Method for generating a plurality of polynucleotides
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- DNA SCRIPT SAS
- Filing Date
- 2024-07-26
- Publication Date
- 2026-06-03
Smart Images

Figure IMGF000025_0001 
Figure 00000033_0000 
Figure 00000035_0000
Abstract
Description
[0001] METHOD FOR GENERATING A PLURALITY OF POLYNUCLEOTIDES
[0002] The present invention relates to methods and kits for generating a plurality of polynucleotides from a single stranded nucleic acid.
[0003] BACKGROUND
[0004] With the progression of polynucleotide synthesis technology, the throughput of multiple polynucleotide synthesis on a same solid support has been increased from 48 primer pairs synthesized in a 96 well plate to 96, 192, 288, 384 or more primer pairs in the same 96 well plate. At the same time, it also became possible to synthesize single stranded nucleic acids of more than hundreds of nucleotides forming several successive polynucleotides, where each polynucleotide is separated from the previous one by a cleavage site. Enzymatic (Hitchcock et al., Nucleic Acids Research 2004, 32(13), 4071-4080), chemical (Hom et al, Nucleosides and Nucleotides, 1991, 10:299-302) or photocleavage (Agasti et al., Journal of the American Chemical Society, 2012, 134(45), 18499-18502; Horn et al, 1991) of such single stranded nucleic acids enables the release of the individual polynucleotides. However, the released polynucleotides may retain a “scar(s)” (refer to the below defined “scarless polynucleotide”) that precludes their use in biological applications. It is therefore necessary to perform additional treatments to eliminate these scars. These additional treatments may be time-consuming and / or expensive, thereby decreasing the advantage of these methods.
[0005] Therefore, there is a need to develop cost-effective methods for generating a plurality of polynucleotides without scar from a single stranded nucleic acid.
[0006] SUMMARY OF THE INVENTION
[0007] By working on this matter, the inventors have discovered that special nucleotides may be advantageously used to form cleavable linkers that, in combination with particular endonucleases, may allow the release of scarless polynucleotides from a single stranded nucleic acid comprising a plurality of polynucleotides. Particularly, the inventors have designed a specific cleavable linker to be used to separate two adjacent polynucleotides of interest within a single stranded nucleic acid. The cleavable linker of the present invention contains two different special nucleotides (as defined further below) that may be cleaved by different endonucleases. The inventors have thus developed a method combining, either sequentially or simultaneously, the cleavage activities of two different endonucleases, e.g., Endonuclease Q (Endo Q) and Endonuclease V (Endo V), which are able to cleave, respectively, the 5’ end of a first special nucleotide and the 3’ end of a second special nucleotide. These special nucleotides are for example, respectively, deoxyuracil (dU) and deoxyinosine (di). The method of the invention is performed on single stranded nucleic acids comprising a plurality of polynucleotides, wherein at least two adjacent polynucleotides are separated by a cleavable linker of the invention, comprising the two different special nucleotides. The method leads to the release of one or more scarless polynucleotides.
[0008] The invention is directed to methods and kits for generating a plurality of polynucleotides from a single stranded nucleic acid, in particular a plurality of scarless polynucleotides.
[0009] In one aspect, the invention relates to a method of generating a plurality of polynucleotides from a single stranded nucleic acid, said method comprising the steps of:
[0010] (a) providing the single stranded nucleic acid which comprises the plurality of polynucleotides and at least one cleavable linker linking at least two polynucleotides of said single stranded nucleic acid that are adjacent, the cleavable linker having two different special nucleotides which have each a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5- hydroxycytosine, 8-oxoguanine, nitroindole and thymine glycol;
[0011] (b) contacting the single stranded nucleic acid with at least one endonuclease able to cleave the single stranded nucleic acid proximate 5’ of the first special nucleotide of the cleavable linker and with at least one endonuclease able to cleave proximate 3’ of the second special nucleotide of the cleavable linker, in order to release at least two polynucleotides of said single stranded nucleic acid that were adjacent, the released polynucleotides devoid of the cleavable linker.
[0012] In some embodiments, the single stranded nucleic acid is contacted sequentially with at least one endonuclease able to cleave a single stranded nucleic acid proximate 5’ of the first special nucleotide of the cleavable linker and then with at least one endonuclease able to cleave proximate 3’ of the second special nucleotide of the cleavable linker, or the reverse.
[0013] In some embodiments, the single stranded nucleic acid is contacted simultaneously with at least one endonuclease able to cleave a single stranded nucleic acid proximate 5’ of the first special nucleotide of the cleavable linker and with at least one endonuclease able to cleave proximate 3’ of the second special nucleotide of the cleavable linker.
[0014] Another aspect of the invention relates to a kit for enzymatically generating a plurality of polynucleotides. Said kit comprises: a first endonuclease able to cleave proximate 3’ of a special nucleotide which has a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5 -hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, nitroindole and thymine glycol; a second endonuclease able to cleave proximate 5’ of a special nucleotide which has a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5- hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, 8-oxoguanine, nitroindole and thymine glycol.
[0015] Particularly, the kit of the invention may further comprise:
[0016] (i) any necessary reagents for synthesizing a single stranded nucleic acid, such as an initiator having a 3 ’-terminal nucleotide having a free 3 ’-hydroxyl, a template-free polymerase, a plurality of 3’-O-blocked nucleoside triphosphates, a de-blocking agent, and a plurality of 3’- O-blocked special nucleotides which have each a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5 -hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, 8- oxoguanine, nitroindole and thymine glycol; and / or
[0017] (ii) a single stranded nucleic acid comprising a plurality of polynucleotides, wherein at least two adjacent polynucleotides of said single stranded nucleic acid are separated by a cleavable linker comprising two different special nucleotides which each have a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5 -hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, 8-oxoguanine, nitroindole and thymine glycol.
[0018] Said endonuclease, able to cleave the single stranded nucleic acid proximate 3’ of the special nucleotide, may be selected from an Endonuclease V, an Endonuclease VIII, and / or an Endonuclease III. In a more particular embodiment, said endonuclease is an Endonuclease V.
[0019] Said endonuclease, able to cleave the single stranded nucleic acid proximate 5’ of the special nucleotide, may be an Endonuclease Q, AGOG, modified AGOG having no ligase activity, USER or UDG. Another aspect of the invention relates to an Endonuclease V comprising an amino acid sequence at least 75 % identical to the amino acid sequence of SEQ ID NO: 9, wherein said Endonuclease V is capable of cleaving proximate 3’ of a special nucleotide which has a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5 -hydroxyuracil, 5,6- dihydrouracil, 5 -hydroxy cytosine, nitroindole and thymine glycol. Particularly, the Endonuclease V of the present invention comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 9 and is capable of cleaving proximate 3’ of a special nucleotide which has a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5- hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, nitroindole and thymine glycol.
[0020] BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Fig. 1A illustrates the experimental design used to demonstrate the enzymatic release of two scarless polynucleotides (“Fwd” and “Rev” primers) from a single stranded nucleic acid attached to a solid support. It contains “dIT” as a cleavable motif for Endonuclease V (Endo V) to cleave the single-stranded nucleic from the support, and “dUTTdIT”, a cleavable linker which is cleaved by the two endonuclease enzymes Endonuclease V and Endonuclease Q. These two enzymes are thus used to cleave the single stranded nucleic acid into defined polynucleotides that can be subsequently purified.
[0022] Fig. IB shows the different cleavage products that may be released by use of Endonuclease V and / or Endonuclease Q from a single stranded nucleic acid attached to and separated from a solid support with “dIT” as a cleavable motif, and “dUTTdIT” as a cleavable linker between two adjacent polynucleotides of said single stranded nucleic acid.
[0023] Fig. 1C shows electrophoresis data of the cleavage products obtained with the method of Fig. IB. The cleavage products were visualized with an Oligo Pro II instrument after standard desalt purification.
[0024] Fig. 2 shows electrophoresis data of the Endonuclease V and Endonuclease Q-mediated cleavage products obtained when the “Fwd” and “Rev” polynucleotide sequences are separated from each other by an incomplete cleavage linker containing only dIT or dU, or by a complete cleavage linker, containing first dU and then dIT, which are separated by adding 0, 1 or more nucleotide bases such as thymidine (T), for example, between the dU and dIT. Black boxes indicate the two desired scarless polynucleotides released from a single stranded nucleic acid of various design. “NEC” refers to “no enzyme control”. The cleavage products were visualized with an Oligo Pro II instrument after standard desalt purification.
[0025] Fig. 3A shows electrophoresis data of the cleavage products obtained when a single stranded nucleic acid comprising two desired polynucleotides, namely “Fwd” and “Rev”, which are separated from each other by a cleavable linker, is cleaved by Endonuclease V and Endonuclease Q separately, or by Endonuclease V and by Endonuclease Q sequentially. Black boxes indicate the desired, scarless polynucleotide products. The cleavage products were visualized with an Oligo Pro II instrument after standard desalt purification.
[0026] Fig. 3B shows the PCR products by using the polynucleotides obtained with the method of Fig. 3 A as primers. The PCR products were visualized with an Oligo Pro II instrument after standard desalt purification.
[0027] Fig. 4A shows a schematic representation of a method for preparing spatially organised primer pairs. A single stranded nucleic acid comprising at least a forward primer, a cleavage linker and a reverse primer is synthesised enzymatically from an initiator DNA attached to a solid support and comprising a free azide. The reverse primer comprises a special nucleotide that is compatible with click chemistry and that can react with the free azide. After the click step is performed, the cleavage by Endo V and Endo Q generates a free linker and a pair of primers, both attached to the solid support, that are spatially organized for the downstream PCR amplification step.
[0028] Fig.4B shows a variant of Fig. 4A wherein the synthesised polynucleotide does not comprise a special nucleotide comprising a base such as di and wherein no enzyme such as Endo V is used. In this embodiment, there is no release of a free linker. Rather, the linker remains attached as a “tail” to the reverse primer.
[0029] DETAILED DESCRIPTION OF THE INVENTION
[0030] One aspect of the invention relates to a method of generating a plurality of polynucleotides from a single stranded nucleic acid comprising the plurality of polynucleotides and at least one cleavable linker comprising two different special nucleotides between at least two adjacent polynucleotides. Said method involves the use of at least one endonuclease able to cleave the single stranded nucleic acid proximate 5’ of the first special nucleotide of the cleavable linker and at least one endonuclease able to cleave proximate 3’ of the second special nucleotide of the cleavable linker.
[0031] The inventors have shown that combining the orthogonal cleavage activities of an Endonuclease Q (Endo Q) and of an Endonuclease V (Endo V) can efficiently release two or more polynucleotides from a single stranded nucleic acid wherein said polynucleotides were linked one to another by a cleavable linker which comprises two different special nucleotides which each have a base such as inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5- hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, nitroindole and thymine glycol. More particularly, the inventors have designed a particular cleavable linker, comprising two different special nucleotides, that may be used to separate two adjacent polynucleotides in a single stranded nucleic acid. This cleavable linker allows the release of polynucleotides with intact 5’ phosphate and / or 3’ hydroxyl groups. Thus, the combination of Endonuclease Q and Endonuclease V, or more generally, the combination of an endonuclease able to cleave the single stranded nucleic acid proximate 5’ of the first special nucleotide of a cleavable linker and an endonuclease able to cleave proximate 3’ of the second special nucleotide of the cleavable linker, allows to release scarless polynucleotide(s).
[0032] The molar ratio of the free polynucleotides can be precisely controlled by manipulating the plurality of each polynucleotide in the single stranded nucleic acid, each separated from the other by a cleavable linker. For example, an equal number of each polynucleotide in the single stranded nucleic acid will result in an equimolar ratio of the two free polynucleotides when resolved at the cleavable linker. A 2:1 ratio in the copy number of the two polynucleotides in the single stranded nucleic acid will result in a 2: 1 molar ratio of the two free polynucleotides when resolved at the cleavable linker and so forth. This unique advantage of the invention proves very useful for downstream experiments using the free polynucleotides produced by the method of the invention, for example where forward and reverse primers are required in equimolar amounts for a downstream PCR reaction.
[0033] The present disclosure will be best understood by reference to the following definitions.
[0034] Definitions
[0035] As used herein, the term “single stranded nucleic acid” means a linear single strand of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) which comprises natural nucleotides and / or non-natural nucleotides. Natural nucleotides are, for example, deoxyadenosine (A), deoxycytidine (C), deoxyguanosine (G), or deoxythymidine (T) for DNA or their ribose counterparts for RNA. Non-natural nucleotides include modified bases, sugars, Peptide Nucleic Acids (PNAs), phosphorothioate internucleosidic linkages, or bases containing linking groups permitting the attachment of labels, such as fluorophores, or haptens, and the like. Examples of nucleotides that may be used in the present invention are nucleotides having a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5 -hydroxyuracil, 5,6- dihydrouracil, 5 -hydroxy cytosine, nitroindole and thymine glycol.
[0036] Said single stranded nucleic acid comprises a plurality of polynucleotides. The term “polynucleotide” refers to a linear polymer of nucleotide monomers. Polynucleotides may comprise from a few nucleotides to several thousand nucleotides. Particularly, a polynucleotide may have a size of from 5 to 100 nucleotides or more. Said polynucleotide can be a polydeoxyribonucleotide, which is composed of deoxyribonucleotides, or an polyribonucleotide, which is composed of ribonucleotides, or a nucleic acid comprising both deoxyribonucleotides and ribonucleotides. Said polynucleotide can comprise natural nucleotides or both natural and non-natural nucleotides as defined above.
[0037] In the context of the invention, the term “special nucleotide” refers to a nucleotide which is a natural nucleotide different from A, T, C, G, or a non-natural nucleotide. Particularly, special nucleotides refer to a nucleotide having a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5 -hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, 8_oxoguanine, nitroindole and thymine glycol. Particular examples of special nucleotides are deoxyuracil (dU) or deoxyinosine (di).
[0038] The term “proximate 5’” means within the limit of 5, 4, 3, 2 or 1 nucleotide(s) before the 5’, or exactly 5’ of said special nucleotide. The term “proximate 3’” means within the limit of 5, 4, 3, 2 or 1 nucleotide(s) after the 3’, or exactly 3’ of said special nucleotide.
[0039] The term “released polynucleotides” refers to polynucleotides which are cleaved from a single stranded nucleic acid.
[0040] The term “scarless polynucleotide” designates a polynucleotide with intact 5’ phosphate and 3’ hydroxyl groups and devoid of any cleavable linker or portion thereof.
[0041] “Single-stranded nucleic acid” of step (a) The inventors have developed specific linear single stranded nucleic acids that comprise a plurality of polynucleotides, wherein at least two adjacent polynucleotides are separated by a cleavable linker.
[0042] The single stranded nucleic acid of the invention may typically comprise from 15 to 1000 nucleotides, particularly from 18 to 800 nucleotides, more particularly from 20 to 600 nucleotides, from 20 to 500 nucleotides, from 20 to 400 nucleotides, still more particularly from 25 to 300 nucleotides. This succession of nucleotides forms a plurality of polynucleotides and at least one cleavable linker.
[0043] According to the invention, the single stranded nucleic acid comprises at least 2 polynucleotides of interest, particularly from 2 to 20 polynucleotides, more particularly from 2 to 12, still more particularly from 2 to 11, from 2 to 10, from 2 to 9, from 2 to 8, from 2 to 7, from 2 to 6, from 2 to 5, from 2 to 4 polynucleotides. In some embodiments, the single stranded nucleic acid comprises 2, 4, 6, 8 or 10 polynucleotides. All or part of the polynucleotides of said plurality may have a predetermined or randomized sequence. For instance, at least 2 polynucleotides of said plurality of polynucleotides have sequences corresponding to those of a pair of PCR primers for a gene of interest. In some embodiments, said single stranded nucleic acid comprises a plurality of 4, 6, 8 or more polynucleotides of interest whose sequences correspond to those of primers for a multiple PCR. In another embodiment, said single stranded nucleic acid comprises a plurality of polynucleotides whose sequences correspond to those of primers for a qPCR.
[0044] In other embodiments, said single stranded nucleic acid comprises one or more polynucleotide(s) comprising a degenerate (randomized) sequence. Such degenerate sequences are widely used in the art, and are sometimes referred to as DNA barcode, or UMIs (Unique Molecule Indicators), for example. The skilled person will readily understand how to design a single stranded nucleic acid comprising at least 2 polynucleotides, wherein one or more of these polynucleotides comprises a barcode, a UMI, or any other degenerate sequence.
[0045] In the linear single stranded nucleic acid, at least two adjacent polynucleotides are separated from each other by a cleavable linker. This means that said two polynucleotides extend successively in the nucleic acid and are linked to each other by the cleavable linker according to the sequence “polynucleotide / cleavable linker / polynucleotide”. In a particular embodiment, each polynucleotide of the plurality of polynucleotides is linked to an adjacent polynucleotide by a cleavable linker.
[0046] In the context of the invention, the term “cleavable linker” refers to a portion of a nucleic acid that connects two adjacent polynucleotides and can be cleaved under predetermined conditions. Said cleavable linker comprises two different special nucleotides specifically recognized by two different endonucleases used in step (b) of the method of the invention. The term “recognized” used herein means identified by an endonuclease as a binding and / or cleaving site. Said first special nucleotide is recognized by an endonuclease which is able to cleave proximate 5’ of said special nucleotide and said second special nucleotide is recognized by an endonuclease which is able to cleave proximate 3’ of said special nucleotide. Advantageously, the first special nucleotide is located at the 5’ end of the cleavable linker and the second special nucleotide is penultimate nucleotide of the 3’ end of said cleavable linker. Said special nucleotides have each a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, 8-oxoguanine, nitroindole and thymine glycol. Particularly, said special nucleotides are deoxyuracil (dU) and deoxyinosine (di).
[0047] It is therefore an object of the present invention to provide a cleavable linker, as defined above, to be used to separate at least two adjacent polynucleotides in a single stranded nucleic acid.
[0048] The cleavable linker can comprise natural and / or non-natural nucleotides.
[0049] The skilled person is able to adapt the sequence of the cleavable linker to the endonucleases used to perform the method of the invention. For example, Endonuclease Q cleaves the phosphodiester bond immediately 5’ of a dU or di, while Endonuclease V cleaves at the second phosphodiester bond 3’ of a dU or di, with a higher affinity for di. Therefore, when a combination of Endonuclease Q and Endonuclease V is employed, suitable cleavable linkers can comprise a dU and a di.
[0050] In a particular embodiment, the cleavable linker has the sequence 5’-Ni(N)mN2N3-3’, wherein:
[0051] - Ni is a special nucleotide having a base selected from uracil, deoxyuracil, 5- hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine and 8-oxoguanine,
[0052] - N2 is a special nucleotide having a base selected from inosine, deoxyinosine, nitroindole, hypoxanthine and thymine glycol, - N represents one or more natural and / or non-natural nucleotides, m being 0 or 1,
[0053] - N3 is a nucleotide selected from natural and non-natural nucleotides.
[0054] N and N3 do not encompass any special nucleotide. Particularly, N may comprise one or more T. Alternatively or in addition, N3 may be T.
[0055] In a particular embodiment, the cleavable linker has the sequence 5’-NIN2N3-3’, wherein Ni, N2 and N3 are defined as above.
[0056] In another particular embodiment, the cleavable linker has the sequence 5’-NINN2N3-3 ’, wherein Ni, N2 and N3 are defined as above and N represents at least one nucleotide. Particularly, N comprises between 1 and 500 nucleotides, particularly between 1 and 300 nucleotides, between 1 and 100 nucleotides, between 1 and 50 nucleotides, or between 1 and 20 nucleotides, preferably between 1 and 10 nucleotides, more preferably between 2 and 6 nucleotides.
[0057] Within the scope of the present invention, any range must be considered as including the upper and lower limits.
[0058] In a particular embodiment, Ni is deoxyuracil (dU) and N2 is deoxyinosine (di). The cleavable linker may have the sequence dUdINs or dUNdINs, N and N3 being as defined above.
[0059] In a more particular embodiment, the cleavable linker is selected from dUdIT, dUTdIT, dUTTdIT, dUTTTdIT, dUTTTTdIT, dUTTTTTdIT and dUTTTTTTdIT, preferably selected from dUdIT, dUTdIT, dUTTdIT and dUTTTTTTdIT.
[0060] According to the invention, the single stranded nucleic acid may comprise a plurality of cleavable linkers, each cleavable linker linking two polynucleotides that are adjacent. Advantageously, at least one cleavable linker is flanked both at its 5’ end and at its 3’ end by a polynucleotide. More advantageously, each polynucleotide of the single stranded nucleic acid is separated from an adjacent polynucleotide by a cleavable linker. The cleavable linkers of a same single stranded nucleic acid may be same or different. Preferably, the cleavable linkers of a same single stranded nucleic acid are all identical.
[0061] In a particular embodiment, the single stranded nucleic acid of the invention is composed from 5’ end to 3’ end by the sequential repeat of “polynucleotide-cleavable linker-polynucleotide-”. Said single stranded nucleic acid may be a free nucleic acid or may be attached to a solid support by its 5’ end or its 3’ end. In a specific embodiment, the single stranded nucleic used in step (a) is attached to a solid support by its 5’ end. Such solid support may be a bead, such as a magnetic bead, a capture bead or other materials (e.g., macro structures and / or insoluble materials) to form a capture bead, or a planar solid, such as a glass slide, a membrane, or a plate (e.g., a plate comprising multiple wells).
[0062] When a single stranded nucleic acid is attached to a solid support, said nucleic acid may be attached to the solid support by a cleavable motif which can be cleaved to release said nucleic acid. The cleavable motif can be any means known in the prior art, such as a short oligonucleotide comprising at least one enzymatically cleavable nucleotide or a chemically cleavable internucleotide linkage. Examples of enzymatically cleavable nucleotides can be a nucleotide having a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, 8-oxoguanine, nitroindole and thymine glycol, preferably a base selected from inosine, deoxyinosine, nitroindole, hypoxanthine and thymidine glycol. More particularly, said enzymatically cleavable nucleotide is deoxyinosine. For instance, the cleavable motif is dIT. An example of a chemically cleavable nucleotide is ribo-uracil (rU), which can be cleaved by KOH.
[0063] In some embodiments, the cleavable linker further comprises, in its 3 ’-end, a modified nucleotide such as Octadiynyl deoxyuracil (Oct-doU or OctdU), which can react by click chemistry with a free azide (N3) group located within the initiator. In this embodiment, the release of the linker upon cleavage by the endonucleases of step b) is preceded, simultaneous to or followed by a click reaction between the released polynucleotide and the initiator DNA attached on the solid support.
[0064] In this embodiment, the cleavable linker has the sequence 5’-Ni(N)mN2N3N4-3’, wherein:
[0065] - Ni is a special nucleotide having a base selected from uracil, deoxyuracil, 5- hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine and 8-oxoguanine,
[0066] - N2 is a special nucleotide having a base selected from inosine, deoxyinosine, nitroindole, hypoxanthine and thymine glycol,
[0067] - N represents one or more natural and / or non-natural nucleotides, m being 0 or 1,
[0068] - N3 is a nucleotide selected from natural and non-natural nucleotides, - NHs a modified nucleotide having a base that is modified at a specific position of the base with a multi-atom linker terminating with an alkyne or azido group, such as Oct- dU.
[0069] N and N3 do not encompass any special nucleotide. Particularly, N may comprise one or more T. Alternatively or in addition, N3 may be T.
[0070] In an alternative embodiment, the cleavable linker remains attached to the polynucleotide located at its 3’-end. In this embodiment, the linker has the sequence 5’-Ni(N)mN3N4-3’, wherein Ni,N, rn N3 and N4 are as defined above.
[0071] In some embodiments, the method of the invention comprises a step of synthetizing the single stranded nucleic acids before the step (a) of providing the single stranded nucleic acid. The single stranded nucleic acids used in the present invention can be designed and synthesized by any conventional method, for example by chemical synthesis based on solid-phase phosphoramidite chemistry described by Adams et al. (1983, J. Amer. Chem. Soc., 105, 661) and Froehler et al. (1983 , Tetrahedron Lett., 24, 3171) or by enzymatic synthesis. Templateindependent enzymatic polynucleotide synthesis methods are for example described in detail in WO 2015 / 159023, WO 2017 / 216472, U.S. patent 5436143, U.S. patent 5763594, Jensen et al (Biochemistry, 57: 1821-1832 (2018)), or Mathews et al (Organic & Biomolecular Chemistry, DOI: 0.1039 / c6ob01371f (2016)); Schmitz et al (Organic Lett., 1(11): 1729-1731 (1999)).
[0072] Preferably, the single stranded nucleic acid is synthesized on a solid support by an enzymatic synthesis, particularly an enzymatic synthesis of polynucleotides with template-free polymerases, such as terminal deoxynucleotidyl transferase (TdT) or variants such those described in detail in W02019 / 135007 for DNA synthesis or a polyA polymerase (PAP) or polyU polymerase (PUP) or variant thereof usually for RNA synthesis (e.g. Heinisch et al, W02021 / 018919). In some embodiments, the single stranded nucleic acid is synthesized from an initiator having a free 3 ’-hydroxyl. In context of the present invention, the term “initiator” refers to a short single-stranded oligonucleotide with a free 3 ’-end, which can be further elongated by a template-free polymerase, such as TdT. The initiator may comprise between 3 and 100 nucleotides, in particular between 3 and 20 nucleotides. In some embodiments, the initiator may comprise a non-nucleic acid compound having a free hydroxyl to which a TdT may couple a 3’-O-blocked dNTP. Said initiator may be attached by its 5’ end to a solid support, by any conventional methods. In some embodiments, the initiator comprises a cleavable motif as defined above at or nearby its 3 ’ end. In a particular embodiment of the invention, the initiator has a 3’-penultimated nucleotide having a base selected from inosine, deoxyinosine, hypoxanthine, nitroindole and thymidine glycol. Particularly, said 3’-penultimated nucleotide is deoxymosine.Endonucleases of step (b)
[0073] According to the method of the present invention, the single stranded nucleic acid as described above is contacted with: at least one endonuclease able to cleave the single stranded nucleic acid proximate 5’ of the first special nucleotide of a cleavable linker, and at least one endonuclease able to cleave proximate 3’ of the second special nucleotide of said cleavable linker.
[0074] By “contacting”, it is meant that the endonucleases are added to the reaction medium containing the single stranded nucleic acid.
[0075] The choice of the special nucleotides of the cleavable linkers is adapted to the cleavage specificities of the endonucleases to be used. Or, alternatively, the choice of the endonucleases is adapted to the sequences of the cleavable linkers used and to the special nucleotides to be cleaved. By doing so, each cleavable linker comprising two different special nucleotides is cleaved by said endonucleases, releasing the corresponding polynucleotides.
[0076] According to the method of the invention, at least one endonuclease able to cleave proximate 5’ of a special nucleotide is used to cleave and release a polynucleotide with an intact 3 ’-OH group. Said endonuclease may be an Endonuclease Q. This enzyme is able to cleave a phosphodiester bond 5 ' of a special nucleotide comprising a base selected from inosine, deoxyinosine, uracil, deoxyuracil, nitroindole, hypoxanthine, thymine glycol, 5 -hydroxyuracil, 5,6-dihydrouracil, and 5 -hydroxy cytosine, with preference to a special nucleotide comprising a base selected from uracil, deoxyuracil, 5 -hydroxyuracil, 5,6-dihydrouracil, and 5- hydroxycytosine, with special nucleotides comprising deoxyuracil (dU) being more preferred.
[0077] Accordingly, Endonuclease Q may be used to cleave any cleavable linker comprising such a special nucleotide at its 5’ end, such as a cleavable linker of sequence dUlS Ns or dUNIS Ns, wherein N, N2 and N3 are as defined above. Particularly, Endonuclease Q may be used with single stranded nucleic acid comprising cleavable linker(s) selected from dUdIT, dUTdIT, dUTTdIT, dUTTTdIT, dUTTTTdIT, dUTTTTTTdIT, dUTTTTTTTTdIT. Suitable Endonucleases Q may be any commercially available Endonuclease Q or any Endonuclease Q described in the prior art, especially a prokaryotic Endonuclease Q, such as Endonuclease Q from or derived from Thermococcus kodakarensis (Shiraishi et al., Nucleic Acids Res. 2015; 43(5): 2853-2863), Pyrococcus furiosus (Shiraishi et al., Sci Rep 6, 25532 (2016)), Bacillus pumulis (Shiraishi et al., Biosci Biotechnology Biochem 81, 1-7 (2017)), or Methanothermobacter thermautotrophicus, etc. Accordingly, suitable Endonucleases Q can be any Endo Q enzyme from the following organisms and comprising the sequences having the following Genbank accession numbers: Bacillus pumilus 8G134 (KY014246); Alicyclobacillus acidocaldarius subsp. acidocaldarius Tc-4-1 (AEJ43581); Syntrophomonas wolfei Goettingen G311 (ABI67927); Thermoanaerobacterium thermosaccharolyticum DSM571 (ADL68842); Paenibacillus vortex V453 (EFU41322); Geobacillus thermoglucosidasius C56-YS93 (AEH47337); Caldicellulosiruptor saccharolyticus DSM 8903 (ABP67491); Desulfobacterium autotrophicum (WP_015906045); Treponema azotonutricium ZAS-9 (AEF81123); Bilophila wadsworthia 3 1 6 (EFV43592); Desulfovibrio desulfuricans ND132 (EGB14354); Spirochaeta thermophila DSM 6192 (ADN02349); Z mobilis subsp. mobilis ATCC 10988 (AEH63449); Geobacter metallireducens GS-15 (ABB33436); Salinispora tropica CNB-440 (ABP56967); Clostridales bacterium 7_7_47FAA (EEQ56693); Methanosphaerula palustris El 9c (WP_012617631); Methanosarcina acetivorans C2A (WP_011020688); Methanococcus maripaludis C5 (WP_011869325); Methanopyrus kandleri AV19 (AAM01639); Methanothermobacter thermau- totrophicus Delta H (WP_010876918); P. furiosus DSM 3638 (WP 011012698) and Thermococcus kodakarensis KOD1 (WP 011249838).
[0078] Particularly, the Endonuclease Q is an Endonuclease Q from or derived from Methanothermobacter thermautotrophicus or Thermococcus kodakarensis. More particularly, said Endonuclease Q is isolated from the thermophilic bacterium Thermococcus kodakarensis and has the sequence of SEQ ID NO: 8.
[0079] Alternatively, or in addition, to, the endonuclease able to cleave proximate 5’ of a special nucleotide may be selected in the group consisting of AGOG, modified AGOG having no ligase activity, USER and UDG associated with Endonuclease VIII.
[0080] AGOG, or archeal 8oxoG DNA glycosylase, is able to cleave 8-oxoguanine and has been described in Wang et al. 2022, Acta Biochim Biophys Sin, 2022, 54(12): 1801-1810. It is a bifunctional enzyme that also displays ligase activity. However, appropriate mutations or substitutions can be carried out, resulting in modified AGOG having no ligase activity, When AGOG or modified AGOG is used as an endonuclease, the special nucleotide is 8-oxoguanine.
[0081] USER (or Uracil-Specific Excision Reagent) is an enzyme commercialized by New England Biolabs under the reference M5505. USER combines the uracil DNA glycosylase (UDG) enzymatic activity of UDG and the lyase activity of Endonuclease VIII (see Bitinaite J., et al. (2007) Nucl. Acids Res. 35, 1992-2002; .Bitinaite, J. and Nichols, N.M. (2009) Curr Protoc Mol Biol. Chapter 3:Unit 3.21; .Vaisvila, R. and Bitinaite, J. (2013) Methods Mol.Biol. 978, 165- 171).
[0082] Uracil DNA glycosylase (UDG) can also be used as the endonuclease able to cleave proximate 5’ of a special nucleotide, followed by Endonuclease VIII. In this case, the special nucleotide is uracil. UDG excises the uracil base and Endonuclease VIII subsequently cleaves the phosphodiester backbone.
[0083] According to the method of the invention, at least one endonuclease able to cleave proximate 3’ of a special nucleotide is further used to cleave and release a polynucleotide with an intact 5’ phosphate group. Said endonuclease may be used alone or in combination with other enzymes. Said endonuclease may be an Endonuclease V, an Endonuclease VIII, or an Endonuclease III.
[0084] Endonuclease V is a highly conserved endonuclease family which cleaves at the second phosphodiester bond 3’ of a special nucleotide comprising a base selected from inosine, deoxyinosine (di), hypoxanthine, uracil, deoxyuracil (dU), 5-hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, nitroindole and thymine glycol (Wu et al., 2019, Molecular Cell 76, 44- 56). In the context of the invention, the base is preferably selected from inosine, deoxyinosine, nitroindole, hypoxanthine and thymine glycol, with deoxyinosine (di) being more preferred.
[0085] Accordingly, Endonuclease V may be used to cleave any cleavable linker comprising such a special nucleotide as penultimate nucleotide of its 3’ end, e.g. a cleavable linker of sequence NidlNs or NiNdlNs, wherein N, Ni and ? are as defined above. Particularly, Endonuclease V may be used with single stranded nucleic acid comprising cleavable linker(s) selected from dUdIT, dUTdIT, dUTTdIT, dUTTTdIT, dUTTTTdIT, dUTTTTTdIT, dUTTTTTTdIT and dUTTTTTTTTdIT.
[0086] Endonuclease V has been identified in different organisms, particularly in bacteria, such as Fervidobacterium gondwanense, Thermotoga maritima or E. coll. In a particular embodiment, the Endonuclease V used is a prokaryotic Endonuclease V, particularly an Endonuclease V from or derived from Fervidobacterium gondwanense. More particularly, the Endonuclease V used in step (b) comprises or consists of an amino acid sequence at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 9. Advantageously, the Endonuclease V used in step (b) comprises or consists of the amino acid sequence SEQ ID NO: 9. Said Endonuclease V is thermostable and may be active in a range of temperature up to 72°C, with an optimal activity at 60 °C.
[0087] Alternatively or in addition to Endonuclease V, Endonuclease VIII (Endonuclease VIII) or Endonuclease III (Endo III) can be used in combination with Uracil DNA glycosylase (UDG) to cleave at a special nucleotide and to release a polynucleotide with an intact 5’ phosphate group. Said special nucleotide has a base such as uracil, thymine glycol, 5,6 dihydroxythymine, 5-hydroxy-5 methylhydanton, uracil glycol, 6-hydroxy-5, 6-dihdrothimine and methyltartronylurea. UDG firstly recognizes and excises such a special base to produce an apurinic site, after which Endonuclease VIII or Endo III cleaves the phosphodiester backbone, thereby separating a single stranded nucleic acid into two polypeptides having a 3’ and 5’ phosphate, respectively. The residual 3’ phosphate can be removed in a subsequent reaction, e.g. by using Polynucleotide Kinase.
[0088] Endonuclease VIII and Endo III have been identified in bacteria, such as in E. coli. Examples of suitable Endonuclease VIII and Endo III are from or derived from E. coli.
[0089] In a particular embodiment, step (b) comprises or consists of contacting the single stranded nucleic acid with at least one Endonuclease Q and at least one Endonuclease V.
[0090] For instance, step (b) comprises or consists of contacting the single stranded nucleic acid with one Endonuclease Q selected from or derived from Methanothermobacter thermautotrophicus, Thermococcus kodakarensis and Pyrococcus furiosus, and one Endonuclease V selected from or derived from E.coli, Fervidobacterium gondwanensis or Thermotoga maritima.
[0091] Particularly, step (b) comprises or consists of contacting the single stranded nucleic acid with the Endonuclease Q from Thermococcus kodakarensis and the Endonuclease V from Fervidobacterium gondwanense.
[0092] More particularly, step (b) comprises or consists of contacting the single stranded nucleic acid with the Endonuclease Q of SEQ ID NO: 8 and the Endonuclease V of SEQ ID NO: 9. Cleavage activity
[0093] According to the invention, the single stranded nucleic acid may be contacted simultaneously or sequentially with the first and second endonucleases.
[0094] The term “contacted simultaneously” means that the first and the second endonucleases perform the cleavage at the same time on the single stranded nucleic acid.
[0095] The simultaneous cleavage by these two enzymes is advantageously performed under suitable conditions (e.g., temperatures, pH, etc.) for both endonucleases. For example, the simultaneous cleavage is performed at a temperature between 30 and 65 °C and a pH between 7 and 9. In a particular embodiment, the single stranded nucleic acid is contacted simultaneously with an Endonuclease Q and an Endonuclease V, preferably a thermostable Endonuclease V, such as the Endonuclease V from Fervidobacterium gondwanensis, at a temperature from 50 to 65°C, particularly at 60 °C + / -5°C, and a pH of 7.5 to 9.5, preferably a pH of 8.0 to 9.0, even more preferably a pH of about 8.5.
[0096] The simultaneous cleavage may be implemented by two enzymes with different enzymatic activities at different molar ratio. For example, the simultaneous cleavage may be performed by an Endonuclease V and an Endonuclease Q at a molar ratio from 5:1 (Endonuclease V: Endonuclease Q) to 1 :5 (Endonuclease V:Endonuclease Q). The molar ratio may be adapted to favor cleavage 5’ of the dU and / or 3’ of the dIT by Endonuclease Q and Endonuclease V, respectively. In a particular embodiment, the molar ratio Endonuclease V : Endonuclease Q is 1 : 1. In another embodiment, the molar ratio Endonuclease V : Endonuclease Q is 5 : 1. In another embodiment, the molar ratio Endonuclease V : Endonuclease Q is 1 :5. The person skilled in the art is able to adapt the molar ratio and the conditions (e.g., pH and temperatures), to the endonucleases and the special nucleotides being used.
[0097] The term “contacted sequentially” means that the first and the second endonucleases perform their enzymatic activities one after another.
[0098] In a particular embodiment of step (b), the single stranded nucleic acid is contacted sequentially, first by Endonuclease Q then by Endonuclease V.
[0099] In another particular, preferred, embodiment of step (b), the single stranded nucleic acid is contacted sequentially, first by Endonuclease V and then by Endonuclease Q. The sequential cleavage of the single stranded nucleic acid by two endonucleases may be performed in a same reaction medium, possibly at different reactional conditions. For example, the first cleavage may be performed at a first temperature and / or a first pH, which are optimal for the first enzyme and the subsequent cleavage is performed at a second temperature and / or a second pH which are optimal for the second enzyme. As an example, the single stranded nucleic acid can be first contacted with an Endonuclease V, for example the Endonuclease V from E.coli, at 37 °C and then with an Endonuclease Q at a temperature from 50 to 65°C. The second endonuclease may be added to the reaction medium at the end of the first cleavage reaction. Optionally, the first endonuclease may be inactivated at the end of the first cleavage reaction and before the addition of the second endonuclease.
[0100] Alternatively, the sequential cleavage of the single stranded nucleic by two endonucleases may be performed in different reaction mediums. For instance, at the end of the first cleavage reaction in a first reaction medium, the intermediate products are recovered and contacted with the second endonuclease in a second reaction medium. The intermediate products, corresponding to the products obtained after cleavage of the nucleic acid by the first enzyme, may be recovered by any conventional means, such as by purification or centrifugation.
[0101] At the end of the reaction, the final product may be recovered. The final product corresponds to the products obtained after cleavage by both enzymes. The final product may comprise released scarless polynucleotides and potentially partially resolved polynucleotides. Partially resolved polynucleotides refer to released polynucleotides which comprise at least a scar. The composition of the final product will depend on the sequence of the single stranded nucleic acid, i.e., the succession of repeat unit “polynucleotide-cleavable linker-polynucleotide”, on the sequence of the cleavable linkers and / or on the endonucleases used.
[0102] At the end of step (b), at least one released polynucleotide is a scarless polynucleotide, i.e. having both a 5’ phosphate group and a 3’ hydroxyl group. In some embodiments, at least two polynucleotides released at the end of step (b) are scarless polynucleotides. Preferably, all the polynucleotides released at the end of step (b) are scarless polynucleotides. Therefore, the released polynucleotides may be directly extended by a polymerase. The released polynucleotides can be used as primers for a polymerase chain reaction (PCR), in particular primers for a multiplex PCR or a quantitative PCR.
[0103] In one embodiment, the single-stranded nucleic acid comprises a pair of forward and reverse primers that can be used directly in a subsequent PCR amplification reaction. In one embodiment, the cleavage linker comprises, in its 3 ’-end, a modified nucleotide such as Octadiynyl deoxyuracil (Oct-doU), which can react by click chemistry with a free azide (N3) group located within the initiator (Fig. 4A). In this embodiment, the release of the linker upon cleavage by the endonucleases of step b) is preceded, simultaneous to, or followed by a click reaction between the released polynucleotide and the initiator DNA attached on the solid support. In this manner, both released polynucleotides, i.e. the forward and the reverse primer are immobilized on a solid support in close proximity. This spatial arrangement is favorable for downstream PCR amplification.
[0104] Typically, when a multitude of synthesis, cleavage and amplification reactions are carried out in a single flow cell surface, this method allows target capture and sequencing in a multiplex manner, without the need for indexing primers. Indeed, since the primers are spatially organized, the location within the flow-cell serves as a unique identifier for each reaction, without the need for an indexing step.
[0105] In an alternative embodiment, illustrated in Fig. 4B, the linker does not comprise a special nucleotide such as di and no enzyme such as Endo V is used. In this embodiment, there is no release of a free linker. Rather, the linker remains attached as a “tail” to the reverse primer.
[0106] In one aspect, the invention relates to a method for carrying out multiplex sequencing of target capture libraries without prior library preparation, said method comprising the steps of enzymatic synthesis of a set of single-stranded nucleic acids, each comprising a pair of forward and reverse primers, separated by a cleavable linker, wherein the reverse primer comprises a modified base at its 5 ’-end; click reaction between the modified base and a free azide present in the initiator DNA; separation of the forward and reverse primers by reacting with an endonuclease able to cleave the single stranded nucleic acid proximate 5’ of a special nucleotide, such as endonuclease Q; capture and clonal amplification of the target sequences; sequencing of the target sequences.
[0107] In some embodiment, the method of the invention further comprises a step (c) for recovering the released scarless polynucleotides at the end of step (b). The recovery step may be performed by any standard nucleic acid purification method, for example by gel purification, column of affinity, or any commercially available nucleic acid purification kit. This step (c) allows, for example, to separate released polynucleotides from released cleavable linkers and partially resolved polynucleotides which may be present at the end of step (b).
[0108] Step (c) for recovering may also be implemented by isopropanol-mediated precipitation, or by affinity column-mediated purification, to remove salts, enzymes, short and non-precipitated oligonucleotides, such as the cleavable linkers.
[0109] Kits
[0110] The present invention also provides kits for generating a plurality of polynucleotides, particularly a plurality of scarless polynucleotides. The term “Kit” refers to any set of reagents for carrying out a method of the invention.
[0111] In some embodiments, a kit of the invention comprises (i) a first endonuclease able to cleave proximate 3’ of a special nucleotide which has a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5 -hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, nitroindole and thymine glycol and (ii) a second endonuclease able to cleave proximate 5’ of a special nucleotide having a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole and thymine glycol. The first and the second endonucleases in the kit are different.
[0112] Particularly, a kit comprises (i) a first endonuclease able to cleave proximate 3’, particularly at the second phosphodiester bond 3’, of a special nucleotide having a base selected from nitroindole, hypoxanthine and thymine glycol and (ii) a second endonuclease able to cleave proximate 5’, particularly 5’, of a special nucleotide selected from uracil, deoxyuracil, 5- hydroxyuracil, 5,6-dihydrouracil, and 5-hydroxycytosine.
[0113] More particularly, a kit comprises (i) a first endonuclease able to cleave at the second phosphodiester bond 3’ of a deoxyinosine and (ii) a second endonuclease able to cleave a phosphodiester bond immediately 5’ of a deoxyuracil.
[0114] The endonucleases may be any one of the above-described endonucleases, depending on the single stranded nucleic acid to cleave. Preferably, a kit comprises an Endonuclease Q and an Endonuclease V. More particularly, the kit comprises an Endonuclease Q from or derived from Thermococcus kodakarensis, in particular an Endonuclease Q of sequence SEQ ID NO: 8, and an Endonuclease V from or derived from Fervidobacterium gondw anense. in particular an Endonuclease V comprising an amino acid sequence at least 75 %, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence SEQ ID NO: 9.
[0115] In a particular embodiment, the kit of the invention comprises an Endonuclease Q of sequence SEQ ID NO: 8 and an Endonuclease V of sequence SEQ ID NO: 9.
[0116] The kits of the invention may further comprise any delivery system for delivering materials. Such delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents and / or supporting materials (e.g., reaction medium, written instructions for performing the assay etc.) from one location to another. For example, kits may include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and / or supporting materials.
[0117] The first endonuclease and the second endonuclease may be stored in the same container or in different containers.
[0118] Such kit of the invention may also comprise reaction medium(s) for the cleavage reaction. Depending on which endonucleases are included, the kit of the invention may comprise a first reaction medium for the first endonuclease and a second reaction medium for the second endonuclease. Alternatively or additionally, the kit of the invention may comprise a reaction medium which is suitable for the simultaneous cleavage by a combination of the endonucleases of the kit.
[0119] A kit of the invention may also comprise means for recovering the released scarless polynucleotides at the end of step (b). Such means may be any conventional polynucleotide recovery systems, such as a column for purification by affinity or by isopropanol-mediated precipitation.
[0120] The kit of the invention may further comprise at least one single stranded nucleic acid as defined above.
[0121] Said single stranded nucleic acid(s) may be attached to a solid support, preferably by means of a cleavable motif as defined above. The kit of the invention may also comprise any necessary reagents for synthesizing such single stranded nucleic acid. For instance, the kit may comprise an initiator having a 3 ’-terminal nucleotide having a free 3 ’-hydroxyl, a template-free polymerase, a plurality of 3’-O-blocked nucleoside triphosphates, a de-blocking agent, and a plurality of 3’-O-blocked special nucleotides which each have a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5-hydroxycytosine, nitroindole and thymine glycol. Said 3’-O-blocked special nucleotides are particularly selected from 3’-O-blocked deoxyuracil and 3’-O-blocked deoxyinosine. The kit may further include a solid support with an initiator attached. Optionally, the initiator is attached to a solid support by its 5’ end.
[0122] Ine one embodiment, the initiator comprises a free azide group that can react by click chemistry with a modified nucleotide such as Octadiynyl deoxyuracil (Oct-doU).
[0123] Therefore, such kit permits (i) to elongate, by template-free polymerase, an initiator or an elongated fragment having a free 3 ’-hydroxyl with a 3’-O-blocked nucleoside triphosphate or a special nucleotide to form a 3’-O-blocked elongated fragment, and then (ii) to deblock the elongated fragment to form an elongated fragment having a free 3 ’-hydroxyl, until (iii) to form a single stranded nucleic acid with predetermined sequence comprising a plurality of polynucleotides and at least one cleavable linker linking at least two polynucleotides that are adjacent.
[0124] The template-free polymerase may be any template-free polymerase, such as a TdT or variant thereof for DNA synthesis (e.g. Ybert et al, WO2017 / 216472; Champion et al, W02019 / 135007) or a polyA polymerase (PAP) or polyU polymerase (PUP) or variant thereof for RNA synthesis (e.g. Heinisch et al, W02021 / 018919).
[0125] The 3’-O-blocked nucleoside triphosphates provided with a kit of the invention may be 3’-O- blocked-dNTP and / or 3’ -O-blocked-rNTP. These compounds comprise a blocking group which protects the hydroxyl group at the 3 ’position from undergoing a chemical change during a chemical or enzymatic process. This blocking group may be any blocking group known in the art, e.g. 3’-O-NH2, 3’-O-azidomethyl, 3’-O-allyl, or 3’-O-phosphate.
[0126] Accordingly, the kit of the invention may also comprise a “de-blocking agent” which is a chemical or enzymatic agent able to cleave the blocking group. The selection of deblocking agent depends on the type of 3 ’-nucleotide blocking group used, whether one or multiple blocking groups are being used, whether initiators are attached to solid supports, and the like. For example, a phosphine, such as tris(2-carboxyethyl)phosphine (TCEP) can be used to cleave a 3’0-azidomethyl group, palladium complexes can be used to cleave a 3’0-allyl group, or sodium nitrite can be used to cleave a 3’0-amino group.
[0127] Endonuclease V
[0128] The present invention also provides Endonucleases V which are capable of cleaving proximate 3’ of a special nucleotide which has a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5 -hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, nitroindole and thymine glycol. Said Endonucleases V comprise or consist of an amino acid sequence at least 75 % identical to the amino acid sequence of SEQ ID NO: 9. Particularly, the Endonucleases V of the invention comprise or consist of the amino acid sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 9. In some embodiments, the amino acid sequence of Endonuclease V of the invention comprises or consists of the amino acid sequence of SEQ ID NO: 9. In other embodiments, the Endonucleases V of the invention comprise or consist of an amino acid sequence at least 75 % identical to the amino acid sequence of SEQ ID NO: 9 and do not comprise or consist of the amino acid sequence of SEQ ID NO: 9. In other embodiments, the Endonucleases V of the invention comprise or consist of an amino acid sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 9 and do not comprise or consist of the amino acid sequence of SEQ ID NO: 9.
[0129] In some embodiments, the Endonuclease V of the invention preferably cleaves proximate 3’ of a special nucleotide which has a base selected from inosine, deoxyinosine, nitroindole, hypoxanthine and thymine glycol, more preferably it cleaves proximate 3’ of a special nucleotide which has deoxyinosine as a base (di).
[0130] The Endonuclease V of the invention may be isolated from nature or produced by any conventional molecular biology techniques. In a particular embodiment, said Endonuclease V is a prokaryotic Endonuclease V, more particularly an Endonuclease V of or derived from Fervidobacterium gondwanense and even more particularly comprising or consisting of the amino acid sequence of SEQ ID NO: 9.
[0131] In another particular embodiment, the Endonuclease V of the invention is thermostable and may be active in a range of temperature up to 72°C, with an optimal activity at 60 °C. The present invention is illustrated more in detail by following examples.
[0132] EXAMPLES
[0133] Example 1 : Synthesized single stranded nucleic acids comprising a plurality of polynucleotides Custom single stranded nucleic acids comprising a plurality of polynucleotides and at least one cleavable linker were enzymatically synthesized at 750 pmol scale on a bead-based solid support which was supplied suspended in 100 pl molecular biology grade H2O. An initiator conjugated to the solid support and used to initiate single stranded nucleic acids synthesis contained dIT residues at its 3’ end as a cleavable motif, the thymine residue having a 3’ hydroxyl group. Alternatively, the single stranded nucleic acids can be obtained from a supplier and then chemically conjugated to the solid support. Alternatively, no solid support is used for the synthesis and only the initiator free in solution is used. The sequences used for Endonuclease V- and Endonuclease Q-mediated release are provided in Table 1.
[0134] Table 1 Single stranded nucleic acid sequences used for Endonuclease V- and Endonuclease Q-mediated release.
[0135] 1The cleavable linker sequences intended for removal are indicated in bold. The released polynucleotides may be used as primers to target a part of the HER2 (ERBB2) gene having the following nucleotide sequence (SEQ ID NO: 7):
[0136] ACGGACGTGGGATCCTGCACCCTCGTCTGCCCCCTGCACAACCAAGAGGTGACAG CAGAGGATGGAACACAGCGGTGTGAGAAG wherein underlined sequences represent the Fwd and Rev primer binding sites, respectively.
[0137] Example 2: Enzymatic cleavage of single stranded DNA fixed on a solid support
[0138] Fervidobacterium gondwanense Endonuclease V (Fg Endonuclease V; sequence SEQ ID NO: 9) and Thermococcus kodakarensis Endonuclease Q (Tko Endonuclease Q; SEQ ID NO: 8) were diluted to a final concentration of 800 nM and 10 pM, respectively, in liberation buffer (170 mM NaCh, 50 mM MgCh and 10 mM TRIS-CI, pH 8.0), either individually or in combination. 100 pl of each enzyme mix, Endonuclease V-only, Endonuclease Q-only or Endonuclease V and Endonuclease Q, was added to the appropriate wells in an AcroPrep™ Advance 96 filter plate (PALL) containing 750 pmol of enzymatically synthesized single stranded nucleic acid linked to the solid support. The reactions were incubated at 60 °C in a Thermomixer with shaking at 900 rpm for 60 minutes. The enzymatically released polynucleotides were collected from the 96 well filter plate by centrifugation at 4700 rpm for 5 min. To ensure all the cleaved polynucleotides were collected, an additional 50 pl of liberation buffer was added to each well in the 96 well filter plate, incubated for 2 min with shaking at 900 rpm and the eluant collected in the same collection plate by centrifugation as described before.
[0139] Example 3 : Enzymatic cleavage of single stranded DNA in solution
[0140] Fg Endonuclease V (0.8 pM) and Tko Endonuclease Q (2 pM ) were combined with 300 pmol DNA substrate in solution (100 pM) and liberation buffer (170 mM NaCh, 50 mM MgCh and 10 mM TRIS-CI, pH 8.0) to a final volume of 100 pl in a 96 well twin. tec LoBind PCR reaction plate (Eppendorf) in order to release the polynucleotides. The reactions were incubated at 60 °C in a Thermomixer with shaking at 900 rpm for 60 minutes. The cleavage reactions were stopped with the addition of 60 mM EDTA (Sigma-Aldrich).
[0141] Example 4: Polynucleotides purification The released polynucleotides were purified from the cleavage reaction mix and smaller linker using a standard desalting technique as follows. Three volumes of 100% isopropanol were added to precipitate the larger polynucleotides and the mixture was transferred to a DNA Binding Plate E (Invitee) desalting plate. The isopropanol was subsequently removed by vacuum filtration, and the remaining salt, smaller non-precipitated oligonucleotide fragments and other impurities were washed away by two rounds of vacuum filtration of 80% EtOH (800 pl). After drying, the purified polynucleotides were eluted by adding twice 50 pl molecular biology grade H2O and collection was done by centrifugation at 4700 rpm for 5 min in an Eppendorf 5430R centrifuge. The purified released polynucleotides were visualized on an Oligo Pro II Fragment Analyzer.
[0142] Example 5: PCR amplification
[0143] The ability of polynucleotides, generated by Endonuclease V- and Endonuclease Q-mediated cleavage, to prime a PCR amplification reaction was determined as follows. Without normalization of polynucleotide concentration, 5 pl of each purified polynucleotide were combined with 10 ng of human genomic DNA (Roche), 10 pl of REDTaq® Ready Mix™ (Merck) and H2O to a final volume of 20 pl. To mediate PCR amplification, the mixture was incubated in a Biometra T One thermocycler programmed to execute the following cycles: denaturation at 95 °C for 1 minute, followed by 35 cycles of denaturation at 95 °C for 30 seconds (s), annealing at 60 °C for 15 s and extension at 72 °C for 30 s at each cycle. The final PCR products were visualized on an Oligo Pro II Fragment Analyzer.
[0144] Example 6
[0145] A single stranded nucleic acid of 47 base pairs (bp), “Fwd / dUTTdIT / Rev” (sequence SEQ ID NO: 5), was synthesized on a solid support according to the method described above. The single stranded nucleic acid is separated from the solid support by the sequence dIT as an Endonuclease V cleavable motif (Fig. 1A). The 19 bp “Fwd” and 23 bp “Rev” polynucleotides are separated from each other by the dUTTdIT motif, which serves as a cleavable linker for Endonuclease V and Endonuclease Q enzymes. Fig. IB illustrates all the cleavage products that can be obtained when cleaving the single stranded nucleic acid Fwd / dUTTdIT / Rev with Endonuclease V and Endonuclease Q. Fig. 1C shows the purified cleavage products that were obtained when Fwd / dUTTdIT / Rev was cleaved from the resin using Endonuclease V only or Endonuclease Q only or a combination of Endonuclease V and Endonuclease Q. Only when 1
[0146] Endonuclease V and Endonuclease Q were used in combination, scarless 19 bp Fwd and 23 bp Rev polynucleotides were released and resolved from Fwd / dUTTdIT / Rev.
[0147] Example 7
[0148] Free single stranded nucleic acids of sequence SEQ ID NO: 1, 2, 3, 4, 5 were contacted with Endonuclease V and Endonuclease Q under the conditions described above for “Example 3 : Enzymatic cleavage of single stranded DNA in solution”.
[0149] Fig. 2 demonstrates the importance of the linker design to obtain scarless Fwd and Rev polynucleotides from a single stranded nucleic acid encoding both the Fwd and Rev polynucleotides. To do so, various single stranded nucleic acids with cleavable linkers containing either only one special nucleotide (dU or di), or a combination of special nucleotides and optionally additional T spacers, were treated with a combination of Endonuclease V and Endonuclease Q. The results of Fig 2 demonstrates that only linkers containing two different special nucleotides (both a dU and a di) mediates the resolution of scarless Fwd and Rev polynucleotide sequences when cleaved with a combination of Endonuclease V and Endonuclease Q. The length of the linker, mediated by varying the number of T bases between the dU and di, did not affect the resolution of scarless Fwd and Rev polynucleotide sequences.
[0150] Example 8
[0151] A single stranded nucleic acid of 51 bp, “Fwd / dUTTTTTTdIT / Rev”(SEQ ID NO: 6), was contacted with either Endonuclease V or Endonuclease Q, or a combination of Endonuclease V and Endonuclease Q to resolve Fwd / dUTTTTTTdIT / Rev into the various cleavage products. Fig 3A demonstrates that, only when Fwd / dUTTTTTTdIT / Rev is cleaved by both Endonuclease V and Endonuclease Q, scarless Fwd and Rev polynucleotides are generated. Cleaving with Endonuclease V or Endonuclease Q only, rendered only the Rev or Fwd as a scarless product, respectively. The other polynucleotide retained the cleavable linker or part thereof.
[0152] When the cleavage products were used as primers in a PCR reaction to amplify 84 bp of the HER2 gene from human genomic DNA, the desired product was obtained only when the scarless cleavage products, generated by a combination of Endonuclease V and Endonuclease Q, were used (Fig. 3B). When Endonuclease V only, or Endonuclease Q only, was used to cleave Fwd / dUTTTTTTdIT / Rev, the subsequent PCR reaction was either unsuccessful or generated a larger, undesired 5’ scarred product, respectively.
Claims
Claims1. A method of generating a plurality of polynucleotides from a single stranded nucleic acid, the method comprising the steps of:(a) providing the single stranded nucleic acid which comprises the plurality of polynucleotides and at least one cleavable linker linking at least two polynucleotides of said single stranded nucleic acid that are adjacent, the cleavable linker having two different special nucleotides which each have a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5- hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, 8-oxoguanine, nitroindole and thymine glycol,(b) contacting the single stranded nucleic acid with at least one endonuclease able to cleave the single stranded nucleic acid proximate 5’ of the first special nucleotide of the cleavable linker and with at least one endonuclease able to cleave proximate 3’ of the second special nucleotide of the cleavable linker in order to release the at least two polynucleotides of said single stranded nucleic acid that were adjacent, the released polynucleotides being deprived of the cleavable linker and,(c) optionally recovering said released oligonucleotides.
2. The method according to claim 1, wherein the single stranded nucleic acid comprises a plurality of cleavable linkers, each cleavable linker linking two polynucleotides that are adjacent.
3. The method according to claim 1 or 2, wherein said endonuclease able to cleave proximate 3’ of the special nucleotide is an Endonuclease V, an Endonuclease VIII, or an Endonuclease III, preferably wherein said Endonuclease V is a prokaryotic Endonuclease V, in particular an Endonuclease V from or derived from Fervidobacterium gondwanense, Thermotoga maritima or E. coli.4v The method according to any one of claims 1 to 3, wherein said endonuclease able to cleave the single stranded nucleic acid proximate 5’ of the special nucleotide is an Endonuclease Q, preferably wherein said Endonuclease Q is a prokaryoticEndonuclease Q, in particular an Endonuclease Q from or derived from Methanothermobacter thermautotrophicus or Thermococcus kodakarensis.
5. The method according to any one of claims 1 to 4, wherein the cleavable linker has a sequence 5’-Ni(N)mN2N3-3’, wherein:(a) Ni is a special nucleotide having a base selected from uracil, deoxyuracil, 5- hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine and 8-oxoguanine;(b) N2 is a special nucleotide having a base selected from inosine, deoxyinosine, nitroindole, hypoxanthine and thymine glycol;(c) N represents one or more natural and / or non-natural nucleotides, m being 0 or 1;(d) N3 is a nucleotide selected from a natural and a non-natural nucleotide.
6. The method according to claim 5, wherein Ni is deoxyuracil (dU) and N2 is deoxyinosine (di).
7. The method according to claim 5 or 6, wherein (N) comprises between 1 and 500 nucleotides, particularly between 1 and 300 nucleotides, between 1 and 100 nucleotides, between 1 and 50 nucleotides, or between 1 and 20 nucleotides, preferably between 1 and 10 nucleotides, more preferably between 2 and 6 nucleotides.
8. The method according to any one of the previous claims, wherein the cleavable linker is selected from dUdIT, dUTdIT, dUTTdIT, dUTTTdIT, dUTTTTIdIT, dUTTTTTdIT and dUTTTTTTdIT.
9. The method according to any one of claim 1 to 8, wherein said single stranded nucleic acid is attached to a solid support by its 5 ’end, preferably wherein said solid support is a bead or a plate.
10. The method according to any one of claims 1 to 9, comprising a step of synthetizing the single stranded nucleic acid, preferably by an enzymatic synthesis, before the step of providing the single stranded nucleic acid.
11. The method according to claim 10, wherein said single stranded nucleic acid is synthesized from an initiator having a free 3 ’-hydroxyl.
12. The method according to claim 11, wherein said initiator has a 3’-penultimated nucleotide which has a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5 -hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, nitroindole and thymine glycol.
13. The method according to any one of claims 1 to 12, wherein at least one released polynucleotide has a 5’ end with a monophosphate group and a 3’ end with a hydroxyl group.
14. A kit for enzymatically generating a plurality of oligonucleotides, said kit comprising:(a) a first endonuclease able to cleave proximate 3’ of a special nucleotide which has a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, nitroindole and thymine glycol;(b) a second endonuclease able to cleave proximate 5’ of a special nucleotide having a based selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5 -hydroxy cytosine, 8-oxoguanine, nitroindole and thymine glycol;(c) and optionally at least one chosen from: i. an initiator having a 3 ’-terminal nucleotide having a free 3 ’-hydroxyl, optionally said initiator being attached to a solid support by its 5’ end, a template-free polymerase, a plurality of 3 ’-O’ -blocked nucleoside triphosphates, a de-blocking agent, and a plurality of 3 ’-O’ -blocked special nucleotides which have each a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6- dihydrouracil, 5 -hydroxy cytosine, nitroindole and thymine glycol, or ii. a single stranded nucleic acid comprising a plurality of polynucleotides, wherein at least two adjacent polynucleotides of said single stranded nucleic acid are separated by a cleavable linker comprising two different special nucleotides which each have a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6- dihydrouracil, 5 -hydroxy cytosine, 8-oxoguanine, nitroindole and thymine glycol.
15. The kit according to claim 14, wherein the first endonuclease is an Endonuclease V and the second endonuclease is an Endonuclease Q.
16. An Endonuclease V comprising an amino acid sequence at least 75 % identical to the amino acid sequence of SEQ ID NO: 9, wherein said Endonuclease V is capable of cleaving proximate 3’ of a special nucleotide which has a base selected from inosine, deoxyinosine, hypoxanthine, uracil, deoxyuracil, 5-hydroxyuracil, 5,6-dihydrouracil, 5- hydroxy cytosine, nitroindole and thymine glycol.