Vector constructs for delivery of nucleic acids encoding uricase and methods of using the same
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- KRIYA THERAPEUTICS INC
- Filing Date
- 2024-07-10
- Publication Date
- 2026-05-20
AI Technical Summary
Current therapies for gout and chronic refractory gout, such as allopurinol and pegloticase, often result in treatment-limiting adverse effects and immunogenicity, failing to adequately lower serum uric acid levels and maintain hyperuricemia control.
The use of recombinant adeno-associated virus (rAAV) vectors carrying uricase expression cassettes, which include a promoter operably linked to nucleic acids encoding uricase proteins with or without signal peptides, for targeted delivery to cells, aiming to achieve sustained uric acid reduction and minimize immunogenicity.
The rAAV vector delivery method effectively reduces serum uric acid levels, decreases urate crystals, and reduces refractory gout episodes, offering a safer and more efficacious approach compared to existing treatments.
Smart Images

Figure IMGF000037_0001 
Figure IMGF000038_0001 
Figure IMGF000039_0001
Abstract
Description
VECTOR CONSTRUCTS FOR DELIVERY OF NUCLEIC ACIDS ENCODING URICASE AND METHODS OF USING THE SAMECROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims the priority benefit of U.S. Provisional Application No. 63 / 513,086 filed July 11, 2023, which is hereby incorporated by reference in its entirety.REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0002] The content of the electronically submitted sequence listing (Name: 4525_121PC01_SequenceListing_ST26.xml; Size: 320,316 bytes; and Date of Creation: July 10, 2024), filed with the application, is incorporated herein by reference in its entirety.FIELD OF DISCLOSURE
[0003] The present disclosure pertains to the medical field and gene delivery, including AAV gene therapy for treating gout, chronic refractory gout, and / or Harrison Syndrome.BACKGROUND
[0004] Gout, one of the most common inflammatory arthritis conditions in the United States, is characterized by the presence of hyperuricemia and the precipitation of monosodium urate crystals, leading to clinical features of acute inflammatory arthritis, articular erosions, tophi, and in some instance, uric acid renal stones and nephropathy (Guttmann A et al. Ther. Adv. Drug. Saf. 2017; 8(12):379-388). When uric acid levels and gout symptoms cannot be controlled with uric acid-lowering therapies, this is referred to as chronic refractory gout (Ali S and Lally EV. Med. Health RI. 2009; 92(11) :369-71). Tophi, a deposit of monosodium urate crystals, are pathgnomonic for gout. Chronic tophaceous gout is also known as Harrison Syndrome. Tophi form in the joints, cartilage, bones, and other places throughout the body, and may break through the skin and appear as white or yellowsish-white, chalky nodules (Angalla R et al. 2016; QJM. 2016;109(10):681 -682). Patients suffering from severe hyperuricemia may also have greateramounts of uric acid sediments in the renal collecting duct, renal pelvis, renal calices and the ureter of the kidney over a short period of time, leading to lumen blockage, unuresis and acute kidney failure (also called hyperuricemic nephropathy) (Hershfield M S. Cecil, Textbook of Medicine (20th), 1508-1515).
[0005] Uricases (also referred to as urate oxidases) are enzymes in the liver peroxisome of some non-human primates and other mammals which catalyze the oxidation of uric acid (e.g., solubility of about 11 mg / 100 mL water) to the more soluble allantoin (e.g., solubility of about 147 mg / 100 mL water), thereby allowing for more effective excretion by kidney (Wortmann R L, Kelley W N, Kelley's Textbook of Rheumatology (6 th), 2001 : 1339-1376). Humans do not naturally produce enzymatically active uricase, as a result of several mutations in the gene for uricase acquired during the evolution of higher primates (Wu, X, et al., (1992) J Mol Evol 34:78-84).
[0006] Allopurinol (an inhibitor of uric acid synthesis) is most commonly used in treating patients suffering from gouty deposition, kidney insufficiency, leukemia and some genetic diseases, wherein it can inhibit xanthine oxidase (Pacher P et al. Pharmacol. Rev. 2006; 58(1): 87-114). Inhibiting xanthine oxidase with allopurinol disables the transformation of hypoxanthine and xanthine into uric acid. In some gout patients, available drugs such as allopurinol frequently produce treatment-limiting adverse effects or do not relieve the symptoms of gout adequately (Hande, K R, et al., (1984) Am J Med 76:47-56 and Fam, A G, (1990) Bailliere's Clin Rheumatol 4: 177-192). Failed attempts to lower serum uric acid levels below the therapeutic threshold with oral urate-lowering therapies such as allopurinol and febuxostat can contribute to chronic refractory gout (Schlesinger N et al. BioDrugs. 2022; 36(2):95-103).
[0007] Injections of recombinant uricase have been used clinically to decrease hyperuricemia, at least transiently, in patients with chronic refractory gout. Recombinant preparations of uricase for human therapy, including uricase from the fungus Aspergillus flavus (e.g., Rasburicase (Elitek®)), have presented clinical challenges such as short circulating half-times and immunogenicity (Ali S and Lally EV. Med. Health RI. 2009; 92(11): 369-71). Certain uricases have been used to prepare conjugates with poly(ethylene glycol) (PEG), resulting in therapeutically efficacious forms of uricase having increased protein half-life and reduced immunogenicity compared to non-PEGylated forms (U.S. Pat. Nos. 4,179,337, 4,766,106, 4,847,325, and 6,576,235; U.S. Pat. Application Pub. US2003 / 0082786A1, each incorporated herein by reference in its entirety). Pegloticase(Krystexxa®) is a recombinant porcine-like uricase covalently conjugated to PEG in order to reduce immunogenicity and increase solubility and serum half-life. In randomized controlled trials, adverse infusion reactions following pegloticase administration were observed and associated with the presence of anti-pegloticase antibody titers. A distinguishing characteristic between responders and nonresponders to pegloticase therapy is the development of anti-pegloticase antibodies in the nonresponders, with the majority of the antibodies directed toward the PEG moiety of pegloticase (Lipsky PE et al. Arthritis Res. Ther. 2014; 16(2):R60). Anti-pegloticase antibodies are associated with a loss of pegloticase serum uric acid lowering effects, leading to the eventual discontinuation of pegloticase therapy.
[0008] The ICso and IC90 of pegloticase in humans are estimated at approximately 1.3 mU / mL and 12 mU / mL uricase activity, respectively (Yue, et al. "Population pharmacokinetic and pharmacodynamic analysis of pegloticase in subjects with hyperuricemia and treatment-failure gout." The Journal of Clinical Pharmacology 48.6 (2008): 708-718), assuming 12.5 mU / pg for pegloticase. And, the cMax of the approved pegloticase dose of 8 mg was reported as 8.1 to 21.4 mU / mL (Ganson et al. Control of hyperuricemia in subjects with refractory gout, and induction of antibody against poly(ethylene glycol) (PEG), in a phase I trial of subcutaneous PEGylated urate oxidase. Arthritis Res Ther 8, R12 (2005), doi.org / 10.1186 / arl861).
[0009] The reduction of uric acid and maintenance of hyperuricemia is a goal of therapeutic approaches to gout, chronic refractory gout and / or Harrison Syndrome. Existing therapies for most gout patients have a significant degree of treatment failure, immunogenicity, and persistence of refractory disease. Therefore, a need for safe and efficaceous therapeutic approaches exists.BRIEF SUMMARY
[0010] Certain aspects of the disclosure relate to polynucleotides (e.g., uricase expression cassettes) encoding a uricase protein; vectors (e.g., viral vectors) comprising the same; recombinant adeno-associated virus (rAAV) particles comprising the same; compositions comprising the same; and methods of using the same. In certain aspects, the uricase expression cassettes; vectors (e.g., viral vectors); recombinant adeno-associated virus (rAAV) particles; and / or compositions are designed for delivery of the polynucleotideencoding the uricase protein to a target cell, site or region of interest. In some aspects, the uricase protein is a secreted uricase which comprises a signal peptide sequence. In some aspects, the uricase protein does not comprise a signal peptide (e.g., for intracellular expression in the liver).
[0011] In some aspects, the disclosure is directed to methods comprising administering a rAAV comprising a uricase expression cassette encoding a uricase protein disclosed herein to a subject in need thereof (e.g., a subject suffering from gout, chronic refractory gout, and / or Harrison Syndrome). In some aspects, the uricase expression cassette comprises a first nucleic acid encoding a uricase (e.g., comprising a signal peptide) and a second nucleic acid encoding a uricase (e.g., not comprising a signal peptide), wherein the first and second nucleic acids can be operably linked to a promoter, optionally the expression cassette can comprise a linker sequence (e.g., IRES, a Furin and / or F2A cleavage site) between the first and second nucleic acids. In some aspects, the rAAV comprises a second uricase expression cassette encoding a uricase protein that does not comprise a signal peptide sequence. In some aspects, the disclosure is directed to administering a second rAAV comprising a second uricase expression cassette encoding a uricase protein that does not comprise a signal peptide sequence to a subject in need thereof (e.g., a subject suffering from gout, chronic refractory gout, and / or Harrison Syndrome).
[0012] In some aspects, the disclosure is directed to administering one or more rAAV comprising a uricase expression cassette comprising a promoter operably linked to (i) a first nucleic acid encoding a secreted uricase protein which comprises a signal peptide and optionally (ii) a second nucleic acid encoding a uricase protein which does not comprise a signal peptide.
[0013] In some aspects, the disclosure is directed to administering one or more rAAV comprising (i) a first uricase expression cassette encoding a secreted uricase protein which comprises a signal peptide and (ii) a second uricase expression cassette encoding a uricase protein which does not comprise a signal peptide. In some aspects, the uricase protein encoded by the second nucleic acid or the second uricase expression cassette has less than 80% homology (i.e., less than 80% sequence identity) to the uricase protein encoded by the first nucleic acid or the first uricase expression cassette. In some aspects, the polynucleotide encoding a second uricase protein comprises a nucleotide sequence less than 80% identical to the nucleotide sequence of the uricase protein encoded by thefirst nucleic acid or the first uricase expression cassette. In some aspects, the polynucleotide encoding the second uricase protein comprises a nucleotide sequence less than 80% identical to the nucleotide sequence of the uricase protein encoded by another polynucleotide as described herein.
[0014] Certain aspects of the disclosure are directed to a method of treating or ameliorating the symptoms associated with gout, chronic refractory gout and / or Harrison Syndrome in a subject in need thereof, comprising administering to the subject an AAV vector comprising (i) a uricase expression cassette comprising a promoter operably linked to a polynucleotide encoding a uricase protein (e.g., a first polynucleotide), and (ii) an inverted terminal repeat (ITR). In some aspects, uricase expression cassette is flanked by two ITRs.
[0015] In some aspects, the uricase protein comprises a signal peptide sequence selected from the group consisting of an IL- 15 signal peptide, an IL-2 signal peptide, an IL-6 signal peptide, an IL- 10 signal peptide, an IL- 12 signal peptide, an IgE signal peptide, an IgK signal peptide, a cystatin S signal peptide, and a human serum albumin signal peptide.
[0016] In some aspects, the AAV vector further comprises a second polynucleotide encoding a second uricase protein, wherein at least one uricase protein does not comprise a signal peptide sequence.
[0017] In some aspects, the polynucleotide encoding the second uricase protein comprises a nucleotide sequence less than 80% identical to the nucleotide sequence of the uricase protein encoded by the first polynucleotide.
[0018] In some aspects, the first and second polynucleotides are operably linked by an IRES sequence, a proteolytic cleavage site, or a combination thereof.
[0019] Certain aspects of the disclosure are directed to a polynucleotide (e.g., an expression cassette) comprising (i) a promoter, and (ii) a nucleotide sequence encoding a uricase protein. In some aspects, the uricase protein comprises a signal peptide. In some aspects, the signal peptide is selected from the group consisting of an IL- 15 signal peptide, an IL-2 signal peptide, an IL-6 signal peptide, an IL- 10 signal peptide, an IL- 12 signal peptide, an IgE signal peptide, an IgK signal peptide, a cystatin S signal peptide, and a human serum albumin signal peptide. In some aspects, the signal peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 10-13 and 98. In some aspects, the signal peptide comprises an amino acid sequence having at least85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 10-13 or 98.In some aspects, the uricase protein does not comprise a signal peptide.
[0020] In some aspects, the uricase protein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-9, 14-21, 95-97, and 99-107. In some aspects, the uricase protein comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1-9, 14-21, 95-97, or 99-107.
[0021] Certain aspects of the disclosure are directed to a polynucleotide comprising (i) a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 22-36 or 1 OS- 113; and, optionally, (ii) a nucleotide sequence encoding a signal peptide selected from the group consisting of SEQ ID NOs: 37-40 and 114. In some aspects, the polynucleotide comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 22-40 or 108-114.
[0022] In some aspects, the polynucleotide further comprises a promoter (e.g., a eukaryotic promoter). In some aspects, the promoter is a tissue-specific promoter. In some aspects, the tissue-specific promoter is a liver-specific promoter (e.g., a hAAT promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, or a DC 172 promoter). In some aspects, the promoter is a hAAT promoter. In some aspects, the promoter is a TBG promoter. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 71, SEQ ID NO: 89, SEQ ID NO: 93, or SEQ ID NO: 94.
[0023] In some aspects, the tissue-specific promoter is a muscle-specific promoter. In some aspects, the muscle-specific promoter is selected from the group consisting of muscle creatine kinase (MCK)-based promoters (e.g., a MCK promoter or a truncated MCK (tMCK) promoter), a CK6 promoter, a hybrid a-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), and a C5-12 synthetic promoter. In some aspects, the muscle-specific promoter is a CK8 promoter. In some aspects, the muscle-specific promoter is a MHCK7 promoter. In some aspects, the promoter comprises a sequencehaving at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 87 or SEQ ID NO: 88.
[0024] In some aspects, the promoter is ubiquitious promoter. In some aspects, the ubiquitous promoter is selected from the group consisting of a CAG promoter, a smCBA promoter, and a CMV promoter. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 61, 64-65, 71, 80-82, or 87-89.
[0025] In some aspects, the polynucleotide (e.g., expression cassette) further comprises a 5’ UTR and / or a 3’ UTR.
[0026] In some aspects, the polynucleotide (e.g., expression cassette) further comprises a polyadenylation (poly A) element.
[0027] In some aspects, the polynucleotide (e.g., expression cassette) comprises a linker sequence selected from an internal ribosome entry site (IRES) sequence, a proteolytic cleavage site, or a combination thereof.
[0028] In some aspects, the proteolytic cleavage site comprises a furin cleavage site, a 2A cleavage site, or a combination thereof.
[0029] In some aspects, the linker comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 91.
[0030] In some aspects, the furin cleavage site comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 90.
[0031] In some aspects, the 2A cleavage site (e.g., F2A) comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 92.
[0032] In some aspects, the polynucleotide (e.g., expression cassette) further comprises an IRES. In some aspects, the IRES sequence comprises a nucleotide sequence at least 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO: 85 or SEQ ID NO: 86.
[0033] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 43-50 or 115-127.
[0034] In some aspects, the vector comprises two or more expression cassettes. In some aspects, the vector comprises two expression cassettes. In some aspects, the expressioncassettes are operably linked by an internal ribosome entry site (IRES) sequence, a proteolytic cleavage site, or a combination thereof. In some aspects, the expression cassettes are operably linked by an IRES sequence. In some aspects, the IRES sequence comprises a nucleotide sequence at least 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO: 85 or SEQ ID NO: 86.
[0035] In some aspects, the polynucleotide (e.g., expression cassette) is flanked by a pair or inverted terminal repeat (ITR) sequences. In some aspects, the ITR sequences are AAV1, AAV2, AAV5, AAV8, or AAV9 serotype ITRs. In some aspects, the ITR sequences are AAV2 serotype ITRs.
[0036] In some aspects, the nucleic acid sequence from ITR to ITR comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 52-59 or 128- 140.
[0037] Certain aspects of the disclosure are directed to a viral vector comprising a polynucleotide or an expression cassette of the disclosure. In some aspects, the vector is an adeno-associated virus (AAV) vector.
[0038] Certain aspects of the disclosure are directed to a recombinant AAV (rAAV) vector, comprising an AAV capsid and a vector genome comprising the polynucleotide or the expression cassette of the disclosure. In some aspects, as least one of the expression cassettes of the vector encodes for a uricase protein that does not comprise a signal peptide sequence.
[0039] Certain aspects of the disclosure are directed to a recombinant AAV (rAAV) vector, comprising an AAV capsid and a vector genome comprising two or more polynucleotides or two or more expression cassettes of the disclosure. In some aspects, the two or more expression cassettes are operably linked by an IRES sequence. In some aspects, at least one of the polynucleotides or expression cassettes of the rAAV vector encodes for a uricase protein that does not comprise a signal peptide sequence. In some aspects, at least one of the polynucleotides or expression cassettes of the rAAV vector encodes for a uricase protein that comprises a signal peptide sequence and at least one of the polynucleotides or expression cassettes of the rAAV vector encodes for a uricase protein that does not comprise a signal peptide sequence.
[0040] In some aspects, the AAV capsid serotype is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh9,AAV9, AAVrhlO, AAV10, AAV11, AAV12, AAVS3, AAV sL65, AAV LKO3, AAV MLIV.K, AAV MLIV.A, AAV NP59, AAV NP40, and AAV NP3O. In some aspects, the AAV capsid serotype is selected from the group consisting of AAV2, AAV5, AAV8, AAV9, and AAVRhlO. In some aspects, the AAV capsid serotype is selected from the group consisting of AAV1 and AAV8. In some aspects, the AAV capsid serotype is selected from the group consisting of AAV5, AAV8, AAV9, AAVS3, AAV sL65, AAV LK03, AAV MLIV.K, AAV MLIV.A, AAV NP84, AAV NP59, AAV NP40 and AAV- NP30. In some aspects, the AAV serotype is AAV1. In some aspects, the AAV serotype is AAV5. In some aspects, the AAV serotype is AAV8. In some aspects, the AAV serotype is AAV9.
[0041] In aspects, the rAAV vector is suitable for delivery and / or administration to the muscle, the salivary gland, the liver, or a combination thereof.
[0042] In some aspects, the administration is to the salivary gland and the rAAV vector comprises an AAV2, an AAV5, an AAV8, an AAV9, or an AAVRhlO serotype capsid.
[0043] In some aspects, the administration is intramuscular and the rAAV vector comprises an AAV1 or an AAV8 capsid.
[0044] In some aspects, the administration is to the liver and the rAAV vector comprises an AAV5, an AAV8, an AAV9, an AAVS3, an AAV sL65, an AAV LK03, an AAV- MLIV.K, an AAV.MLIV.A, an AAV-NP84, an AAV-NP59, an AAV-NP40 or an AAV- NP30 capsid.
[0045] In some aspects, the rAAV vector comprises (i) an AAV5 or AAV9 capsid and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a liver-specific promoter (e.g., a hAAT promoter or a thyroxine- binding globulin (TBG)) operably linked to a nucleotide sequence encoding the uricase protein. In some aspects, the rAAV vector further comprises a second polynucleotide (e.g., a second expression cassette) comprising a promoter (e.g., a CAG, CMV, or smCBA promoter) operably linked to a nucleotide sequence encoding a uricase protein, optionally wherein the uricase protein comprises a signal peptide sequence. In some aspects, the first and second polynucleotide are operably linked. In some aspects, the first and second polynucleotide are operably linked by an internal ribosome entry site (IRES) sequence, a proteolytic cleavage site, or a combination thereof. In some aspects, the polynucleotides are operably linked by an IRES. In some aspects, the proteolytic cleavage site comprises a furin cleavage site, a 2A cleavage site, or a combination thereof.
[0046] In aspects, the rAAV vector is suitable for delivery and / or administration by intravenous or hepatic portal vein to the liver.
[0047] In some aspects, the rAAV vector comprises (i) an AAV1 or AAV8 capsid and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a ubiquitous promoter (e.g., a CAG, CMV, or smCBA promoter) operably linked to a nucleotide sequence encoding the uricase protein, optionally, wherein the uricase protein comprises a signal peptide sequence. In some aspects, the rAAV vector further comprises a second polynucleotide (e.g., a second expression cassette) comprising a liver-specific promoter operably linked to a nucleotide sequence encoding a uricase protein, optionally wherein the uricase protein does not comprise a signal peptide sequence. In some aspects, the first and second polynucleotide are operably linked. In some aspects, the polynucleotides are operably linked by an IRES. In some aspects, the polynucleotides are operably linked by a proteolytic cleavage site. In aspects, the rAAV vector is suitable for delivery and / or administration by intramuscular injection.
[0048] Certain aspects of the disclosure are directed to a host cell (e.g., a mammalian cell) comprising a polynucleotide, an expression cassette, a vector, or a rAAV vector of the disclosure.
[0049] Certain aspects of the disclosure are directed to methods of treating or ameliorating the symptoms associated with gout, chronic refractory gout, and / or Harrison Syndrome in a subject in need thereof, comprising administering to the subject a polynucleotide, an expression cassette, a vector, or a rAAV vector of the disclosure. In some aspects, the methods disclosed are directed to a method of treating or ameliorating the symptoms associated with gout, chronic refractory gout, and / or Harrison Syndrome in a subject in need thereof, comprising administering to the subject a recombinant AAV (rAAV) vector comprising an AAV capsid and an AAV vector genome comprising AAV ITRs flanking a uricase expression cassette comprising a promoter operably linked to a polynucleotide encoding a uricase protein. In aspects, the AAV vector genome further comprises a second nucleic acid encoding a second uricase and / or a second uricase expression cassette. In aspects, the method further comprises administering to the subject a second rAAV vector comprising an AAV capsid and an AAV vector genome comprising AAV ITRs flanking a second uricase expression cassette. In aspects, the delivery and / or administration is intramuscular or intravenous.
[0050] In some aspects, the methods of the disclosures provide (i) reduced / regulated serum uric acid levels in the subject; (ii) reduced urate crystals (e.g., tophi) in the subject; (iii) reduced refractory gout episodes in the subject; or (iv) any combination thereof.
[0051] In some aspects, the methods of the disclosures provide increased serum uricase activity of at least 5 mU / mL in the subject after administration. In some aspects, the methods of the disclosures provide increased serum uricase activity of about 5 mU / mL to about 600 mU / mL, in the subject after administration.BRIEF DESCRIPTION OF FIGURES
[0052] FIG. 1 shows a plasmid map of a vector including the following ITR to ITR elements: AAV ITRs flanking in 5’ to 3’ order a CMV enhancer, a CBA promoter, a CBA Exon 1, a shortened intron, a nucleic acid encoding a signal peptide, a nucleic acid encoding a uricase, a bovine poly adenylation site (bGH PA), and a stuffer sequence.
[0053] FIG. 2 shows a plasmid map of a vector including the following ITR to ITR elements: AAV ITRs flanking in 5’ to 3’ order a CMV enhancer, a CMV promoter, a 5' UTR spacer, a chimeric intron from human P-globin and immunoglobulin heavy chain genes, a nucleic acid encoding a signal peptide, a nucleic acid encoding a uricase, a bovine poly adenylation site (bGH PA), and a stuffer sequence.
[0054] FIG. 3 shows a plasmid map of a vector including the following ITR to ITR elements: AAV ITRs flanking in 5’ to 3’ order an hApo-HCR enhancer, a hAAT promoter, a modified SV40 intron, a nucleic acid encoding a signal peptide, a nucleic acid encoding a uricase, a bovine poly adenylation site (bGH PA), and a stuffer sequence.
[0055] FIG. 4 shows a plasmid map of a vector including the following ITR to ITR elements: AAV ITRs flanking in 5’ to 3’ order a CMV enhancer, a CMV promoter, a 5' UTR spacer, a chimeric intron from human P-globin and immunoglobulin heavy chain genes, a nucleic acid encoding a signal peptide, a nucleic acid encoding a first uricase, a furin site, a linker sequence, a F2A peptide sequence, a nucleic acid encoding a second uricase, and a bovine poly adenylation site (bGH PA).
[0056] FIG. 5 shows the results of a secreted uricase activity assay in plasmid transfected HepG2 liver cells. Plasmid PA-012 encodes uricase Anl9 / 22, and includes a smCBA promoter and IL-6 signal peptide sequence. Plasmid PA-002 encodes the pegloticase polypeptide, and includes a cmCBA promoter and IL-6 signal peptide sequence. PlasmidsPA-049, PA-056, and PA-058 each encode the pegloticase polypeptide, and include a liver-specific TBG promoter, and either an IL-6, cystatin, or human albumin signal peptide sequence, respectively. Uricase activity is shown as mU / mL relative to a uricase control. Results are shown as the average of uricase activity from biological triplicates in a single assay. BLQ = below the limit of quantitation.
[0057] FIG. 6 shows a Western blot comparing secreted uricase protein levels from HepG2 cells transfected with the uricase-encoding plasmids and a control plasmid expressing GFP. An anti-uricase antibody was used to detect uricase.
[0058] FIG. 7 shows a Western blot comparing the intracellular uricase expression levels from HepG2 cells transfected with the uricase-encoding plasmids. An anti-uricase antibody was used to detect uricase.
[0059] FIG. 8 shows a Western blot comparing secreted uricase protein levels from C2C12 muscle cells transfected with plasmids encoding the uricase variant An96. Plasmid PA-015 includes a smCBA promoter, plasmid PA-038 includes a muscle-specific CK8 promoter, and plasmid PA-040 includes a muscle-specific MHCK7 promoter. Supernatants were harvested 72 hours after transfection and uricase was detected with an anti-uricase antibody.
[0060] FIG. 9 shows the results of a secreted uricase activity assay in AAV-uricase transduced HEK293T cells. AAV vectors encoding uricase Anl9 / 22 were generated with AAV1 or AAV9 capsids including an IL-6 signal peptide sequence, and either a smCBA promoter (AAV 1-012 and AAV9-012) or a CMV promoter (AAV 1-020 and AAV9-020). HEK293T cells were infected at various multiplicity of infection (MOI) (IxlO6, 5xl05, or 2.5xl05vector genomes (vg) / cell). AAV9-GFP vectors were included as a negative control. Transduction supernatants were collected at 72 hours post AAV addition and analyzed for uricase activity. Uricase activity is shown as mU / mL relative to uricase control. Results are shown as the average of uricase activity from biological duplicates.
[0061] FIG. 10 shows a Western blot comparing secreted uricase protein levels from HEK293T cells transduced with the uricase-encoding AAV vectors. An anti-uricase antibody was used to detect uricase.
[0062] FIG. 11 shows a Western blot comparing secreted uricase protein levels from HepG2 liver cells transduced with an AAV vector encoding uricase Anl9 / 22 generated with AAV1 capsid including an IL-6 signal peptide sequence and a liver-specific TBG promoter (AAV1-061). AAV1-061 was compared to a control GFP vector (AAV2-GFP)at a MOI of IxlO6vg / cell. HepG2 cells were transduced with the vectors and supernatant was harvested after 72 hours. An anti-uricase antibody was used to detect uricase.
[0063] FIG. 12 shows a Western blot comparing secreted uricase protein levels from HepG2 liver cells transduced with an AAV vector encoding uricase Anl9 / 22 generated with AAV9 capsid including an IL-6 signal peptide sequence and a liver-specific TBG promoter (AAV9-061). AAV9-061 was compared to mock transduced cells at a MOI of IxlO6vg / cell. Expression supernatants were collected from vector transduced HepG2 cells and control cells at 72 or 96 hours post vector addition. An anti-uricase antibody was used to detect uricase.
[0064] FIG. 13 shows the results of a secreted uricase activity assay in plasmid transfected U87 cells. Plasmids encoding different uricase sequences under the control of different promoters and signal peptide sequences were evaluated for secreted uricase activity. Plasmids were transfected, or a mock transfection, into U87 cells and supernatants were collected and tested for functional uricase after 72 hours. Plasmid PA- 002 encodes the pegloticase polypeptide, and includes a cmCB A promoter and IL-6 signal peptide sequence. Plasmid PA-010 encodes pegadricase, and includes a cmCBA promoter and IL-6 signal peptide sequence. Plasmid PA-011 encodes rasburicase, and includes a cmCBA promoter and IL-6 signal peptide sequence. Plasmid PA-012 encodes uricase Anl9 / 22, and includes a smCBA promoter and IL-6 signal peptide sequence. Plasmid PA-015 encodes uricase An96, and includes a smCBA promoter and IL-6 signal peptide sequence. Uricase activity is shown as mU / mL relative to uricase control. Results are shown as the average of uricase activity from biological triplicates.
[0065] FIG. 14 shows the results of a secreted uricase activity assay in plasmid transfected HEK293T cells. Plasmids encoding different uricase sequences under the control of different promoters and signal peptide sequences were evaluated for secreted uricase activity. HEK293T cells were transfected with the plasmids at varying doses (250, 125, or 62.5 ng plasmid) and supernatants were harvested at 72 hours post-transfection. GFP plasmid (TS-5021) was included as a control. Plasmid PA-012 encodes uricase An 19 / 22, and includes a smCBA promoter and IL-6 signal peptide sequence. Plasmid PA-069 encodes uricase SUO, and includes a CAG promoter and cystatin signal peptide sequence. Plasmid PA-070 encodes uricase SPEG, and includes a CAG promoter and cystatin signal peptide sequence. Uricase activity is shown as mU / mL relative to uricase control. Results are shown as the average of uricase activity from biological triplicates.
[0066] FIG. 15 shows the results of an in vivo serum uricase activity assay after administration of rAAV uricase vectors. Groups of 6 mice (C57BL6 mice) were dosed with either vehicle or 2.5xlOnvg / animal of AAV9-smCBA-Uricase Anl9 / 22 (AAV9— 012). The injections were delivered intramuscularly (IM) or intravenously (IV). Blood was collected retroorbitally at weeks 2, 4, 6, and 8 post- AAV injection, sera was separated, and uricase activity was tested. Uricase activity is shown as mU / mL relative to uricase control. Results are shown for the collections at weeks 2, 4, and 6 post- AAV injection.DETAILED DESCRIPTION OF THE DISCLOSUREDefinitions
[0067] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present application, including the definitions, will control. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
[0068] Throughout this disclosure, the term “a” or “an” entity refers to one or more of that entity; for example, “a polynucleotide,” is understood to represent one or more polynucleotides. As such, the terms “a” (or “an”), “one or more,” and “at least one” can be used interchangeably herein.
[0069] Furthermore, “and / or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0070] Numerical values presented herein may be written out, or expressed in scientific notation, i.e. x x 10y, or scientific E notation xEy.
[0071] It is understood that wherever aspects are described herein with the language "comprising," otherwise analogous aspects described in terms of "consisting of' and / or "consisting essentially of' are also provided.
[0072] The term “about” is used herein to mean approximately, roughly, around, or in the regions of. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” is used herein to modify a numerical value above and below the stated value by a variance of 10 percent, up or down (higher or lower), unless indicated otherwise.
[0073] The term "at least" prior to a number or series of numbers is understood to include the number adjacent to the term "at least," and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21 -nucleotide nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range. "At least" is also not limited to integers (e.g., "at least 5%" includes 5.0%, 5.1%, 5.18% without consideration of the number of significant figures).
[0074] As used herein, "no more than" or "less than" is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. When "no more than" is present before a series of numbers or a range, it is understood that "no more than" can modify each of the numbers in the series or range.
[0075] Nucleotide sequences are presented herein by single strand only, in the 5' to 3' direction, from left to right, unless specifically indicated otherwise. Nucleotides and amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the one-letter code, or the three letter code, both in accordance with, 37 CFR §1.822 and established usage.
[0076] "Nucleic acid," "polynucleotide," and "oligonucleotide," are used interchangeably in the present application. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. The terms "nucleic acid," "polynucleotide," and "oligonucleotide," as used herein, are defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides can also be referred to as nucleic acid molecules or oligomers. Polynucleotides can be made recombinantly, enzymatically, or synthetically, e.g., bysolid-phase chemical synthesis followed by purification. When referring to a sequence of the polynucleotide or nucleic acid, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. Polynucleotides are presented herein in the direction from the 5' to the 3' direction. A polynucleotide of the present disclosure can be a deoxyribonucleic acid (DNA) molecule or ribonucleic acid (RNA) molecule. Nucleotide bases are indicated herein by a single letter code: adenine (A), guanine (G), thymine (T), cytosine (C), inosine (I) and uracil (U).
[0077] The term "mRNA," as used herein, refers to a single stranded RNA that encodes the amino acid sequence of one or more polypeptide chains.
[0078] "Complementary" polynucleotides are those that are capable of base pairing according to the standard Watson-Crick complementarity rules. Specifically, purines will base pair with pyrimidines to form a combination of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. It is understood that two polynucleotides can hybridize to each other even if they are not completely complementary to each other, provided that each has at least one region that is substantially complementary to the other. In some aspects, the term "complementary," when used to describe a first nucleic acid sequence in relation to a second nucleic acid sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleic acid sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleic acid sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 °C, or 70 °C, for 12-16 hours followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can be used. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
[0079] As used herein, the term "polypeptide" is intended to encompass a singular "polypeptide" as well as plural "polypeptides," and comprises any chain or chains of two or more amino acids. Thus, as used herein, a "peptide," a "peptide subunit," a "protein,"an "amino acid chain," an "amino acid sequence," or any other term used to refer to a chain or chains of two or more amino acids, are included in the definition of a "polypeptide," even though each of these terms can have a more specific meaning. The term "polypeptide" can be used instead of, or interchangeably with any of these terms. The term further includes polypeptides which have undergone post-translational or postsynthesis modifications, for example, conjugation of a palmitoyl group, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting / blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino acids. The term "peptide," as used herein encompasses full length peptides and fragments, variants or derivatives thereof. A "peptide" as disclosed herein, can be part of a fusion polypeptide comprising additional components such as, e.g., a signal peptide, an Fc domain or an albumin domain. A peptide as described herein can also be derivatized in a number of different ways. A peptide described herein can comprise modifications including e.g., PEGylation.
[0080] The term “coding sequence” or “sequence encoding” is used herein to mean a DNA or RNA region (the transcribed region) which “encodes” a particular protein, e.g., such as uricase. A coding sequence is transcribed (DNA) and translated (RNA) into a polypeptide, in vitro or in vivo, when placed under the control of an appropriate regulatory region, such as a promoter. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, cDNA from prokaryotes or eukaryotes, genomic DNA from prokaryotes or eukaryotes, and synthetic DNA sequences. A transcription termination sequence can be located 3' to the coding sequence.
[0081] A gene can comprise several operably linked fragments, such as a promoter, a 5' leader sequence, an intron, a coding sequence and a 3 '-nontranslated sequence, e.g., comprising a polyadenylation site or a signal sequence. As used herein, “expression of a gene” refers to the process wherein a gene is transcribed into an RNA and / or translated into an active protein.
[0082] An open reading frame (ORF) as used herein is the part of a reading frame that has the ability to be translated. An ORF is a continuous stretch of codons that begins with a start codon and ends at a stop codon. In some aspects, an ORF sequence can be shown or referenced with or without the start codon sequence and / or the stop codon sequence.
[0083] A Kozak consensus sequence, Kozak consensus or Kozak sequence, is known as a sequence which occurs on eukaryotic mRNA and has the consensus (gcc)gccRccAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another “G ” In some aspects, the polynucleotide comprises a nucleic acid sequence having at least 95%, at least 99% sequence identity, or more to the Kozak consensus sequence. In some aspects, the polynucleotide comprises a Kozak consensus sequence.
[0084] By "determining the level of a protein" is meant the detection of a protein, or an mRNA encoding the protein, by methods known in the art either directly or indirectly. "Directly determining" means performing a process (e.g., performing an assay or test on a sample or "analyzing a sample" as that term is defined herein) to obtain the physical entity or value. "Indirectly determining" refers to receiving the physical entity or value from another party or source (e.g., a third-party laboratory that directly acquired the physical entity or value). Methods to measure protein level generally include, but are not limited to, western blotting, immunoblotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, immunofluorescence, surface plasmon resonance, chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry, liquid chromatography (LC)-mass spectrometry, microcytometry, microscopy, fluorescence activated cell sorting (FACS), and flow cytometry, as well as assays based on a property of a protein including, but not limited to, enzymatic activity or interaction with other protein partners. Methods to measure mRNA levels are known in the art.
[0085] By "level" is meant a level or activity of a protein, or mRNA encoding the protein, optionally as compared to a reference. The reference can be any useful reference, as defined herein. By a "decreased level" or an "increased level" of a protein is meant a decrease or increase in protein level, as compared to a reference. A level of a protein can be expressed in mass / vol (e.g., g / dL, mg / mL, pg / mL, ng / mL) or percentage relative to total protein or mRNA in a sample.
[0086] The term “sequence identity” is used herein to mean a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In certain aspects, sequence identity is calculated based on the full length of two given SEQ ID NOor on part thereof. Part thereof can mean at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of both SEQ ID NO, or any other specified percentage. The term “identity” can also mean the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values can be generated using the sequence comparison computer program BLAST.
[0087] In certain aspects, methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs.
[0088] Substantial homology” or “substantial similarity,” means, when referring to a nucleic acid or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95% to 99% of the sequence.
[0089] The term “promoter” is used herein to mean a nucleic acid sequence or fragment that functions to control the transcription of one or more genes (or coding sequence), located upstream with respect to the direction of transcription of the transcription initiation site of the gene or coding sequence, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter.
[0090] As used herein, the terms "ubiquitous promoter" or "constitutive promoter" is any promoter that directs RNA production in many or all tissue / cell types at most times, e.g., the human CMV immediate early enhancer / promoter region that promotes constitutive expression of cloned DNA inserts in mammalian cells. Non-limiting examples of constitutive promoters used in mammalian systems include the simian virus 40 earlypromoter (SV40), cytomegalovirus immediate-early promoter (CMV), human Ubiquitin C promoter (UBC), human elongation factor la promoter (EFl A), mouse phosphoglycerate kinase 1 promoter (PGK), and chicken P-Actin promoter coupled with CMV early enhancer (CAG or CAGG).
[0091] As used herein, the term "regulatable promoter" is any promoter whose activity is affected by a cis or trans acting factor (e.g., an inducible promoter, such as an external signal or agent).
[0092] As used herein, a “tissue-specific promoter" is any promoter that is preferentially active in specific types of differentiated cells / tissues.
[0093] As used herein, the term "enhancer" is a cis-acting element that stimulates or inhibits transcription of adjacent genes. An enhancer that inhibits transcription is also referred to as a "silencer." Enhancers can function (e.g., can be associated with a coding sequence) in either orientation, over distances of up to several kilobase pairs (kb) from the coding sequence and from a position downstream of a transcribed region.
[0094] The terms "operatively linked," "operatively inserted," "operatively positioned," "under control" or "under transcriptional control" means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene. The term "operably linked" means that a DNA sequence and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence(s). The term "operably inserted" means that the DNA of interest introduced into the cell is positioned adjacent a DNA sequence which directs transcription and translation of the introduced DNA (i.e., facilitates the production of, e.g., a polypeptide encoded by a DNA of interest).
[0095] As used herein, the term "internal ribosome entry site" or "IRES" refers to an element that promotes direct internal ribosome entry to the initiation codon, such as ATG, of a cistron (a protein encoding region), thereby leading to the cap-independent translation of the gene. See, e.g., Jackson R J et al., Trends Biochem Sci 15(12):477-83 (199); Jackson R J and Kaminski, A. RNA 1 (10):985-l 000 (1995). "Under translational control of an IRES" as used herein means that translation is associated with the IRES and proceeds in a cap-independent manner.
[0096] The term "self-processing cleavage site" or "self-processing cleavage sequence," as used herein refers to a post-translational or co-translational processing cleavage site orsequence. Such a "self-processing cleavage" site or sequence refers to a DNA or amino acid sequence, exemplified herein by a 2A site, sequence or domain or a 2A-like site, sequence or domain. The term "self-processing peptide" is defined herein as the peptide expression product of the DNA sequence that encodes a self-processing cleavage site or sequence, which upon translation, mediates rapid intramolecular (cis) cleavage of a protein or polypeptide comprising the self-processing cleavage site to yield discrete mature protein or polypeptide products.
[0097] As used herein, the term "additional proteolytic cleavage site," refers to a sequence that is incorporated into an expression construct of the disclosure adjacent a self-processing cleavage site, such as a 2A or 2A like sequence, and provides a means to remove additional amino acids that remain following cleavage by the self-processing cleavage sequence. Exemplary 2A peptides include, but are not limited to, P2A, E2A, F2A, and T2A. Exemplary “additional proteolytic cleavage sites” are described herein and include, but are not limited to, furin cleavage sites with the consensus sequence RXK(R)R. Such furin cleavage sites can be cleaved by endogenous subtili sin-like proteases, such as furin and other serine proteases within the protein secretion pathway. In some aspects, other exemplary "additional proteolytic cleavage sites" can be used, as described in e.g., Lie et al., Sci Rep 7, 2193 (2017).
[0098] As used herein, the term “multicistronic” or “multicistronic vector” refers to a nucleic acid sequence having two or more open reading frames (e.g., genes). An open reading frame in this context is a sequence of codons that is translatable into a polypeptide or protein (e.g. a uricase proterin). “Bicistronic” or “bicistronic vector” refers to a nucleic acid sequence having two open reading frames (e.g., genes). An open reading frame in this context is a sequence of codons that is translatable into a polypeptide or protein (e.g. a uricase protein). In some aspects, the construct of the disclosure is a multicistronic (e.g., bicistronic) construct (e.g., comprising a first uricase protein and a second uricase protein).
[0099] The term “transgene” is used herein to mean a gene or a nucleic acid molecule that is introduced into a cell. An example of a transgene is a nucleic acid encoding a therapeutic polypeptide (e.g., a gene encoding a uricase). In some aspects, the gene can be present but in some cases normally not expressed or expressed at an insufficient level in the cell. In this context, “insufficient” means that although said gene is normally expressed in a cell, a condition and / or disease as disclosed herein could still develop. Incertain aspects, the transgene allows for the increased expression or over-expression of the gene, e.g., a uricase. The transgene can comprise sequences that are native to the cell, comprise sequences that do not naturally occur in the cell, or it can comprise combinations of both. In certain aspects, the transgene can comprise modified sequences coding for a uricase, and / or additional peptide(s) or protein(s) that can be operably linked to appropriate regulatory sequences for expression of the sequences coding for a uricase in the cell. In some aspects, the transgene is not integrated into the host cell's genome.
[0100] As used herein, the term "modified" refers to a changed state or structure of a molecule of the disclosure. Molecules can be modified in many ways including chemically, structurally, and functionally. In some aspects, the modification is relative to a reference wild-type (or unmodified) molecule.
[0101] As used herein, the term "synthetic" means produced, prepared, and / or manufactured by the hand of man. In some aspects, synthesis of polynucleotides or polypeptides or other molecules of the present disclosure can be chemical or enzymatic.
[0102] The terms “modified genes”, “modified nucleic acids”, and the like are used interchangeably herein to mean the introduction of one or more modifications or changes relative to the in the natural or wild-type sequence of the genes or nucleic acid sequence. Such modifications may or may not result in mutations to the encoded protein sequence. In some aspects, the modified nucleic acid encodes a wild-type or mutant protein sequence or fragment thereof.
[0103] As used herein, the terms "uricase" and "urate oxidase" are used herein interchangeably. Uricases (uricases; E.C. 1.7.3.3) are enzymes which catalyze the oxidation of uric acid to a more soluble product, allantoin, a purine metabolite that is more readily excreted. Uricases exist extensively in microorganisms (such as Bacillus fastidiosus, Candida mycoderma and Aspergillus flaws , plants (such as beans and chickpeas), and animals (such as pigs, cows, dogs, and papios) (Suzuki K et al., J. Biosci. Bioeng., 2004, 98: 153-158). Uricases can catalyze the oxidation of uric acid to allantoin in the presence of oxygen, releasing carbon dioxide (Retailleau P et al., Acta. Cryst. D., 2004, 60: 453-462). Humans do not produce enzymatically active uricase, which is understood to be a result of several mutations in the gene for uricase acquired during the evolution of higher primates. Wu, X, et al., (1992) J Mol Evol 34:78-84, incorporated herein by reference in its entirety. As a consequence, in susceptible individuals, excessiveconcentrations of uric acid in the blood (hyperuricemia) can lead to painful arthritis (gout), disfiguring urate deposits (tophi) and / or renal failure.
[0104] As used herein, the term “uricase activity” refers to the enzymatic activity of uricase in catalyzing the oxidation of uric acid to allantoin. Uricase activity can be defined in terms of “units” of uricase activity. For example, in some aspects, one unit of uricase activity refers to the amount of enzyme required to convert 1 pmol of uric acid into allantoin per minute under specific assay conditions (e.g., at pH 8.5 and at about 25 °C).
[0105] The terms "transcriptional regulatory protein," "transcriptional regulatory factor," and "transcription factor" are used interchangeably herein, and refer to a nuclear protein that binds a DNA response element and thereby transcriptionally regulates the expression of an associated gene or genes. Transcriptional regulatory proteins generally bind directly to a DNA response element, however in some cases binding to DNA can be indirect by way of binding to another protein that in turn binds to, or is bound to a DNA response element.
[0106] As used herein, the term “signal peptide,” refers to a polypeptide sequence or combination of sequences that are sufficient to mediate the translocation of a polypeptide to the cell surface. Without being bound by any particular theory, translocation of a polypeptide to the cell surface can be mediated by the secretory pathway, including the translocation of a polypeptide from the cytosol to the endoplasmic reticulum, and the subsequent transport of the polypeptide through the Golgi, and to the cell membrane, where the protein can remain embedded in the cell membrane, or be secreted from the cell. As used herein, “signal peptides,” can include naturally-occurring and synthetic signal sequences, signal “patches” and the like. In some aspects, the signal peptide is a modified signal peptide.
[0107] As used herein, the term "termination signal sequence" can be any genetic element that causes RNA polymerase to terminate transcription, such as for example a polyadenylation signal sequence. A polyadenylation signal sequence is a recognition region necessary for endonuclease cleavage of an RNA transcript that is followed by the polyadenylation consensus sequence AATAAA. A polyadenylation signal sequence provides a "polyA site," i.e., a site on a RNA transcript to which adenine residues will be added by post-transcriptional polyadenylation.
[0108] The term "derived from," as used herein, refers to a component that is isolated from or made using a specified molecule or organism, or information (e.g., amino acid or nucleic acid sequence) from the specified molecule or organism. For example, a nucleic acid sequence (e.g., a modified uricase gene) that is derived from a second nucleic acid sequence (e.g., a wild-type uricase gene) can include a nucleotide sequence or portion thereof that is identical or substantially similar to the nucleotide sequence of the second nucleic acid sequence. In some aspects, mutants, analogs or derivatives can be derived from a wild-type sequence.
[0109] In the case of a polynucleotide, the derived species can be obtained by, for example, naturally occurring mutagenesis, artificial directed mutagenesis or artificial random mutagenesis. The mutagenesis used to derive polynucleotides can be intentionally directed or intentionally random, or a mixture of each. The mutagenesis of a polynucleotide to create a different polynucleotide derived from the first can be a random event (e.g., caused by polymerase infidelity) and the identification of the derived polynucleotide can be made by appropriate screening methods.
[0110] As used herein, the term "delivery vector" or "vector" refers to any vehicle for the cloning of and / or transfer of a nucleic acid into a host cell, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc. A vector can be a replicon to which another nucleic acid segment can be attached so as to bring about the replication of the attached segment. A "replicon" refers to any genetic element (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of replication in vivo, i.e., capable of replication under its own control. The term "delivery vector" or "vector" includes both viral and nonviral vehicles for introducing the nucleic acid into a cell in vitro, ex vivo or in vivo. A large number of vectors are known and used in the art including, for example, plasmids, modified eukaryotic viruses, or modified bacterial viruses. In some aspects, insertion of a polynucleotide into a suitable vector can be accomplished by ligating the appropriate polynucleotide fragments into a chosen vector that has complementary cohesive termini. Vectors can be engineered to encode selectable markers or reporters that provide for the selection or identification of cells that have incorporated the vector. Expression of selectable markers or reporters allows identification and / or selection of host cells that incorporate and express other coding regions contained on the vector. Examples of selectable marker genes known and used in the art include: genes providing resistance to ampicillin, streptomycin, gentamycin,kanamycin, hygromycin, bialaphos herbicide, sulfonamide, and the like; and genes that are used as phenotypic markers, ie., anthocyanin regulatory genes, isopentanyl transferase gene, and the like. Examples of reporters known and used in the art include: luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), P-galactosidase (LacZ), P-glucuronidase (Gus), and the like. Selectable markers can also be considered to be reporters. In some aspects, the delivery vector is selected from the group consisting of a viral vector (e.g., an AAV vector), a plasmid, a lipid, a protein particle, a bacterial vector, and a lysosome.[OHl] Some aspects of the disclosure are directed to biological vectors, which can include viruses, particularly attenuated and / or replication-deficient viruses. In some aspects, chemical vectors include lipid complexes and naked DNA constructs.
[0112] As used herein, the term "naked DNA" or "naked nucleic acid" and the like refers to a nucleic acid molecule that is not contained within a viral particle, bacterial cell, or other encapsulating means that facilitates delivery of nucleic acid into the cytoplasm of the target cell. Naked nucleic acid can be associated with means for facilitating delivery of the nucleic acid to the site of the target cell (e.g., to facilitate travel into the target cell of the nucleic acid through the alimentary canal, protect the nucleic acid from stomach acid, and / or serve to penetrate intestinal mucus) and / or to the surface of the target epithelial cell.
[0113] A "viral vector" refers to a sequence (e.g., viral genome) or vector that comprises viral derived material and can be used to carry or delivery a payload. Viral vectors can be used to deliver genetic materials into cells such as one or more polynucleotide regions encoding or comprising a molecule of interest, e.g., a protein, a peptide, and a polynucleotide or a plurality thereof. Viral vectors can be modified for specific applications. In some aspects, the delivery vectors comprises a viral vector selected from the group consisting of an adeno-associated viral (AAV) vector, an adenoviral vector, a lentiviral vector, or a retroviral vector.
[0114] As used herein, the term "mutation" refers to any changing of the structure of a gene, resulting in a variant (also called "mutant") form that can be transmitted to subsequent generations. Mutations in a gene can be caused by the alternation of single base in DNA, or the deletion, insertion, or rearrangement of larger sections of genes or chromosomes.
[0115] As used herein, the term "administration" refers to the administration of a molecule or composition of the present disclosure (e.g., a polynucleotide (e.g., an expression cassette), an AAV vector, rAAV vector, or a composition disclosed herein) to a subject or system. Administration to an animal subject (e.g., to a human) can be by any appropriate route, such as but not limited to intravenous, hepatic portal vein, and / or intramuscular injection.
[0116] The term "adeno-associated virus vector" or "AAV vector" as used herein refers to any vector which comprises or derives from components of an adeno-associated vector and is suitable to infect mammalian cells, preferably human cells. The term AAV vector typically designates an AAV-type viral particle or virion comprising a payload. The AAV vector can be derived from various serotypes, including combinations of serotypes (i.e., "pseudotyped" AAV) or from various genomes (e.g., single stranded or self- complementary). In addition, the AAV vector can be replication defective and / or targeted. As used herein, the term "adeno-associated virus" (AAV), includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3 A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAV type S3, AAV type sL65, AAV type LK03, AAV type MLIV.K, AAV type MLIV. A, AAV type NP59, AAV type NP40, AAV type NP30, AAVrh8, AAVrh9 AAVrhlO, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, those AAV serotypes and clades disclosed by Gao et al. (J. Virol. 78:6381 (2004)) and Moris et al. (Virol. 33:375 (2004)), and any other AAV. See, e.g., FIELDS et al. VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). In some aspects, an "AAV vector" includes a derivative of a known AAV vector. In some aspects, an "AAV vector" includes a modified or an artificial AAV vector. The terms "AAV genome" and "AAV vector" can be used interchangeably. In some aspects, the AAV vector is modified relative to the wild-type AAV serotype sequence.
[0117] The phrase "contacting a cell" (e.g., contacting a cell with a polynucleotide (e.g., an expression cassette), vector, rAAV vector, or composition of the disclosure) as used herein, includes contacting a cell directly or indirectly. In some aspects, contacting a cell with a polynucleotide, an expression cassette, vector, rAAV vector, or composition includes contacting a cell in vitro with the polynucleotide, expression cassette, vector, rAAV vector, or composition or contacting a cell in vivo with the polynucleotide,expression cassette, vector, rAAV vector, or composition. Thus, for example, the polynucleotide, expression cassette, vector, rAAV vector, or composition can be put into physical contact with the cell by the individual performing the method, or alternatively, the polynucleotide, expression cassette, vector, rAAV vector, or composition can be put into a situation that will permit or cause it to subsequently come into contact with the cell.
[0118] In some aspects, contacting a cell in vitro can be done, for example, by incubating the cell with the polynucleotide, expression cassette, vector, rAAV vector, or composition. In some aspects, contacting a cell in vivo can be done, for example, by injecting the polynucleotide, expression cassette, vector, rAAV vector, or composition of the disclosure into or near the tissue where the cell is located (e.g., hepatic cell or intramuscularly), or by injecting the polynucleotide, expression cassette, vector, rAAV vector, or composition into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell can be contacted in vitro with a polynucleotide, expression cassette, vector, rAAV vector, or composition of the disclosure and subsequently transplanted into a subject.
[0119] In some aspects, contacting a cell with a polynucleotide, expression cassette, vector, rAAV vector, or composition of the disclosure includes "introducing" or "delivering" (directly or indirectly) the polynucleotide, expression cassette, vector, rAAV vector, or composition into the cell by facilitating or effecting uptake or absorption into the cell. Introducing a polynucleotide, expression cassette, vector, rAAV vector, or composition into a cell can be in vitro and / or in vivo.
[0120] As used herein, the term "in vitro" refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe). In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection.
[0121] As used herein, the term "in vivo" refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof).
[0122] Transduction” of a cell by a virus means that there is transfer of a nucleic acid from the virus particle to the cell. In some aspects, transduction refers to the delivery of a nucleic acid or nucleic acids encoding a uricase disclosed herein into a recipient host cell by a viral vector. For example, transduction of a target cell by a rAAV vector of thedisclosure leads to transfer of the rAAV genome (e.g., comprising a polynucleotide of the disclosure) contained in that vector into the transduced cell.
[0123] As used herein, the term "transfection" refers to methods to introduce exogenous nucleic acids into a cell. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures. The list of agents that can be transfected into a cell is large and includes, e.g., siRNA, shRNA, sense and / or anti-sense sequences, DNA encoding one or more genes and organized into an expression plasmid, e.g., a vector.
[0124] “Vector” as used herein means a recombinant plasmid or virus that comprises a polynucleotide to be delivered into a host cell, either in vitro or in vivo.
[0125] The term “host cell” or “target cell” is used herein to mean the cell into which the polynucleotide delivery takes place, either in vitro or in vivo. AAV vectors are able to transduce both dividing and non-dividing cells.
[0126] “Recombinant” means distinct from that generally found in nature.
[0127] “Serotype” with respect to vector or virus capsid is defined by a distinct immunological profile based on the capsid protein sequences and capsid structure.
[0128] “AAV Cap” means AAV Cap proteins, VP1, VP2 and VP3 and analogs thereof.
[0129] “AAV Rep” means AAV Rep proteins and analogs thereof.
[0130] “Flanked,” with respect to a sequence that is flanked by other elements, indicates the presence of one or more the flanking elements upstream and / or downstream, i.e., 5' and / or 3', relative to the sequence. The term “flanked” is not intended to indicate that the sequences are necessarily contiguous. For example, there may be intervening sequences between the nucleic acid encoding the transgene and a flanking element. A sequence (e.g., a transgene) that is “flanked” by two other elements (e.g., ITRs), indicates that one element is located 5' to the sequence and the other is located 3' to the sequence; however, there may be intervening sequences between.
[0131] As used herein, the terms "effective amount," "therapeutically effective amount," and a "sufficient amount" of, e.g., a polynucleotide, expression cassette, vector, rAAV vector, or composition of the disclosure refer to a quantity sufficient to, when administered to the subject, including a human, effect beneficial or desired results, including clinical results, and, as such, an "effective amount" or synonym thereto depends on the context in which it is being applied. In some aspects, a therapeutically effective amount of an agent (e.g., a polynucleotide, expression cassette, vector, rAAV particle, orcomposition disclosed herein) is an amount that results in a beneficial or desired result in a subject as compared to a control.
[0132] The amount of a given therapeutic agent or composition will correspond to such an amount will vary depending upon various factors, such as the given agent, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject (e.g., age, sex, and / or weight) or host being treated, and the like.
[0133] As used herein, the term "gene therapy" is the insertion of nucleic acid sequences (e.g., a nucleic acid comprising a promoter operably linked to a polynucleotide encoding a therapeutic molecule as defined herein) into an individual's cells and / or tissues to treat a disease or condition. Gene therapy also includes insertion of a transgene that is inhibitory in nature, i.e., that inhibit, decrease or reduce expression, activity or function of an endogenous gene or protein, such as an undesirable or aberrant (e.g., pathogenic) gene or protein. Such transgenes can be exogenous. An exogenous molecule or sequence is understood to be molecule or sequence not normally occurring in the cell, tissue and / or individual to be treated. Both acquired and congenital diseases can be amenable to gene therapy.
[0134] In some aspects, the disclosure provides modified nucleic acids encoding mutant uricase or a functional fragment thereof. The disclosure also provides nucleic acid constructs that include as part of their sequence the modified nucleic acid(s) encoding mutant uricase or a functional fragment thereof. For example, the disclosure includes expression cassettes, plasmids and / or other vectors that include the modified nucleic acid sequence(s) along with other elements, such as regulatory elements. In some aspects, the disclosure provides a packaged gene delivery vehicle, such as a viral capsid, including the modified nucleic acid sequence(s) encoding mutant uricase or a functional fragment thereof. The disclosure also includes methods of expressing mutant uricase or a functional fragment thereof by delivering the modified nucleic acid sequence(s) into a cell along with elements required to promote expression in the cell. The disclosure also provides gene therapy methods in which the modified nucleic acid sequence(s) encoding mutant uricase or a functional fragment thereof is / are administered to a subject, e.g., as a component of one or more vectors and / or packaged as a component of one or more viral gene delivery vehicles. Treatment can, for example, be effected to treat or reduce thesymptoms of chronic refractory gout (e.g., Harrison Syndrome) in a subject in need thereof. Each of these aspects of the disclosure is discussed in further detail herein.
[0135] The term "pharmaceutical composition," as used herein, represents a composition comprising a compound or molecule described herein, e.g., a polynucleotide, expression cassette, vector, or rAAV vector disclosed herein, formulated with a pharmaceutically acceptable excipient, and can be manufactured or sold with the approval of a governmental regulatory agency as part of a therapeutic regimen for the treatment of disease in a mammal.
[0136] A "pharmaceutically acceptable excipient," as used herein, refers to any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient.
[0137] By a "reference" is meant any useful reference used to compare protein or mRNA levels or activity. The reference can be any sample, standard, standard curve, or level that is used for comparison purposes. The reference can be a normal reference sample or a reference standard or level. A "reference sample" can be, for example, a control, e.g., a predetermined negative control value such as a "normal control" or a prior sample taken from the same subject; a sample from a normal healthy subject, such as a normal cell or normal tissue; a sample (e.g., a cell or tissue) from a subject not having a disease; a sample from a subject that is diagnosed with a disease, but not yet treated with a compound described herein; a sample from a subject that has been treated by a compound described herein; or a sample of a purified protein (e.g., any described herein) at a known normal concentration.
[0138] As used herein, the term "subject" refers to any organism to which a composition disclosed herein, e.g., a polynucleotide, expression cassette, vector, rAAV vector, or composition of the present disclosure, can be administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include any animal (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans). A subject can seek or be in need of treatment, require treatment, be receiving treatment, be receiving treatment in the future, or be a human or animal who is under care by a trained professional for a particular disease or condition.
[0139] As used herein, the terms "treat," "treated," and "treating" mean both therapeutic treatment and prophylactic or preventative measures wherein the object is to prevent orslow down (lessen) an undesired physiological condition, disorder, or disease, or obtain beneficial or desired clinical results. In some aspects, treating reduces or lessens the symptoms associated with a disease or disorder. In some aspects, the treating results in a beneficial or desired clinical result.
[0140] Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease; stabilized (i.e., not worsening) state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder, or disease. In some aspects, treatment includes eliciting a clinically significant response without excessive levels of side effects. In some aspects, treatment includes prolonging survival as compared to expected survival if not receiving treatment. As used herein, the term "amelioration" or "ameliorating" refers to a lessening of severity of at least one indicator of a condition or disease. As used herein, the term "preventing" or "prevention" refers to delaying or forestalling the onset, development or progression of a condition or disease for a period of time, including weeks, months, or years.Uricase
[0141] The present disclosure provides polynucleotides (e.g., uricase expression cassettes), vectors, and rAAV vectors for delivery and expression of uricase to a cell or subject. In some aspects, the uricase expression cassette comprises a promoter operably linked to a nucleic acid encoding a uricase protein.
[0142] Uricase genes and proteins have been identified in several mammalian species, for example, pig, baboon, rat, rabbit, mouse, and rhesus monkey. The sequences of various uricase proteins are described herein by reference to their public data base accession numbers, as follows: gi|50403728|sp|P25689; gi|20513634|dbj |BAB91555.1; gi|176610|AAA35395.1; gi|20513654|dbj |BAB91557.1; gi|47523606|ref]NP— 999435.1; gi|6678509|ref]NP— 033500.1; gi|57463|emb|CAA31490.1; gi|20127395|re^NP— 446220. 1; gi| 137107|sp|Pl 1645; gi|51458661 |ref]XP— 497688.1; gi|207619|gb|AAA42318.1; gi|26340770|dbj|BAC34047.1; and gi|57459|emb|CAA30378.1. Each of these sequences and their annotations in the public databases accessible through the National Center forBiotechnology Information (NCBI) is incorporated by reference in its entirety. Additional ancestral uricases have been described, e.g., in Li Z et al. Mol. Biol. Evol. 2022; 39(l):msab312, which is incorporated herein by reference in its entirety.
[0143] In some aspects, the uricase protein is a full length version of a naturally occurring uricase protein or a modified version of a naturally occurring uricase protein, or any functional fragment thereof, or a fusion protein thereof. In some aspects, the uricase protein comprises an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 1-21, 95-97, or 99-107. In some aspects, the uricase protein comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1- 21, 95-97, or 99-107.
[0144] In some aspects, the uricase protein is a fusion protein (i.e., chimera) of pig uricase and baboon uricase. In some aspects, amino acids 1-252 of the pig uricase (e.g., SEQ ID NO: 2) (GenBank: AAA31141.1) and amino acids 253-304 of the baboon uricase (e.g., SEQ ID NO: 3) (GenBank: AAA35395.1) are selected to form a fusion protein.
[0145] In some aspects, the nucleic acid sequence encodes a full length version of a naturally occurring uricase protein or a functional fragment thereof, a modified version of a naturally occurring uricase protein or a functional fragment thereof, or a fusion protein thereof. In some aspects, the nucleic acid sequence encoding the uricase protein comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 22-36 or 108-113.
[0146] In some aspects, the uricase protein comprises a signal peptide sequence. In some aspects, the signal peptide sequence is selected from the group consisting of SEQ ID NOs: 10-13 or 98. In some aspects, the signal peptide comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any of SEQ ID NOs: 10-13 or 98. In some aspects, the uricase protein comprises an amino acid sequence selected from the group consisting of 1-9, 14-21, 95-97, and 99-107. In some aspects, the uricase protein comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NO: 1-9, or 14-21, 95-97, or 99-107. In some aspects, the uricase protein does not comprise a signal peptide sequence.
[0147] Certain aspects of the disclosure are directed to a polynucleotide comprising (i) a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 22-36 or 1 OS- 113; and, optionally, (ii) a nucleotide sequence encoding a signal peptide selected from the group consisting of SEQ ID NOs: 37-40 and 114. In some aspects, the polynucleotide comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 22-40 or 108-114. In some aspects, the polynucleotide further comprises (iii) a second nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 22-36 or 108-113. In some aspects, the nucleotide sequences (e.g., the first and second nucleotide sequence) are operably linked. In some aspects, the first and second nucleotide sequences are operably linked by an IRES sequence. In some aspects, the IRES sequence comprises a nucleotide sequence at least 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO: 85 or SEQ ID NO: 86. In some aspects, the polynucleotide comprises a single nucleotide sequence encoding a signal peptide selected from the group consisting of SEQ ID NOs: 37-40 and 114. In some aspects, at least one of the nucleotide sequences (e.g., the second nucleotide sequence) is not adjacent to a nucleotide sequence encoding a signal peptide.
[0148] In some aspects, the polynucleotide further comprises a promoter (e.g., a eukaryotic promoter). In some aspects, the promoter is a liver-specific promoter (e.g., a hAAT promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, or a DC 172 promoter). In some aspects, the promoter is a hAAT promoter. In some aspects, the promoter is a TBG promoter. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 71, SEQ ID NO: 89, SEQ ID NO: 93, or SEQ ID NO: 94.
[0149] In some aspects, the promoter is selected from the group consisting of a ubiquitous promoter e.g., a CAG promoter, a CBA promoter, a smCBA promoter, or a CMV promoter. In some aspects, the promoter is a CMV promoter. In some aspects, the promoter is a CBA promoter. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 61, 64-65, 71, 80-82, or 87-89. Insome aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 64-65 or 80-81.
[0150] In some aspects, the promoter is a muscle-specific promoter. In some aspects, the muscle-specific promoter is selected from the group consisting of muscle creatine kinase (MCK)-based promoters (e.g., a MCK promoter or a truncated MCK (tMCK) promoter), a CK6 promoter, a hybrid a-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), and a C5-12 synthetic promoter). In some aspects, the muscle-specific promoter is a CK8 promoter. In some aspects, the muscle-specific promoter is a MHCK7 promoter. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 87 or SEQ ID NO: 88.
[0151] In some aspects, the polynucleotide (e.g., expression cassette) further comprises a 5’ UTR and / or a 3’ UTR.
[0152] In some aspects, the polynucleotide (e.g., expression cassette) further comprises a polyadenylation (poly A) element.
[0153] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 43-50 or 115- 127. In some aspects, the uricase expression cassette comprises a nucleic acid encoding a promoter operably linked to a nucleic acid encoding a uricase protein. In some aspects the uricase protein comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1. In some aspects the uricase protein comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 4. In some aspects the uricase protein comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 5. In some aspects the uricase protein comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 15. In some aspects the uricase protein comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 19. In some aspects the uricase protein comprisesan amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 99. In some aspects, the uricase protein does not comprise a signal peptide sequence.
[0154] In certain aspects, a composition comprising a delivery vector, e.g., a viral vector, comprising nucleic acids encoding a uricase protein disclosed herein is suitable for delivery to a subject in need thereof.
[0155] In some aspects, a uricase expression cassette comprising a nucleic acid sequence encoding a uricase protein can be packaged in a viral vector (e.g., an AAV vector) disclosed herein, wherein the nucleic acid sequence encoding a uricase protein is operably linked with the promoter. In some aspects, the uricase expression cassette comprises a first nucleic acid encoding a uricase (e.g., comprising a signal peptide) and a second nucleic acid encoding a uricase (e.g., not comprising a signal peptide), wherein the first and second nucleic acids can be operably linked to a promoter, optionally the expression cassette can comprise a linker sequence (e.g., IRES, a Furin and / or F2A cleavage site) between the first and second nucleic acids. In some aspects, a second uricase expression cassette comprising a nucleic acid sequence encoding a uricase protein that does not comprise a signal peptide sequence can be packged in the viral vector (i.e., the same viral vector as a first uricase expression cassette). In some aspects, the two uricase encoding nucleic acids or the two uricase expression cassettes are operably linked (e.g., by an IRES sequence). In some aspects, the two uricase encoding nucleic acids or the two uricase expression cassettes are operably linked by a linker sequence. In some aspects, the linker sequence is selected from an IRES sequence, a proteolytic cleavage site (e.g., a furin and / or 2A cleavage site, e.g., F2A), or a combination thereof. In some aspects, the proteolytic cleavage site comprises a furin cleavage site, a 2A cleavage site, or a combination thereof. In some aspects, the linker comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 91. In some aspects, the furin cleavage site comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 90. In some aspects, the 2A cleavage site (e.g., F2A peptide sequence) comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 92.
[0156] In some aspects, the uricase protein encoded by the second uricase encoding nucleic acid or the first uricase expression cassette has less than 80% homology (i.e., less than 80% sequence identity) to the uricase protein encoded by the first uricase encoding nucleic acid or the first uricase expression cassette. In some aspects, the polynucleotide encoding a second uricase protein comprises a nucleotide sequence less than 80% identical to the nucleotide sequence of the uricase protein encoded by the first uricase encoding nucleic acid or the first uricase expression cassette.
[0157] In some aspects, the promoter can drive the expression of the uricase protein in a host cell (e.g., a hepatocyte cell). In some aspects, the polynucleotide (e.g., one or more uricase expression cassettes), vector, rAAV vector, or composition comprising the nucleic acid encoding the uricase protein can be formulated for administration to a subject, e.g., intramuscularly, intravenously, via a hepatic portal vein, or any combination thereof.
[0158] In some aspects, the nucleic acids encoding a protein or functional fragment thereof disclosed herein is suitable for delivery to other delivery sites disclosed herein. In some aspects, the nucleic acids encoding the uricase protein are modified nucleic acids.
[0159] In some aspects, the modified nucleic acid has reduced innate immunogenicity relative to the corresponding wild-type sequence and / or unmodified sequence. In some aspects, the modified nucleic acid has increased expression relative to the corresponding wild-type sequence and / or unmodified sequence. In some aspects, the modified nucleic acid has decreased expression relative to the corresponding wild-type sequence and / or unmodified sequence. In some aspects, the modified sequences are developed through in silico methods followed by manual sequence examination. Nucleic acids of the disclosure can be produced using molecular biology techniques, e.g., modified cDNAs encoding a uricase protein discussed herein can be obtained by PCR amplification or cDNA cloning techniques.Table 1: Uricase and Signal Peptide Amino Acid SequencesTable 2: Uricase and Signal Peptide Nucleotide SequencesUricase Expression Cassettes
[0160] In certain aspects, provided herein are uricase expression cassettes comprising a nucleotide sequence encoding a uricase protein (e.g., one or two uricase proteins), and vectors, e.g., vectors comprising such uricase expression cassettes for expression in a host cell. In some aspects, the uricase expression cassette comprises the nucleic acid sequence encoding a full length version of a naturally occurring uricase protein or a functional fragment thereof, a modified version of a naturally occurring uricase protein or a functional fragment thereof, or a fusion protein thereof. In some aspects, the uricase expression cassette comprises two or more uricase encoding nucleic acids which are operably linked (e.g., linked by an IRES sequence, a Furin and / or F2A cleavage site). In some aspects, the vector can comprise two or more uricase expression cassettes which are operably linked (e.g., linked by an IRES sequence, a Furin and / or F2A cleavage site). In some aspects, a first nucleic acid or a first uricase expression cassette comprising a nucleic acid sequence encoding a uricase protein or functional fragment thereof is operably linked (e.g., linked by an IRES sequence, a Furin and / or F2A cleavage site) to a second nucleic acid or a second uricase expression cassette comprising a nucleic acid sequence encoding a uricase protein or functional fragment thereof. In some aspects, the two uricase encoding nucleic acids or two uricase expression cassettes are operably linked by a linker sequence. In some aspects, the linker sequence is selected from an IRES sequence, a proteolytic cleavage site (e.g., a furin and / or 2A cleavage site, e.g., F2A), or a combination thereof. In some aspects, the proteolytic cleavage site comprises a furin cleavage site, a 2A cleavage site, or a combination thereof. In some aspects, the linker comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%,91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 91. In some aspects, the furin cleavage site comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 90. In some aspects, the 2A cleavage site (e.g., F2A peptide sequence) comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 92.
[0161] In some aspects, the uricase protein encoded by the second uricase encoding nucleic acid or second uricase expression cassette has less than 80% homology (i.e., less than 80% sequence identity) to the uricase protein encoded by the first uricase encoding nucleic acid or first uricase expression cassette. In some aspects, the polynucleotide encoding a second uricase protein comprises a nucleotide sequence less than 80% identical to the nucleotide sequence of the uricase protein encoded by the first uricase encoding nucleic acid or first uricase expression cassette.
[0162] In some aspects, the uricase protein or functional fragment thereof encoded by the first uricase expression cassette comprises a signal peptide sequence. In some aspects, the uricase protein or functional fragment thereof encoded by the second uricase encoding nucleic acid or the second uricase expression cassette does not comprise a signal peptide sequence.
[0163] In some aspects, the nucleic acid sequence encoding the uricase protein (e.g., the first or second uricase protein) comprises a nucleotide sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 22-36 or 108-113. In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 43-50 or 115-127.
[0164] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 43.
[0165] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 44.
[0166] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 45.
[0167] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 46.
[0168] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 47.
[0169] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 48.
[0170] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 49.
[0171] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 50.
[0172] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 115.
[0173] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 116.
[0174] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 117.
[0175] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 118.
[0176] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 119.
[0177] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 120.
[0178] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 121.
[0179] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 122.
[0180] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 123.
[0181] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 124.
[0182] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 125.
[0183] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 126.
[0184] In some aspects, the polynucleotide (e.g., expression cassette) comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 127.
[0185] Uricase expression cassettes provided herein can be, e.g., in the form of RNA or in the form of DNA. DNA includes cDNA, genomic DNA, and synthetic DNA, and DNA can be double-stranded or single-stranded. If single stranded, DNA can be the coding strand or non-coding (anti-sense) strand. In some aspects, the uricase expression cassette is a cDNA or a DNA lacking one more endogenous introns. In some aspects, the uricase expression cassettes is a non-naturally occurring uricase expression cassette. In some aspects, the uricase expression cassette is recombinantly produced. In some aspects, the uricase expression cassettes are isolated. In some aspects, the uricaseexpression cassettes are substantially pure. In some aspects, the uricase expression cassette is purified from natural components.
[0186] The Kozak consensus sequence, Kozak consensus or Kozak sequence, is known as a sequence which occurs on eukaryotic mRNA and has the consensus (gcc)gccRccAUGG (SEQ ID NO: 41), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another “G ” In some aspects, the vector comprises a nucleotide sequence having at least about 85%, at least about 90%, at least about 95% sequence identity, or more to the Kozak consensus sequence. In some aspects, the vector comprises a Kozak consensus sequence. In some aspects, the vector includes a Kozak consensus sequence after the polynucleotide encoding one or more proteins of interest is inserted into the vector, e.g., at the restrict site downstream of the promoter. For example, the vector can include a nucleotide sequence of GCCGCCATG, where the ATG is the start codon of the protein of interest. In some aspects, the vector comprises a nucleotide sequence of GCGGCCGCCATG (SEQ ID NO: 42), where the ATG is the start codon of the protein of interest.
[0187] In certain aspects, a composition comprising a delivery vector, e.g., a viral vector, comprising nucleic acids encoding a uricase protein are provided for herein. In some aspects, the delivery vector, e.g., the viral vector, further comprises nucleic acids encoding a second uricase protein that does not comprise a signal peptide sequence. In some aspects, the composition comprises a second delivery vector, e.g., a second viral vector, comprising nucleic acids encoding a second uricase protein that does not comprise a signal peptide sequence.
[0188] In some aspects, the delivery vector (e.g., a delivery vector comprising one or more nucleic acids encoding a uricase protein with or without a signal peptide sequence) is suitable for delivery or administration to a host cell or tissue. In some aspects, the delivery or administration is by injection (e.g., intramuscular, intraveneous, via hepatic portal vein, and / or via salivary glands). In some aspects, the delivery or administration is by infusion (e.g., intraveneous and / or via hepatic portal vein). In some aspects, the delivery or administration is by injection and / or infusion as a single dose. In some aspects, the single dose administration comprising multiple injections or infusions.
[0189] Also provided herein are kits, vectors, or host cells comprising (i) a uricase expression cassette comprising a nucleotide sequence encoding any one of SEQ ID NOs: 43-50 or 115-127 or any sequence in Table 3 and (ii) a delivery vector.Table 3: Expression Cassettes Encoding UricaseVector Constructs
[0190] Some aspects of the disclosure are directed to a vector construct or an expression construct (e.g., a uricase expression cassette) having a eukaryotic promoter operably linked to a nucleotide sequence that encodes a uricase protein disclosed herein. In some aspects, the vector constructs or expression constructs containing the nucleotide sequence (or the corresponding RNA sequence) which can be used in accordance with the disclosure can be any eukaryotic expression construct containing the DNA or the RNA sequence of interest. For example, a plasmid or viral construct (e.g. an AAV vector) can be cleaved to provide linear DNA having ligatable termini. These termini are bound to exogenous DNA having complementary, like ligatable termini to provide a biologically functional recombinant DNA molecule having an intact replicon and a desired phenotypic property. In some aspects, the vector construct or expression construct is capable of replication in both eukaryotic and prokaryotic hosts, which constructs are known in the art and are commercially available.
[0191] The exogenous (i.e., donor) DNA used in the disclosure is obtained from suitable cells, and the vector constructs or expression constructs prepared using techniques well known in the art. Likewise, techniques for obtaining expression of exogenous DNA or RNA sequences in a genetically altered host cell are known in the art (see e.g., Kormal et al., Proc. Natl. Acad. Sci. USA, 84:2150-2154 (1987); Sambrook et al. Molecular Cloning: a Laboratory Manual, 2nd Ed., 1989, Cold Spring Harbor Laboratory Press,Cold Spring Harbor, N.Y.; each of which are hereby incorporated by reference with respect to methods and compositions for eukaryotic expression of a DNA of interest).
[0192] In some aspects, the promoter is a strong, eukaryotic promoter such as a promoter from human cytomegalovirus (CMV), mouse CMV promoter, mouse mammary tumor virus (MMTV), Rous sarcoma virus (RSV), or adenovirus. Exemplary promoters include, but are not limited to the promoter from the immediate early gene of human CMV (Boshart et al., Cell 41 :521-530 (1985) and the promoter from the long terminal repeat (LTR) of RSV (Gorman et al, Proc. Natl. Acad. Sci. USA 79:6777-6781 (1982)). In some aspects, the promoter is a CMV early enhancer / chicken P actin (CBA) promoter, a human Ubiquitin C promoter (UBC), CAG promoter, CMV, a human elongation factor la promoter (EFla), EFla with a CMV enhancer, a CMV promoter with a CMV enhancer (CMVe / p), a CBA promoter with a CMV enhancer, a small chicken beta-actin promoter / cytomegalovirus enhancer (smCBA) promoter, a SV40 early promoter, a CMV promoter with a SV40 intron, a CBA promoter with a CMV enhancer and a CAG intron, a mouse phosphoglycerate kinase 1 promoter (PGK), EFla promoter with a truncated 5’ LTR and a chimeric HBG and IgHC intron.
[0193] In some aspects, the promoter is a ubiquitous promoter, e.g., a CAG promoter, a CMV promoter, and a smCBA promoter. In some aspects, the promoter is a CMV promoter. In some aspects, the promoter is a smCBA promoter. In some aspects, the promoter is a CBA promoter. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 64, 65, 80, or 81. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 64. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 65. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 80. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 81.
[0194] In some aspects, the vector construct or expression construct contains a promoter to facilitate expression of the nucleotide sequence within a host cell (e.g., a hepatocyte or a myocyte).
[0195] In some aspects, the promoter is a tissue-specific promoter. In some aspects, the promoter is a liver-specific promoter. In some aspects, the promoter is a muscle-specific promoter. In some aspects, the promoter is a human Alpha- 1 antitrypsin (hAAT) promoter, a thyroxine-binding globulin (TBG) promoter, a calmodulin-dependent protein kinase II (CAM) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, or DC 172 promoter. In some aspects, the promoter is a hAAT promoter. In some aspects, the promoter is a TBG promoter. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 71, SEQ ID NO: 89, SEQ ID NO: 93, or SEQ ID NO: 94.
[0196] In some aspects, the promoter is a muscle creatine kinase (MCK)-based promoter, e.g., as described in Wang B et al. Gene Ther. 2008; 15(22): 1489-99. In some aspects, the promoter is a MCK promoter, a truncated MCK (tMCK) promoter, a CK6 promoter, a hybrid a-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or a C5-12 synthetic promoter. In some aspects, the muscle-specific promoter is a CK8 promoter. In some aspects, the muscle-specific promoter is a MHCK7 promoter. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 87 or SEQ ID NO: 88.
[0197] In some aspects, the promoter comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 82.
[0198] In some aspects, the nucleic acid sequence comprising the promoter can comprises an intron. In some aspects, the intron is selected from the group consisting of an SV40 intron, MVM intron, or a human betaglobin intron.
[0199] In some aspects, the vector constructs or expression constructs of the disclosure can also include other components such as a marker (e.g., an antibiotic resistance gene (such as an ampicillin resistance gene) or P-galactosidase) to aid in selection of cells containing and / or expressing the construct, an origin of replication for stable replication of the construct in a bacterial cell (preferably, a high copy number origin of replication), anuclear localization signal, or other elements which facilitate production of the DNA construct, the protein encoded thereby, or both. In some aspects, the vector constructs of the disclosure can comprise an antibiotic resistance gene including, but not limited to, neomycin, kanamycin, puromycin, and / or zeocin. In some aspects, the vector constructs of the disclosure can comprise a ColEl, fl, pUC, pl5A or pMBl origin of replication.
[0200] In some aspects, the vector construct of the disclosure contains a backbone comprising a ColEl origin of replication and / or a kanamycin resistance gene of SEQ ID NO: 51.
[0201] In some aspects, the vector construct can comprise an ColEl origin of replication and kanamycin resistance such as 5’- gccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccat aggctccgcccccctgacggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgt ccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagct gggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacac gacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtgg tggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtag ctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctc aagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaa aaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaagcccaatctgaataatgttacaaccaattaaccaattctg attagaaaaactcatcgagcatcaaatgaaactgcaatttattcatatcaggattatcaataccatatttttgaaaaagccgtttctgta atgaaggagaaaactcaccgaggcagttccataggatggcaagatcctggtatcggtctgcgattccgactcgtccaacatcaat acaacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaatcaccatgagtgacgactgaatccggtgagaatggca aaagtttatgcatttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaaccaaaccgttattc attcgtgattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaatgcaaccggcgc aggaacactgccagcgcatcaacaatattttcacctgaatcaggatattcttctaatacctggaatgctgtttttccggggatcgcag tggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggcataaattccgtcagccagtttagtctg accatctcatctgtaacatcattggcaacgctacctttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaagcgat agattgtcgcacctgattgcccgacattatcgcgagcccatttatacccatataaatcagcatccatgttggaatttaatcgcggcct cgacgtttcccgttgaatatggctcat-3 ’ (SEQ ID NO: 51)
[0202] For eukaryotic expression, the vector construct or expression construct can comprise at a minimum a eukaryotic promoter operably linked to a DNA of interest, which is in turn operably linked to a polyadenylation sequence. The polyadenylation signal sequence can be selected from any of a variety of polyadenylation signal sequencesknown in the art. In some aspects, the polyadenylation signal sequence is the SV40 early polyadenylation signal sequence. In some aspects, the polyadenylation signal sequence is the bovine growth hormone polyadenylation signal sequence (bGHpA). In some aspects, the polyadenylation signal sequence is the human growth hormone polyadenylation signal sequence (hGHpA). In some aspects, the polyadenylation signal sequence is the SV40 polyadenylation signal sequence (SV40pA). The construct can also include one or more introns, which can increase levels of expression of the DNA of interest, particularly where the DNA of interest is a cDNA (e.g., contains no introns of the naturally-occurring sequence). Any of a variety of introns known in the art can be used (e.g., the human P- globin intron, which is inserted in the vector construct or expression construct at a position 5' to the DNA of interest). In some aspects, the intron is an SV40 intron. In some aspects, the intron is from an immunoglobulin heavy chain. In some aspects, the intron is a chimera between the human P-globin and immunoglobin heavy chain gene. In some aspects, the intron comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 75-79.
[0203] In some aspects, the polynucleotide comprises a poly(A). In some aspects, the poly(A) is a synthetic poly(A) or a bovine growth hormone (BGH) poly(A). In some aspects, the poly(A) comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 72 or SEQ ID NO: 73.
[0204] In some aspects, the nucleic acid sequence vector construct or expression construct comprises a nucleic acid encoding a signal peptide operably linked to a nucleic acid encoding a uricase protein. In some aspects, the signal peptide is an endogenous signal peptide. In some aspects, the signal peptide is a modified signal peptide. In some aspects, the nucleic acid sequence vector construct or expression construct comprises a nucleic acid encoding a uricase protein that is not operably linked to a nucleic acid encoding a signal peptide.
[0205] In some aspects, the nucleic acid sequence vector construct or expression construct comprises an IRES sequence. In some aspects, the IRES sequence comprises a nucleic acid sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity toSEQ ID NO: 85 or SEQ ID NO: 86. In some aspects, the IRES sequence comprises a nucleic acid sequence of SEQ ID NO: 85 or SEQ ID NO: 86.
[0206] In some aspects, the nucleic acid sequence vector or expression contruct comprises a proteolytic cleavage site (e.g., a furin and / or 2A cleavage site, e.g., F2A), or a combination thereof. In some aspects, the proteolytic cleavage site comprises a furin cleavage site, a 2A cleavage site, or a combination thereof. In some aspects, the linker comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 91. In some aspects, the furin cleavage site comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 90. In some aspects, the 2A cleavage site (e.g., F2A peptide sequence) comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 92.
[0207] In some aspects, the nucleic acid sequence vector construct or expression construct comprises a promoter, a nucleic acid encoding a signal peptide, and a nucleic acid encoding a uricase protein in a 5'-3' orientation.
[0208] In some aspects, the nucleic acid sequence vector construct or expression construct comprises a promoter, a nucleic acid encoding a uricase protein, and a nucleic acid encoding a signal peptide in a 5'-3' orientation.
[0209] In some aspects, the nucleic acid sequence vector construct or expression construct comprises a promoter and a nucleic acid encoding a uricase protein that does not comprise a signal peptide in a 5'-3' orientation.
[0210] In some aspects, the nucleic acid sequence vector construct or expression construct comprises a promoter, a nucleic acid encoding a signal peptide, a first nucleic acid encoding a uricase protein, an IRES sequence, a promoter, and a second nucleic acid encoding a uricase protein in a 5'-3' orientation.
[0211] In some aspects, the nucleic acid sequence vector construct or expression construct comprises a promoter, a first nucleic acid encoding a uricase protein, a nucleic acid encoding a signal peptide, an IRES sequence, a promoter, and a second nucleic acid encoding a uricase protein in a 5'-3' orientation.
[0212] In some aspects, the nucleic acid sequence vector construct or expression construct comprises a promoter, a first nucleic acid encoding a uricase protein, a nucleicacid encoding a signal peptide, proteolytic cleavage site, and a second nucleic acid encoding a uricase protein in a 5'-3' orientation.
[0213] The vector constructs for delivery of the polynucleotides (e.g., uricase expression cassettes) disclosed herein can be either viral or non-viral, or can be composed of naked DNA admixed with an adjuvant such as viral particles (e.g., AAV particle) or cationic lipids or liposomes. An "adjuvant" is a substance that does not by itself produce the desired effect, but acts to enhance or otherwise improve the action of the active compound.
[0214] In some aspects, a composition comprising a delivery vector, e.g., a viral vector, comprising a nucleic acid construct or an expression construct comprising a nucleic acid encoding a uricase protein disclosed herein. In some aspects, the delivery vector is suitable for delivery to a cell or tissue. In some aspects, the delivery vector is suitable for delivery to a combination of cells or tissues. In some aspects, the tissue is a connective tissue, a muscle tissue, a liver tissue, a kidney tissue, or an adipose tissue. In some aspects, the tissue is joint, cartilage, or bone tissue. In some aspects, the tissue is liver tissue. In some aspects, the tissue is muscle tissue. In some aspects, the tissue is kidney tissue. In some aspects, the tissue is muscle tissue, liver tissue, kidney tissue, or any combination thereof.
[0215] In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a promoter, a nucleic acid sequence encoding a uricase protein, and a poly(A) in the 5'-3' orientation.
[0216] In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a promoter, a nucleic acid sequence encoding a signal peptide, a nucleic acid sequence encoding a uricase protein, and a poly(A) in the 5'-3' orientation.
[0217] In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a promoter, a nucleic acid sequence encoding a uricase protein, a nucleic acid sequence encoding a signal peptide, and a poly(A) in the 5'-3' orientation.
[0218] In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a promoter, a nucleic acid sequence encoding a uricase protein that does not comprise a signal peptide, and a poly(A) in the 5'-3' orientation.
[0219] In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a first promoter, a nucleic acid sequence encoding a signalpeptide, a nucleic acid sequence encoding a uricase protein, a poly(A), an IRES sequence, a second promoter, a second nucleic acid encoding a uricase protein, and a poly(A) in the 5 '-3' orientation.
[0220] In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a first promoter, a nucleic acid sequence encoding a uricase protein, a nucleic acid sequence encoding a signal peptide, a poly(A), and IRES sequence, a second promoter, a second nucleic acid sequence encoding a uricase protein that does not comprise a signal peptide, and a poly(A) in the 5'-3' orientation.
[0221] In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a promoter, a nucleic acid sequence encoding a signal peptide, a nucleic acid sequence encoding a uricase protein, a poly(A), a proteolytic cleavage site, a second nucleic acid encoding a uricase protein that does not comprise a signal peptide, and a poly(A) in the 5'-3' orientation.
[0222] In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a promoter, a nucleic acid sequence encoding a uricase protein, a nucleic acid sequence encoding a signal peptide, a poly(A), a proteolytic cleavage site, a second nucleic acid sequence encoding a uricase protein that does not comprise a signal peptide, and a poly(A) in the 5'-3' orientation.
[0223] In some aspects, the nucleic acid construct or expression construct comprises a single promoter sequence. In some aspects, the single promoter sequence is located 5' of the nucleic acid sequence encoding a uricase protein.
[0224] In some aspects, the first promoter and the second promoter are the same sequence. In some aspects, the first promoter and the second promoter are different sequences.
[0225] In some aspects the nucleic acid sequence from ITR to ITR comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 52-59 or 128- 140, as shown in Table 4.Table 4. Vector ITR-to-ITR Sequences Encoding Uricase- Ill -
[0226] In some aspects, the vector constructs or expression constructs (e.g., one or more uricase expression cassettes) disclosed herein comprise one or more of the elements listed in Table 5.Table 5: Nucleic Acid Sequences of Exemplary Construct ElementsDelivery Vectors
[0227] Certain aspects of the disclosure are directed to a delivery vector comprising a nucleic acid encoding a uricase protein disclosed herein. In some aspects, the delivery vector comprises a second nucleic acid encoding a uricase protein that does not comprise a signal peptide sequence. In some aspects, the delivery vector is a viral vector, a non- viral vectors, a plasmid, a lipid, or a lysosome. In some aspects, the therapeutic effect of the uricase protein is local, systemic, or both.
[0228] In some aspects, the delivery vector is suitable for delivery or administration to or near a host cell, e.g., hepatocyte cells or cells of the salivary glands (e.g., acinar cells, ductal cells, and / or myoepithelial cells). In some aspects, the delivery or administration is by injection (e.g., intramuscular or intraveneous). In some aspects, the delivery or administration is by infusion. In some aspects, the delivery or administration is orally. In some aspects, the delivery or administration is by injection and / or infusion as a single dose. In some aspects, the single dose administration comprising multiple injections or infusions.
[0229] In some aspects, the delivery vector is an AAV vector (e.g., a rAAV vector).
[0230] In some aspects, the rAAV vector comprises (i) an AAV5 capsid and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a liver-specific promoter (e.g., an hAAT promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, or DC 172 promoter) operably linked to a nucleotide sequence encoding the uricase protein, optionally, wherein the uricase protein comprises a signal peptide sequence. In some aspects, the rAAV vector comprises (i) an AAV9 capsid and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a liver-specific promoter (e.g., an hAAT promoter, a human thyroxine binding globulin(TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, or a DC 172 promoter) operably linked to a nucleotide sequence encoding the uricase protein, optionally, wherein the uricase protein comprises a signal peptide sequence. In some aspects, the rAAV vector comprises (i) an AAV capsid selected from the group consisting of AAV5, AAV8, AAV9, AAVS3, AAV sL65, AAV LK03, AAV MLIV.K, AAV MLIV.A, AAV NP84, AAV NP59, AAV NP40, and AAV NP30 and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a liver-specific promoter (e.g., an hAAT promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, or DC 172 promoter) operably linked to a nucleotide sequence encoding the uricase protein, optionally, wherein the uricase protein comprises a signal peptide sequence. In aspects, the rAAV vector is suitable for delivery and / or administration by intravenous or hepatic portal vein to the liver.
[0231] In some aspects, the rAAV vector comprises (i) an AAV1 capsid and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a ubiquitous promoter (e.g., a CAG, CMV, or smCBA promoter) operably linked to a nucleotide sequence encoding the uricase protein, optionally, wherein the uricase protein comprises a signal peptide sequence.
[0232] In some aspects, the rAAV vector comprises (i) an AAV capsid selected from the group consisting of AAV2, AAV5, AAV8, AAV9, and AAVRhlO and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a ubiquitous promoter (e.g., a CAG, CMV, or smCBA promoter) operably linked to a nucleotide sequence encoding the uricase protein, optionally, wherein the uricase protein comprises a signal peptide sequence. In aspects, the rAAV vector is suitable for delivery and / or administration to the salivary gland.
[0233] In some aspects, the rAAV vector comprises (i) an AAV1 or AAV 8 capsid and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a muscle-specific promoter (e.g., a CK6 promoter, a CK8 promoter, or a hybrid a-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7)) operably linked to a nucleotide sequence encoding the uricase protein, optionally, wherein the uricase protein comprises a signal peptide sequence. In some aspects, the rAAV vector comprises a muscle-specific promoter (e.g., a muscle creatine kinase(MCK)-based promoter). In some aspects, the rAAV vector comprises a MCK promoter, a truncated MCK (tMCK) promoter, a CK6 promoter, a CK8 promoter, a hybrid a- myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or a C5-12 synthetic promoter. In some aspects, the muscle-specific promoter is a CK8 promoter. In some aspects, the muscle-specific promoter is a MHCK7 promoter. In aspects, the rAAV vector is suitable for delivery and / or administration by intramuscular injection.Non-Viral Vectors
[0234] The polynucleotide of the disclosure can be administered using a non-viral vector. "Non-viral vector," as used herein is meant to include naked DNA, chemical formulations containing naked DNA (e.g., a formulation of DNA and cationic compounds (e.g., dextran sulfate)), and naked DNA mixed with an adjuvant such as a viral particle (i.e., the DNA of interest is not contained within the viral particle, but the transforming formulation is composed of both naked DNA and viral particles (e.g., AAV particles) (see e.g., Curiel et al., Am. J. Respir. Cell Mol. Biol. 6:247-52 (1992)). Thus the "non-viral vector" can include vectors composed of DNA plus viral particles where the viral particles do not contain the DNA of interest within the viral genome.
[0235] In some aspects, the non-viral vector is a bacterial vector. See e.g., Baban etal., Bioeng Bugs., 1(6):385— 394 (2010).
[0236] In some aspects, the DNA of interest can be complexed with polycationic substances such as poly-L-lysine or DEAC-dextran, targeting ligands, and / or DNA binding proteins (e.g., histones). DNA- or RNA-liposome complex formulations comprise a mixture of lipids which bind to genetic material (DNA or RNA) and facilitate delivery of the nucleic acid into the cell. Liposomes which can be used in accordance with the disclosure include DOPE (dioleyl phosphatidyl ethanol amine), CUDMEDA (N-(5- cholestrum-3-P-ol 3-urethanyl)-N',N'-dimethylethylene diamine).
[0237] Lipids which can be used in accordance with the disclosure include, but are not limited to, DOPE (Dioleoyl phosphatidylethanolamine), cholesterol, and CUDMEDA (N- (5-cholestrum-3-ol 3 urethanyl)-N',N'-dimethylethylenediamine). As an example, DNA can be administered in a solution containing one of the following cationic liposome formulations: Lipofectin™ (LTI / BRL), Transfast™ (Promega Corp), Tfx50™ (Promega Corp), TfxlO™ (Promega Corp), or Tfx20™ (Promega Corp). The concentration of the liposome solutions range from about 2.5% to 15% volume:volume, preferably about 6%to 12% volume:volume. Further exemplary methods and compositions for formulation of nucleic acid (e.g., DNA, including DNA or RNA not contained within a viral particle) for delivery according to the method of the disclosure are described in U.S. Pat. Nos. 5,892,071; 5,744,625; 5,925,623; 5,527,928; 5,824,812; 5,869,715.
[0238] Polymer particles can be used in accordance with the disclosure for polymer- based gene delivery. See e.g., Putnam et al., PNAS 98 (3): 1200-1205 (2001).
[0239] The DNA of interest can also be administered as a chemical formulation of DNA or RNA coupled to a carrier molecule (e.g., an antibody or a receptor ligand) which facilitates delivery to host cells for the purpose of altering the biological properties of the host cells. The term "chemical formulations" refers to modifications of nucleic acids to allow coupling of the nucleic acid compounds to a carrier molecule such as a protein or lipid, or derivative thereof.
[0240] In certain aspects, a composition comprising a non-viral delivery vector comprising a nucleic acid encoding a uricase protein disclosed herein is suitable for delivery or administration is by injection (e.g., intramuscular or intraveneous). In some aspects, the delivery or administration is by infusion. In some aspects, the delivery or administration is by injection and / or infusion as a single dose. In some aspects, the single dose administration comprising multiple injections or infusions.
[0241] In some aspects, the composition comprising a non-viral delivery vector comprises a nucleic acid encoding a uricase protein disclosed herein that is produced in the target cells. In some aspects, the therapeutic effect of the uricase protein is local, systemic, or both.
[0242] In some aspects, the non-viral vector comprises a polynucleotide (e.g., expression cassette) comprising: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 43-50 or 115-127. In some aspects, the non-viral vector comprises a construct or expression construct (e.g., uricase expression cassette) comprising any one of SEQ ID NOs: 43-50 or 115-127.Viral Vectors
[0243] In general, viral vectors used in accordance with the disclosure can comprise a viral particle derived from a naturally-occurring virus which has been genetically altered to render the virus replication-defective and to express a recombinant gene of interest(e.g., a uricase gene) in accordance with the disclosure. Once the virus delivers its genetic material to a cell, it does not generate additional infectious virus but does introduce exogenous recombinant genes into the cell, preferably into the genome of the cell.
[0244] Numerous viral vectors are well known in the art, including, for example, retrovirus, adenovirus, adeno-associated virus (AAV), herpes simplex virus (HSV), cytomegalovirus (CMV), vaccinia and poliovirus vectors. In some aspects, the delivery vector (e.g., viral vector) is selected from the group consisting of an adeno-associated viral (AAV) vector, an adenoviral vector, a lentiviral vector, or a retroviral vector. AAV are preferred viral vectors since this virus efficiently infects slowly replicating and / or terminally differentiated cells.
[0245] Where a replication-deficient virus is used as the viral vector, the production of infective virus particles containing either DNA or RNA corresponding to the DNA of interest can be produced by introducing the viral construct into a recombinant cell line which provides the missing components essential for viral replication. In some aspects, transformation of the recombinant cell line with the recombinant viral vector will not result in production of replication-competent viruses, e.g., by homologous recombination of the viral sequences of the recombinant cell line into the introduced viral vector. Methods for production of replication-deficient viral particles containing a nucleic acid of interest are well known in the art and are described in, e.g., Rosenfeld et al., Science 252:431-434 (1991) and Rosenfeld et al., Cell 68:143-155 (1992) (adenovirus); U.S. Patent No. 5,139,941 (adeno-associated virus); U.S. Patent No. 4,861,719 (retrovirus); and U.S. Patent No. 5,356,806 (vaccinia virus).
[0246] In certain aspects, the viral delivery vector comprising a nucleic acid encoding a uricase protein disclosed herein is suitable for delivery to or near a host cell. In some aspects, the delivery or administration is by injection (e.g., intramuscular or intraveneous). In some aspects, the delivery or administration is by infusion. In some aspects, the delivery or administration is by injection and / or infusion as a single dose. In some aspects, the single dose administration comprising multiple injections or infusions.
[0247] In some aspects, the viral delivery vector comprises a nucleic acid encoding a therapeutic protein, e.g., a uricase protein disclosed herein is produced in a target cell. In some aspects, the therapeutic effect of the uricase protein is local, systemic, or both.
[0248] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising: a nucleotide sequence at least 85%, 86%, 87%,88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 43-50 or 115-127.
[0249] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 43.
[0250] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 44.
[0251] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 45.
[0252] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 46.
[0253] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 47.
[0254] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 48.
[0255] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 49.
[0256] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%,88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 50.
[0257] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 115.
[0258] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 116.
[0259] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 117.
[0260] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 118.
[0261] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 119.
[0262] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 120.
[0263] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 121.
[0264] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%,88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 122.
[0265] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 123.
[0266] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 124.
[0267] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 125.
[0268] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 126.
[0269] In some aspects, the viral vector (e.g., an AAV vector) comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 127.
[0270] In some aspects, the viral vector (e.g., an AAV vector) comprises a vector construct or expression construct (e.g., uricase expression cassette) comprising any one of SEQ ID NOs: 43-50 or 115-127.
[0271] In some aspects, the viral vector (e.g., an AAV vector) comprises a AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 52-59 or 128-140.Adeno-Associated Virus (AA V)-Mediated Gene Therapy
[0272] AAV, a parvovirus belonging to the genus Dependovirus, has several attractive features not found in other viruses. For example, AAV can infect a wide range of hostcells, including non-dividing cells. Furthermore, AAV can infect cells from different species. Importantly, AAV has not been associated with any human or animal disease, and does not appear to alter the physiological properties of the host cell upon integration. Finally, AAV is stable at a wide range of physical and chemical conditions, which lends itself to production, storage, and transportation requirements.
[0273] The AAV genome, a linear, single-stranded DNA molecule containing approximately 4700 nucleotides (the AAV-2 genome consists of 4681 nucleotides), generally comprises an internal non-repeating segment flanked on each end by an inverted terminal repeat (ITR). The ITRs are approximately 145 nucleotides in length (AAV-1 has ITRs of 143 nucleotides) and have multiple functions, including serving as origins of replication, and as packaging signals for the viral genome.
[0274] The internal non-repeated portion of the genome includes two large open reading frames (ORFs), known as the AAV replication (rep) and capsid (cap) regions. These ORFs encode replication and capsid gene products, respectively: replication and capsid gene products (i.e., proteins) allow for the replication, assembly, and packaging of a complete AAV virion. More specifically, a family of at least four viral proteins are expressed from the AAV rep region: Rep 78, Rep 68, Rep 52, and Rep 40, all of which are named for their apparent molecular weights. The AAV cap region encodes at least three proteins: VP1, VP2, and VP3.
[0275] AAV is a helper-dependent virus, requiring co-infection with a helper virus (e.g., adenovirus, herpesvirus, or vaccinia virus) in order to form functionally complete AAV virions. In the absence of co-infection with a helper virus, AAV establishes a latent state in which the viral genome inserts into a host cell chromosome or exists in an episomal form, but infectious virions are not produced. Subsequent infection by a helper virus "rescues" the integrated genome, allowing it to be replicated and packaged into viral capsids, thereby reconstituting the infectious virion. While AAV can infect cells from different species, the helper virus must be of the same species as the host cell. Thus, for example, human AAV will replicate in canine cells that have been co-infected with a canine adenovirus.
[0276] In some aspects, to produce recombinant AAV (rAAV) virions containing the DNA, a suitable host cell line is transfected with an AAV vector containing the DNA, but lacking rep and cap. The host cell is then infected with wild-type (wt) AAV and a suitable helper virus to form rAAV virions. Alternatively, wt AAV genes (known as helperfunction genes, comprising rep and cap) and helper virus function genes (known as accessory function genes) can be provided in one or more plasmids, thereby eliminating the need for wt AAV and helper virus in the production of rAAV virions. The helper and accessory function gene products are expressed in the host cell where they act in trans on the rAAV vector containing the heterologous gene. The heterologous gene is then replicated and packaged as though it were a wt AAV genome, forming a recombinant AAV virion. When a subject's cells are transduced with the resulting rAAV virion, the DNA enters and is expressed in the subject's cells. Because the subject's cells lack the rep and cap genes, as well as the accessory function genes, the rAAV virion cannot further replicate and package its genomes. Moreover, without a source of rep and cap genes, wt AAV virions cannot be formed in the patient's cells. See e.g., U.S. Appl. Publ. No. 2003 / 0147853.
[0277] In some aspects, AAV vectors of the present disclosure can comprise or be derived from any natural or recombinant AAV serotype. According to the present disclosure, the AAV serotype can be, but is not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh9, AAVrhlO, AAV11, AAV12, AAVS3, AAV sL65, AAV LK03, AAV MLIV.K, AAV MLIV. A, AAV NP59, AAV NP40, and AAV NP30. In some aspects, the AAV serotype is AAV1 or AAV5. In some aspect, the AAV vector is modified relative to the wild-type AAV serotype sequence. In some aspects, the AAV vector is modified relative to a wild-type AAV.
[0278] In aspects, the AAV vector is suitable for delivery and / or administration to the muscle, the salivary gland, the liver, or a combination thereof.
[0279] In some aspects, the AAV vector serotype is suitable for delivery to the salivary gland (e.g., serotype AAV2, AAV5, AAV8, AAV9, or AAVRhlO).
[0280] In some aspects, the AAV vector serotype is suitable for intramuscular delivery (e.g., serotype AAV1 or AAV8).
[0281] In some aspects, the AAV vector serotype is is suitable for delivery to the liver (e g., serotype AAV5, AAV8, AAV9, AAVS3, AAV sL65, AAV LK03, AAV-MLIV.K, AAV.MLIV.A, AAV-NP84, AAV-NP59, AAV-NP40 or AAV-NP30).
[0282] In some aspects, the AAV can be from a family of AAV capsid variants (e.g., MyoAAV) for muscle-directed gene delivery has been described (Tabebordbar M et al. Cell. 2021; 184(19): 4919-4937, which is incorporated herein by reference). In some aspects, controlling the expression of the uricase to only muscle cells may reduce theexpression of the uricase in immune cells, thereby limiting the generation of an immune response to the uricase protein.
[0283] In certain aspects, a composition comprising an AAV delivery vector comprising a nucleic acid encoding a uricase protein disclosed herein. In some aspects, the AAV delivery vector comprising a nucleic acid encoding a uricase protein disclosed herein suitable for delivery to a host cell. In some aspects, the delivery or administration is by injection. In some aspects, the delivery or administration is by infusion. In some aspects, the delivery or administration is by injection and / or infusion as a single dose. In some aspects, the single dose administration comprising multiple injections or infusions. In some aspects, the therapeutic effect of the uricase protein is local, systemic, or both.
[0284] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 43-50 or 115-127.
[0285] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 43.
[0286] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 44.
[0287] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 45.
[0288] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 46.
[0289] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%,89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 47.
[0290] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 48.
[0291] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 49.
[0292] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 50.
[0293] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 115.
[0294] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 116.
[0295] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 117.
[0296] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 118.
[0297] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%,89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 119.
[0298] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 120.
[0299] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 121.
[0300] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 122.
[0301] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 123.
[0302] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 124.
[0303] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 125.
[0304] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 126.
[0305] In some aspects, the AAV delivery vector comprises a polynucleotide (e.g., expression cassette) comprising a nucleotide sequence at least 85%, 86%, 87%, 88%,89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 127.
[0306] In some aspects, the AAV delivery vector comprises a vector construct or expression construct (e.g., uricase expression cassette) comprising any one of SEQ ID NOs: 43-50 or 115-127.AAV Vector ComponentsInverted Terminal Repeats (ITRs)
[0307] The AAV vectors of the present disclosure comprise a viral genome with at least one ITR region and a payload region, e.g., a polynucleotide (e.g., a uricase expression cassette) encoding a uricase protein disclosed herein. In some aspects, the AAV vector has two ITRs. These two ITRs flank the payload region at the 5' and 3' ends. The ITRs function as origins of replication comprising recognition sites for replication. ITRs comprise sequence regions, which can be complementary and symmetrically arranged. ITRs incorporated into AAV vectors of the disclosure can be comprised of naturally occurring polynucleotide sequences or recombinantly derived polynucleotide sequences.
[0308] The ITRs can be derived from the same serotype as the capsid, selected from any of the serotypes listed herein, or a derivative thereof. The ITR can be of a different serotype from the capsid. In some aspects, the AAV vector has more than one ITR. In a non-limiting example, the AAV vector has a viral genome comprising two ITRs. In some aspects, the ITRs are of the same serotype as one another. In some aspects, the ITRs are of different serotypes. Non-limiting examples include zero, one or both of the ITRs having the same serotype as the capsid. In some aspects both ITRs of the AAV vector are AAV1 ITRs. In some aspects both ITRs of the AAV vector are AAV5 ITRs. In some aspects both ITRs of the AAV vector are AAV8 ITRs. In some aspects both ITRs of the AAV vector are AAV9 ITRs.
[0309] Independently, each ITR can be about 75 to about 175 nucleotides in length. An ITR can be about 100-105 nucleotides in length, about 106-110 nucleotides in length, about 111-115 nucleotides in length, about 116-120 nucleotides in length, about 121-125 nucleotides in length, about 126-130 nucleotides in length, about 131-135 nucleotides in length, about 136-140 nucleotides in length, about 141-145 nucleotides in length or about 146-150 nucleotides in length. In some aspects, the ITRs are about 140-142 nucleotides inlength. Non-limiting examples of ITR length are about 102, about 140, about 141, about 142, about 145 nucleotides in length, and those having at least 95% identity thereto.
[0310] In some aspects, the AAV vector comprises at least one inverted terminal repeat having a length such as, but not limited to, about 75-80, about 75-85, about 75-100, about 80-85, about 80-90, about 80-105, about 85-90, about 85-95, about 85-110, about 90-95, about 90-100, about 90-115, about 95-100, about 95-105, about 95-120, about 100-105, about 100-110, about 100-125, about 105-110, about 105-115, about 105-130, about 110- 115, about 110-120, about 110-135, about 115-120, about 115-125, about 115-140, about 120-125, about 120-130, about 120-145, about 125-130, about 125-135, about 125-150, about 130-135, about 130-140, about 130-155, about 135-140, about 135-145, about 135- 160, about 140-145, about 140-150, about 140-165, about 145-150, about 145-155, about 145-170, about 150-155, about 150-160, about 150-175, about 155-160, about 155-165, about 160-165, about 160-170, about 165-170, about 165-175, or about 170-175 nucleotides.
[0311] In some aspects, the length of a first and / or a second ITR regions for the AAV vector can be about 75-80, about 75-85, about 75-100, about 80-85, about 80-90, about 80-105, about 85-90, about 85-95, about 85-110, about 90-95, about 90-100, about 90- 115, about 95-100, about 95-105, about 95-120, about 100-105, about 100-110, about 100-125, about 105-110, about 105-115, about 105-130, about 110-115, about 110-120, about 110-135, about 115-120, about 115-125, about 115-140, about 120-125, about 120- 130, about 120-145, about 125-130, about 125-135, about 125-150, about 130-135, about 130-140, about 130-155, about 135-140, about 135-145, about 135-160, about 140-145, about 140-150, about 140-165, about 145-150, about 145-155, about 145-170, about ISO- 155, about 150-160, about 150-175, about 155-160, about 155-165, about 160-165, about 160-170, about 165-170, about 165-175, and about 170-175 nucleotides.
[0312] In some aspects, the AAV vector comprises a nucleic acid sequence encoding a uricase protein disclosed herein which can be located near the 5 ' end of the flip ITR in the vector. In some aspects, the AAV vector comprises a nucleic acid sequence encoding a uricase protein disclosed herein, which can be located near the 3' end of the flip ITR in the vector. In some aspects, the AAV vector comprises a nucleic acid sequence encoding a uricase protein disclosed herein, which can be located near the 5' end of the flop ITR in the vector. In some aspects, the AAV vector comprises a nucleic acid sequence encoding a uricase protein disclosed herein, which can be located near the 3' end of the flop ITR inthe vector. In some aspects, the AAV vector comprises a nucleic acid sequence encoding a uricase protein disclosed herein, which can be located between the 5' end of the flip ITR and the 3' end of the flop ITR in the vector. In some aspects, the AAV vector comprises a nucleic acid sequence encoding a uricase protein disclosed herein, which can be located between (e.g., half-way between the 5' end of the flip ITR and 3' end of the flop ITR or the 3' end of the flop ITR and the 5' end of the flip ITR), the 3' end of the flip ITR and the 5' end of the flip ITR in the vector.
[0313] In some aspects, the AAV vector comprises a nucleic acid sequence encoding a uricase protein disclosed herein, which can be located within about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 or more than about 30 nucleotides downstream or upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in the vector.
[0314] As another non-limiting example, the AAV vector comprises a nucleic acid sequence encoding a uricase protein disclosed herein, which can be located within about 1-5, about 1-10, about 1-15, about 1-20, about 1-25, about 1-30, about 5-10, about 5-15, about 5-20, about 5-25, about 5-30, about 10-15, about 10-20, about 10-25, about 10-30, about 15-20, about 15-25, about 15-30, about 20-25, about 20-30 or about 25-30 nucleotides downstream or upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in the vector.
[0315] In some aspects, the AAV vector comprises a nucleic acid sequence encoding a uricase protein disclosed herein, which can be located within the first about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25% or more than about 25% of the nucleotides upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in the vector.
[0316] As another non-limiting example, the AAV vector comprises a nucleic acid sequence encoding a uricase protein disclosed herein, which can be located with the first about 1-5%, about 1-10%, about 1-15%, about 1-20%, about 1-25%, about 5-10%, about 5-15%, about 5-20%, about 5-25%, about 10-15%, about 10-20%, about 10-25%, about 15-20%, about 15-25%, or about 20-25% downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in the vector.
[0317] In some aspects, the nucleic acid sequence from ITR to ITR comprises: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 52-59 or 128- 140.
[0318] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 52.
[0319] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 53.
[0320] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 54.
[0321] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 55.
[0322] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 56.
[0323] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 57.
[0324] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 58.
[0325] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 59.
[0326] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 128.
[0327] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 129.
[0328] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 130.
[0329] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 131.
[0330] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 132.
[0331] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 133.
[0332] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 134.
[0333] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 135.
[0334] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 136.
[0335] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NOs 137.
[0336] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 138.
[0337] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 139.
[0338] In some aspects, the nucleic acid sequence from ITR to ITR comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 140.Promoters
[0339] In some aspects, the payload region of the AAV vector comprises at least one regulatory element to enhance the nucleic acid specificity and / or expression. Non-limiting examples of elements to enhance the nucleic acid specificity and expression include, e.g., promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (Poly A) signal sequences and upstream enhancers (USEs), CMV enhancers, and introns.
[0340] Expression of nucleic acid of the present disclosure after delivery to or integration in the genomic DNA of a target cell can require a specific promoter, including but not limited to, a promoter that is species specific, inducible, tissue-specific, or cell cyclespecific (Parr et al., Nat. Med.3: 1145-9 (1997); the contents of which are herein incorporated by reference in their entirety).
[0341] In some aspects, the promoter is deemed to be efficient when it drives expression of a uricase protein disclosed herein carried in the payload region of the AAV vector. In some aspects, the promoter is a promoter deemed to be efficient when it drives expression of the uricase protein of the present disclosure in the host cell being targeted.
[0342] Promoters can be naturally occurring or non-naturally occurring. Non-limiting examples of promoters include viral promoters and mammalian promoters. In some aspects, the promoters can be human promoters. In some aspects, the promoter can be truncated. Promoters which drive or promote expression in most tissues include, but are not limited to, human elongation factor la-subunit (EFla), cytomegalovirus (CMV) immediate-early enhancer and / or promoter, chicken P-actin (CBA) and its derivative CAG, P glucuronidase (GUSB), or ubiquitin C (UBC). In some aspects, the promoter is a tissue-specific promoter. In some aspects, the promoter is a liver-specific promoter. In some aspects, the promoter is a muscle-specific promoter. In some aspects, the promoter is a human Alpha- 1 antitrypsin (hAAT) promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, or a DC 172 promoter. In some aspects, the promoter is a TBG promoter. In some aspects, the promoter is a hAAT promoter. Insome aspects, the promoter is a muscle creatine kinase (MCK)-based promoter. In some aspects, the promoter is a MCK promoter, a truncated MCK (tMCK) promoter, a CK6 promoter, a hybrid a-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or a C5-12 synthetic promoter. In some aspects, the muscle-specific promoter is a CK8 promoter. In some aspects, the muscle-specific promoter is a MHCK7 promoter.
[0343] In some aspects, tissue-specific expression elements can be used to restrict expression to certain cell types such as, but not limited to, liver tissue promoters or muscle tissue promoters.
[0344] In some aspects, the promoter can be less than 1 kb. In some aspects, the promoter can have a length between about 15-20, about 10-50, about 20-30, about 30-40, about 40- 50, about 50-60, about 50-100, about 60-70, about 70-80, about 80-90, about 90-100, about 100-110, about 100-150, about 110-120, about 120-130, about 130-140, about 140- 150, about 150-160, about 150-200, about 160-170, about 170-180, about 180-190, about 190-200, about 200-210, about 200-250, about 210-220, about 220-230, about 230-240, about 240-250, about 250-260, about 250-300, about 260-270, about 270-280, about 280- 290, about 290-300, about 200-300, about 200-400, about 200-500, about 200-600, about 200-700, about 200-800, about 300-400, about 300-500, about 300-600, about 300-700, about 300-800, about 400-500, about 400-600, about 400-700, about 400-800, about 500- 600, about 500-700, about 500-800, about 600-700, about 600-800 or about 700-800 nucleotides.
[0345] In some aspects, the promoter can be a combination of two or more components of the same or different starting or parental promoters such as, but not limited to, CMV, CAG, EFla, and CBA. In some aspects, the promoter is a CMV early enhancer / chicken P actin (CAG) promoter, a CAG promoter, a CBA promoter, a human CMV promoter, a mouse CMV promoter, an EFla promoter, an EFla promoter with a CMV enhancer, a CMV promoter with a CMV enhancer (CMVe / p), a CMV promoter with a SV40 intron. In some aspects, the promoter is a CBA promoter.
[0346] In some aspects, each component in the promoter can have a length between about 200-300, about 200-400, about 200-500, about 200-600, about 200-700, about 200-800, about 300-400, about 300-500, about 300-600, about 300-700, about 300-800, about 400- 500, about 400-600, about 400-700, about 400-800, about 500-600, about 500-700, about 500-800, about 600-700, about 600-800 or about 700-800 nucleotides.
[0347] In some aspects, the AAV vector comprises a ubiquitous promoter. Non-limiting examples of ubiquitous promoters include, e.g., a human CMV promoter, a mouse CMV promoter, a CBA promoter (including derivatives CAG, CBh, etc.), an EF-la promoter, a PGK promoter, an UBC promoter, a GUSB promoter (hGBp), and an UCOE promoter (promoter of HNRPA2B1-CBX3).
[0348] In some aspects, the AAV vector comprises an enhancer element, a promoter and / or a 5'UTR intron. The enhancer element, also referred to herein as an "enhancer," can be, but is not limited to, a CMV enhancer, the promoter can be, but is not limited to, an EFla, CMV, CBA, UBC, GUSB, NSE, Synapsin, MeCP2, and GFAP promoter and the 5'UTR / intron can be, but is not limited to, SV40, CBA-MVM (Minute virus of mice), human P-globin, immunoglobulin heavy chain, a chimera between the human P-globin and immunoglobin heavy chain gene. In some aspects, the promoter is a cytomegalovirus (CMV) promoter. In some aspects, the promoter is a CBA promoter. In some aspects, the promoter is an EFla promoter. In some aspects, the promoter is a CAM promoter. In some aspects, the intron is a SV40 intron, MVM intron or a human betaglobin intron in the vector. In some aspects, the promoter is a CMV promoter fused to a CMV enhancer. In some aspects, the promoter is a CMV enhancer fused to an EFla promoter. In some aspects, the promoter is a CMV promoter fused to a SV40 intron. In some aspects, the AAV vector comprises an engineered promoter. In some aspects, the AAV vector comprises a CMV early enhancer / chicken P actin (CAG) promoter. In some aspects the AAV vector comprises a promoter from a naturally expressed protein. In some aspects, the enhancer comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 60, 62, or 63. In some aspects, the AAV vector comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 66-70 or 84.
[0349] In some aspects, the AAV vector comprises a human Alpha- 1 antitrypsin (hAAT) promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, or DC172 promoter, e.g., where the AAV serotype is AAV5 or AAV9.
[0350] In some aspects, the AAV vector comprises a simian virus 40 early promoter (SV40), a cytomegalovirus immediate-early promoter (CMV), a human Ubiquitin C promoter (UBC), a human elongation factor la promoter (EF1A), a mousephosphoglycerate kinase 1 promoter (PGK), CAG promoter, or a small chicken beta-actin promoter / cytomegalovirus enhancer (smCBA) promoter, e.g., where the AAV serotype is AAV1. In some aspects, the AAV vector comprises a muscle creatine kinase (MCK)- based promoter. In some aspects, the AAV vector comprises a MCK promoter, a truncated MCK (tMCK) promoter, a CK6 promoter, a hybrid a-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or a C5-12 synthetic promoter.
[0351] In some aspects, the AAV vector comprises a single promoter. In some aspects, the AAV vector comprises more than one promoter. In some aspects, the AAV vector comprises a promoter located 5' of the nucleic acid sequence encoding for a uricase protein.Untranslated Regions (UTRs)
[0352] By definition, wild-type untranslated regions (UTRs) of a gene are transcribed but not translated. Generally, the 5' UTR starts at the transcription start site and ends at the start codon and the 3' UTR starts immediately following the stop codon and continues until the termination signal for transcription.
[0353] Features typically found in abundantly expressed genes of specific target organs can be engineered into UTRs to enhance transcribed product stability and production. In some aspects, a 5' UTR from mRNA normally expressed in the liver (e.g., albumin, serum amyloid A, Apolipoprotein A / B / E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII) can be used in AAV vector of the disclosure to enhance expression.
[0354] Wild-type 5' untranslated regions (UTRs) include features which play roles in translation initiation. Kozak sequences, which are commonly known to be involved in the process by which the ribosome initiates translation of many genes, are usually included in 5' UTRs. Kozak sequences have the consensus CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG), which is followed by another 'G. In some aspects, the 5' UTR in an AAV vector of the present disclosure includes a Kozak sequence. In some aspects, the 5' UTR in an AAV vector of the present disclosure does not include a Kozak sequence.
[0355] Wild-type 3' UTRs are known to have stretches of Adenosines and Uridines embedded therein. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into three classes (Chen et al, 1995, the contents ofwhich are herein incorporated by reference in its entirety). Class I AREs, such as, but not limited to, c-Myc and MyoD, contain several dispersed copies of an AUUUA motif within U-rich regions. Class II AREs, such as, but not limited to, GM-CSF and IGFR-a, possess two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Class III ARES, such as, but not limited to, c-Jun and Myogenin, are less well defined. These U rich regions do not contain an AUUUA motif. Most proteins binding to the AREs are known to destabilize the messenger, whereas members of the ELAV family, most notably HuR, have been documented to increase the stability of mRNA. HuR binds to AREs of all the three classes. Engineering the HuR specific binding sites into the 3' UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of the message in vivo.
[0356] Introduction, removal or modification of 3' UTR AU rich elements (AREs) can be used to modulate the stability of polynucleotides. When engineering specific polynucleotides, e.g., payload regions of viral genomes, one or more copies of an ARE can be introduced to make polynucleotides less stable and thereby curtail translation and decrease production of the resultant protein. Likewise, AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein.
[0357] In some aspects, the 3' UTR of an AAV vector of the present disclosure can include an oligo(dT) sequence for addition of a poly-A tail.
[0358] In some aspects, an AAV vector of the present disclosure can be engineered to include, alter or remove at least one miRNA binding site, sequence or seed region.
[0359] Any UTR from any gene known in the art can be incorporated into an AAV vector of the present disclosure. These UTRs, or portions thereof, can be placed in the same orientation as in the gene from which they were selected or they can be altered in orientation or location. In some aspects, the UTR used in an AAV vector of the present disclosure can be inverted, shortened, lengthened, made with one or more other 5' UTRs or 3' UTRs known in the art. As used herein, the term "altered" as it relates to a UTR, means that the UTR has been changed in some way in relation to a reference sequence. For example, a 3' or 5' UTR can be altered relative to a wild-type or native UTR by the change in orientation or location as taught above or can be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. In some aspects, an AAV vector of the present disclosure comprises at least one artificialUTRs, which is not a variant of a wild-type UTR. In some aspects, an AAV vector of the present disclosure comprises UTRs, which have been selected from a family of transcripts whose proteins share a common function, structure, feature or property.Polyadenylation Sequence
[0360] In some aspects, the AAV vectors of the present disclosure comprise at least one polyadenylation sequence. The AAV vectors of the present disclosure can comprise a polyadenylation sequence between the 3' end of the payload coding sequence and the 5' end of the 3' ITR.
[0361] In some aspects, the polyadenylation sequence or "polyA sequence" can range from absent to about 500 nucleotides in length.
[0362] In some aspects, the polyadenylation sequence is about 10-100, about 10-90, about 10-80, about 10-70, about 10-60, about 10-55, about 10-50, about 20-100, about 20-90, about 20-80, about 20-70, about 20-60, about 20-55, about 20-50, about 30-100, about 30-90, about 30-80, about 30-70, about 30-60, about 30-55, about 30-50, about 40- 100, about 40-90, about 40-80, about 40-70, about 40-60, about 40-55, about 40-50, about 45-100, about 45-90, about 45-80, or about 45-70 about 45-60, about 45-55, about 45-50 nucleotides in length.
[0363] In some aspects, the AAV vector comprises a nucleic acid sequence encoding a uricase protein disclosed herein, which can be located upstream of the polyadenylation sequence in the vector. In some aspects, the AAV vector comprises a nucleic acid sequence encoding a uricase protein disclosed herein, which can be located downstream of a promoter such as, but not limited to, EFla, CMV, U6, CAG, smCBA, CBA, EFla with a CMV enhancer, CMV promoter with a SV40 intron, CMV promoter with a CMV enhancer, or a CBA promoter with a SV40 intron, a MVM intron, a human betaglobin intron, immunoglobulin heavy chain intron, or a chimera of a human betaglobin intron and a immunoglobulin heavy chain intron in the vector.
[0364] In some aspects, the AAV vector of the present disclosure comprises a nucleic acid sequence encoding a uricase protein disclosed herein, which can be located within about 1-5, about 1-10, about 1-15, about 1-20, about 1-25, about 1-30, about 5-10, about 5-15, about 5-20, about 5-25, about 5-30, about 10-15, about 10-20, about 10-25, about 10-30, about 15-20, about 15-25, about 15-30, about 20-25, about 20-30 or about 25-30nucleotides downstream from the promoter and / or upstream of the poly adenylation sequence in the vector.
[0365] In some aspects, the AAV vector comprises a rabbit globin polyadenylation (poly A) signal sequence. In some aspects, the AAV vector comprises a human growth hormone polyadenylation (poly A) signal sequence. In some aspects, the AAV vector comprises a bovine growth hormone polyadenylation (poly A) signal sequence.
[0366] In some aspects, the AAV vector comprises an SV40 polyadenylation signal sequence (SV40 pA), a bovine growth hormone polyadenylation signal sequence (bGHpA), or a human growth hormone polyadenylation signal sequence (hGHpA).Introns
[0367] In some aspects, the payload region of an AAV vector of the present disclosure comprises at least one element to enhance the expression such as one or more introns or portions thereof.
[0368] In some aspects, the promoter for an AAV vector of the present disclosure is a CMV promoter. In some aspects, the promoter for an AAV vector of the present disclosure is a CMV early enhancer / chicken P actin (CAG) promoter. As another nonlimiting example, the promoter for an AAV vector of the present disclosure is a smCBA promoter. In some aspects, the AAV vector can comprise a CBA promoter. In some aspects, the AAV vector can comprise a chimeric intron. In some aspects, the AAV vector can comprise a SV40 intron.
[0369] In some aspects, the promoter is a CMV early enhancer / chicken P actin (CAG) promoter, EFla, human CMV, mouse CMV, EFla promoter fused to CMV enhancer, CMV promoter fused to a SV40 intron, CMV promoter fused to a CMV enhancer, or a tissue-specific promoter. In some aspects, the tissue-specific promoter is a liver-specific promoter (e.g., a hAAT promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, or a DC 172 promoter). In some aspects, the liverspecific promoter is a TBG promoter. In some aspects, the liver-specific promoter is a hAAT promoter. In some aspects, the tissue-specific promoter is a muscle-specific promoter. In some aspects, the muscle-specific promoter is selected from the group consisting of (e.g., muscle creatine kinase (MCK)-based promoters such as a MCK promoter, a truncated MCK (tMCK) promoter, a CK6 promoter, a hybrid a-myosin heavychain enhancer- / MCK enhancer-promoter (MHCK7), or a C5-12 synthetic promoter). In some aspects, the muscle-specific promoter is a CK8 promoter.
[0370] In some aspects, the encoded uricase protein disclosed herein can be located downstream of a promoter in an expression vector such as, but not limited to, CMV, CBA, CAG, or smCBA promoter. In some aspects, the promoter comprises an intron such as SV40, MVM intron, a human betaglobin intron, human immunoglobulin heavy chain intron, a chimera of a human betaglobin intron and a human immunoglobulin heavy chain intron, or others known in the art. In some aspects, the intron is selected from the group consisting of an SV40 intron, MVM intron, a human betaglobin intron, a human immunoglobulin heavy chain intron, or a chimera of a human immunoglobulin heavy chain intron and a human betaglobin intron.Filler Sequences
[0371] In some aspects, the AAV vector comprises one or more filler sequences (also referred to as “stuffer sequences”). In some aspects, the AAV vector comprises one or more filler sequences in order to have the length of the AAV vector be the optimal size for packaging. In some aspects, the AAV vector comprises at least one filler sequence in order to have the length of the AAV vector be about 2.0-2.5 kb, e.g., about 2.3 kb. In some aspects, the AAV vector comprises at least one filler sequence in order to have the length of the AAV vector be about 4.6 kb. In some aspects, the vector backbone comprises a filler sequence.
[0372] In some aspects, the AAV vector comprises one or more filler sequences in order to reduce the likelihood that a hairpin structure of the vector genome (e.g., a modulatory polynucleotide described herein) can be read as an inverted terminal repeat (ITR) during expression and / or packaging. In some aspects, the AAV vector comprises at least one filler sequence in order to have the length of the AAV vector be about 2.0-2.5 kb, e.g., about 2.3 kb. In some aspects, the AAV vector comprises at least one filler sequence in order to have the length of the AAV vector be about 4.6 kb.
[0373] In some aspects, the AAV vector is a single stranded (ss) AAV vector and comprises one or more filler sequences which have a length about between 0.1 kb and about 3.8 kb.
[0374] In some aspects, the AAV vector is a self-complementary (sc) AAV vector and comprises one or more filler sequences which have a length about between about 0.1 kb and about 1.5 kb.
[0375] In some aspects, the AAV vector comprises any portion of a filler sequence. The vector can comprise, e.g., about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% of a filler sequence.
[0376] In some aspects, the AAV vector is a single stranded (ss) AAV vector and comprises one or more filler sequences in order to have the length of the AAV vector be about 4.6 kb. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 3' to the 5' ITR sequence. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 5' to a promoter sequence. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 3' to the polyadenylation signal sequence. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 5' to the 3' ITR sequence. In some aspects, the AAV vector comprises at least one filler sequence, and the filler sequence is located between two intron sequences. In some aspects, the AAV vector comprises at least one filler sequence, and the filler sequence is located within an intron sequence. In some aspects, the AAV vector comprises two filler sequences, and the first filler sequence is located 3' to the 5' ITR sequence and the second filler sequence is located 3' to the polyadenylation signal sequence. In some aspects, the AAV vector comprises two filler sequences, and the first filler sequence is located 5' to a promoter sequence and the second filler sequence is located 3' to the polyadenylation signal sequence. In some aspects, the AAV vector comprises two filler sequences, and the first filler sequence is located 3' to the 5' ITR sequence and the second filler sequence is located 5' to the 5' ITR sequence.
[0377] In some aspects, the AAV vector is a self-complementary (sc) AAV vector and comprises one or more filler sequences in order to have the length of the AAV vector be about 2.3 kb. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 3' to the 5' ITR sequence. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 5' to a promotersequence. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 3' to the polyadenylation signal sequence. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 5' to the 3' ITR sequence.
[0378] In some aspects, the AAV vector comprises at least one filler sequence, and the filler sequence is located between two intron sequences. In some aspects, the AAV vector comprises at least one filler sequence, and the filler sequence is located within an intron sequence. In some aspects, the AAV vector comprises two filler sequences, and the first filler sequence is located 3' to the 5' ITR sequence and the second filler sequence is located 3' to the polyadenylation signal sequence. In some aspects, the AAV vector comprises two filler sequences, and the first filler sequence is located 5' to a promoter sequence and the second filler sequence is located 3' to the polyadenylation signal sequence. In some aspects, the AAV vector comprises two filler sequences, and the first filler sequence is located 3' to the 5' ITR sequence and the second filler sequence is located 5' to the 5' ITR sequence.
[0379] In some aspects, the AAV vector can comprise one or more filler sequences between one of more regions of the AAV vector. In some aspects, the filler region can be located before a region such as, but not limited to, a payload region, an ITR, a promoter region, an intron region, an enhancer region, and / or a polyadenylation signal sequence region. In some aspects, the filler region can be located after a region such as, but not limited to, a payload region, an ITR, a promoter region, an intron region, an enhancer region, and / or a polyadenylation signal sequence region. In some aspects, the filler region can be located before and after a region such as, but not limited to, a payload region, an ITR, a promoter region, an intron region, an enhancer region, and / or a polyadenylation signal sequence region.
[0380] In some aspects, the AAV vector can comprise one or more filler sequences which bifurcates at least one region of the AAV vector. The bifurcated region of the AVV vector can comprise about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% of the of the region to the 5' of the filler sequence region.
[0381] In some aspects, the filler sequence can bifurcate at least one region so that about 10% of the region is located 5' to the filler sequence and about 90% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 20% of the region is located 5' to the filler sequence and about 80% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 30% of the region is located 5' to the filler sequence and about 70% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 40% of the region is located 5' to the filler sequence and about 60% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 50% of the region is located 5' to the filler sequence and about 50% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 60% of the region is located 5' to the filler sequence and about 40% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 70% of the region is located 5' to the filler sequence and about 30% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 80% of the region is located 5' to the filler sequence and about 20% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 90% of the region is located 5' to the filler sequence and about 10% of the region is located 3' to the filler sequence.
[0382] In some aspects, the AAV vector comprises a filler sequence after the 5' ITR. In some aspects, the AAV vector comprises a filler sequence after the promoter region. In some aspects, the AAV vector comprises a filler sequence after the payload region. In some aspects, the AAV vector comprises a filler sequence after the intron region. In some aspects, the AAV vector comprises a filler sequence after the enhancer region. In some aspects, the AAV vector comprises a filler sequence after the polyadenylation signal sequence region. In some aspects, the AAV vector comprises a filler sequence before the promoter region. In some aspects, the AAV vector comprises a filler sequence before the payload region. In some aspects, the AAV vector comprises a filler sequence before the intron region.
[0383] In some aspects, the AAV vector comprises a filler sequence before the enhancer region. In some aspects, the AAV vector comprises a filler sequence before thepolyadenylation signal sequence region. In some aspects, the AAV vector comprises a filler sequence before the 3' ITR. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the 5' ITR and the promoter region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the 5' ITR and the payload region.
[0384] In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the 5' ITR and the intron region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the 5' ITR and the enhancer region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the 5' ITR and the polyadenylation signal sequence region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the promoter region and the payload region.
[0385] In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the promoter region and the intron region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the promoter region and the enhancer region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the promoter region and the polyadenylation signal sequence region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the promoter region and the 3' ITR.
[0386] In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the payload region and the intron region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the payload region and the enhancer region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the payload region and the polyadenylation signal sequence region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the payload region and the 3' ITR.
[0387] In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the intron region and the enhancer region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the intron region and the polyadenylation signal sequence region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the intron region and the 3' ITR. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the enhancer region and the polyadenylation signal sequence region. Insome aspects, a filler sequence can be located between two regions, such as, but not limited to, the enhancer region and the 3' ITR. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the polyadenylation signal sequence region and the 3' ITR.
[0388] In some aspects, an AAV vector can comprise two filler sequences. The two filler sequences can be located between two regions as described herein.Method for Producing Recombinant AA Vs
[0389] The present disclosure provides also methods for the generation of AAV particles, by viral genome replication in a viral replication cell comprising contacting the viral replication cell with an AAV polynucleotide or AAV genome (e.g., rAAV vector of the present disclosure). In the context of the present disclosure, the AAV vectors disclosed herein, e.g., AAV vectors comprising at least one polynucleotide encoding a uricase protein disclosed herein are considered AAV payload construct vectors.
[0390] In some aspects, an AAV particle is produced by a method comprising the steps of (1) co-transfecting competent bacterial cells with a bacmid vector and either a viral construct vector and / or AAV payload construct vector, (2) isolating the resultant viral construct expression vector and AAV payload construct expression vector and separately transfecting viral replication cells, (3) isolating and purifying resultant payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, (4) co-infecting a viral replication cell with both the AAV payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, and (5) harvesting and purifying the viral particle comprising a parvoviral genome.
[0391] In some aspects, the present disclosure provides a method for producing an AAV particle comprising the steps of (1) simultaneously co-transfecting mammalian cells, such as, but not limited to HEK293 cells, with a payload region (e.g., polynucleotide encoding a uricase protein of the disclosure), a construct expressing rep and cap genes and a helper construct, and (2) harvesting and purifying the AAV particle comprising a viral genome.
[0392] In some aspects, the AAV particles can be produced in a viral replication cell that comprises an insect cell. Growing conditions for insect cells in culture, and production of heterologous products in insect cells in culture are well-known in the art, see, e.g., U.S. Patent No. 6,204,059.
[0393] The viral replication cell can be selected from any biological organism, including prokaryotic (e.g., bacterial) cells, and eukaryotic cells, including, insect cells, yeast cells and mammalian cells. Viral replication cells can comprise mammalian cells such as A549, WEH1, 3T3, 10T1 / 2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO. W138, HeLa, HEK293, Saos, C2C12, L cells, HT1080, HepG2 and primary fibroblast, hepatocyte and myoblast cells derived from mammals. Viral replication cells comprise cells derived from mammalian species including, but not limited to, human, monkey, mouse, rat, rabbit, and hamster or cell type, including but not limited to fibroblast, hepatocyte, tumor cell, cell line transformed cell, etc.
[0394] Viral production disclosed herein describes processes and methods for producing AAV particles that contact a target cell to deliver a payload, e.g. a recombinant viral construct, which comprises a polynucleotide sequence encoding a payload such as a uricase protein disclosed herein.
[0395] In some aspects, the AAV particles can be produced in a viral replication cell that comprises a mammalian cell. Viral replication cells commonly used for production of recombinant AAV particles include, but are not limited to 293 cells, COS cells, HeLa cells, and KB cells.
[0396] In some aspects, AAV particles are produced in mammalian cells wherein all three VP proteins are expressed at a stoichiometry approaching 1 : 1 : 10 (VP1 :VP2:VP3). The regulatory mechanisms that allow this controlled level of expression include the production of two mRNAs, one for VP1, and the other for VP2 and VP3, produced by differential splicing.
[0397] In some aspects, AAV particles are produced in mammalian cells using a triple transfection method wherein a payload construct, parvoviral Rep and parvoviral Cap and a helper construct are comprised within three different constructs. The triple transfection method of the three components of AAV particle production can be utilized to produce small lots of virus for assays including transduction efficiency, target tissue (tropism) evaluation, and stability.
[0398] In some aspects, the viral construct vector and the AAV payload construct vector can be each incorporated by a transposon donor / acceptor system into a bacmid, also known as a baculovirus plasmid, by standard molecular biology techniques known and performed by a person skilled in the art. Transfection of separate viral replication cell populations produces two baculoviruses, one that comprises the viral construct expressionvector, and another that comprises the AAV payload construct expression vector. The two baculoviruses can be used to infect a single viral replication cell population for production of AAV particles.
[0399] Baculovirus expression vectors for producing viral particles in insect cells, including but not limited to Spodoptera frugiperda (Sf9) cells, provide high titers of viral particle product. Recombinant baculovirus encoding the viral construct expression vector and AAV payload construct expression vector initiates a productive infection of viral replicating cells. Infectious baculovirus particles released from the primary infection secondarily infect additional cells in the culture, exponentially infecting the entire cell culture population in a number of infection cycles that is a function of the initial multiplicity of infection, see, e.g., Urabe, M. et al., J Virol. 2006 Feb; 80 (4): 1874-85, the contents of which are herein incorporated by reference in their entirety.
[0400] Production of AAV particles with baculovirus in an insect cell system can address known baculovirus genetic and physical instability. Baculovirus-infected viral producing cells are harvested into aliquots that can be cryopreserved in liquid nitrogen; the aliquots retain viability and infectivity for infection of large-scale viral producing cell culture (Wasilko DJ et al., Protein Expr Purif. 2009 Jun; 65(2): 122-32).
[0401] In some aspects, stable viral replication cells permissive for baculovirus infection are engineered with at least one stable integrated copy of any of the elements necessary for AAV replication and viral particle production including, but not limited to, the entire AAV genome, Rep and Cap genes, Rep genes, Cap genes, each Rep protein as a separate transcription cassette, each VP protein as a separate transcription cassette, the AAP (assembly activation protein), or at least one of the baculovirus helper genes with native or non-native promoters.
[0402] In some aspects, AAV particle production can be modified to increase the scale of production. Transfection of replication cells in large-scale culture formats can be carried out according to any methods known in the art.
[0403] In some aspects, cell culture bioreactors can be used for large scale viral production. In some cases, bioreactors comprise stirred tank reactors.Cell Lysis
[0404] Cells of the disclosure, including, but not limited to viral production cells, can be subjected to cell lysis according to any methods known in the art. Cell lysis can be carriedout to obtain one or more agents (e.g. viral particles) present within any cells of the disclosure.
[0405] Cell lysis methods can be chemical or mechanical. Chemical cell lysis typically comprises contacting one or more cells with one or more lysis agent. Mechanical lysis typically comprises subjecting one or more cells to one or more lysis condition and / or one or more lysis force. In some aspects, chemical lysis can be used to lyse cells. As used herein, the term "lysis agent" refers to any agent that can aid in the disruption of a cell. In some cases, lysis agents are introduced in solutions, termed lysis solutions or lysis buffers. As used herein, the term "lysis solution" refers to a solution (typically aqueous) comprising one or more lysis agent. In addition to lysis agents, lysis solutions can include one or more buffering agents, solubilizing agents, surfactants, preservatives, cryoprotectants, enzymes, enzyme inhibitors and / or chelators.
[0406] Concentrations of salts can be increased or decreased to obtain an effective concentration for rupture of cell membranes. Lysis agents comprising detergents can include ionic detergents or non-ionic detergents. Detergents can function to break apart or dissolve cell structures including, but not limited to cell membranes, cell walls, lipids, carbohydrates, lipoproteins and glycoproteins.
[0407] In some aspects, mechanical cell lysis is carried out. Mechanical cell lysis methods can include the use of one or more lysis condition and / or one or more lysis force. As used herein, the term "lysis condition" refers to a state or circumstance that promotes cellular disruption. Lysis conditions can comprise certain temperatures, pressures, osmotic purity, salinity and the like. In some aspects, lysis conditions comprise increased or decreased temperatures. In some aspects, lysis conditions comprise changes in temperature to promote cellular disruption. Cell lysis carried out according to such aspects can include freeze-thaw lysis.
[0408] As used herein, the term "lysis force" refers to a physical activity used to disrupt a cell. Lysis forces can include, but are not limited to mechanical forces, sonic forces, gravitational forces, optical forces, electrical forces and the like. Cell lysis carried out by mechanical force is referred to herein as "mechanical lysis." Mechanical forces that can be used according to mechanical lysis can include high shear fluid forces.
[0409] In some aspects, a method for harvesting AAV particles without lysis can be used for efficient and scalable AAV particle production. In a non-limiting example, AAV particles can be produced by culturing an AAV particle lacking a heparin binding site,thereby allowing the AAV particle to pass into the supernatant, in a cell culture, collecting supernatant from the culture; and isolating the AAV particle from the supernatant, as described in US Patent Application 20090275107.
[0410] Certain aspects of the disclosure are directed to host cells (e.g., mammalian cells) comprising the rAAV vectors of the disclosure. Except as otherwise indicated, methods known to those skilled in the art may be used for the construction of recombinant parvovirus and AAV (rAAV) constructs, packaging vectors expressing the parvovirus Rep and / or Cap sequences, and transiently and stably transacted packaging cells. Such techniques are known to those skilled in the art. See, e.g., SAMBROOK et al., MOLECULAR CLONING: A LABORATORY MANUAL 2nd Ed. (Cold Spring Harbor, N.Y., 1989); AUSUBEL el al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Green Publishing Associates, Inc. and John Wiley Sons, Inc., New York).A A V Purification
[0411] Cell lysates comprising viral particles can be subjected to clarification. Clarification refers to initial steps taken in purification of viral particles from cell lysates. Clarification serves to prepare lysates for further purification by removing larger, insoluble debris. Clarification steps can include, but are not limited to centrifugation and filtration.
[0412] In some aspects, AAV particles can be purified from clarified cell lysates by one or more methods of chromatography. Chromatography refers to any number of methods known in the art for separating out one or more elements from a mixture. Such methods can include, but are not limited to ion exchange chromatography (e.g. cation exchange chromatography and anion exchange chromatography), immunoaffinity chromatography and size-exclusion chromatography.Methods of Treatment and Use
[0413] Certain aspects of the disclosure are directed to the use of the polynucleotides (e.g., uricase expression cassettes), vectors, and rAAV of the disclosure for treating a subject in need thereof. Some aspects of the present disclosure are directed to a method of delivering a gene therapy encoding a uricase protein to a subject in need thereof. In certain aspects, the methods for disclosed herein comprise delivery or administration of a polynucleotide (e.g., uricase expression cassettes), delivery vector, rAAV, or compositiondisclosed herein to or near a host cell. In some aspects, the delivery or administration is by injection. In some aspects, the delivery or administration is by infusion. In some aspects, the delivery or administration is by injection and / or infusion as a single dose. In some aspects, the single dose administration comprising multiple injections or infusions.
[0414] Certain aspects of the disclosure are directed to methods of treating or ameliorating the symptoms associated with gout, chronic refractory gout, and / or Harrison Syndrome in a subject in need thereof, comprising administering to the subject a polynucleotide, an expression cassette, a vector, or a rAAV vector of the disclosure.
[0415] In some aspects, the methods disclosed are directed to a method of treating or ameliorating the symptoms associated with gout, chronic refractory gout, and / or Harrison Syndrome in a subject in need thereof, comprising administering to the subject a recombinant AAV (rAAV) vector comprising an AAV capsid and an AAV vector genome comprising AAV ITRs flanking a uricase expression cassette comprising a promoter operably linked to a polynucleotide encoding a uricase protein. In aspects, the delivery and / or administration is intramuscular or intravenous. In some aspects, the methods of the disclosures provide (i) reduced / regulated serum uric acid levels in the subject; (ii) reduced urate crystals (e.g., tophi) in the subject; (iii) reduced refractory gout episodes in the subject; or (iv) any combination thereof.
[0416] In some aspects, the method comprising administering a rAAV vector comprising: (i) an AAV5 capsid and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a liver-specific promoter (e.g., an hAAT promoter) operably linked to a nucleotide sequence encoding the uricase protein, optionally, wherein the uricase protein comprises a signal peptide sequence. In aspects, the rAAV vector is suitable for delivery and / or administration by intravenous or hepatic portal vein to the liver.
[0417] In some aspects, the method comprises adiminstering a rAAV vector comprising: (i) an AAV1 capsid and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a ubiquitous promoter (e.g., a CAG, CBA, or smCB A promoter) operably linked to a nucleotide sequence encoding the uricase protein, optionally, wherein the uricase protein comprises a signal peptide sequence. In aspects, the rAAV vector is suitable for delivery and / or administration by intramuscular injection.
[0418] In some aspects, the method comprises adiminstering a rAAV vector comprising: (i) an AAV1 capsid and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a muscle-specific promoter (e.g., a CK8 or MHCK7 promoter) operably linked to a nucleotide sequence encoding the uricase protein, optionally, wherein the uricase protein comprises a signal peptide sequence. In aspects, the rAAV vector is suitable for delivery and / or administration by intramuscular injection.
[0419] In some aspects, the rAAV vector comprises a polynucleotide (e.g., expression cassette) comprising: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 43-50 or 115-127. In some aspects, the rAAV delivery vector comprises a vector construct or expression construct (e.g., uricase expression cassette) comprising any one of SEQ ID NOs: 43-50 or 115-127.
[0420] In some aspects, the method comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 52-59 or 128-140.
[0421] In some aspects, the method comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 52.
[0422] In some aspects, the method comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 53.
[0423] In some aspects, the method comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 54.
[0424] In some aspects, the method comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 55.
[0425] In some aspects, the method comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 56.
[0426] In some aspects, the method comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 57.
[0427] In some aspects, the method comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 58.
[0428] In some aspects, the method comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 59.
[0429] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 128.
[0430] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 129.
[0431] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 130.
[0432] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 131.
[0433] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 132.
[0434] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 133.
[0435] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 134.
[0436] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 135.
[0437] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 136.
[0438] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 137.
[0439] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 138.
[0440] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 139.
[0441] In some aspects, the mehod comprises delivering a rAAV vector comprising an AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 140.
[0442] In some aspects, the methods disclosed are directed to a method of treating or ameliorating the symptoms associated with gout in a subject in need thereof.
[0443] In some aspects, the methods disclosed are directed to a method of treating or ameliorating the symptoms associated with chronic refractory gout in a subject in need thereof.
[0444] In some aspects, the methods disclosed are directed to a method of treating or ameliorating the symptoms associated with Harrison Syndrome.
[0445] In some aspects, the method comprises administering to the subject an AAV vector genome comprising a uricase expression cassette comprising a promoter operably linked to a polynucleotide encoding a uricase protein, wherein the the AAV vector genome is encapsidated by an AAV vector. In some aspects, the method comprises administering to the subject a recombinant AAV (rAAV) particle comprising an AAV capsid and the AAV vector genome comprising a uricase expression cassette comprising a promoter operably linked to a polynucleotide encoding a uricase protein. In aspects, the delivery and / or administration is intramuscular. In aspects, the delivery and / or administration is intravenous and / or via the hepatic portal vein. In some aspects, the methods of the disclosures provide (i) reduced / regulated serum uric acid levels in the subject; (ii) reduced tophi in the subject; (iii) reduced refractory gout episodes in the subject; or (iv) any combination thereof.
[0446] In some aspects, the method of the disclosure provides a serum uricase activity in the subject after administration of a polynucleotide (e.g., a uricase expression cassette) encoding a uricase protein, a vector (e.g., viral vector) comprising the same, a recombinant adeno-associated virus (rAAV) particle comprising the same, or a composition comprising the same as disclosed herein. In some aspects, the subject has a serum uricase activity of at least 5 mU / mL (e.g., at least 6 mU / mL, at least 7 mU / mL, at least 8 mU / mL, at least 9 mU / mL, at least 10 mU / mL, at least 11 mU / mL, at least 12 mU / mL, at least 13 mU / mL, at least 14 mU / mL, at least 15 mU / mL, at least 16 mU / mL, at least 17 mU / mL, at least 18 mU / mL, at least 19 mU / mL, or at least 20 mU / mL) after the administration (e.g., after a single dose and / or after multiple doses). In some aspects,the subject has a serum uricase activity of at least 5 mU / mL (e.g., at least 6 mU / mL, at least 7 mU / mL, at least 8 mU / mL, at least 9 mU / mL, at least 10 mU / mL, at least 11 mU / mL, at least 12 mU / mL, at least 13 mU / mL, at least 14 mU / mL, at least 15 mU / mL, at least 16 mU / mL, at least 17 mU / mL, at least 18 mU / mL, at least 19 mU / mL, or at least 20 mU / mL) for at least 1, 2, 3, or 4 weeks after administration. In some aspects, the subject has a serum uricase activity of at least 5 mU / mL (e.g., at least 6 mU / mL, at least 7 mU / mL, at least 8 mU / mL, at least 9 mU / mL, at least 10 mU / mL, at least 11 mU / mL, at least 12 mU / mL, at least 13 mU / mL, at least 14 mU / mL, at least 15 mU / mL, at least 16 mU / mL, at least 17 mU / mL, at least 18 mU / mL, at least 19 mU / mL, or at least 20 mU / mL) for more than 4 weeks after the administration.
[0447] In some aspects, the subject has a serum uricase activity of about 5 mU / mL to about 600 mU / mL after the administration of a polynucleotide (e.g., a uricase expression cassette) encoding a uricase protein, a vector (e.g., viral vector) comprising the same, a recombinant adeno-associated virus (rAAV) particle comprising the same, or a composition comprising the same as disclosed herein. In some aspects, the subject has a serum uricase activity of about 10 mU / mL to about 600 mU / mL after the administration. In some aspects, the subject has a serum uricase activity of about 10 mU / mL to about 300 mU / mL after the administration. In some aspects, the subject has a serum uricase activity of about 50 mU / mL to about 300 mU / mL after the administration. In some aspects, the subject has a serum uricase activity of about 100 mU / mL to about 300 mU / mL after the administration. In some aspects, the subject has a serum uricase activity of about 5 mU / mL to about 100 mU / mL after the administration. In some aspects, the subject has a serum uricase activity of about 5 mU / mL to about 50 mU / mL after the administration.
[0448] In some aspects, the subject has a serum uricase activity of between 5 mU / mL and 600 mU / mL after the administration of a polynucleotide (e.g., a uricase expression cassette) encoding a uricase protein, a vector (e.g., viral vector) comprising the same, a recombinant adeno-associated virus (rAAV) particle comprising the same, or a composition comprising the same as disclosed herein. In some aspects, the subject has a serum uricase activity of between 10 mU / mL and 600 mU / mL after the administration. In some aspects, the subject has a serum uricase activity of between 10 mU / mL and 300 mU / mL after the administration. In some aspects, the subject has a serum uricase activity of between 50 mU / mL and 300 mU / mL after the administration. In some aspects, the subject has a serum uricase activity of between 100 mU / mL and 300 mU / mL after theadministration. In some aspects, the subject has a serum uricase activity of between 5 mU / mL and 100 mU / mL after the administration. In some aspects, the subject has a serum uricase activity of between 5 mU / mL and 50 mU / mL after the administration.
[0449] In some aspects, the disclosure is directed to a method of delivering a gene therapy to a muscle tissue (e.g., intramuscularly). In some aspects, the disclosure is directed to a method of delivering a gene therapy to the liver (e.g., intravenously or via the hepatic portal vein). In some aspects, the therapeutic effect of the uricase gene therapy is local, systemic, or both.
[0450] In aspects, the methods disclosed are directed to administering a rAAV vector disclosed herein to the muscle, the salivary gland, the liver, or a combination thereof.
[0451] In some aspects, the administration is to the salivary gland and the rAAV vector comprises an AAV2, an AAV5, an AAV8, an AAV9, or an AAVRhlO serotype capsid.
[0452] In some aspects, the administration is intramuscular and the rAAV vector comprises an AAV1, an AAV8, or an AAV9 capsid. In some aspects, the administration is intramuscular and the rAAV vector comprises an AAV1 capsid. In some aspects, the administration is intramuscular and the rAAV vector comprises an AAV8 capsid. In some aspects, the administration is intramuscular and the rAAV vector comprises an AAV9 capsid.
[0453] In some aspects, the administration is to the liver and the rAAV vector comprises an AAV5, an AAV8, an AAV9, an AAVS3, an AAV sL65, an AAV LK03, an AAV- MLIV.K, an AAV.MLIV.A, an AAV-NP84, an AAV-NP59, an AAV-NP40 or an AAV- NP30 capsid.
[0454] In some aspects, the methods disclosed herein (e.g., for treating a subject suffering from gout, chronic refractory gout, and / or Harrison Syndrome) comprise administereing a rAAV vector comprising (i) an AAV5, an AAV8, an AAV9, an AAVS3, an AAV sL65, an AAV LK03, an AAV MLIV.K, an AAV MLIV. A, an AAV NP84, an AAV NP59, an AAV NP40 or an AAV NP30 capsid (e.g., an AAV5 or an AAV9 capsid) and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a liver-specific promoter (e.g., an hAAT promoter or a thyroxine-binding globulin (TBG)) operably linked to a nucleotide sequence encoding the uricase protein. In some aspects, the rAAV vector further comprises a second polynucleotide (e.g., a second expression cassette) comprising a promoter (e.g., a CAG, CMV, CBA, or smCBA promoter) operably linked to a nucleotide sequence encoding a uricase protein, optionallywherein the uricase protein comprises a signal peptide sequence. In some aspects, the first and second polynucleotide are operably linked. In some aspects, the first and second polynucleotide are operably linked by an internal ribosome entry site (IRES) sequence, a proteolytic cleavage site, or a combination thereof. In some aspects, the polynucleotides are operably linked by an IRES. In some aspects, the proteolytic cleavage site comprises a furin cleavage site, a 2A cleavage site, or a combination thereof. In aspects, the rAAV vector is suitable for delivery and / or administration by intravenous or hepatic portal vein to the liver.
[0455] In some aspects, the methods disclosed herein (e.g., for treating a subject suffering from gout, chronic refractory gout, and / or Harrison Syndrome) comprise administereing a rAAV vector comprising (i) an AAV1 or an AAV8 capsid and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a ubiquitous promoter (e.g., a CAG, CMV, CBA, or smCBA promoter) operably linked to a nucleotide sequence encoding the uricase protein, optionally, wherein the uricase protein comprises a signal peptide sequence. In some aspects, the rAAV vector further comprises a second polynucleotide (e.g., a second expression cassette) comprising a liverspecific promoter operably linked to a nucleotide sequence encoding a uricase protein, optionally wherein the uricase protein does not comprise a signal peptide sequence. In some aspects, the first and second polynucleotide are operably linked. In some aspects, the polynucleotides are operably linked by an IRES. In some aspects, the polynucleotides are operably linked by a proteolytic cleavage site. In aspects, the rAAV vector is suitable for delivery and / or administration by intramuscular injection.
[0456] In some aspects, the methods disclosed herein (e.g., for treating a subject suffering from gout, chronic refractory gout, and / or Harrison Syndrome) comprise administereing a rAAV vector comprising (i) an AAV2, an AAV5, an AAV8, an AAV9, or an AAVRhlO capsid and (ii) a vector genome comprising AAV ITRs flanking a polynucleotide (e.g., an expression cassette) comprising a ubiquitous promoter (e.g., a CAG, CMV, CBA, or smCBA promoter) operably linked to a nucleotide sequence encoding the uricase protein, optionally, wherein the uricase protein comprises a signal peptide sequence. In some aspects, the rAAV vector further comprises a second polynucleotide (e.g., a second expression cassette) comprising a liver-specific promoter operably linked to a nucleotide sequence encoding a uricase protein, optionally wherein the uricase protein does not comprise a signal peptide sequence. In some aspects, the first and second polynucleotideare operably linked. In some aspects, the polynucleotides are operably linked by an IRES. In some aspects, the polynucleotides are operably linked by a proteolytic cleavage site. In aspects, the rAAV vector is suitable for delivery and / or administration to a salivary gland.
[0457] Certain aspects of the disclosure are directed to a host cell (e.g., a mammalian cell) comprising a polynucleotide, an expression cassette, a vector, or a rAAV vector of the disclosure.
[0458] In some aspects, a delivery vector of the present disclosure (e.g., a viral vector, a non-viral vectors, a plasmid, a lipid, or a lysosome) comprising a promoter operably linked to a nucleic acid sequence that encodes a uricase protein disclosed herein can be administered to or near a target host cell.
[0459] In some aspects, the methods disclosed herein can be practiced through the administration of the gene therapy composition comprising the polynucleotide (e.g., uricase expression cassette), vector, rAAV particle, or composition of the present disclosure, a cell comprising the polynucleotide (e.g., uricase expression cassette), vector, or rAAV particle of the present disclosure, a cell comprising a nucleic acid encoding a uricase protein of the present disclosure integrated into its genomic DNA, or a pharmaceutical composition comprising any of the above. Thus, methods disclosed herein reciting the administration of the polynucleotide (e.g., uricase expression cassette), vector, or rAAV particle of the present disclosure can be also practiced by administering any of these compositions.
[0460] In some aspects, methods disclosed herein can be practiced through the administration of a gene therapy composition comprising a nucleic acid encoding a uricase protein disclosed herein.
[0461] Based on the methods disclosed herein, the gene therapy composition comprising a uricase expression cassette, an AAV vector genome, or an rAAV particle of the present disclosure for use in therapy, or for use as a medicament, or for use in treating a disease or disorder a subject in need thereof is contemplated. In some aspects, the disease or disorder to be treated is gout. In some aspects, the disease or disorder to be treated is chronic refractory gout. In some aspects, the disease or disorder to be treated is Harrison Syndrome.
[0462] In some aspects, administration of the gene therapy composition comprising an uricase expression cassette, an AAV vector genome, or a rAAV particle of the present disclosure can decrease serum uric acid levels.
[0463] In some aspects, the delivery or administration is by injection. In some aspects, the delivery or administration is by infusion. In some aspects, the delivery or administration is by injection and / or infusion as a single dose. In some aspects, the single dose administration comprising multiple injections or infusions. In some aspects, the subject suffers from gout, chronic refractory gout, and / or Harrison Syndrome.Pharmaceutical Compositions
[0464] Certain aspects of the disclosure are directed to a pharmaceutical composition comprising a polynucleotide (e.g., uricase expression cassette), vector, or rAAV of the disclosure. In some aspects, a pharmaceutical composition disclosed herein comprises a delivery vector of the present disclosure (e.g., an AAV vector) comprising a promoter operably linked to a nucleic acid sequence that encodes a uricase protein disclosed herein and a pharmaceutically-acceptable excipient or carrier. Pharmaceutically acceptable excipients or carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition.
[0465] Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions comprising a delivery vector of the present disclosure (e.g., an AAV vector) or a plurality thereof (see, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 18th ed. (1990)). The pharmaceutical compositions are generally formulated sterile and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration. In some aspects, the pharmaceutical composition comprises more than one AAV vector of the present disclosure, wherein each vector comprises at least one polynucleotide encoding at least one therapeutic molecule disclosed herein.
[0466] In some aspects, a pharmaceutical composition comprises (i) one or more delivery vectors disclosed herein (e.g., AAV vectors or AAV capsids), and (ii) one or more additional therapeutic agents for the treatment of a disorder. In some aspects, the one or more delivery vectors disclosed herein (e.g., AAV vectors or AAV capsids) and the one or more therapeutic agents for a disease or disorder (e.g., gout, chronic refractory gout, and / or Harrison Syndrome) are co-administered in a single pharmaceutical composition.
[0467] In some aspects, the pharmaceutical composition comprises a rAAV vector comprising a polynucleotide (e.g., expression cassette) comprising: a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,99%, or 100% identical to any one of SEQ ID NOs: 43-50. In some aspects, pharmaceutical composition comprises a rAAV delivery vector comprising a vector construct or expression construct (e.g., uricase expression cassette) comprising any one of SEQ ID NOs: 43-50 or 115-127.
[0468] In some aspects, the pharmaceutical composition comprises a rAAV vector comprises a AAV genome comprising from ITR to ITR a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 52-59 or 128-140.
[0469] In some aspects, the polynucleotide (e.g., uricase expression cassette), vector, or rAAV of the disclosure are formulated for the treatment of a disease or disorder (e.g., gout, chronic refractory gout, and / or Harrison Syndrome), and optionally, are coadministered with an additional therapeutic agent as a separate pharmaceutical composition (e.g., prior to, after, or concurrently with administration of the polynucleotide (e.g., uricase expression cassette), vector, or rAAV of the disclosure).
[0470] In some aspects, the pharmaceutical composition is for use as a medicament. In some aspects, the medicament is used for preventing, reducing or ameliorating the symptoms of, delaying, curing, reverting and / or treating gout, chronic refractory gout, and / or Harrison Syndrome. In some aspects, the subject treated is a mammal, e.g. cats, rodent, (mice, rats, gerbils, guinea pigs, mice or rats), dogs, or humans.
[0471] Therapeutic agent for gout typically fall into two broad categories, uric acid lowering drugs and anti-inflammatory drugs that control the onset of acute inflammation. The uric acid-lowering drugs can be classified into xanthine oxidase inhibitors for reducing the production of uric acid, uricosuric drugs for increasing the excretion of uric acid, and uricase for decomposing uric acid according to the mechanism of action. Xanthine Oxidase Inhibitors (XOI) are first-line uric acid lowering drugs, and includ allopurinol, febuxostat and topiroxostat. Uricosuric drugs include probenecid as the first- line single agent, the combination of fenofibrate and losartan, metrazolidone, and benzbromarone. Anti-inflammatory drugs include glucocorticoids, non-steroidal antiinflammatory drugs (NSAIDs) and colchicine.
[0472] In some aspects, the modified nucleic acid, expression construct, delivery vector and / or composition is used for preventing, reducing or ameliorating the symptoms of, delaying, reverting, curing and / or treating gout, chronic refractory gout, and / or Harrison Syndrome, when said the modified nucleic acid, expression construct, delivery vectorand / or composition is able to exhibit an anti-gout effect. An anti-gout effect can be reached when uric acid levels in the blood are decreased and / or regulated in the subject. This can be assessed using techniques known to the skilled person. In this context, “decrease” means at least a detectable decrease using an assay known to the skilled person or using assays as carried out in the experimental part.
[0473] An anti-gout effect can also be observed when the progression of a typical symptom (i.e. acute inflammatory arthritis, tophi) has been slowed down as assessed by a physician. A decrease of a typical symptom associated with gout can mean a slowdown in progression of symptom development or a complete disappearance of symptoms. Symptoms, and also a decrease in symptoms, can be assessed using a variety of methods, to a large extent the same methods as used in diagnosis of gout, including clinical examination and routine laboratory tests. Such methods include both macroscopic and microscopic methods, as well as molecular methods, biochemical, immunohistochemical and others.
[0474] A medicament as provided herein is preferably able to alleviate one symptom or one characteristic of a patient or of a cell, tissue or organ of said gout patient if after at least one week, one month, six month, one year or more of treatment using the modified nucleic acid, viral expression construct, viral vector, or composition disclosed herein, said symptom or characteristic is decreased or no longer detectable.
[0475] In some aspects, the pharmaceutical composition of the disclosure is formulated for administration to or near a target host cell. In some aspects, the composition is formulated for delivery or administration is by injection. In some aspects, the composition is formulated for delivery or administration is by infusion. In some aspects, the composition is formulated for delivery or administration is by injection and / or infusion as a single dose.
[0476] Also provided herein are pharmaceutical compositions comprising delivery vectors disclosed herein (e.g., uricase expression cassettes or rAAV particles) having the desired degree of purity, and a pharmaceutically acceptable carrier or excipient, in a form suitable for administration to a subject. Pharmaceutically acceptable excipients or carriers can be determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions comprising a plurality of vectors, e.g., AAV vectors described herein. (See, e.g., Remington's PharmaceuticalSciences, Mack Publishing Co., Easton, Pa. 21st ed. (2005)). The pharmaceutical compositions are generally formulated sterile and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.
[0477] Acceptable carriers, excipients, or stabilizers are nontoxic to recipients (e.g., animals or humans) at the dosages and concentrations employed.
[0478] Examples of carriers or diluents include, but are not limited to, water, saline, Ringer's solutions, dextrose solution, and 5% human serum albumin. Except insofar as any conventional media or compound is incompatible with the delivery vectors disclosed herein (e.g., uricase expression cassettes or rAAV particles), use thereof in the compositions is contemplated. In some aspects, a pharmaceutical composition is formulated to be compatible with its intended route of administration.
[0479] In some aspects, the pharmaceutical composition comprising the delivery vectors disclosed herein (e.g., uricase expression cassettes or rAAV particles) is administered intravenously, e.g. by injection or hepatic portal vein. In some aspects, the pharmaceutical composition comprising the delivery vectors disclosed herein (e.g., uricase expression cassettes or rAAV particles) is administered intramuscularly. The delivery vectors disclosed herein (e.g., uricase expression cassettes or rAAV particles) can optionally be administered in combination with other therapeutic agents that are at least partly effective in treating the disease, disorder or condition for which the delivery vectors disclosed herein (e.g., uricase expression cassettes or rAAV particles) are intended.
[0480] The delivery vectors disclosed herein (e.g., uricase expression cassettes or rAAV particles) can be formulated using one or more excipients to (1) increase stability; (2) increase cell transfection or transduction; (3) permit the sustained or delayed release; or (4) alter the biodistribution (e.g., target the AAV vector to specific tissues or cell types).
[0481] In some aspects, the AAV serotype of the rAAV particle is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh9, AAV9, AAVrhlO, AAV10, AAV11, AAV12, AAVS3, AAV sL65, AAV LK03, AAV MLIV.K, AAV MLIV. A, AAV NP59, AAV NP40, and AAV NP30. In aspects, the AAV serotype is AAV1. In aspects, the AAV serotype is AAV5. In aspects, the AAV serotype is AAV8. In aspects, the AAV serotype is AAV9.
[0482] In some aspects, the recombinant AAV (rAAV) particle comprises an expression cassette comprising a ubiquitous promoter (e.g., a CAG promoter, a CMV promoter, or a smCBA promoter) operably linked to a nucleotide sequence encoding a uricase protein,wherein the AAV serotype is AAV1. In some aspects, the rAAV particle is administered intramuscularly, thereby producing uricase protein and / or treating gout, chronic refractory gout, and / or Harrison Syndrome in the subject.
[0483] In some aspects, the recombinant AAV (rAAV) particle comprises an expression cassette comprising a muscle-specific promoter (e.g., a CK8 promoter or a MHCK7 promoter) operably linked to a nucleotide sequence encoding a uricase protein, wherein the AAV serotype is AAV1. In some aspects, the recombinant AAV (rAAV) particle comprises an expression cassette comprising a muscle-specific promoter (e.g., a CK6 promoter, a CK8 promoter, or a hybrid a-myosin heavy chain enhancer- / MCK enhancerpromoter (MHCK7)) operably linked to a nucleotide sequence encoding a uricase protein, wherein the AAV serotype is selected from AAV1 and AAV8. In some aspects, the rAAV particle is administered intramuscularly, thereby producing uricase protein and / or treating gout, chronic refractory gout, and / or Harrison Syndrome in the subject.
[0484] In some aspects, the recombinant AAV (rAAV) particle comprises an expression cassette comprising a ubiquitous promoter (e.g., a CAG, CMV, CBA, or smCBA promoter) operably linked to a nucleotide sequence encoding a uricase protein, wherein the AAV serotype is selected from the group consisting of AAV2, AAV5, AAV8, AAV9, and AAVRhlO. In some aspects, the rAAV particle is administered via the salivary gland(s), thereby producing uricase protein and / or treating gout, chronic refractory gout, and / or Harrison Syndrome in the subject.
[0485] In some aspects, the recombinant AAV (rAAV) particle comprises an expression cassette comprising a liver-specific promoter (e.g., a human Alpha-1 antitrypsin (hAAT) promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, or DC 172 promoter) operably linked to a nucleotide sequence encoding a uricase protein, wherein the AAV serotype is selected from any one of AAV5, AAV8, AAV9, AAVS3, AAV sL65, AAV LK03, AAV MLIV.K, AAV MLIV. A, AAV NP84, AAV NP59, AAV NP40 and AAV NP30. In some aspects, the rAAV particle is administered intravenously, via the hepatic portal vein, thereby producing uricase protein and / or treating gout, chronic refractory gout, and / or Harrison Syndrome in the subject.Administration
[0486] The compositions and delivery vectors disclosed herein (e.g., uricase expression cassettes or rAAV particles) can be administered by any route which results in a therapeutically effective outcome, e.g., for therapeutic expression of a uricase protein disclosed herein. In some aspects, the administration can be to or near the target host cells. In some aspects, the delivery or administration is by injection. In some aspects, the delivery or administration is by infusion. In some aspects, the delivery or administration is orally. In some aspects, the delivery or administration is by injection and / or infusion as a single dose. In some aspects, the single dose administration comprising multiple injections or infusions.
[0487] The amount of nucleic acid to transform a sufficient number of cells and provide for expression of therapeutic levels of the protein can be assessed using an animal model (e.g., a rodent (mouse or rat) or other mammalian animal model) to assess factors such as the efficiency of transformation, the levels of protein expression achieved, the susceptibility of the targeted cells to transformation, and the amounts of vector and / or nucleic acid required to transform target cells.
[0488] The precise amount of vector and / or nucleic acid administered will vary greatly according to a number of factors including the susceptibility of the target cells to transformation, the size and weight of the subject, the levels of protein expression desired, and the condition to be treated.
[0489] In some aspects, the pharmaceutical composition comprising a polynucleotide (e.g., uricase expression cassette), vector, or rAAV of the disclosure van be administered by intramuscular injection.
[0490] In some aspects, the pharmaceutical composition comprising a polynucleotide (e.g., uricase expression cassette), vector, or rAAV of the disclosure can be administered intravenously, into the hepatic portal vein, and / or into the salivary gland(s).
[0491] The delivery vectors disclosed herein (e.g., AAV vectors or AAV capsids) can be administered in any suitable form, either as a liquid solution or suspension, as a solid form suitable for liquid solution or suspension in a liquid solution.Kits
[0492] The present disclosure also provides kits, or products of manufacture, comprising (i) a polynucleotide (e.g., uricase expression cassette), vector, rAAV, or pharmaceutical composition of the disclosure the delivery vector of the present disclosure, and (ii) optionally instructions for use (e.g., a package insert with instructions to perform any of the methods described herein).
[0493] In some aspects, the kit or product of manufacture comprises (i) comprising the delivery vectors of the present disclosure (e.g., an AAV vector or expression construct (e.g., uricase expression cassette) comprising a nucleic acid encoding a uricase protein disclosed herein), or a pharmaceutical composition of the present disclosure, (ii) optionally, an additional therapeutic agent, and (iii) optionally, instructions for use (e.g., a package insert with instructions to perform any of the methods described herein are also contemplated).
[0494] In some aspects, the components of a kit or product of manufacture disclosed herein are in one or more containers. In some aspects, the kit or product of manufacture comprises (i) an AAV vector or expression construct (e.g., uricase expression cassette) comprising a nucleic acid encoding a uricase protein disclosed herein, and (ii) a brochure with instructions administer the AAV vector or expression construct (e.g., uricase expression cassette) to a subject.
[0495] In some aspects, a kit or product of manufacture of the present disclosure comprises at least one delivery vector (e.g., uricase expression cassettes or rAAV particles). In some aspects, a kit or product of manufacture of the present disclosure comprises at least one polynucleotide encoding at least one uricase protein disclosed herein.
[0496] One skilled in the art will readily recognize that polynucleotides (e.g., uricase expression cassette), vectors, rAAV particles, and pharmaceutical compositions of the present disclosure, or combinations thereof, can be readily incorporated into one of the established kit formats which are well known in the art.
[0497] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art.
[0498] All of the references cited above, as well as all references cited herein, are incorporated herein by reference in their entireties.
[0499] Having described the present invention, the same will be explained in greater detail in the following examples, which are included herein for illustration purposes only, and which are not intended to be limiting to the invention.EXAMPLESExample 1 : Detection of uricase in supernatant of AAV-uricase infected cells
[0500] To assess the ability of the AAV-uricase constructs described herein to express and produce uricase, in vitro transduction of cells is performed and secretion of uricase into the cellular supernatant assayed. 293T cells, primary hepatocytes and MSC cells are seeded in 6-well plates at a density of IX 106cells per well. The cells are then transduced with recombinant AAV (rAAV) particles as described herein, for example AAV 1 -uricase, AAV5-uricase, AAV8-uricase, and AAV9-uricase rAAV particles at a MOI =105. Supernatants are collected 24, 48, and 72 hours after transduction and the uricase content is determined using the Amplex Red Uric Acid / Uricase Assay Kit (Thermo Fisher Catalog # A22181), according to the manufacturer's protocol. Detection of uricase in the supernatant will indicate effective expression and secretion of the uricase protein following rAAV transduction of cells.Example 2: Intravenous administration of AAV-uricase
[0501] The reduction of uric acid and maintenance of hyperuricemia is a goal of the therapeutic approach to gout, chronic refractory gout and / or Harrison Syndrome.
[0502] A mouse model for hyperuricemia has been described, wherein the expression of Facilitated Glucose Transporter 9 (Glut9) was disrupted in the kidney and liver leading to pronounced hyperuricemia (Preitner F et al. Proc. Natl. Acad. Sci. U.S.A. 2009; 106(36): 15501-6, which is incorporated herein by reference in its entirety). The C57BL / 6-Slc2a9tml lTho7J Glut9loxmice from Jackson Laboratory (Strain #:026945) , the AAV-uricase contracts (e.g., including a liver-specific promoter, (e.g., a human Alpha-1 antitrypsin (hAAT) promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, or DC 172 promoter), with or without a signal sequencesuch as an IL-6 signal peptide, and an AAV capsid selected from the group consisting of AAV5, AAV8, AAV9, AAVS3, AAV sL65, AAV LK03, AAV MLIV.K, AAV MLIV.A, AAV NP84, AAV NP59, AAV NP40 and AAV-NP30) as described herein are administered / delivered intravenously or into the hepatic portal vein of the mice. By administering an AAV-uricase contruct with a liver-specific promoter and encoding a uricase protein without a signal sequence (i.e., a non-secreted uricase protein), expression of the uricase is largely restricted to the liver, wherein it may process liver-synthesized uric acid. Controlling the expression of the uricase to only the liver may also reduce the expression of the uricase in immune cells, thereby limiting the generation of an immune response to the uricase protein. Previous studies with liver-specific expression of other transgenes (e.g., an AAV vector expressing factor IX) has indicated that restricting transgene expression to the liver induces tolerance to the transgene products (see, e.g., Crudele JM et al. Blood. 2015; 125(10): 1553-61 and Mingozzi F et al. Blood. 2007; 110(7):2334-41), and may therefore also help induce tolerance to the uricase protein following liver-restricted uricase expression.
[0503] A set of control mice (e.g., C57BL / 6 mice) are injected intravenously with an equal volume of phosphate buffered saline (PBS), and / or with a rAAV particle that does not encode a payload.
[0504] Uric acid levels in mouse sera and urine are then monitored at different time points (e.g., 0, 2, 4, 6, 8, 12, 20 and 28 weeks) after administration. Specifically, blood is collected by retro-orbital or arterial bleeding at each corresponding time point, serum is separated, and the uric acid content in the serum and urine is determined by using an Amplex Red Uric Acid / Uricase Assay Kit (Thermo Fisher Catalog # A22181), according to the manufacturer's protocol. A reduction in the levels of uric acid in the mouse serum and urine, compared to the control mice group(s), will indicate therapeutic levels of uricase are being produced by the rAAV-uricase.Example 3: Intramuscular administration of AAV-uricase
[0505] The C57BL / 6-Slc2a9tml 1Thor / J Glut9loxmice from Jackson Laboratory (Strain #:026945), as described in Example 2, will be administered the AAV-uricase contracts (e.g., including a ubiquitous promoter or a muscle-specific promoter, a signal sequence such as from hIL-6, and an AAV capsid selected from AAV1 and AAV8) described herein intramuscularly into the mice.
[0506] A set of control mice (e.g., C57BL / 6 mice) are injected intramuscularly with an equal volume of phosphate buffered saline (PBS), and / or with a control rAAV particle that does not encode a payload.
[0507] Uric acid levels in mouse sera and urine are then monitored at different time points (e.g., 0, 2, 4, 6, 8, 12, 20 and 28 weeks) after intravenous intramuscular administration. Specifically, blood is collected by retro-orbital bleeding at each corresponding time point, serum is separated, and the uric acid content in the serum and urine is determined by using an Amplex Red Uric Acid / Uricase Assay Kit (Thermo Fisher Catalog # A22181), according to the manufacturer's protocol. A reduction in the levels of uric acid in the mouse serum and urine, compared to the control mice group(s), will indicate therapeutic levels of uricase are being produced by the rAAV-uricase.Example 4: Intramuscular administration of AAV-uricase in WT Mice
[0508] Using an inbred mouse, such as BALB / c or C57BL / 6, the AAV-uricase contructs (e.g., including a ubiquitous promoter (e.g., CMV) and an AAV capsid selected from AAV1 and AAV8) described herein is administered / delivered intramuscularly into the mice.
[0509] A set of control mice (e.g., C57BL / 6 mice) are injected intramuscularly with an equal volume of phosphate buffered saline (PBS), and / or with a rAAV particle that does not encode a payload.
[0510] Endogenous uricase is an intracellular protein and should not have significant circulating levels within the serum. The uricase activity in mouse sera will be monitored at different time points (e.g., 0, 2, 4, 6, 8, 12, 20 and 28 weeks) after intramuscular administration. Specifically, blood is collected by retro-orbital bleeding at each corresponding time point, serum is separated, and the uricase activity is determined by using an Amplex Red Uric Acid / Uricase Assay Kit (Thermo Fisher Catalog # A22181), according to the manufacturer's protocol. An increase of uricase activity will demonstrate the ability of rAAV-uricases to secrete sufficient uricase for therapeutic effect.Example 5: Salivary gland administration of AAV-uricase
[0511] Using C57BL / 6-Slc2a9tml lTho7J Glut9loxmice from Jackson Laboratory (Strain #:026945) , as described in Example 2, the AAV-uricase contructs (e.g., including a ubiquitous promoter (e.g., CMV or smCBA) and an AAV capsid selected from the groupconsisting of AAV2, AAV5, AAV8, AAV9, and AAVRhlO) described herein are administered / delivered to the submandibular salivary gland of the mice.
[0512] A set of control mice (e.g., C57BL / 6 mice) are injected in the submandibular salivary gland with an equal volume of phosphate buffered saline (PBS), and / or with a rAAV particle that does not encode a payload.
[0513] Uric acid levels in mouse sera, saliva, and urine are then monitored at different time points (e.g., 0, 2, 4, 6, 8, 12, 20 and 28 weeks) after salivary gland administration. Specifically, blood is collected by retro-orbital bleeding at each corresponding time point, serum is separated, and the uric acid content in the serum and urine is determined by using an Amplex Red Uric Acid / Uricase Assay Kit (Thermo Fisher Catalog # A22181), according to the manufacturer's protocol. The uricase activity is also measured in saliva to confirm secretion of the uricase enzyme. A reduction in the levels of uric acid in the mouse serum and urine, compared to the control mice group(s), will indicate therapeutic levels of uricase are being produced by the rAAV-uricase.Example 6: Intravenous administration of secreted and non-secreted AAV-uricases
[0514] In addition to administering a monotherapy of either secreted or non-secreted uricase to a subject in need (e.g., administering an AAV-uricase construct with or without a signal peptide sequence), it may be advantageous in certain patients to administer a combination therapy wherein both secreted and non-secreted uricases are encoded by each AAV-uricase construct. For a liver-directed AAV-uricase construct, specifically, an intracellular uricase (i.e., uricase protein that does not include a signal peptide) will be used. Alternatively, two AAV-uricase constructs may be administered, wherein a first AAV-uricase construct encodes for a uricase protein with a signal peptide sequence, and wherein a second AAV-uricase construct encodes for a uricase protein without a signal peptide sequence.
[0515] The C57BL / 6-Slc2a9tml lTho7J Glut9loxmice from Jackson Laboratory (Strain #:026945), as described in Example 2, will be administered AAV-uricase contracts (e.g., including a liver-specific promoter, (e.g., a human Alpha-1 antitrypsin (hAAT) promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alphaantitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, or DC172 promoter), and an AAV capsid selected from any one of AAV5, AAV8, AAV9, AAVS3, AAV sL65, AAV LK03, AAV MLIV.K, AAV MLIV.A, AAV NP84, AAVNP59, AAV NP40 and AAV NP30) that encode a first uricase protein that includes a signal sequence (e.g., an IL-6 signal peptide sequence) and a second uricase protein that does not include a signal sequence (wherein the nucleic acid sequence encoding each uricase protein is operably linked via an IRES sequence or proteolytic cleavage site), as described herein, are administered / delivered intravenously or into the hepatic portal vein of the mice.
[0516] A set of control mice (e.g., C57BL / 6 mice) are injected intravenously with an equal volume of phosphate buffered saline (PBS), and / or with a rAAV particle that does not encode a payload.
[0517] Uric acid levels in mouse sera and urine are then monitored at different time points (e.g., 0, 2, 4, 6, 8, 12, 20 and 28 weeks) after administration. Specifically, blood is collected by retro-orbital or arterial bleeding at each corresponding time point, serum is separated, and the uric acid content in the serum and urine is determined by using an Amplex Red Uric Acid / Uricase Assay Kit (Thermo Fisher Catalog # A22181), according to the manufacturer's protocol. A reduction in the levels of uric acid in the mouse serum and urine, compared to the control mice group(s), will indicate therapeutic levels of uricase are being produced by the rAAV-uricase.Example 7: Methods for uricase detection assaysCell Plasmid Transfection Assay:
[0518] Cells were seeded at 5xl04(HEK293T), IxlO5(HepG2), or 5xl04(C2C12) cells per well in a 48-well plate. At approximately 75% confluence, cells were then treated with plasmid complexed with Lipofectamine™ 3000 Transfection Reagent (Invitrogen L3000001) at varying doses of lipid complexed plasmid (250, 125, or 62.5 ng plasmid) and incubated under cell culture conditions for 72-96 hours. Cell plates were centrifuged at 200g for 5 minutes followed by harvesting of cell transfection media and preparation of cell lysates.Cell Vector Transduction Assay:
[0519] Cells were seeded at 5xl04(HEK293T) or IxlO5(HepG2) cells per well in a 48- well plate. At -75% confluence, cells were then treated with AAV vectors carrying constructs encoding the gene of interest at varying doses of vector (IxlO6, 5xl05, or 2.5xl05MOI) and incubated under standard cell culture conditions for 72 hours. Cellplates were centrifuged at 200g for 5 minutes followed by harvesting of cell transduction media and preparation of cell lysates.Secreted uricase functional activity assay:
[0520] Transfection and transduction cell culture supernatant samples were tested for functional uricase activity using the Amplex® Red Uric Acid / Uricase Assay Kit (Invitrogen A22181). All samples were collected and assayed on the same day to avoid freeze-thaw. Each undiluted supernatant sample was loaded into a 96-well, black-wall, clear-bottom plate. An equal volume of Amplex® Red reagent / HRP / uric acid working solution was then added to each well and the plate was incubated for 30 minutes at 37°C. After incubation, the endpoint fluoresence signal (excitation 545nm, emission 590nm) was measured using a microplate reader. Uricase activity was calculated using a standard curve produced with the kit provided positive control.Mouse serum uricase functional activity assay:
[0521] Mouse serum samples were tested for functional uricase activity using the Uricase Fluorometric Assay Kit (abeam ab234042). Each sample was diluted 1 :4 in assay buffer and then assayed in duplicate by loading into a 96-well, black-wall, clear-bottom plate. The OxiRed Probe reaction mix was then added to each well and the plate was incubated for 30 minutes at 37°C. After incubation, the endpoint fluoresence signal (excitation 535nm, emission 587nm) was measured using a microplate reader. Uricase activity was calculated using a standard curve produced by diluting uricase from Arthrobacter globiformis (Sigma U7128-100UN) in 1 :4 diluted male pooled C57BL / 6 serum (BioIVT MSE01SRM-0101278).SDS-PAGE and Western blot assays:
[0522] Cell supernatants and lysates were run on 4-12% Tris-Glycine Novex gels (Invitrogen XP04122) and proteins were transferred to 0.2um PVDF membranes using iBlot2 system (Thermo Fisher) for Western analyses. Membranes were blocked with 1% BSA in PBS and incubated with 1 :500 dilution of anti-uricase antibody (Santa Cruz Biotechnology sc-166070). Membranes were washed with PBST and then incubated with 1 :2000 anti-Mouse IgG linked to HRP (Invitrogen 31430). Membranes were washed withPBST and incubated with HRP ECL reagent (Peirce) and imaged using iBright FL1500 Imaging system (Thermo Fisher).Example 8: Detection of uricase in the supernatant of AAV-uricase plasmid transfected cells
[0523] Plasmids encoding different uricase sequences under control of different promoters and signal peptides were evaluated for secreted uricase activity using plasmids containing the AAV genome. Plasmids were transfected into HepG2 cells, or a mock transfection was performed, and supernatants were collected and tested for functional uricase after 72 hours. Untreated cell supernatant was also included as a control.• Plasmid PA-012 encodes uricase An 19 / 22, and includes a smCBA promoter and IL-6 signal peptide sequence.• Plasmid PA-002 encodes the pegloticase polypeptide, and includes a cmCB A promoter and IL-6 signal peptide sequence.• Plasmids PA-049, PA-056, and PA-058 each encode the pegloticase polypeptide and include a liver-specific TBG promoter, and either an IL-6, cystatin, or human albumin signal peptide sequence, respectively.
[0524] After 72 hours of expression, supernatants from these transfection cultures were harvested and tested for functional uricase using the Amplex Red Uric Acid / Uricase fluorometric kit. The uricase activity is shown in FIG. 5.
[0525] Plasmid PA-012, which had a smCBA promoter and IL-6 secretion signal peptide, showed uricase activity in the supernatant, while the uricase constructs encoding the pegloticase polypeptide with a smCBA or the liver-specific TBG promoter and either a IL-6, Cystatin, or human albumin signal peptide sequence showed no secreted uricase activity (PA-002, -049, -056, and -058). These transfection supernatants were also analyzed by SDS-PAGE and Western blot analyses using anti-uricase antibody (FIG. 6). The blot showed a strong uricase band (~35 kDa) for PA-012 and very weak bands in the pegloticase construct lanes. Cells from these transfections were subsequently lysed and analyzed by SDS-PAGE and Western blot analyses using anti-uricase antibody (FIG. 7) in order to assess whether the relative ratio of secreted to intracellular uricase production. Uricase constructs PA-002, -049, -056, and -058 showed intracellular uricase expression, although to lower leves than in cells transfected with the PA-012 construct.
[0526] Expression of the uricase An96 variant was also tested in a plasmid including a smCBA promoter (PA-015) and compared to constructs utilizing the muscle-specific promoters CK8 and MHCK7 (PA-038 and PA-040, respectively) by transfecting these plasmids into C2C12 muscle cells (FIG. 8). Transfection supernatants were harvested after 72 hours and analyzed by SDS-PAGE and Western blotting with anti-uricase antibody. Expression levels of uricase from the PA-038 and PA-040 constructs was lower than that from PA-015.
[0527] Microbial uricases were also tested for their ability to be secreted from U87 cells. Plasmids were constructed with smCBA promoter and IL-6 signal peptide sequences for Pegadricase (PA-010) and Rasburicase (PA-011) and compared to mammalian-derived uricases (PA-002, PA-012 and PA-015). U87 cells were transfected with these plasmids and supernatants were harvested at 72 hours. Supernatants were tested for functional uricase using Amplex Red Uric Acid / Uricase fluorometric kit and results plotted as mU / mL of kit positive control uricase (FIG. 13). PA-012, PA-015, and PA-011 all showed activity while PA-002 and PA-010 were negative.
[0528] Uricases (PA-069 and PA-070) under the control of a CAG promoter and Cystatin signal peptide (as described in Chinese Patent Nos. CN111088268A and CN108103079B, each of which is incorporated herein by reference in its entirety) were compared to uricase construct PA-012. Plasmid PA-069 encodes uricase SUO, and includes a CAG promoter and cystatin signal peptide sequence. Plasmid PA-070 encodes uricase SPEG, and includes a CAG promoter and cystatin signal peptide sequence. HEK293T cells were transfected with these plasmids at varying doses (250, 125, or 62.5 ng plasmid) and supernatants were harvested at 72 hours. Supernatants were tested for functional uricase using Amplex Red Uric Acid / Uricase fluorometric kit and results plotted as mU / mL of kit positive control uricase (FIG. 14). PA-012 showed the highest level of uricase activity, with a significantly higher dose-dependent increase in activity compared to PA-069 and PA-070.Example 9: Detection of uricase in the supernatant of rAAV uricase vector transduced cells
[0529] Recombinant AAV (rAAV) vectors including constructs encoding uricase Anl9 / 22 were generated in AAV1 or AAV9 capsids using an IL-6 signal peptide sequence and a smCBA promoter (AAV 1-012 and AAV9-012) or a CMV promoter(AAV 1-020 and AAV9-020) and HEK293T cells were subsequently infected at various MOI (IxlO6, 5xl05, or 2.5xl05vg / cell). Transduction supernatants were collected at 72 hours post AAV addition and analyzed for uricase activity using Amplex Red Uric Acid / Uricase Assay Kit (FIG. 9). All uricase transductions resulted in secreted uricase activity above the control transduction (AAV9-GFP) and showed MOI-dependent increases in activity. The AAV transductions were subsequently analyzed by SDS-PAGE and Western blot using anti -uricase antibody (FIG. 10), which showed high secreted uricase levels across each of the uricase contracts tested.
[0530] The ability to express and secrete uricase Anl9 / 22 in HepG2 liver cells was tested using a vector with AAV1 capsid and including an IL-6 signal peptide sequence and a liver-specific TBG promoter (AAV1-061). HepG2 cells were transduced with this vector (IxlO6vg / cell) or a control AAV2-GFP vector, and the cell supernatants were harvested after 72 hours. Supernatants were analyzed by SDS-PAGE and Western blot using antiuricase antibody (FIG. 11). AAV1-061 was able to produce and secrete uricase from HepG2 cells. In a similar experiment, AAV9 capsid was used to deliver uricase Anl9 / 22 (AAV9-061) to HepG2 cells at a IxlO6MOI, and supernatants were collected 72 and 96 hours post infection. As shown in FIG. 12, uricase from AAV9-061 -transduced cells was detected after 72 hours, and increased in detectable protein levels at 96 hours.Example 10: In vivo expression of secreted uricase from IM or IV injections of rAAV9 uricase vectors
[0531] The ability of rAAV9 uricase vectors to secrete uricase in vivo was evaluated in C57BL6 mice. Groups of 6 mice were dosed either vehicle or 2.5xlOnvector genomes per animal of AAV9-smCBA-Uricase (AAV9-012). The injections were delivered IM or IV. For IM injections, 8 pL of vector or vehicle was injected into the tibalis, gastrocemis, and quadricep muscle groups of both rear legs for a total of 48 pL. For IV injections a bolus of 200 pL of vector was injected via tail vein. Blood was collected retroorbitally at weeks 2, 4, 6, and 8 post AAV injection. After the sera was separated, the uricase activity was tested from each animal at each time point using the Uricase Fluorometric Assay Kit (abeam ab234042). Results from the serum uricase activity level for the week 2, 4, and 6 collections are shown in FIG. 15. Levels of serum uricase were higher in the IV injected group compared to the IM injected group. In both IV and IM groups, uricase levels continued to increase through week 4 post- AAV injection, with a decrease in uricaselevels noted at 6 weeks post-AAV injection. For IM and IV injected AAV9-012 vector, serum uricase activity ranged from 159 mU / mL to 332 mU / mL over the course of 8 weeks post-AAV injection. For the vehicle injected mice, <2 mU / mL uricase activity was observed at all timepoints. These results suggest that efficacious levels of uricase activity were achieved.
Claims
WHAT IS CLAIMED IS:
1. A method of treating or ameliorating the symptoms associated with gout, chronic refractory gout and / or Harrison Syndrome in a subject in need thereof, comprising administering to the subject an AAV vector comprising (i) a uricase expression cassette comprising a promoter operably linked to a polynucleotide encoding a uricase protein, and (ii) an inverted terminal repeat (ITR).
2. The method of claim 1, wherein the uricase protein comprises a signal peptide sequence selected from the group consisting of an IL- 15 signal peptide, an IL-2 signal peptide, an IL-6 signal peptide, an IL- 10 signal peptide, an IL- 12 signal peptide, an IgE signal peptide, an IgK signal peptide, a cystatin S signal peptide, and a human serum albumin signal peptide.
3. The method of claim 1, wherein the AAV vector further comprises (i) a second polynucleotide encoding a second uricase protein, wherein at least one uricase protein does not comprise a signal peptide sequence.
4. The method of claim 3, wherein the polynucleotide encoding the second uricase protein comprises a nucleotide sequence less than 80% identical to the nucleotide sequence of the uricase protein encoded by the polynucleotide of claim 1.
5. The method of claim 3 or 4, wherein the polynucleotides encoding the first and second polynucleotides are operably linked by an IRES sequence, a proteolytic cleavage site, or a combination thereof.
6. The method of claim 5, wherein the the IRES sequence comprises a nucleotide sequence at least 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO: 85 or SEQ ID NO: 86.
7. The method of claim 5, wherein the proteolytic cleavage site comprises a furin cleavage site comprising a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 90.
8. The method of claim 5, wherein the proteolytic cleavage site comprises a F2A cleavage site comprising a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 92.
9. The method of claim 1, further comprising administering to the subject a second AAV vector comprising (i) a uricase expression cassette comprising a promoter operably linkedto a polynucleotide encoding a second uricase protein, and (ii) an inverted terminal repeat (ITR), wherein at least one of the encoded uricase proteins does not comprise a signal peptide sequence.
10. The method of any one of claims 3-9, wherein the signal peptide sequence is selected from the group consisting of an IL- 15 signal peptide, an IL-2 signal peptide, an IL-6 signal peptide, an IL- 10 signal peptide, an IL- 12 signal peptide, an IgE signal peptide, an IgK signal peptide, a cystatin S signal peptide, and a human serum albumin signal peptide.
11. The method of any one of claims 1 to 10, wherein the uricase protein comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 1-9, 95-97, or 106-107.
12. The method of any one of claims 1-11, wherein the promoter is a liver-specific promoter.
13. The method of claim 12, wherein the liver-specific promoter is selected from the group consisting of a human Alpha-1 antitrypsin (hAAT) promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, and a DC 172 promoter.
14. The method of any one of claims 1-11, wherein the promoter is a ubiquitous promoter.
15. The method of claim 14, wherein the ubiquitous promoter is selected from the group consisting of a CAG promoter, a CMV promoter, and a smCAB promoter.
16. The method of any one of claims 1-15, wherein the uricase expression cassette comprises a 5’ UTR and / or a 3’ UTR.
17. The method of any one of claims 1-16, wherein the uricase expression cassette comprises a poly(A) sequence.
18. The method of any one of claims 1-17, wherein the polynucleotide comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 22-40 or 108-114.
19. The method of any one of claims 1-18, wherein the AAV vector comprises a pair of ITRs flanking the uricase expression cassette.
20. The method of claim 19, wherein the ITRs are AAV2 serotype.
21. The method of any one of claims 1-20, wherein the AAV vector is encapsidated by an AAV capsid.
22. The method of claim 21, wherein the serotype of the AAV capsid is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh9, AAV9, AAVrhlO, AAV10, AAV11, AAV12, AAVS3, AAV sL65, AAV LK03, AAV MLIV.K, AAV MLIV. A, AAV NP59, AAV NP40, and AAV NP30.
23. The method of claim 21, wherein the serotype of the AAV capsid is selected from the group consisting of AAV2, AAV5, AAV8, AAV9, and AAVRhlO.
24. The method of claim 21, wherein the serotype of the AAV capsid is selected from the group consisting of AAV1 and AAV8.
25. The method of claim 21, wherein the serotype of the AAV capsid is selected from the group consisting of AAV5, AAV8, AAV9, AAVS3, AAV sL65, AAV LK03, AAV MLIV.K, AAV MLIV. A, AAV NP84, AAV NP59, AAV NP40, and AAV NP30.
26. The method of any one of claims 21-22 or 24, wherein the AAV serotype is AAV1.
27. The method of any one of claims 21-23 or 25, wherein the AAV serotype is AAV5.
28. The method of any one of claims 21-25, wherein the AAV serotype is AAV8.
29. The method of any one of claims 21-23 or 25, wherein the AAV serotype is AAV9.
30. The method of any one of the previous claims, wherein the delivery and / or administration is intramuscular (IM).
31. The method of any one of the previous claims, wherein the delivery and / or administration is intravenous (IV).
32. The method of any one of the previous claims, wherein the delivery and / or administration is via the salivary gland.
33. The method of any one of the previous claims, wherein the delivery and / or administration is via hepatic portal vein.
34. The method of any one of the previous claims, wherein the administration is a single dose or multiple doses.
35. The method of any one of the previous claims, wherein (i) serum uric acid levels are reduced and / or regulated in the subject; (ii) tophi are reduced in the subject; (iii) reduced refractory gout episodes in the subject; or (iv) any combination thereof.
36. The method of any one of the previous claims, wherein the subject has a serum uricase activity of at least 5 mU / mL after the administration.
37. The method of any one of the previous claims, wherein the subject has a serum uricase activity of about 5 mU / mL to about 600 mU / mL after the administration.
38. A polynucleotide comprising (i) a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 22-36; and, optionally, (ii) a nucleotide sequence encoding a signal peptide selected from the group consisting of SEQ ID NOs: 37-40 and 114.
39. The polynucleotide of claim 38, which further comprises (iii) a second nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 22-36 or 108-113.
40. The polynucleotide of claim 39, wherein the nucleotide sequences are operably linked by an IRES sequence, a proteolytic cleavage site, or a combination thereof.
41. The polynucleotide of claim 40, wherein the IRES sequence comprises a nucleotide sequence at least 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO: 85 or SEQ ID NO: 86.
42. The polynucleotide of claim 40, wherein the proteolytic cleavage site comprises a furin cleavage site comprising a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 90.
43. The polynucleotide of claim 40, wherein the proteolytic cleavage site comprises a F2A cleavage site comprising a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 92.
44. The polynucleotide of any one of claims 39 to 43, wherein at least one of the nucleotide sequences is not adjacent to a nucleotide sequence encoding a signal peptide.
45. The polynucleotide of any one of claims 38-44, which further comprises a promoter.
46. The polynucleotide of claim 45, wherein the promoter is a tissue-specific promoter, optionally a liver-specific promoter or a muscle-specific promoter.
47. The polynucleotide of claim 46, wherein the tissue specific promoter is the liver-specific promoter, optionally selected from the group consisting of a human Alpha- 1 antitrypsin (hAAT) promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, a hepatic locus control region- 1 (HCR) promoter, and a DC 172 promoter.
48. The polynucleotide of claim 46, wherein the tissue specific promoter is the musclespecific promoter, optionally selected from the group consisting of a muscle creatine kinase (MCK)-based promoters (e.g., a MCK promoter or a truncated MCK (tMCK)promoter), a CK6 promoter, a hybrid a-myosin heavy chain enhancer- / MCK enhancerpromoter (MHCK7), a CK8 promoter, and a C5-12 synthetic promoter.
49. The polynucleotide of claim 45, wherein the promoter is a ubiquitous promoter.
50. The polynucleotide of claim 49, wherein the ubiquitous promoter is selected from the group consisting of a CAG promoter, a CMV promoter, and a smCBA promoter.
51. The polynucleotide of any one of claims 45-49, wherein the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 61, 64-65, 71, 80-82, 87-89, or 93-94.
52. The polynucleotide of any one of claims 38-51, which comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 43-50 or 115-127.
53. The polynucleotide of any one of claims 38-52, wherein the polynucleotide comprises a poly(A) sequence.
54. The polynucleotide of any one of claims 38-53, wherein polynucleotide comprises a 5’ UTR and / or a 3’ UTR55. A vector comprising the polynucleotide of any one of claims 38-54.
56. The vector of claim 55, wherein the vector is an adeno-associated virus (AAV) vector.
57. A recombinant AAV (rAAV) particle, comprising an AAV capsid and a vector genome comprising the polynucleotide of any one of claims 38-54.
58. The rAAV particle of claim 57, wherein the vector genome comprises a nucleic acid sequence from ITR to ITR which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 52-59 or 128-140.
59. The AAV vector or rAAV particle of any one of claims 56-58, wherein the AAV serotype is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh9, AAV9, AAVrhlO, AAV10, AAV11, AAV12, AAVS3, AAV sL65, AAV LK03, AAV MLIV.K, AAV MLIV.A, AAV NP59, AAV NP40, and AAV NP30.
60. The AAV vector or rAAV particle of any one of claims 56-59, wherein the AAV serotype is selected from the group consisting of AAV2, AAV5, AAV8, AAV9, and AAVRhlO.
61. The AAV vector or rAAV particle of any one of claims 56-59, wherein the AAV serotype is selected from the group consisting of AAV1 and AAV8.
62. The AAV vector or rAAV particle of any one of claims 56-59, wherein the AAV serotype is selected from the group consisting of AAV5, AAV8, AAV9, AAVS3, AAV sL65, AAV LK03, AAV MLIV.K, AAV MLIV. A, AAV NP84, AAV NP59, AAV NP40, and AAV NP30.
63. The AAV vector or rAAV particle of any one of claims 56-59 or 61, wherein the AAV serotype is AAV1.
64. The AAV vector or rAAV particle of any one of claims 56-60 or 62, wherein the AAV serotype is AAV5.
65. The AAV vector or rAAV particle of any one of claims 56-62, wherein the AAV serotype is AAV8.
66. The AAV vector or rAAV particle of any one of claims 56-60 or 62, wherein the AAV serotype is AAV9.
67. A host cell comprising the polynucleotide, the vector, or the rAAV particle of any one of claims 38-66.
68. A method of treating or ameliorating the symptoms associated with gout, chronic refractory gout and / or Harrison Syndrome in a subject in need thereof, comprising administering to the subject the polynucleotide, the vector, or the rAAV particle of any one of claims 38-66.
69. The method of claim 68, wherein the administration is intramuscular (IM), intravenous (IV), via the salivary gland, or via hepatic portal vein.
70. The method ofclaim 68 or 69, wherein the administration is a single dose or multiple doses.
71. The method of any of one of claims 68-70, wherein (i) serum uric acid levels are reduced and / or regulated in the subject; (ii) tophi are reduced in the subject; (iii) reduced refractory gout episodes in the subject; or (iv) any combination thereof.
72. The method of any one of claims 68-71, wherein the subject has a serum uricase activity of at least 5 mU / mL after the administration.
73. The method of any one of claims 68-72, wherein the subject has a serum uricase activity of about 5 mU / mL to about 600 mU / mL after the administration.