRISPR, the Cas nuclease opens both strands of the targeted sequence of DNA to introduce the modification by:

[0122] (i) knock-in mutations, facilitated via homology directed repair (HDR) which is the traditional pathway of targeted genomic editing approaches. This allows for the introduction of targeted DNA damage and repair. HDR employs the use of similar DNA sequences to drive the repair of the break via the incorporation of exogenous DNA to function as the repair template;

[0123] (ii) knock-out mutations caused by CRISPR-Cas result from the repair of the double-stranded break by means of non-homologous end joining (NHEJ) or POLQZ polymerase theta-mediated end-joining (TMEJ). These end-joining pathways can often result in random deletions or insertions at the repair site, which may disrupt or alter gene functionality.

[0124] These genomic manipulations often produce physical traits in organisms that are normally absent.

[0125] In a specific embodiment, the present invention provides the use of the combination provided herein wherein the genetically modified organism is produced by in vivo knock-in and / or gene knock-out engineering.

[0126] A nucleic acid may be introduced in a manner such that the nucleic acid is able to enter a cell(s), e.g., via an in vivo or ex vivo protocol. By "in vivo" it is meant in the nucleic acid is administered to a living body of an organism. By "ex vivo" it is meant that cells or explants are modified outside of the organism, and then such cells or organs are regenerated to an organism.

[0127] In another embodiment, the present invention provides the use of a combination as provided herein wherein cells can be transfected by in vitro knock-in and / or gene knock-out engineering. In some embodiments, the combination according to the invention is administered through injection.

[0128] In a preferred embodiment, the combination according to the invention is injected in an organism, in particular in the body cavity (e.g. abdomen, thorax, dorsal cavity), preferably near or in the ovaries of said organism. The combination can be injected in an organism’s body cavity, such as the ovary cavity in order to deliver the RNP complex to the germline cells hence creating mutated offspring. Injection can be done by any means known to the skilled person, e.g. by using a needle or microinjector. When injecting mites, injections are in particular done ventrally in the body cavity near the third pair of legs. Thrips can be injected in the middle of the ventral side of the abdomen.

[0129] In yet a specific embodiment, the present invention provides the use of a combination of the invention wherein the combination is injected in the ovaries of an organism, in particular invertebrates, more in particular arthropods, mollusks, annelids, platyhelminthes, nematodes, echinoderms, Porifera and / or Cnidaria.

[0130] In a further embodiment, the present invention provides the use of a combination wherein the combination is injected in a body cavity, preferably in the ovary cavity of arthropods in particular chelicerates, Pancrustaceans and / or myriapods.

[0131] Non-limiting examples of arthropods for which the combination according to the invention is particularly suitable are Prostigmata such as Tetranychus urticae, Tetranychus kanzawai, Panonychus ulmi, Panonychus citri, Mesostigmata such as Amblyseius swirskii, Phytoseiulus persimilis, Thysanoptera such as Frankliniella occidentalis, Diptera such as Anopheles gambiae, Hemiptera such as Bemisia tabaci and Nezara viridula.

[0132] In a further aspect, the invention provides a combination comprising one or more amphiphilic peptide(s), preferably BAPC, one or more endosomal escape reagent(s), preferably saponin, and one or more ribonucleoprotein (RNP) complexes wherein said RNP comprises a Cas RNA-guided nuclease associated with a guide RNA (gRNA) for use in in CRISPR / Cas gene editing.

[0133] In a particular embodiment, the treatment, use or method of the invention is applied one time, preferably more than one time on the same organism or cell, i.e. at least two, three, four or more times.

[0134] In one aspect, the present invention provides a combination for use in the production of genetically modified screening models or organisms with more extensive genetic modifications. In a particular embodiment, the combination according to the invention can be used for organism genome engineering including several specific applications: (i) the inactivation or alteration of genes in model organisms in order to elucidate the functions of these genes; (ii) the production of organism models of human disease to study disease progression in a controlled manner and evaluate potential therapies; (iii) and the use of genetically modified organisms for industrial, pharmaceutical, and biotechnological production. Genetic modification of animals is particularly relevant for translating into products for the agricultural and pharmaceutical industries. EXAMPLES

[0135] The invention will now be illustrated by means of the following examples. It will be understood by those skilled in the art that various changes and modifications can be easily made without departing from the technical spirit or essential features of the present invention. Therefore, it is to be understood that the below-described examples are illustrative in all aspects and do not limit the scope of the invention in any way.

[0136] Materials

[0137] Table 1 : Compounds used in injection mixes to evaluate their effect on CRISPR / Cas9 editing.

[0138] Name Supplier Catalogue reference

[0139] ‘Recombinant Streptococcus pyogenes Cas9 or Cas12 protein containing three nuclear localization sequences (NLS) was purchased from Integrated DNA Technologies (Leuven, Belgium) at a custom concentration of 50 pg / pl. “The single guide RNAs (sgRNAs) consist of the 20 nt guide sequence and a 80-mer “Synthego scaffold” with 2’-O-methyl analogs and 3’ phosphorothioate internucleotide linkages at the first three 5’ and 3’ terminal RNA residues. The sgRNAs were dissolved in provided TE buffer and concentrations were determined using a Denovix DS-11 FX spectrophotometer.

[0140] Table 2: Insect and mite species used for experiments.

[0141] Order Species Table 3: sgRNA target sequences used.

[0142] Species Target gene sgRNA name Target sequence (5’ 3’)

[0143] * crPD is a crRNA and is used in combination with Cas12, while the sgRNAs are used in combination with Cas9

[0144] Table 4: Equipment used for injection. Methods

[0145] 1. Insect and mite rearing

[0146] The London strain of the spider mite Tetranychus urticae is a wild type (WT) outbred reference laboratory strain whose complete genome was Sanger sequenced in 201 1 (Grbic et al., 201 1). All knockout injection experiments were performed with mites from this strain. The ALB-NL strain used in complementation tests was previously described (Bryon et al., 2017). For the knock-in of the etoxazole resistance mutation in CHS1 , strain GSS (German susceptible strain) was used (Stumpf et al., 2001). All strains were maintained on Phaseolus vulgaris cv. “Prelude” at room temperature with 16:8 (light:dark) photoperiod. In order to have mites of similar age in the experiments, adult females were placed on a bean leaf and allowed to lay eggs for 24h after which they were removed. The bean leaves were kept in climate chambers at 26 °C, 60% relative humidity (RH- and 16:8 light:dark (L:D) photoperiod. After 8 days, deutonymph females were transferred to a new bean leaf without males (for most experiments requiring virgin females) orwith males (forthe experiment requiring fertilized females). T. urticae is a haplodiploid species meaning males develop from unfertilized eggs and are haploid whereas females develop from fertilized eggs and are diploid. Haploid eggs are preferred as recessive trait are visible in the phenotype. Females were kept in the incubator until used for injection experiments (3-4 days in adult stage). After experiments mites were also kept in the incubators under the same conditions.

[0147] Frankliniella occidentalis is a thrips species that reproduces via arrhenotoky and was reared in containers with green bean pods in climate chambers at 25°C, 65% R.H., and 16:8 (light:dark) photoperiod. Trips were synchronized for experiments by allowing females to lay eggs for 24 hours, after which they were removed. After 11 days, virgin female that hatched from these eggs, but that were still in the pupal stage, were collected and transferred to bean leaves placed on wet cotton until they reached the adult stage. Injections were performed on 16 days old females. After injecting, insects were again moved to bean leaves and kept in the climate chamber. Pollen (Nutrimite™, Biobest) was added as source of protein.

[0148] The predatory mite Amblyseius swirskii was reared on detached bean leaves in climate chambers at 25°C, 65% R.H., and photoperiod of 16 L:8 D. Typha pollen (Nutrimite™, Biobest) was used to feed the mites every two days. Few cotton fibers were placed on the leaves to serve as an oviposition substrate. Although males of A. swirskii are haploid, females only lay eggs after mating and in some embryos the paternal chromosomes are eliminated after fertilization, generating haploid males. Therefore, mated females (2-3 days in adult stage) were injected.

[0149] Anopheles gambiae mosquitoes were maintained at 26°C and 70% RH under a 12:12 L:D photoperiod. All stages of larvae were fed on ground fish food (Tetramin tropical flakes, Tetra, Blacksburg, VA, USA) and adults were provided with 10% sucrose solution ad libitum. 24 hours before injections, mosquitos were blood fed with blood supply (50,50 mix of human research red cells and plasma, NHS blood and transplant service) using a Hemotek membrane feeding system.

[0150] Bemisia tabaci, a whitefly species that is a thriving pest worldwide in tropical and subtropical climates, was reared on tabaco plants in climate chambers at 25°C, 65% R.H., and photoperiod of 16 L:8 D. Eggs were synchronized and whiteflies were injected with the CRISPR / Cas9 formulation 1-2 days post adult emergence.

[0151] 2. Evaluation of various compounds on CRISPR / Cas9 knock-out efficiency in T. urticae

[0152] The phytoene desaturase (PD) gene was used as target gene since knock-out mutations in this gene result in pigment defects and loss of red pigment in the eyes and legs (henceforth referred to as “albinism”), a phenotype which can be visually observed (Dermauw et al. 2020). CRISPR / Cas9 Ribonucleoprotein particles (RNPs) were prepared by mixing 1.5 pl of Cas9 nuclease (50 pg / pl) with 1.5 pl of sgPD1 and 1.5 pl of sgPD2 (both 4 pg / pl). The mixture was incubated for 10 min at room temperature. After incubation, about 0.5 pl of variable compounds were added (individually or in mixture as indicated in Table 4). For the formulations that contain BAPC (BAPtofect-25; either alone or in mixture), an incubation of 30 min on ice was done after adding all compounds. Finally, the injection mix was centrifuged at 4 °C for 10 min at 20,000 g and kept on ice until used for injection.

[0153] Table 4: Overview of different compounds added to the Cas9 RNP mix with sgPD1 and sgPD2 (4 pg / pl each).

[0154] Between 300-400 virgin females that reached adulthood three to four days before, were aligned on Allura red stained 2% agarose gel platforms with their dorsal side in contact with the agar. These platforms were made by adding two glass microscope slides (26 x 76 mm, 1.1 mm thick), attached to each other by double-sided tape, into a Petri dish immediately after pouring the agar plates. After solidification, the gels were cut to form a staircase like platform. Females were then injected using a Nanoject III microinjector (Drummond Scientific) and needles made out of 3-000-203-G / X Glass Capillaries (Drummond Scientific). Needles were pulled using a P-1000 Micropipette Puller (Sutter Instruments) with following settings: “heat: 500, pull: 60, velocity: 70, delay: 200, pressure: 500, Ramp: 490” and were sharpened with a BV-10 Micropipette Beveler (Sutter Instruments). Injections were done under a Leica S8 APO microscope (Leica). Each female was injected with 3 nl of RNP mix ventrally in the body cavity near the third pair of legs. After injecting, mites were placed on detached bean leaves (on wet cotton in Petri dishes) and allowed to lay eggs. The females were transferred to a new bean leaf every 24h and were removed 72h after injection. All treatments were independently replicated 3 times.

[0155] Based on the results of the formulations, further optimization of the injection mix was done by using only the most efficient sgRNA (sgPD2) and surfactants such as Triton X-100, Tween 20 and CHAPS were tested in combination with BAPC. The dose of surfactant to be added was determined by preliminary experiments where a range of concentrations (with 2-fold increase between each concentration) of each compound was injected in females (50 females per concentration). Survival and fecundity were evaluated and the highest concentration where females were still able to produce offspring was selected for each surfactant. Hence 1.5 pl of Cas9 nuclease (50 pg / pl) was mixed with 3 pl of sgPD2 (10 pg / pl) and incubated at room temperature. After 10 min, BAPC was added with one of the examined saponins or surfactants (Table 5). The CRISPR / Cas9 mix was incubated, centrifuged and injected in 300-400 virgin females as described earlier. To investigate the effect of the used BAPC concentration on the KO frequency, three injection mixes were prepared using the “BAPC+ Quillaja saponin” formulation, but with a BAPC stock concentration of 2, 10 or 50 pg / pl. With each mix, 100 virgin females were injected. After injection, mites were allowed to lay eggs on bean leaves for a total of 48h (with a transfer to a new leaf after 24h). The experiment was independently repeated 3 times. Finally, the “BAPC+ Quillaja saponin ” formulation was also evaluated with half the dose of Cas9 RNPs. 200 virgin females were injected with this mix once and mites were allowed to lay eggs on bean leaves for a total of 48h (with a transfer to a new leaf after 24h).

[0156] Table 5: Overview of saponins and various surfactants added to the Cas9 RNP mix (1.5 pl of 50 pg / pl Cas9 + 3 pl of 10 pg / pl sgPD2).

[0157] 3. Screening and analysis of T. urticae mutants

[0158] Male haploid progeny of injected mothers were visually screened for albinism in all experiments. For the first experiments where both sgPD1 and sgPD2 were used, individuals showing a mutant phenotype were placed on individual leaf discs and crossed with virgin females of the ALB-NL line containing a known mutation in the PD gene (= complementation test). The female offspring of this cross was screened for albinism since they will also have the mutant phenotype if the albinism in the male father was caused by a KO mutation in PD. Two to four days after the cross to the ALB-NL strain, males that were still alive were individually crushed in 18 pl STE buffer (100 mM NaCI, 10 mM Tris-HCI, 1 mM EDTA, pH 8) and 2 pl proteinase K (10 mg / ml). This crude extract was incubated at 37°C for 30 min followed by proteinase K deactivation at 98°C for 10 min. A PCR was performed on these raw DNA extracts amplifying a 535 bp region containing the two sgRNA targeting sites using the GoTaq® G2 DNA Polymerase and the “phytoene desaturase sg1 +2” primer pair (Table 6). The temperature profile consisted out of a 2 min denaturation step at 92°C followed by a touch-down of 5 cycles with denaturation at 92 °C for 30 s, annealing at 60 °C-1 °C / cycle for 30 s and elongation at 72 °C for 1 min. Next, 37 cycles of 30s at 92°C, 30s at 55°C and 1 min at 72°C were performed. After a final elongation of 72 °C for 5 min, a quality check was performed by running 5 pl of PCR product in a 2% agarose gel for 30 min at 100 V. The remaining PCR product was purified using an EZNA® Cycle Pure Kit (Omega Bio-Tek). Purified PCR template was sent to LGC genomics for Sanger sequencing. For the experiment evaluating efficiency in diploid eggs, F2 sons emerging from F1 albino females were also analyzed using the PCR and Sanger sequencing protocol, but were not crossed to ALB-NL. Based on these results it was clear the loss of eye coloration was a reliable phenotypic marker to score KO efficiencies. Hence, for the remaining PD KO experiments, mutants were no longer crossed to ALB-NL or send for Sanger sequencing, but were considered KO mutants based on phenotype.

[0159] Table 6: Primers used for amplification of sgRNA target regions.

[0160] SEQ

[0161] Product name Primer names & sequences (5’ to 3’)* ID NO Tm(°C) Amplicon phytoene desaturase F: GACACACTCTGCCAACACAA 11 59.1

[0162] 525 bp

[0163] R: GGACGAGTGGAATGAAGATACC 12 58.8

[0164] F: ATGGACATCGATGGGACCAA 13 59.5 2 bp

[0165] R : CTGTACGGACCAGGACTATC 14 60.5

[0166] F: CATGATACCACGGCTACCAC 15 57.7 4 bp R: TGTCCCAATGCAGCTTCTTG 16 58.3

[0167] F: ACCTGCACCTGATGACAATTC 17 59.0

[0168] ANTP t t it 8 bp

[0169] R: ACCCGATACTTGTAGCATGTG 18 58.2

[0170] F: TGCACTACTCATGATGGCTGT 19 59.0

[0171] 547 bp R: AGATCCTTTACGTCTGGGGC 20 58.7

[0172] A. swirskii SLC25A38 F: CTGGAGTGGGCATGTACTTC 21 58.8

[0173] 479 bp target site R: ATGTCGAACTGTTGGGAAGC 22 58.59

[0174] F: AAAATGTGACGCGGAAAGTG 23 57.6

[0175] F. occidentalis white 335 bp | R: TCCCCGCTGAAGACGTTC 24 59.4 .xF: TTGCGTACATGAGTTGAGCC 25 59.0 „„„

[0176] F. occidentalis white-like „ - 331 bp

[0177] R: ATTGCGGGTTGTCGATCTTC 26 59.0

[0178] F: GCACGGCAG I l l i GTCATCA 60.0

[0179] B. tabaci white 581 bp |

[0180] R: GGAAAAACGCCTTGTGAGCA 60.0

[0181] *“F” and “R” indicate primer sequences in the forward and reverse orientation, respectively.

[0182] 4. Effect of age of injected mothers on CRISPR KO efficiency

[0183] To evaluate whether the age of injected females has an effect on the KO frequency in the offspring. The “BAPC+ Quillaja saponin” formulation was injected in virgin adult females who had reached adulthood for 1 day, 4 days and 7 days. The experiment was performed three times independently with 100 females of each age group injected in every replicate. After injection, mites were allowed to lay eggs on bean leaves for a total of 48h (with a transfer to a new leaf after 24h). For each age group, the offspring was counted and the percentage KO was calculated based on screening for the phenotype.

[0184] 5. Validation of efficiency in diploids

[0185] In order to see the effect of the formulation in diploid mites, injections were performed in fertilized females. For all replicates, 200-300 females (that were not separated from the males before reaching the adult stage) were each injected with 3 nl of “BAPC+ Quillaja saponin” formulation. As a control, 100 virgin females were also injected with the same mixture. Females were allowed to lay eggs for a total of 72 h (being transferred to a new leaf every 24h). Later, the deutonymph female offspring was screened for the presence of the phenotype. Each F1 albino female was transferred to a single leaf disc and allowed to reach the adult stage. About 2 weeks later 3 to 12 F2 males were collected per F1 albino

[0186] RECTIFIED SHEET (RULE 91) ISA / EP mother and the PD gene was analyzed as described earlier for each individual son. This experiment was repeated 3 times independently.

[0187] 6. Other target genes in T. urticae: CYP384A1 and ANTP

[0188] Two other target genes were selected to investigate whether high KO frequencies can also be obtained for other genes than phytoene desaturase. The first gene, CYP384A1 (tetur38g00650), is also involved in spider mite pigmentation. Disruption of this gene results in a phenotype referred to as “lemon” (Wybouw et al., 2019). The second gene, Homeobox protein antennapedia type or ANTP (tetur20g02430) is a Hox gene that was shown to be involved in the leg development of spiders (Khadjeh et al., 2012). For each target gene, 100-200 virgin-females were injected per replicate using the “BAPC+ Quillaja saponin” formulation with sgCYP for CYP384A1 or sgANTP for the ANTP gene. Offspring was screened for mutant phenotypes (mites displaying a more yellow coloration in case o CYP3841 mutants and mites having aberrant number of legs (instead of the canonical four pairs of legs) in case of ANTP mutants and mutants were analyzed by sequencing as described earlier using primer pairs “CYP384A1 target site” and “ANTP target site” (Table ) for CYP384A1 and ANTP mutant samples respectively. For each target site, the experiment was repeated 3 times independently.

[0189] 7. Obtained efficiency using Cas12

[0190] Since the usage of other Cas protein can offer flexibility in CRISPR applications, the use of another common and commercially available Cas enzyme, Cas12, was tested. The PD gene was again selected as target and the required crRNA was designed, “crPD” (Table 3). A combination of 1.5 pl Cas12 (50pg / pl) and 3 pl crPD (4 pg / pl) was mixed with the BAPC+ Quillaja saponin and injected in virgin mothers. Resulting offspring was screened and albino sons were analyzed by sanger sequencing as described earlier using primer pair “phytoene desaturase Cas12” (Table 6). The experiment was repeated 3 times independently.

[0191] 8. Precise gene editing and Knock-In (KI) of chitin synthase resistance mutations using homology directed repair

[0192] Next to random mutations from DNA breaks caused by Cas9 cleavage, specific mutations can be introduced by using the homology directed repair (HDR) pathway. To demonstrate this, a single nucleotide polymorphism (SNP) was introduced in the chitin synthase 1 (CHS1) gene that is known to cause extreme resistance towards the acaricide etoxazole. The SNP is a replacement of adenine to thymine at position 3049 in the CHS1 coding sequence resulting in the substitution of isoleucine by phenylalanine at position 1017 in the chitin synthase protein. A single-stranded oligo DNA nucleotide (ssODN) of 192 bp containing the SNP along with several silent mutations that disrupted the target site of the sgRNA, preventing further Cas9 cleavage upon HDR of the CHS1 gene, was ordered from IDT. The silent mutations also served as a control for false positives as the SNP at position 3049 is a common mutation and might appear in the population by chance. A mixture of 1.8 pl Cas9 (50 pg / pl), 1.8 pl sgCHS (20 pg / pl), 0.5 pl BAPC, 0.5 pl ssODN (60 pg / pl) and 0.2 pl saponin (7.5 pg / pl) was injected in 400 virgin females (3nl per female). After injection, mites were allowed to lay eggs on bean leaves for a total of 48h (with a transfer to a new leaf after 24 h) . After three days, eggs were sprayed with 1 10 mg a.i. / L etoxazole. Five days later, the bean leaves were screened and survivors were analyzed by sequencing as described earlier, but using primer pair “CHS1 target site” (Table ).

[0193] 9. Evaluating the method in other arthropods

[0194] To test whether the BAPC and saponin based CRISPR / Cas9 formulation is also successful in transforming other arthropods, knock-out experiments were performed in Frankliniella occidentalis using “sgWhite” and “sgWhite-like”, Anopheles gambiae using “sgKMO”, Amblyseius swirskii using “sgSLC” and Bemisia tabaci using “sgWhite-BT” (see Table 3 for target sequences). For F. occidentalis, 100 to 200 virgin females were placed on double sided tape with their dorsal side and injected in the middle of the ventral side of the abdomen with 5 nl of CRISPR / Cas9 mix (Table ) per female. Injections were performed 3 times independently for “sgWhite” and once for “sgWhite-like”. After injecting, thrips females were placed on bean leaf discs and allowed to lay eggs for a total of 48 h (being transferred to a new leaf after 24h). Eight days after injecting, the male offspring was screened for a divergent phenotype (Mackenzie et al., 1999). Analysis of mutants (DNA extraction, PCR, purification and sequencing) was performed as described for T. urticae, but using the “F. occidentalis White” and “F. occidentalis Whitelike” primer pair (Table ) for injections targeting the White and White-like gene respectively. For A. gambiae, 86 females were anesthetized with CO2 injected 24 hours after being blood fed. Each female was injected with 128 nl of CRISPR / Cas9 mix (Table 7). 48h after injections females were left to lay eggs, progeny was reared to the pupal stage and screened for changes in the eye color. Some of the mutant males and females were intercrossed to investigate whether the germline cells were also edited and six mutants were sent for Sanger sequencing. For A. swirskii, 300 mites were immobilized on double sided tape and injected with 5 nl of CRISPR / Cas9 mix (Table ). Mites were allowed to lay eggs for a total of 72 h (being transferred to a new leaf after 24h) and progeny was screened for divergent phenotypes and mutants were analyzed as done for T. urticae and F. occidentalis, but using primer pair “A. swirskii SLC25A38 target site”. The A. swirskii CRISPR / Cas9 experiment was repeated 5 times. For B. tabaci, about 100 females were immobilized on agarose gel and injected with 3 nl of CRISPR / Cas9 mix (Table ). The injected whiteflies were then allowed to lay eggs for a total of 48 h (being transferred to a new leaf after 24h). Resulting offspring was screened for divergent phenotypes and mutants were analyzed as done for T. urticae and F. occidentalis, but using primer pair " B. tabaci white”. Injections were repeated 3 times.

[0195] Table 7: Injection mix composition for F. occidentalis, A. gambiae and A. swirskii. C (concentration), V (volume). Results

[0196] 1. Evaluation of various compounds on CRISPR / Cas9 and Cas12 knock-out efficiency in T. urticae

[0197] Different adjuvants such as chloroquine, saponin, lipofectamine and BAPC were added to the Cas9 RNP targeting the phytoene desaturase gene of T. urticae attempting to increase the low transformation efficiency. After injecting the CRISPR / Cas9 mix in the ovary of virgin female spider mites, the transformation efficiency was scored as the percentage of the total offspring showing an albino phenotype (Fig. 1). A single adjuvant was not able to significantly increase the transformation efficiency (<1 % offspring showing albinism). However, in one treatment a strong synergistic effect was observed between BAPC and saponin, reaching editing efficiencies of 5-6% in the eggs deposited within 48h after injection (Fig. 1A). All 66 albino males found in over the three replicates of this treatment were crossed to virgin females of the ALB-NL strain. 54 of them successfully mated and produced albino daughters, indicating a disruption of the PD gene is responsible for the observed phenotype. In addition, for a total of 90 albino samples (over all treatments) Sanger sequencing data was obtained confirming KO events (deletions or insertions) at the target site. In the first part of this experiment both sgPD1 and sgPD2 were used. However, as mutations were rarely observed in the sgPD1 target region (data not shown) we only used sgPD2 in all further experiments.

[0198] Using the “BAPC+ saponin” formulation and sgPD2 at a higher concentration (10 pg / pl), KO efficiencies were up to 20%. In addition, the concentration of BAPC added to the injection mix was decreased and increased 5-fold to see the effect on the KO efficiency. Even when the BAPC stock concentration was decreased to 2 pg / pl the high KO frequencies were maintained. On the other hand, increasing the BAPC stock concentration to 50 pg / pl did not increase transformation efficiency (Fig. 1 B). In addition, to validate whether the high efficiencies could also be obtained for other genes, two other target genes were selected: CYP384A1 (tetur38g00650) a pigment related gene and ANTP (tetur20g02430) a Hox gene involved in leg development. Again KO efficiencies between 10 and 20% could be observed (Fig. 1 C). Finally, an experiment was performed to evaluate whether these high transformation efficiencies could be obtained using Cas12, another commonly used Cas protein. Within the offspring produced within 24h after injection, 5.20%, 10.21 % and 7.53% were KO mutants while in the offspring produced 24-48h after injection 7.82%, 8.87% and 8.6% were KO mutants in the three replicates respectively.

[0199] 2. Effect of age and fertilization of mothers on KO efficiency

[0200] In some cases the age of the injected females can be crucial to obtain efficient KO results, for example in the case for Tribolium castaneum and Blattella germanica. To evaluate whether the age of injected females also has an effect on the KO frequency in T. urticae using the formulated mix, females who had reached adulthood for 1 day, 4.days and 7 days were injected with “BAPC+ saponin” formulation. There was no effect of age on KO efficiency (Fig. 2). The potential of the formulation to transform diploid eggs was evaluated by injecting fertilized females. Although a lower KO frequency was observed in the female offspring, a moderate transformation rate (+ / - 5 %) was still observed (Fig. 2). The lower efficiency was expected as in diploids both copies of the phytoene desaturase gene have to be knocked-out in order to obtain an albino phenotype, which inherits recessively.

[0201] 3. Precise gene editing of chitin synthase using homology directed repair

[0202] In addition to knock-outs, the CRISPR / Cas9 technology can be used to introduce specific mutations in the DNA. However, this is more challenging as a DNA repair template (“Repair template” in Figure 3) containing the desired mutation has to be present at the DNA breakage position in order to be used by the DNA HDR repair mechanisms. To demonstrate that the “BAPC+ saponin” formulation can be used to introduce precise mutations, the adenine at position 3049 in the coding sequence of CHS1 was successfully changed to a thymine resulting in etoxazole resistance. In addition, the silent control mutations were also integrated in the CHS1 coding sequence.

[0203] 4. Evaluating the method in other arthropods

[0204] Attempts to transform F. occidentalis, an arthropod species that has never been genetically transformed before, were very successful using the “BAPC+ saponin” formulation. Targeting the White and Whitelike gene, very high KO efficiencies up to 26% and 32% were obtained for White and White-like respectively (Fig. 4). Sanger sequencing data was obtained for 57 White and 9 White-like mutants all confirming KO deletions at the target site. Further, although we only performed one replicate, an editing efficiency of 11 .8% was observed forthe KMO gene in A. gambiae (Fig. 4). For B. tabaci, KO efficiencies ranging from 20 to 39% were observed (Fig. 4).

[0205] For A. swirskii, a KO was obtained in the orthologous gene of SLC25A38 from T. urticae, a mitochondrial glycine transporter gene suspected to be involved in pigmentation in spider mites (Huo et al., 2021) . One mutant (of the 32 mites produced within the first 24 hours after injection, KO = 3.12 %) was found in one of the five replicates and Sanger sequencing revealed a deletion in the gene at the position targeted by the sgRNA.

[0206] REFERENCES

[0207] Bryon, A., Kurlovs, A.H., Dermauw, W., Greenhalgh, R., Riga, M., Grbic, M., Tirry, L., Osakabe, M., Vontas, J., Clark, R.M., Van Leeuwen, T., 2017. Disruption of a horizontally transferred phytoene desaturase abolishes carotenoid accumulation and diapause in Tetranychus urticae. Proceedings of the National Academy of Sciences of the United States of America 114, E5871- E5880. https: / / doi.org / 10.1073 / pnas.1706865114

[0208] Huo, S.-M., Zhang, Y.-Y., Song, Z.-R., Xiong, X.-H., Hong, X.-Y., 2021 . The potential pigmentation- related genes in spider mites revealed by comparative transcriptomes of the red form of Tetranychus urticae. Insect Molecular Biology 30, 580-593. https: / / doi.org / 10.11 11 / imb.12727 Khadjeh, S., Turetzek, N., Pechmann, M., Schwager, E.E., Wimmer, E.A., Damen, W.G.M., Prpic, N.- M., 2012. Divergent role of the Hox gene Antennapedia in spiders is responsible for the convergent evolution of abdominal limb repression. Proceedings of the National Academy of Sciences 109, 4921-4926. https: / / doi.org / 10.1073 / pnas.1116421109

[0209] Mackenzie, S.M., Brooker, M.R., Gill, T.R., Cox, G.B., Howells, A.J., Ewart, G.D., 1999. Mutations in the white gene of Drosophila melanogaster affecting ABC transporters that determine eye colouration. Biochimica et Biophysica Acta (BBA) - Biomembranes 1419, 173-185. https: / / doi.Org / 10.1016 / 50005-2736(99)00064-4

[0210] Stumpf, N., Zebitz, C.P.W., Kraus, W., Moores, G.D., Nauen, R., 2001 . Resistance to Organophosphates and Biochemical Genotyping of Acetylcholinesterases in Tetranychus urticae (Acari: Tetranychidae). Pesticide Biochemistry and Physiology 69, 131-142. https: / / d0i.0rg / l 0.1006 / pest.2000.2516

[0211] Wybouw, N., Kurlovs, A.H., Greenhalgh, R., Bryon, A., Kosterlitz, O., Manabe, Y., Osakabe, M., Vontas, J., Clark, R.M., Van Leeuwen, T., 2019. Convergent evolution of cytochrome P450s underlies independent origins of keto-carotenoid pigmentation in animals. Proceedings of the Royal Society B: Biological Sciences 286, 20191039-20191039. https: / / d0i.0rg / l 0.1098 / rspb.2019.1039

Claims

CLAIMS1 . A combination comprising one or more cationic nanoparticles, one or more endosomal escape reagent(s), and one or more ribonucleoprotein (RNP) complexes wherein said RNP comprises a Cas RNA-guided nuclease associated with a guide RNA (gRNA), and wherein said cationic nanoparticle is a nanoparticle formed by assembly of amphiphilic compounds selected from the list comprising: peptides, lipids or surfactants, or a mixture thereof.

2. A combination according to claim 1 , wherein said cationic nanoparticle is a Branched Amphiphilic Peptide Capsule (BAPC), an Amphiphilic Peptide Capsule (APC), a Corralling Amphipathic Peptide Colloids (CAPC) or a derivative thereof.

3. A combination according to any one of claim 1-2, wherein said endosomal escape reagent is selected from the list comprising: saponin, L-leucyl- L-leucine O-methyl ester, UNC7938, amantadine, ammonium chloride, amphotericin B, bafilomycin A, a derivative of any of the foregoing or any combination thereof, in particular saponin or a derivative thereof.

4. A combination according to any one of claim 1-3, wherein said Cas RNA guided nuclease is selected from the list comprising: Cas9, Cas12, Cas 12a-l, Cas 12k, SaCas9, High-Fidelity Cas9, eSpCas9, CasMINI, Cas13, Cas 13a, Cas13b, Cas13c, Cas13d; CasX, CasY, Cas3, Cas5, Cas 8a, Cas8b, Cas8c, Casi o, Cas10d, Cas4-Cas1-Cas2 Complex, or Cas 14a.

5. A combination according to any one of claim 1-4, wherein said Cas RNA-guided nuclease is CRISPR-associated protein 9 (Cas9) and / or CRISPR-associated protein 12 (Cas12), or a derivate thereof.

6. A combination according to any one of claim 1-5, wherein said gRNA is selected from the list comprising sgRNA, crRNAs, tracrRNAs, crtracrRNAs.

7. A combination according to any one of claim 1-6, wherein the mass ratio gRNA:cationic nanoparticle is about and between 1 :1 to about 100:1 , about and between 2;1 to about 80:1 , about and between 3:1 to about 60:1 , about and between 4:1 to about 40:1 , about and between 5:1 to about 30:1 , or about and between 6:1 to about 20:1 .

8. Use of a one or more cationic nanoparticles, one or more endosomal escape reagent(s), and one or more ribonucleoprotein (RNP) complexes in the production of a non-human genetically modified invertebrate, even more in particular an arthropod, mollusk, annelid, platyhelminth, nematode, echinoderm, Porifera and / or Cnidaria.

9. Use according to claim 8, wherein said one or more cationic nanoparticles, one or more endosomal escape reagent(s), and one or more ribonucleoprotein (RNP) complexes are injected into a female invertebrate.

10. Use according to claim 9, wherein said female invertebrate produces genetically modified offspring.

11. Use according to any one of claims 8-10, wherein said genetically modified invertebrate is produced by in vivo knock-in and / or gene knock-out engineering.

12. Use according to any one of claims 8-11 , wherein the invertebrate is an arthropod, in particular a chelicerate, Pancrustacean or myriapod.

13. A combination comprising a cationic nanoparticle; and an endosomal escape reagent, in particular saponin or a derivative thereof; for use in a Clustered regularly interspaced short palindromic repeats-CRISPR-associated enzyme (CRISPR-CAS) method, wherein said cationic nanoparticle is a nanoparticle formed by assembly of amphiphilic compounds selected from the list comprising: peptides, lipids, or surfactants, or a mixture thereof.

14. A combination according to claim 13, wherein said cationic nanoparticle is a BranchedAmphiphilic Peptide Capsule (BAPC), an Amphiphilic Peptide Capsule (APC), or a Corralling Amphipathic Peptide Colloids (CAPC).

15. A combination for use according to claim 13 or 14, for gene-editing of invertebrate animals, in particular arthropods.